A Practical Guide To Cellular and Molecular Immunology

1
TABLE OF CONTENTS
1.0 INFLAMMATION
1.1 Purification of mononuclear and polymorphonuclear
cells......................................................................................4
1.2 Isolation of cells from the peritoneal cavities of mice 8
1.3 Adherence purification of monocytes...........................9
1.4 Antibody- or C3b-dependent phagocytosis...................10
1.5 Activation of macrophages...........................................12
1.6 Monokine Bioassays......................................................14
1.6.1 Assay for IL-1 activity.......................................14
1.6.2 Assay for IL-6 activity.......................................17
1.6.3 Cytotoxicity assay for TNFa..............................19
1.7. Neutrophil chemotaxis assay.......................................21
1.8. FceRI-dependent activation of mast cells....................24
2.0 ANTIBODIES: PURIFICATION & CHARACTERIZATION

2.1 Hybridoma cell culture with production of monoclonal
antibodies.............................................................................26
2.2 Affinity purification of IgG antibodies..........................27
2.2.1 Avid-AL affinity chromatography.......................27
2.2.2 Protein A-Sepharose affinity chromatography..29
2.3 Preparation of IgM antibodies......................................31
2.4 Analysis & characterization of immunoglobulins.........33
2.4.1 Polyacrylamide gel electrophoresis of
immunoglobulins.........................................................33
2.4.2 Western blotting to detect immunoglobulins....35
3.0 T CELL AND B CELL RESPONSES

3.1 C'-dependent depletion of CD4+ and CD8+ T Cells.......37
3.2 MACS purification (or depletion) of CD4+ and CD8+ T
Cells......................................................................................39
3.3 Assessment of T cell proliferation................................41
3.4 Plaque Forming Cell (PFC) assay for IgM-producing cells
..............................................................................................44
3.5 ELISPOT assays for single cytokine- or Ab-producing
cells......................................................................................45
3.6 ELISA assay for detection of antigen-specific antibodies
..............................................................................................49
3.7 In vivo assessment of T cell responses.......................51
3.8 Immunohistochemical detection of cytokines in tissues
..............................................................................................53
4.0 MOLECULAR ANALYSIS OF CYTOKINE mRNA EXPRESSION

2
4.1 Northern blotting...........................................................55

4.1.1 Purification of cellular RNA..............................55
4.1.2 Electrophoresis of RNA & transfer to membranes
.....................................................................................58
4.1.3 32P-labelled cDNA probe synthesis..................61
4.1.4 Pre-hybridization, hybridization, and washing. .63
4.1.5 Detection of mRNA bands.................................65
4.2 In Situ hybridization......................................................67

4.2.1 Probe synthesis & purification.........................67
4.2.2 Preparation of slides for hybridization.............71
4.2.3 Hybridization of 35S-cRNA riboprobes to cellular
mRNA...........................................................................74
4.2.4 Post-hybridization washing & autoradiography76
4.2.5 Autoradiograph development & counter-staining
.....................................................................................78
4.3 Semi-quantitative RT-PCR to detect cytokine mRNA....79

4.3.1 First strand cDNA Synthesis using Oligo(dT)
priming.........................................................................80
4.3.2 PCR amplification of the target cDNA..............81
4.3.2 Detection of RT-PCR products...........................82
APPENDICES
5.1 APPENDIX A -- GENERAL METHODS.............................83
5.1.1 Anti-sheep RBC antisera...................................83
5.1.2 Cell counting.....................................................83
5.1.3 C3b opsinization of yeast..................................84
5.1.4 Cytocentrifuge preparations.............................85
5.1.5 Dialysis tubing...................................................85
5.1.6 Fixation of tissues for ISH or IHC.....................85
5.1.7 Lung cells (single cell suspension)..................86
5.1.8 Lysis of red blood cells.....................................86
5.1.8.1 Hypotonic lysis with H2O......................86
5.1.8.2 Lysis with ammonium chloride.............86
5.1.9 Opsinization of SRBC with antibody.................87
5.4.10 Protein assay in microtiter plates..................87
5.1.11 Splenocytes (single cell suspensions)............87
5.1.12 Splenocytes (spleen cell-conditioned medium)
.....................................................................................88
5.1.13 Staining Protocols...........................................89
5.1.13.1 Giemsa stains......................................89
5.1.13.1.1 Wrights-Giemsa staining.........89
3
5.1.13.1.2 Giemsa staining of tissue

sections.....................................................89
5.1.13.2 Gills hematoxylin for IHC.....................90
5.1.13.3 Toluidine blue staining (ISH counter-
stain)...................................................................90
5.1.14 Standard curves (e.g., cytokines)...................90
5.1.15 TESPA-treatment of glass slides.....................91
5.2 APPENDIX B -- REAGENTS & SOLUTIONS
CELLULAR IMMUNOLOGY REAGENTS........................92

