J BIOCHEM MOLECULAR TOXICOLOGY
Volume 13, Number 2, 1999
Lead and Mercury Mutagenesis: Type of Mutation
Dependent upon Metal Concentration
Maria E. Ariza* and Marshall V. Williams
Department of Medical Microbiology, The Molecular, Cellular and Developmental Biology Progam, Biochemistry Program and the
Comprehensive Cancer Center, The Ohio State University, Columbus, OH 43210
Received 10 July 1998; revised 09 September 1998; accepted 18 September 1998
ABSTRACT: Lead and mercury are toxic metals that
are widely distributed in the atmosphere, soil, and
groundwater. It is estimated that 24 @ 104 tons of
these metals are released annually into the environ-
ment by natural and industrial processes. Therefore,
human exposure to low relatively nontoxic concentra-
tions of these metals is unavoidable. However, the pos-
sible health effects of such exposure remain contro-
versial. We have previously reported that low,
subthreshold concentrations (0.11 lM) of these metals
are mutagenic in the transgenic Chinese hamster ovary
cell line AS52. The purpose of the present study is to
determine the types of mutations induced in the gpt
gene in AS52 cells. Using multiplex polymerase chain
reaction and southern blot analyses, we characterized
the 138 lead-induced, 192 mercury-induced, 29 reactive
oxygen radical-induced, and 20 spontaneously arising
mutants for point and deletion mutations in the gpt
gene. Similar levels of point mutations were observed
in the lead- and mercury-induced populations (47.8
and 53.6, respectively), which was significantly less
than that occurring in the spontaneously arising and
reactive oxygen intermediate-induced mutants. How-
ever, further examination of the data revealed that at
concentrations of the metals of equal to or less than 0.4
lM, the majority of the mutations in the gpt gene were
point mutations, while at higher concentrations, dele-
tions (partial and complete) were the predominant
type of mutation. These results are consistent with the
hypothesis that lead and mercury induce mutations in
eukaryotic cells by at least two distinct mechanisms.
q 1998 John Wiley & Sons, Inc. J Biochem Toxicol 13:
107112, 1999
KEY WORDS: Lead, Mercury, Mutagenesis, AS52 Cells
*Present Address: Maria E. Ariza, Ph.D., Arizona Cancer Cen-
ter, Department of Pathology, University of Arizona, Tucson, AZ
85724.
Address correspondence to Marshall V. Williams, Ph.D., De-
partment of Medical Microbiology and Immunology, The Ohio State
University, 2074 Graves Hall, 333 W. Tenth Avenue, Columbus, OH
43210. Tel.: (614) 292-0717; fax: (614) 292-9805; E-mail: wil-
liams.70@osu.edu.
q 1998 John Wiley & Sons, Inc. CCC 1095-6670/98/020107-06
INTRODUCTION
The toxic effects of lead (Pb2`) and mercury (Hg2`)
on multiple organ systems is well documented (1), and
threshold exposure levels have been estlished (24).
However, subthreshold amounts of Pb2` and Hg2` are
released continously into the environment by indus-
trial and natural processes. Thus, exposure to subthres-
hold amounts of these metals is unavoidable, and such
exposure may result in the accumulation of a signifi-
cant body burden over a persons lifetime (5). While
concerns have been raised, the biological effects asso-
ciated with exposure to subthreshold concentrations of
these metals are unknown.
Pb2` and Hg2` are reported to be clastogenic, te-
tratogenic, and in some cases mutagenic (610). It has
been suggested that the genotoxic effects of these met-
als may be due to their ability to induce reactive oxy-
gen intermediates (ROI) in cells and that these ROI ei-
ther alone or in combination with the metal induce
DNA damage. Our previous studies, using the trans-
genic Chinese hamster ovary cell line, AS52, demon-
strated that the acute treatment of these cells with low
concentrations of Pb2` and Hg2` (0.11 lM) results is
a dose-dependent increase (2.11- to 6.24-fold) in the
mutation frequency of AS52 when compared to spon-
taneous mutation frequency (6.71TGr mutants/106
clonable cells) nontreated controls (11). These concen-
trations of Pb2` and Hg2` also induce the formation of
hydrogen peroxide (H2O2) in AS52 cells by at least two
distinct mechanisms, and there is a causal relationship
between the induction of H2O2 by these metals and
mutagenesis (12).
The purpose of the present study is to determine
the types of mutations (point, partial deletion, dele-
tion) induced by these metals. This information is criti-
cal for elucidating the mechanisms of how these metals
induce DNA lesions and the effect that such lesions
may have on the DNA repair capacity of the cell.
107
108 ARIZA AND WILLIAMS
MATERIALS AND METHODS
AS52 Cell Culture
AS52 cells were obtained from Dr. Kenneth Tindall
(National Institute for Environmental Health Sciences,
Research Triangle Park, NC). AS52 cells were grown
and maintained as described previously (11,12).
Mutagenesis
Mutagenesis of AS52 cells was performed as we
have described previously (11,12). Briefly, 24 hours
prior to treatment (day 11), cells were washed twice
with Hanks Balanced Salt Solution (HBSS) and plated
at a density of 106 cells in F-12 medium containing 5%
heat inactivated and dialyzed fetal calf serum (FCS).
On day 0, cells were collected, washed, and treated
with different concentrations (0.11 lM) of lead chlo-
ride or mercuric acetate in HBSS for 1 hour. After treat-
ment, cells were washed three times with HBSS, F-12
medium containing 5% FCS was added, and the cells
were incubated overnight at 378C. To allow for phe-
notypic expression, cells (106) were subcultured on
days `1 and `4 in F-12 medium containing 5% FCS.
Selection was performed on day `6 following treat-
ment, by culturing 106 cells in F-12 medium containing
5% FCS and 10 lM 6-thioguanine (TG), at a density of
2 2 105 cells per 100 mm dish. Cells were incubated
for 10 days and examined for the development of TG-
resistant (TGr) clones. Only those clones containing
greater than 50 cells were counted. Clones were sub-
cloned, expanded, and frozen in liquid nitrogen for ad-
ditional studies.
To obtain clones containing mutations in the gpt
gene induced by ROI, AS52 cells were treated either
with a radical generating system (xanthine oxidase;
0.01 unit/mL and 50 lM hypoxanthine in F-12 me-
dium for 20 min at 378C) or with H2O2 (100 lM in F-
12 medium for 1 h at 378C) on day 0. After treatment,
cells were processed as described earlier.
For the purpose of these analyses, it is important
to insure that the mutants being analyzed represent
independent mutational events. Recovery of sibling
mutants could lead to an overestimation for a given
type of mutation. Therefore, the following criteria were
established. Within a single experiment, if mutant
clones isolated from the same plate exhibited different
types of mutation, it was assumed that they were the
result of independent mutational events. Conversely,
if mutant clones isolated from the same plate or any
plate in that experimental group exhibited the same
type of mutation, it was assumed that they represented
the same mutational event. However, if mutant clones
isolated from different experimental groups exhibited
the same type of mutation, it was assumed that they
represented independent mutational events.
Volume 13, Number 2, 1999
Cytotoxicity and Cloning Efficiency
Cytotoxicity and cloning efficiency were deter-
mined, as described previously, by comparing the clon-
ing efficiency of the treated cell populations to that ob-
served in the nontreated control (11,12).
Polymerase Chain Reaction (PCR)
The procedures used to analyze the TGr-AS52 mu-
tants have been described in detail (1315). Briefly, ge-
nomic DNA from spontaneous, Pb2`, Hg2`, and H2O2
induced TGr-AS52 mutant clones, as well as DNA from
wild-type AS52 cells, was isolated using the Oncor
nonorganic DNA extraction kit. The DNA was resus-
pended in TE buffer and examined by gel electropho-
resis to insure that the DNA had not been degraded.
The purified DNA, approximately 1 lg, was amplified
by multiplex-PCR using two sets of primers with a
Perkin Elmer Model 9600 Thermocycler. The first set
of primers (10/29: AAGCTTGGACACAAGACAGG-
CTTGCCAGA and 12/30: GCCTCCAGAATACTTA-
CTGGAAACTATTGT) flank the gpt gene. Primer 10/
29 is a 29 mer that hybridizes 58 to the gpt gene from
base pair (bp) 1199 to 1171. Primer 12/30 is a 30 mer
that hybridizes 38 to the gpt structural gene from bp
543 to 514. The second set of primers (DHFR1:
ACCTGTACCCAATACACATAACCAGCAA, DHFR
2: CTTGCTCCCCTTTCTTCTGTAATTAGTCTC) flank
exon 5 of the dhfr gene, which was used as an internal
PCR control. Primer DHFR 1 is a 28 mer that hybrid-
izes 58 to exon 5 of the dhfr gene from bp 2 to 29. Primer
DHFR 2 is a 30 mer that hybridizes 38 to exon 5 of the
dhfr gene from bp 412 to 383. Positive controls used for
the amplification reactions consisted of 1 lg of wild-
type AS52 DNA and 1 lg of pSV2gpt plasmid. PCR
mixture lacking DNA was used as a negative control.