Acidified isopropanol..........................................92
Actinomycin D.....................................................92
Alsevers solution................................................92
Ammonium chloride............................................92
Ammonium sulfate (saturated solutions)..........92
Borate-buffered saline........................................92
ELISPOT & ELISA Carbonate Coating buffer.....92
Isotonic Percoll Density Gradient Medium........93
PAGE running buffer...........................................93
PAGE 2x sample prep buffer...............................93
PAGE gel fix buffer.............................................93
Phosphate-buffered saline (PBS).......................93
Giemsa Stain......................................................93
Giemsa Stock Solution.......................................93
0.4% Trypan Blue................................................94
MOLECULAR BIOLOGY REAGENTS

Agarose/formaldehyde/MOPS gel (for Northerns)
............................................................................94
Cesium Chloride (for isolation of total cellular
RNA)....................................................................94
DEPC-treated water (& other solutions)............94
Dithiothreitol.......................................................94
EDTA (0.5M)........................................................94
Guanidinium Isothiocyanate (GSCN)................94
ISH 10x salts......................................................94
ISH hybridization buffer......................................95
Northern blotting pre-hyb/hybridization solution95
MOPS (1 M).........................................................95
5X MOPS Buffer..................................................95
Phenol (salt-saturated).......................................95
Reagents for purifying DNA from agarose gels. 96
General purpose restriction endonuclease
buffers.................................................................96
4
RNA sample prep buffer (Northern analysis).....96

RNA sample dye/loading buffer..........................96
RNAse A..............................................................96
Salmon sperm DNA.............................................96
Sodium acetate (3M)..........................................96
20X SSC (4 liters)...............................................97
STE buffer...........................................................97
5.3 APPENDIX C -- TISSUE CULTURE MEDIA

Click's medium............................................................98
DMEM...........................................................................98
DMEM-0% FCS.............................................................98
DMEM-10% FCS............................................................98
DMEM-10% normal horse serum.................................98
HBSS (Ca++ and Mg++-free)........................................98
MEM.............................................................................98
RPMI 1640....................................................................98
RPMI-0% FCS...............................................................98
RPMI-10% FCS.............................................................98
5.4 APPENDIX D -- MAINTENANCE OF CELL LINES

7TD1 cells (for assay of IL-6)......................................99
Cl.MC/C57.1 cells (C57 mast cells).............................99
L-929 cells (for TNF bioassay)....................................99
LM-1 cells (for assay of IL-1).......................................99
Pu5-1.8 cells (macrophage cell line)..........................99
5.6 APPENDIX F -- Human cytokine RT-PCR primers.........101

5.7 APPENDIX G -- WWW Immunology sites of interest......102
5.7 APPENDIX G -- Selected templates for 96--well plates 103
5
1.0 INFLAMMATION:
In the first week of this course we will begin to acquire some of
the basic skills needed to examine several components of the
inflammatory cascade, a series of responses that are integrally
intertwined with the immune system. First we will begin to acquire
some basic skills in tissue culture, and the purification of selected
cells associated with the immunoinflammatory system (i.e.,
peripheral blood [PBL] monocytes and neutrophils [PMN or
polymorphonuclear cells]). Then we will learn how to identify them
using morphologic criteria, and how to assess a couple of functions
associated with monocytes/macrophages - phagocytosis (a
subfunction of antibody-dependent cellular cytotoxicity) and
activation-dependent monokine production.
1.1 Purification of mononuclear and polymorphonuclear cells from

mouse peripheral blood.
While this protocol is designed specifically for the purification
of cells from the peripheral blood, such density gradient systems can
also be used for other cell systems (e.g., to purify PMN from
glycogen-elicited peritoneal cavity preparations). In general it is
better to use polypropylene [p.p.] rather than polystyrene [p.s.] tubes
because polypropylene is less "sticky" for the cells and therefore
activates them to a lesser extent than polystryrene. On the other
hand, polypropylene tubes are more expensive, so this too needs to
be taken into account.
Materials
BALB/c mouse
anaesthetic (methoxyfluorane)
clinical centrifuge, 15 ml centrifuge tubes, 4 ml round bottom p.s.
tubes
23-25 ga needles & 1 ml syringes
pipettes/pipettors (micro- and macropipettes)
microscope slides (frosted end; & pencil for labeling)
sterile surgical tools (optional, for open body cardiac puncture)
laminar flow hood, inverted microscope, hemocytometer
6
Reagents
anticoagulant (heparin 1000U/ml)
DMEM with 1 U/ml heparin or with 3 mg/ml EDTA anticoagulant
DMEM-10% FCS (see Appendix A)
70% ethanol
isotonic Percoll(see Appendix C)
RBC sedimentation buffer (4.5% dextran-T500 in PBS)
cytocentrifuge
METHOD
1. Obtain blood from surgically anaesthetized (or euthanized)
mouse either by closed- or open-body cardiac puncture.
Withdraw blood slowly into a 1 ml syringe containing 100 l of
heparin, being careful not to hemolyse the red blood cells by
using too much back pressure on syringe. Work fairly quickly, or
mix the blood with the anticoagulant in the syringe fairly often,
so that the blood doesn't coagulate.
2. Mix the blood with the RBC sedimentation buffer (1 volume sed.
buffer: 1 volume blood) in the 4 ml tubes and allow the mixture to
stand undisturbed on the bench for 20 - 45' (the time can be
highly variable, depending on the species of animal) . The RBC's 1
will form rouleaux (chains of RBC's) that will sediment out of

suspension rather rapidly, leaving you with a leukocyte/platelet-
rich plasma layer above the settled RBC's.
3. Withdraw the plasma layer and transfer to a 15 ml polypropylene
tube. Add 10 - 12 ml of DMEM-anticoagulant to the plasma and
sediment the leukocytes out of suspension by centrifugation
1 RBC do not sediment from bovine blood using this dextran sedimentation protocol.
Alternately, with bovine blood, one can either use the density gradients directly
with diluted (1:1 with PBS) anticoagulated blood, followed by RBC lysis of the red
cell rich-PMN fraction, or use the buffy coat of white blood cells from the top of
sedimented whole anticoagulated whole blood and fractionate these cells using
density gradient centrifugation as noted.
7
(1000 rpm for 10') , . Aspirate the platelet-rich medium, avoiding

2 3
the cell pellet, and then resuspend the cells by vigorously

flicking the tube. When the cell pellet has become a 'paste' on
the lower walls of the tube, add 5 - 10 ml of tissue culture
medium and then gently vortex by hand to ensure that you have
a 'single cell suspension' (i.e., no clumps of cells).
4. While the cells are spinning in step 3, prepare a 70% isotonic
Percoll gradient cushion by mixing together 1.75 ml isotonic
Percoll and 0.75 ml of DMEM/heparin/EDTA, in a 15 ml p.p. tube . 4
After resuspending the cell pellet from step 3, gently layer this
suspension on top of the 70% isotonic Percoll 'cushion', so that
there is no mixing of the two layers. Centrifuge the cell
gradients for 25 min at 2000 rpm (room temperature) in the
clinical centrifuge, and allow the centrifuge rotor to coast to a
stop (i.e., no brake).
5. The completed gradient will appear much as it did before
spinning, but now the PMN and RBC will reside as a pellet at the
bottom of the tube and the mononuclear cells (monocytes and
lymphocytes) will reside as a band of cells at the interface
between the tissue culture medium and the isotonic Percoll. To
harvest the mononuclear cells, simply pipette the cells directly
from the interface, trying to avoid aspirating any substantial
volume of the Percoll. Transfer the cells to a new tube and dilute
any of the density gradient medium by topping up the tube with
additional medium. To harvest the PMN, carefully aspirate the
remaining Percoll solution, then resuspend the pelleted cells by
2 This fairly low speed centrifugation step reduces the platelet contamination of
the mononuclear cell fraction of the blood. Platelets are a very rich source of a
number of cytokines (including TGF) and other potent biologically active
mediators.
3 Alternately, the platelet-rich leukocyte-plasma can be loaded directly onto the
gradients. This saves some time in the purification procedure, but leaves the
mononuclear cell fraction containing high levels of platelets, which can be gotten
rid of by a subsequent low-speed spin (i.e., 1000 rpm for 10 min, in the clinical
centrifuge)
4 Alternately, one can use other density gradient media, such as Ficoll-Hypaque or
Lymphocyte Separation Medium (see ALTERNATE PROTOCOL), which is useful for
the preparation of mononuclear cells from an array of species. Furthermore, LSM
gradients are run for only 15-25 min.
8
flicking the tube and then adding a large volume of medium. If

the PMN are badly contaminated with red blood cells, these can
by lysed by hypotonic lysis or ammonium chloride (see Appendix
D).
20'@
transfer WBC- 2000 rpm
rich plasma to
70% percoll
plasma
30' @
RT
mononuclear cells
percoll percoll
spin percoll PMN & RBC

allow RBC gradient
to to separate
sediment monocytes &
PMN/RBC
6. Wash both cell preparations (i.e., PMN and mononuclear cells) as

above, and resuspend the cells in a minimal volume (e.g., 1 ml)
of medium. Remove 20 l of each preparation for cell counting
by hemocytometer and determine the cell numbers and
viabilities (see Appendix D). If the mononuclear cell fraction is
heavily contaminated with platelets, rewash at low speed (i.e.,
800 rpm for 10').
7. Prepare cytocentrifuge slides of the cells by applying 5x104 cells
in 100 l of medium to each slide assembly and centrifuging
them for 5 min at 1500 rpm. Allow the sedimented cells to dry
well before staining them with Giemsa solution (see Appendix
D).
8. If you have sufficient cells remaining, set them up in culture at a
cell density of 3x106 cells/ml and challenge both the monocytes
and PMN with endotoxin as in 1.1.
9
1.1a ALTERNATE PROTOCOL 1 (for rapid mononuclear cell