PCR reactions contained in a total volume of 100
lL: Taq polymerase (0.5 units), 1 lg of genomic DNA,
200 ng of primers 10/29 and 12/30, and 60 ng of prim-
ers DHFR 1 and DHFR 2 in 15 mM Tris-HCl, pH 8.8;
60 mM KCl, 1.5 mM MgCl2, and 20 mM each of the
dNTPs. Reactions were performed in 0.2 mL thin-wall
PCR tubes (PGC Scientific). The DNA/primer mixture
was denatured at 948C for 2 minutes for the first cycle.
For the 29 subsequent cycles of PCR, samples were de-
natured at 948C for 30 seconds, annealed at 558C for 30
seconds, and allowed to undergo DNA synthesis at
728C for 1 minute. At the end of 30 cycles, aliquots from
each of the PCR reactions were removed and analyzed
by gel electrophoresis.
The 0.7 kb band containing the amplified gpt se-
quence was isolated and used as a template for sec-
ondary PCR amplification using the primers 5.1 and
12/30. Primer 5.1 (CGCAACCTATTTTCCCCTCG-
ACT) is a 26 mer that hybridizes 58 to the gpt structural
Volume 13, Number 2, 1999
FIGURE 1. Protocol used for analysis of DNA from various mu-
tants.
gene from bp 162 to 137, and it is internal to primer
10/29. Positive controls for secondary PCR amplifica-
tion reactions included 1 lg of plasmid pSV2gpt as
well as 10 ng of the gpt fragment. Water was used as a
negative control. The DNA/primer mix was denatured
at 948C for 2 minutes for the first cycle. For the re-
maining 19 cycles, samples were denaturated at 948C
for 30 seconds, annealed at 558C for 30 seconds, and
allowed to undergo DNA synthesis at 728C for 1 min-
ute. Following secondary amplification, aliquots from
each of the PCR products were removed and analyzed
by agarose gel electrophoresis.
Electrophoresis
PCR products were analyzed by agarose gel elec-
trophoresis. Electrophoresis was performed at 60 V for
14 hours, depending upon the size of the gel, at 258C.
The gel was composed of 1% (w/v) low-melting-point
agarose in TBE buffer (89 mM Tris, 89 mM borate and
2 mM EDTA). TBE was used as the running buffer.
Southern Hybridization Analysis
The procedures used to analyze TGr-AS52 mutants
have been described in detail (1315). Genomic DNA
from Pb2` and Hg2` induced TGr mutant clones was
isolated using the Oncor nonorganic DNA extraction
kit. DNA was digested in separate reactions using ei-
ther EcoRI and HindIII or BamHI and HindIII as rec-
ommended by the supplier. Each reaction included 10
LEAD AND MERCURY MUTAGENESIS 109
15 lg of DNA and 35-fold excess of restriction
enzyme. Digested samples were separated by electro-
phoresis through a 0.8% agarose gel in TBE buffer.
DNA was transferred to a Maximum Strength Nytran
Plus membrane using the alkaline-transfer technique
as recommended by the supplier. Briefly, the gel was
soaked in denaturation buffer (0.4 M NaOH/0.6 M
NaCl) two times for 15 minutes each. Following de-
naturation, the DNA was blotted onto a Nytran mem-
brane by capillary transfer, using fresh transfer buffer
(0.4 M NaOH/0.6 NaCl), for 214 hours. The mem-
brane was soaked in 52 SSPE (0.18 M NaCl, 10 mM
NaPO4, pH 7.7 and 1 mM EDTA) and baked at 65
808C for 30 minutes to immobilize the DNA. The mem-
branes were prehybridized in hybridization bottles
with prehybridization buffer [50% formamide pH 7.4/
62 SSPE/52 Denhardts reagent/0.5% SDS/salmon
testes (1 mg/mL) DNA] and incubated for 12 hours
at 428C. 32P-primer-labeling of the DNA probe (0.7 kb
fragment containing the gpt gene) was performed at
258C for 1 hour, using the Random Primers DNA La-
beling Kit, as described by the manufacturer. 32P-pri-
mer-labeling reaction contained 25 ng of denatured
DNA, dATP, dGTP, dTTP, random primers buffer mix-
ture, 50 lCi [32P]dCTP, and the Klenow fragment of
Escherichia coli DNA polymerase I. The prehybridiza-
tion solution was removed, and the denatured radio-
labeled probe was added to the hybridization solution
(same composition as prehybridization buffer), and
membranes were hybridized overnight at 428C. The
membranes were washed twice for at least 15 minutes
each with 72 SSPE/0.5% SDS at room temperature,
and soaked twice in 12 SSPE/0.5% SDS for at least 15
minutes at 378C. The membranes were soaked for 1
hour in 0.12 SSPE/1% SDS at 688C and exposed to
Kodak XAR-5 film with intensifying screens at 1708C
for 13 days.