gradients)
Rather than using Percoll or Ficoll-Paque gradients to separate
the mononuclear cells from the other leukocytes, one can use
Lymphocyte Separation Medium (LSM; Organon-Technika), which
seems to be useful across a wide array of species (e.g., human,
bovine, equine, murine, ovine). The procedures employed are
essentially identical to those for the Percoll gradients, with the
exception that the cells are centrifuged on the gradients at 1500 rpm
(i.e., 400xg) for 15 - 30 min. Thus the spin is shorter and at a much
lower speed (which may be desirable in terms of the harshness of
cellular treatment as well as in term so the times involved). The
drawback to using an abbreviated centrifugation time is that
neutrophils will not sediment to the bottom of the gradients in this
time, but instead will remain suspended in and can be recovered
from the LSM rather than as a pellet at the bottom of the tube.
Materials
all materials required for the Percoll isolation procedure (1.1)
Reagents
all reagents required for the Percoll isolation procedure (1.1)
Lymphocyte Separation Medium (LSM; Organon-Technika Inc)
METHOD
1-3. Obtain leukocyte/platelet-rich plasma as in the Percoll procedure
(1.1).
4. Pipette 3 ml of LSM into a 15 ml p.p. conical centrifuge tube,
then carefully overlay this with either the platelet-rich leukocyte-
plasma or with platelet depleted, washed white blood cells.
5. Centrifuge the gradients for 15 - 25 min at 1500 rpm in the
5
clinical centrifuge (i.e., 400xg).
5 Fifteen minutes is usually adequate to fully purify the mononuclear cells from the
polymorphonuclear cells and is sufficient to sediment any contaminating red blood
cells, but is is not adequate to sediment the neutrophils in the LSM. A longer spin
time (e.g., 25') is required to sediment these cells.
10
6. Harvest the mononuclear cells as a band from the top of the

density gradient medium, as in 1.1 - step 5, and wash them as
in 1.1 - step 6.
1.1b ALTERNATE PROTOCOL 2 (fractionation of leukocyte sub-

populations)
The individual leukocyte populations (i.e., monocytes,
lymphocytes, basophils, eosinophils and neutrophils) can be at least
partially purified as discrete bands directly from continuous density
gradients. These are relatively easy to generate as custom
gradients which can be tailored for individual needs by simply
changing the low and high density "ends" of the gradient.
TABLE . Examples of useful density ranges for fractionating various

cell populations
Materials
all materials required for the Percoll isolation procedure (1.1)
a continuous density gradient pouring apparatus (commercial or
"home-made")
Percoll solutions of the required density 6
Reagents
all reagents required for the Percoll isolation procedure (1.1)
METHOD
6 The formula for calculating the volumes of materials needed to achieve specific
densities with Percoll is: , where
11
1-3. Obtain leukocyte/platelet-rich plasma as in the Percoll procedure

(1.1).
4. Pour the continuous density gradients by placing low density
Percoll in the first chamber and high density Percoll in the
second chamber. The medium is best delivered from the
gradient pourer into the individual tubes using a peristaltic or
other pump -- as the high density medium empties from the
second chamber into the centrifuge tube, it is replaced and
thereby diluted by low density medium. The second chamber
should be equipped with a mixer or stirrer to ensure rapid and
complete mixing of the reagents during this process. By
steadily withdrawing the delivery needle as the centrifuge tube
fills, you will generate a gradient of continuously decreasing
density, with the density at the bottom of the gradient being
equal to that of the medium in chamber 2 and that at the top of
the gradient being equal to that of the medium in chamber 1.
mixer peristaltic
pump
centrifuge
tube
delivery
tubing or
needle
flow
high
low
density withdraw
density
Percoll needle with
Percoll
(chamber 2) advancing
(chamber1) gradient
5. When the gradient formation is complete, very carefully load the

peripheral blood leukocytes to be fractionated on top of the
gradients. Since the low density medium may be of a density
very similar to that of the medium in which the cells are
12
resuspended, great care may to be needed to avoid mixing of the

cells and gradient medium.
6. Run the gradients for 25 min at 2000 rpm in the clinical
centrifuge, just as in 1.1, and harvest them in an analogous
manner. However, what you will notice with these gradients is
that there are multiple bands, the precise number and their
locations depending on the species and immune status of the
blood donor. For example, quiescent eosinophils of humans and
horses will run at a density equivalent to about _____g/ml, while
activated eosinophils are hypodense, and will run as a discrete
band at a density of about _____g/ml. Harvest each band into a
separate tube.
7. Wash the cells from each band using an appropriate medium for
your purposes (e.g., DMEM-10% or RPMI-10%) and count them
using a hemocytometer. The cells can be morphologically
identified on stained cytocentrifuge preparations.
13
1.2 Isolation of cells from the peritoneal cavities of mice.

The serosal (abdominal or peritoneal) cavity of mice is a rich
source of macrophages which are easily purified by simply flushing
the cavity and performing a plastic adherence step (see 1.4). In
this section, we will simply examine the method for lavage of the
serosal cavity.
Materials
BALB/c mouse
clinical centrifuge, 15 ml centrifuge tubes, 4 ml round bottom p.s.
tubes
23-25 ga needles & 10 ml syringes
pipettes/pipettors (micropipettes and macropipettes)
sterile surgical tools (optional, for open body cardiac puncture)
laminar flow hood
inverted microscope
hemocytometer
Reagents
Ca++Mg++-free-HBSS (HBSS)
70% ethanol
cytocentrifuge
METHOD
1. Euthanize mouse with methoxyfluorane and cervical dislocation,
and then wet its abdomen with 70% ethanol. Fully reflect the
abdominal skin dorsally and ventrally, being careful to not tear
any holes in the abdominal wall (small holes discovered during
step 2 can be clamped off using hemostats).
2. Using a 25 ga needle, inject 10 ml of HBSS into the peritoneal
cavity, through the abdominal wall, and then massage the
distended gut to wash the serosal cells into the HBSS.
14
3. Slowly withdraw the fluid using a 23 ga needle on a 10 ml

syringe and transfer the wash solution to a 50 ml polypropylene
tube.
4. Repeat the wash with another 10 ml of HBSS and pool the two
washings.
5. Wash the cells by centrifugation and resuspend to the desired
cell density, in the desired medium. Determine the cell numbers
using a hemocytometer.
15
1.3 Adherence purification of monocytes or macrophages

Monocytes or macrophages can be easily purified by taking
advantage of the fact that they adhere rapidly and tenaciously to
plastic (polystyrene, but not polypropylene) surfaces. So in this
procedure, you will simply take the total mononuclear cell fraction from
PBL as well as the total peritoneal lavage population and place the
cells into the wells of multi-well microscope slides, a particularly
convenient format for the experiments we will be doing. Macrophage
adherence ostensibly works much better in the absence of protein (e.g.,
FCS), so this protocol will be performed using DMEM-0% FCS.
Materials/Reagents
all materials for purification of mononuclear and PMN from mouse
PBL ( 1.1) or peritoneal macrophages (1.2)
plastic petri dishes or multi-well microscope slides
DMEM-0% FCS
DMEM-10% FCS
METHOD
1. Resuspend the mononuclear or serosal cells at 3x106 cells/ml
in DMEM-0% FCS and add 300 l of the cell suspension to each
well of the multiwell slide.
2. Incubate the cells at 37C in the CO2 incubator for 3 h.
3. Remove the non-adherent cells by repeatedly pipetting the
culture medium directly onto the cell monolayer that has formed
on the bottom of each well. If you are not thorough enough at
this stage, large numbers of lymphocytes will remain with the
monocytes/macrophages on the plastic/glass surface. Remove
the resuspended, non-adherent cells by aspirating the medium
(save the aspirates if you want to retain the monocyte-depleted
lymphocyte preparation). Repeat this procedure as needed,
monitoring the success of washing by direct visual observation
under the inverted microscope.
4. To remove the cells from the plastic, you can either remove the
medium from the cells and replace it with 0.02% EDTA in saline,
and then transfer the dishes onto ice for 10-15 min. By smoothly
16
scraping the bottom of the dish with a cell scraper, 90 - 95% of

the adherent cells will be dislodged as viable cells - wash the
cells and resuspend in DMEM-10% FCS. Alternately, the cells
can be removed by treating with EDTA and trypsin (this
eliminates the need for scraping, but increases the wear and
tear on the macrophage surface proteins).
5. To activate the cells in situ, just add LPS to a final concentration
of 1-10 g/ml.
17
1.4 Antibody- or C3b-dependent phagocytosis by macrophages

In this assay we will explore the potentials for macrophages to
specifically interact with cells that have been targeted by the
humoral immune system. That is, antibody-coated cells can be
phagocytosed or otherwise killed by macrophages that bind the
target via the FcR. We will use the classical example of opsinized
(i.e., antibody- [or C'-] coated) sheep red blood cell phagocytosis by
purified PBL monocytes. This is the basis for antibody-dependent
cellular cytotoxicity (ADCC) by immunoinflammatory cells against
multiple types of cellular targets (e.g., tumour cells, bacterial cells,
etc...).
Materials
monolayers of PBL monocytes in 8-well multi-well slides ( 1.3); or
use peritoneal lavage cells from normal or proteose/peptone-
injected mice
humidified 37C CO2 incubator
clinical centrifuge & tubes
sterile eppendorf tubes
Reagents
C3b-coated zymosan beads (5.4.12)
0.5% suspension of SRBC in PBS
anti-SRBC-coated SRBC (5.4.13).
normal mouse serum (heat-inactivated at 56C for 30 min)
DMEM-10% FCS
METHOD
1. Take the monocyte/macrophage monolayers, in multi-well slides
out of the 37C incubator and to pairs of the wells add either 20
l of either: the antibody-coated SRBC, normal SRBC suspension,
C3b-coated zymosan, or 'activated' zymosan suspension.
Incubate the cells/slides for 60 min at 37C.
2. Remove the slides from the incubator and wash the free SRBC or
zymosan from the cultures by resuspending the sedimented cells
with your pipetter and aspirating the contents. Examine the
18
cells using the phase contrast condenser of the inverted

microscope to determine the extent to which the SRBC/zymosan
particles have been internalized by the macrophages (i.e., are
very dull by phase contrast) or remain in the extracellular
compartment (i.e., are very bright by phase contrast). Return the
cells to the 37C incubator and periodically check them again to
follow the internalization of the particles.
0 min 60 min 1-4h

Ab- or C'-opsinized (adherence to M) (phagocytosis)
SRBC or yeast
3. At the end of the experiment, take the well casing from the slide
itself and fix the cells by immersion in 100% ethanol for 2 min.
Allow the slides to air dry, and stain the slides with Giemsa
stain (Appendix D).
5. Calculate the mean numbers (+/- SEM) of SRBC or zymosan
particles in the macrophages in each treatment group. To do
this, you will count the numbers of SRBC contained within 25
macrophages in each of ten 40x microscope fields, for each well
on the slide. Perform an ANOVA test to determine the statistical
significance of your results, and plot the data (including means,
SEM, and probability values) on a graph.
19
1.5 Activation of macrophages with bacterial lipopolysaccharide