RESULTS
In order to rapidly screen a large number of mu-
tants, a protocol was established to analyze DNA for
types of mutations using multiplex PCR and Southern
hybridization to characterize deletion mutations (Fig-
ure 1). For multiplex PCR, the gpt gene and exon 5 of
the dhfr gene were amplified simultaneously. The dhfr
fragment served as an internal PCR control, and only
those samples containing the amplified exon were in-
cluded in the analyses. External controls included am-
plification of the gpt gene from pSV2gpt DNA as well
as the gpt gene from DNA of wild-type AS52 cells.
When DNA from wild-type AS52 cells is amplified,
three DNA fragments are amplified: a linked PCR
product migrating at about 1.1 kb, the wild-type gpt
band migrating at 0.7 kb, and the 0.4 kb dhfr internal
110 ARIZA AND WILLIAMS Volume 13, Number 2, 1999

control. A typical example of multiplex PCR analysis

FIGURE 2. Primary PCR of DNA from wild-type, spontaneous,
and Hg2` induced mutants. DNA was isolated from mutants and
wild-type AS52 cells; PCR amplified and the amplified fragments
separated as described in Materials and Methods. Lane 1: molecular
weight markers (100 bp DNA ladder); lane 2: negative PCR control;
lane 3: pSV2 gpt plasmid, positive PCR control; lane 4: wild-type
AS52 DNA, positive PCR control, lane 5: spontaneous AS52 mutant;
lanes 610: Hg2` (0.8 lM) induced mutants; lanes 1113: Hg2` (0.6
lM) induced mutants.
TABLE 1. Frequency of Mutation Types Induced in the gpt
gene by Pb2` and Hg2`
Deletion
Number of
Mutations
Mutants Point
Treatmenta Examined Mutations Partial Complete
is shown in Figure 2. For these analyses, amplified gpt
fragments from DNA of mutants were classified as
containing point mutations if the size of the fragment
was the same as that obtained in the positive controls.
To confirm that bands being amplified in multiplex
PCR were the gpt gene, nested PCR was performed on
the primary PCR gpt product as described in Materials
and Methods. Only those fragments amplified by
nested PCR were used in the analysis.
Mutations initially classified as deletion mutations
by PCR analyses could be the result of a point/partial
deletion mutation in the regions where the primers an-
nealed, or they could be the result of a deletion of the
entire gpt gene. To address this question, Southern hy-
bridization was performed. A typical result of
Southern hybridization analyses is shown in Figure 3.
Using this approach, the types of mutations occur-
ring in independently arising Pb2` and Hg2` induced
mutants were characterized and compared to the types
of mutations occurring in spontaneous mutants and
ROI-induced mutants (Table 1). Overall, similar levels
of point mutations were observed in the Pb2` and Hg2`
induced mutants (47.8 and 53.6%, respectively), but
this was significantly less than that observed in the
spontaneously arising and ROI-induced mutants
(89.8%) (p , 0.05). However, further examination of the
data indicates that at 0.4 lM and below, the majority
of mutations in the gpt gene are point mutations (65
and 72%, respectively, for Pb2` and Hg2`), while at
higher concentrations of the metals, the majority of the
mutations are partial deletions and deletions (67 and
72%, respectively, for Pb2` and Hg2`).