Monocytes or macrophages can be activated by the addition of
many different kinds of reagents (e.g., immune complexes,
interferon-, bacterial products, etc..). In this protocol, we will use
the bacterial cell wall product lipopolysaccharide (LPS) to activate
cultures of Pu5-1.8 (Pu5) cells, a murine macrophage cell line; Pu5
cells were one of the original lines used in the cloning of murine
TNFa. While we will be using this cell line (in order to save the lives
of a number of mice), precisely the same protocol and approximately
the same results would be obtained if we were to use freshly purified
monocytes or macrophages. Later in the week we will then
determine the extent to which you have activated the cells by
quantifying their secretion of a number of monokines (i.e., IL-1, IL-6,
and TNFa).
Materials
laminar flow hood
humidified 37C CO2 incubator
subconfluent monolayer cultures of Pu5-1.8 cells in DMEM-10% FCS
inverted microscope
sterile eppendorf tubes
cell scraper
-20C freezer & freezer bags
Reagents
bacterial endotoxin, 1 mg/ml DMEM-0% FCS (E. coli
lipopolysaccharide; LPS)
METHOD
1. Take a look at the growing Pu5 cells under the inverted
microscope to get a feeling of how they 'should' look under
normal conditions.
20
2. Using a cell scraper, dislodge the Pu5 cells from the plastic and
then transfer them to a 50 ml centrifuge tube. Remove 20 l of
the cell suspension for cell counting with the hemocytometer.
3. While counting the Pu5 cells, sediment them by centrifugation
(10 min at 1500 rpm in the clinical centrifuge). To resuspend
them in fresh DMEM-10% FCS, completely aspirate the
supernatant from the tubes, and then very briskly and repeatedly
flick the tube with the cell pellet to disperse the pellet.
Dispersal will be complete when the pellet has become a paste
on the walls of the tube. Add sufficient DMEM-10% FCS to bring
the cells to a concentration of 3x106 cells/ml, and then dispense
the cell suspension into the wells of 24-well plates, at 1 ml per
well. You will need 8 wells of cells (4 wells of unstimulated cells
& 4 wells of stimulated cells) for todays experiment, as well as 4
wells which contain medium but no cells (LPS-medium controls)
4. Add LPS (to a final concentration of 10 g/ml) to the 4
'stimulated cells' wells and to the 4 'LPS-medium control' wells,
and an equivalent amount of DMEM to the 4 wells of
unstimulated Pu5 cells. Return the cultures to the 37C CO 2
incubator.
5. Label the eppendorf tubes with your initials, the date, and the
sample information (e.g., Pu5 supn't. + [or -] LPS; 1 [or 6, or 24]
h). In addition to the supernatants from the cell cultures, save
several aliquots of the DMEM-10% FCS that was used for the
cultures (as medium controls)
6. At 1, 6, and 24 h post-challenge, examine the cells to get a
feeling for whether the LPS has affected them in any visible
manner. At each time, also harvest the culture medium from the
appropriate wells, centrifuge them for a few minutes at full
speed in the microfuge, and then aliquot each one into four
eppendorf tubes (200 l/tube). Store all aliquots in the -20
freezer (long-term storage requires a -80 freezer).
7. At the end of the experiment, place all of the plasticware & cells
in the contaminated-discard pan.
21
1.6 Monokine Bioassays:
1.6.1 Assay for IL-1 activity

In this assay, we will depend on the property of LM-1 cells (a
sub-clone of the ATCC cell line D10.G4) to proliferate in the presence
of IL-1. While D10.G4 cells, like thymocytes, proliferate in response
to IL-1 in the presence of sub-mitogenic doses of PHA or ConA, LM-1
cells do not need the PHA or ConA to respond to IL-1. Before the
assay, the cells are rendered more sensitive to IL-1 by starving them
of this cytokine for 5-7 days. The cell proliferation will be measured
by examining the abilities of the cells in each well of the 96-well
plates to take up and reduce the dye MTT to an insoluble blue-black
formazan precipitate within their mitochondria. Thus the assays
measures the mitochondrial activity of the cells, not the numbers of
cells. While this is a very convenient parameter, it carries with it
some problems, such as the influence agents that affect
mitochondrial activity can have on the results.
Materials
humidified CO2 incubator
96-well tissue culture plates
micropipetters, tips
multi-channel pipetter
clinical centrifuge, tubes 15 ml
15 ml centrifuge tubes
hemocytometer
ELISA plate reader (with a 595 nm wavelength filter)
Reagents
LM-1 cells which have not been fed fresh IL-1-containing medium for
5-7 days, and which were washed and held overnight in Click's-
10% FCS without conditioned medium (i.e., IL-1-starved LM-1
cells)
Click's-10% FCS without conditioned medium (Click's-10% FCS-CM-)
recombinant mouse IL-1 (our present stock soln is at a concentration
of 7.5 ng/l)
22
MTT, (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide), 5