None 20 18 1 1 DISCUSSION
Hydrogen peroxide 21 13 3 0
Radical generating system 8 8 0 0
Our previous studies demonstrated that low con-
Pb2` (lM) centrations (0.11 lM; 0.020.2 ppm) of Pb2` and Hg2`
0.1 13 5 7 1 were mutagenic (11) and that they induced H2O2 in
0.2 15 13 2 0
0.3 16 14 0 2
AS52 cells by two distinct mechanisms: one that was
0.4 21 10 4 7 dependent upon xanthine oxidase activity, and that
0.5 18 6 10 2 there was a causal relationship between H2O2 induc-
0.6 25 9 7 9 tion by these metals and mutagenesis (12). The results
0.8 21 4 7 10 from the present study demonstrate that the predom-
1.0 9 5 1 3
inant type of mutation induced in the gpt transgene of
Hg2` (lM) AS52 cells is dependent upon the concentration of
0.1 24 19 1 4 metal. At concentrations of Pb2` or Hg2` below 0.5 lM,
0.2 42 27 4 11
0.3 36 25 1 10
point mutations were the predominant type of muta-
0.4 13 10 1 2 tion, while at higher concentrations of the metals, de-
0.5 17 7 8 2 letion mutations were the most frequent type of mu-
0.6 10 2 5 3 tation detected. What may be responsible for these
0.8 22 8 10 4 differences?
1.0 28 5 10 13
ROI induce several types of promutagenic damage
a
AS52 cells were treated as described in Materials and Methods. DNA was
extracted and analyzed by multiplex PCR and southern hybridization as de-
in DNA including base modifications and single- and
scribed in Materials and Methods. double-strand breaks. In addition to inducing H2O2,
Volume 13, Number 2, 1999
FIGURE 3. Southern hybridization of Hg2` induced AS52 mutants. Genomic DNA from mutants classified as containing deletion mutations
based upon PCR analysis was purified, digested, separated, and hybridized to the gpt probe as described in Materials and Methods. Lane 1:
wild-type AS52; lane 2: Hg2` (0.1 lM) induced; lanes 3 and 4: Hg2` (0.2 lM) induced; lanes 5 and 6: Hg2` (0.3 lM) induced; lane 7: Hg2` (0.4
lM) induced; lane 8: Hg2` (0.5 lM) induced; lane 9: Hg2` (0.6 lM) induced; lanes 10 and 11: Hg2` (0.8 lM) induced.
Pb2` and Hg2` bind to DNA with Pb2` exhibiting a
high affinity for phosphate groups and Hg2` exhibiting
a preferential affinity for thymidine residues (1618).
At higher concentrations of the metals, the formation
of metal ionDNA complexes could affect DNA repli-
cation, particularly if such damage occurs in short re-
petitive DNA sequences. Such sequences may be in-
volved in deletion formation by transient
misalignment and slippage-realignment mechanisms
(1921). Furthermore, formation of metal ionDNA
complexes could alter chromatin structure, and this
may interfere with normal DNA repair processes. Pb2`
and Hg2` are reported to increase the infidelity of
DNA synthesis (22,23) and to inhibit DNA replication
(2426) and DNA repair processes (2729); all of these
may contribute to the mutagenic (610) and cellular
transformation (30) potentials of Pb2` and Hg2`. How-
ever, most of these studies were preformed using
higher concentrations (mt;1 lM) of these metals. Thus,
while our results definitely proved that these metals
are mutagenic by at least two mechanisms, additional
studies are required to determine the effect that low
concentrations (0.11 lM) of Pb2` and Hg2` have on
both the fidelity of DNA replication and on DNA re-
pair processes.
REFERENCES
1. Vallee BL, Ulmer DD. Biochemical effects of mercury,
cadmium and lead. Annu Rev Biochem 1972; 41:91145.
2. US EPA (Environmental Protection Agency). Review of
the National Ambient Air Quality Standard for Lead: ex-
posure, analysis, methodology and validation. EPA Of-
LEAD AND MERCURY MUTAGENESIS 111
fice of Air Quality Office Planning and Standards EPA
450/2-89-011. 1989.
3. US EPA (Environmental Protection Agency) and Agency
for Toxic Substances and Disease Registry, US Public
Health Service. Toxicological profile for mercury. Clem-
ent Assoc. #205-88-0608. 1989.
4. US EPA (Environmental Protection Agency) and Agency
for Toxic Substances and Disease Registry, US Public
Health Service. Toxicological profile for lead. Syracuse
Research Corp. #68-C8-0004. 1990.
5. Schweinsberg F, von Karsa L. Heavy metal concentra-
tions in humans. Comp Biochem Physiol 1990; 95:117
123.
6. Kazantis G. Role of cobalt, iorn, lead, manganese, mer-
cury, platinum, selenium and titanium in carcinogenesis.
Environ Health Perspect 1981; 40:143161.