mg/ml in PBS (stable for 2-3 wks at 4C)
acidified isopropanol (see Appendix C)
23
METHOD
1. Starve the LM-1 cells 4-7 days before assay (feed them fresh
conditioned medium some 4-7 days before the assay, and then
do not feed them again). The night before the assay, wash the
cells in fresh Click's-10% FCS-CM- and leave them in culture
overnight.
2. On the day of the assay, resuspend the LM-1 cells to 4X105
cells/ml in Click's-10% FCS-CM- and dispense into the 96-well
plates at 100 l/well, using a template pattern similar to the one
depicted.
1 2 3 4 5 6 7 8 9 10 11 12
A
B standards
(pg/ml)
C plate blank (A1-H1)
cytokine standards (4 doses)
D 0.5 5.0 50 500
test samples (10/plate)
E medium control
F 'plate-effect' blank wells
G
H
-Do not add any cells to the first column (i.e., wells A1, B1, ...,
H1) of each plate, but do add all other reagents (e.g., Click's
without IL-1) -- this will be the plate blank.
-Do not use the outer wells of the plate for any samples (there is
an 'edge-effect' of the plates), but add DMEM-0% FCS to
these wells.
-Always include a medium-only control (i.e., the same medium as
that used for the experimental treatments, but which has not
been exposed to the experimental cells). Use the same
volume of experimental medium as that used in the test
samples wells -- if you have multiple doses of test samples,
use equivalent multiple doses of medium controls.
-In this format, one plate will accept 10 experimental samples,
each done in quadruplicate.
24
3. Add 80 l of Click's-10% FCS-CM-, and 20 l of appropriately

diluted rmIL-1 standard (like all samples and standards, in
quadruplicate sets of wells) to a series of wells to achieve final
doses of 0.5, 5.0, 50 and 500 pg/ml (see Appendix D, Generation
of standard curves).
4. In parallel sets of quadruplicate wells, run samples (LPS-
stimulated Pu5 cell culture supernatants) and medium controls
(DMEM-10% FCS + 10 g/ml LPS) at required volumes (usually 5-
20 l/well). Bring the final volume of each well to 200 l with
Click's-10% FCS-CM-, and return the cells to the 37C humidified
CO2 incubator for 3 - 5 days.
5. To measure the extent of the IL-1-driven LM-1 cell proliferation in
each well, use the micropipetter to add 20 l of MTT stock
solution (5 mg/ml) to each well, and then return the plates to the
humidified 37C CO2 incubator for 1 - 2 h.
6. (Optional: centrifuge the plates for 10 min at 1500 rpm to
sediment cells.) Carefully remove 150 l of medium from each
well in the plate, and add 100 l of acidified isopropanol to each
well. Agitate the plates on the ELISA plate shaker for 3
minutes, and then read the plates on the ELISA plate reader, set
at a reading wavelength of 595 nm. Download the data to a 3-
1/2" Macintosh-formatted floppy disc.
7. Use the Microplate manager program to crunch your data, and
Statview+ to perform the statistical analyses. Plot your results
as a bar graph (+/- SEM) using the Cricket III program provided.
25
1.6.2 Assay for IL-6 activity

Like the IL-1 assay, the IL-6 assay depends on the fact that
7TD1 cells proliferate strongly in response to low concentrations of
IL-6. Again, we will measure this response using the MTT dye
method.
Materials
hemocytometer
Reagents
7TD1 cells in RPMI-10% FCS supplemented with rhIL-6 (80 pg/ml)
RPMI-10% FCS (see Appendix B)
recombinant human IL-6 (rhIL-6; our stock solution is at 100 ng/ml)
MTT (5 mg/ml in PBS)
acidified isopropanol
METHOD
1. Wash the 7TD1 cells two times in RPMI-10% FCS, and resuspend
to a concentration of 2.5x104 cells/ml in RPMI-10% FCS.
2. Add 100 l of cells to each well in plate, using the same or a
similar sample plate format to that indicated in 1.5.1 (IL-1
assay).
3. Add cytokine standards (2.5, 25, 250 & 2500 pg/ml final
concentration) in 20 l of RPMI-10% FCS, and add your samples
and experimental medium controls in appropriate volumes. In
this assay, we will use 1.0, 2.0, and 5.0 l of the LPS-stimulated
Pu5 cell culture supernatants, so you will need three sets of
'medium controls', each containing 1.0, 2.0 or 5.0 l of DMEM-
10% FCS supplemented with 10 g/ml of LPS.
26
4. Return the plates to the 37C CO2 incubator for 3 days.