7. Leonard A, Jacquet P, Lauwerys RR. Mutagenicity and
teratogenicity of mercury compounds. Mutat Res 1982;
114:118.
8. Heck JD, Costa M. In vitro assessment of the toxicity of
metal compounds. II. Mutagenesis. Biol Trace Met Res
1982; 4:319330.
9. Gebhart E. Chromosome damage in individuals exposed
to heavy metals. Toxicol Environ Chem 1984; 8:253265.
10. Hansen K, Stern RM. A survey of metal-induced muta-
genicity in vitro and in vivo. Toxicol Environ Chem 1984;
9:8791.
11. Ariza ME, Williams MV. Mutagenesis of AS52 cells by
low concentrations of lead (II) and mercury (II). Environ
Mol Mutagen 1996; 27:3033.
12. Ariza ME, Bijur GN, Williams MV. Lead and mercury
mutagenesis: role of H2O2, superoxide dismutase and
xanthine oxidase. Environ Mol Mutagen 1998; 31:352
361.
13. Tindall KR, Stankowski LF, Machanoff R, Hsie AW.
Analyses of mutation in pSV2gpt transformed CHO
cells. Mutat Res 1986; 160:121131.
14. Tindall KR, Stankowski LF, Machanoff R, Hsie AW. De-
tection of deletion mutations in pSV2gpt transformed
cells. Mol Cell Biol 1987; 4:14111415.
112 ARIZA AND WILLIAMS
15. Tindall KR, Stankowski LF. Molecular analysis of spon-
taneous mutations at the gpt locus in Chinese hamster
ovary (AS52) cells. Mutat Res 1989; 220:241253.
16. Yamane T, Davidson N. On the complexing of desoxy-
ribonucleic acid (DNA) by mercuric ion. J Am Chem Soc
1961; 83:25992607.
17. Nandi US, Wang JC, Davidson N. Separation of deoxy-
ribonucleic acids by Hg(II) binding and Cs2SO4 density-
gradient centrifugation. Biochemistry 1965; 4:16871696.
18. Sissoeff I, Grisuard J, Guille E. Studies on metal ions-
DNA interactions: Specific behavior of reiterated DNA
sequences. Prog Biophys Molec Biol 1976; 31:165169.
19. Kunkel TA, Soni A. Mutagenesis by transient misalign-
ment. J Biol Chem 1988; 263:1478414789.
20. Kunkel TA. Misalignment-mediated DNA synthesis er-
rors. Biochemistry 1990; 29:80038011.
21. Kunkel TA. Slippery DNA and diseases. Nature 1993;
365:207208.
22. Sirover MA, Loeb LA. Infidelity of DNA synthesis in
vitro: screening for potential metal mutagens or carcino-
gens. Science 1976; 194:14341436.
23. Zakour RA, Kunkel TA, Loeb LA. Metal-induced infi-
delity of DNA synthesis. Environ Health Perspect 1981;
40:197205.
Volume 13, Number 2, 1999
24. Costa M, Cantoni O, deMars M, Swartzendruber D. Toxic
metals produce an S-phase specific cell cycle block. Res
Comm Chem Pathol Pharmacol 1982; 38:405419.
25. Robison SH, Cantoni O, Costa M. Analysis of metal-in-
duced DNA lesions and DNA-repair replication in mam-
malian cells. Mutat Res 1984; 131:173181.
26. Williams MV, Winters T, Waddell K. In vitro effects of
mercury (II) on deoxyuridine triphosphate nucleotidoh-
ydrolase, DNA polymerase (], b), and uracil-DNA gly-
cosylase activities in cultured human cells: relationship
to DNA damage, DNA repair and cytotoxicity. Mol Phar-
macol 1987; 31:200207.
27. Popenoe EA, Schmaeler MA. Interaction of human DNA
polymerase b with ions of copper, lead and cadmium.
Arch Biochem Biophys 1979; 196:109120.
28. Cantoni O, Costa M. Correlations of DNA strand breaks
and their repair with cell survival following acute ex-
posure to mercury (II) and X-rays. Mol Pharmacol 1983;
24:8487.
29. Christie NT, Cantoni O, Sugiyama M, Cattabeni F, Costa
M. Differences in the effects of Hg (II) on DNA repair
induced in Chinese hamster ovary cells by ultraviolet or
X-rays. Mol Pharmacol 1985; 29:173178.
30. Heck JD, Costa M. In vitro assessment of the toxicity of
metal compounds. I. Mammalian cell transformation.
Biol Trace Element Res 1982; 4:7182.