5. After 3 days, add 20 ul of MTT solution (5 mg/ml) to each well
(including plate blank wells), and return plates to the incubator
for 1-2 hr. When the mitochondria in each of the cells are
plainly visible at 40x magnification, centrifuge the plates and
remove 150 l of medium from each well. Add 100 l of acidified
isopropanol (lysis buffer) to each well, vortex vigorously in the
ELISA plate shaker for 3 min, and then leave the plates on your
bench overnight.
6. The next morning, read the plates at 595 nm wavelength on the
ELISA plate reader and download the data to a 3-1/2" Macintosh-
formatted floppy disc.
7. Use the Microplate manager program to crunch your data, and
Statview to perform the statistical analyses. Plot your results
as a bar graph (+/- SEM) using the Cricket III program provided.
27
1.6.3 Cytotoxicity assay for TNFa bioactivity

TNFa activity is usually detected using a cytotoxicity assay.
L929 cells (or at least many of its sub-lines) are sensitive to TNFa
such that this cytokine kills the cells over 18 h. However, the
cytotoxic effects of this cytokine are markedly diminished by the
presence of other proteins (e.g., FCS), so that as much as possible,
the assay should be run the absence of other proteins. Finally, L929
cells are most sensitive to the effects of TNFa when the assay is run
in the presence of a low levels of a transcription inhibitor (e.g.,
actinomycin D).
Materials
hemocytometer
Reagents
L-929 cells in DMEM-10% normal horse serum (NHS).
DMEM-0% NHS
recombinant murine TNFa standards (diluted as in Appendix D)
Actinomycin-D (stock 5 mg/ml in 95% ethanol)
MTT (5 mg/ml PBS)
Acidified isopropanol (lysis buffer)
METHOD
1. On the day before the assay, harvest L929 cells from a flask by
trypsinization (remove DMEM-10 % NHS medium and add DMEM-
0% NHS medium. Add 4 - 5 drops of 1% trypsin/10 ml of
medium and allow the typsin to digest the cells off of the plastic.
This process can be expedited by watching the cells and, when
they are beginning to lift well, but many still remain attached,
28
forcefully slapping the flask down on your thigh. All cells will be
dislodged instantaneously.
2. Wash the dislodged cells in DMEM-10% NHS medium, resuspend
them to 4.5x105 cells/ml, and dispense 70 l to each well of a 96-
well plate (for plate format, see 1.5.1; IL-1 assay). Return plate
to the 37C CO2 incubator.
3. The next day, just prior to running the assay, remove all of the
serum-containing medium from the wells by inverting the plate
and vigorously flicking it. Add 180 l of DMEM-0% NHS
containing 2.5 g/ml of actinomycin D (i.e., a 2000-fold dilution of
the stock Act D).
4. Add TNFa standards (0.04, 0.4, 4.0 and 40 units/well), control
medium, and experimental samples (LPS-stimulated Pu5 cell
supernatants & controls) to their appropriate wells, each in a 20
l total volume, so that the total well volumes equal 200 l.
5. Return plate to the 37C CO2 incubator overnight.
6. The next day, examine the cells under the inverted microscope
to get a feeling for the relative levels of L929 cell death in each
well. Add 20 l of MTT (5 mg/ml PBS) to each well (including
plate blank wells), and again return the plates to the incubator.
7. After 45 - 60', re-examine the cells to confirm that adequate
levels of MTT conversion to formazan dye have occurred in the
mitochondria (see 1.5.1, IL-1 assay) and then remove 150 l of
medium from each well in the plate and replace it with 100 l of
acidified isopropanol.
8. Vortex the plates on an ELISA plate shaker to solubilize the
formazan dye, and read the plates on the ELISA plate reader at
595 nm wavelength. Calculate the cytotoxicity in each of the
wells using the formula:
percent cytotoxicity =
mean OD590 medium control wells - OD 590 experimental well x 100
mean OD590 medium control wells
9. Calculate the mean (+/- SEM) cytotoxicities for the standards and
each treatment group, express them in terms of units (+/- SEM) of
TNF activity (a unit of TNF activity is that amount of cytokine
29
required to kill 50% of the cells in the assay) and graph your
results. Perform a statistical analysis to confirm that your
results are meaningful.
30
1.7. Neutrophil chemotaxis assay

Neutrophils are attracted in large numbers into inflammatory
foci (e.g., loci of C' cascade activation, bacterial infections),
where they are important to the clearance of bacteria or other
insults both by virtue of their abilities to phagocytose the
offenders, as well as through their toxic secretory products.
These cells have receptors for an array of chemoattractants,
including bacterial products (e.g., formyl-methionyl-leucyl-
phenylalanine; fMLP), complement split products (e.g., C3a, C5a),
and an array of chemokines (e.g., IL-8 or CINC in rodents). For
this exercise, we will purify neutrophils from the peripheral blood
of mice as in 1.1, then use these cells to study the
chemoattractant activities of fMLP and C3a/C5a (i.e., zymosan-
activated serum;5.4.11 ), as represented in zymosan-activated
sera (i.e., C3a, C5a)..
Materials
microchemotaxis chamber (NeuroProbe Inc)
PVP-free (PVPF) polycarbonate cell migration filters (5 m pore size;
Millipore or NeuroProbe)
purified peripheral blood granulocytes
Reagents
DMEM-0% FCS media
Ca/Mg --HBSS
f-met-leu-phe bacterial tripeptide
zymosan-activated serum ( 5.4.11)
interleukin 8 (or CINC)
METHOD
1. Generate a neutrophil-rich population from the peripheral blood,
using dextran sedimentation (or if your experiments require
purified cells, percoll-purified neutrophils), adjusting the
population to a final concentration of 2x106 cells/ml of HBSS.
31
2. Prepare the chemoattactants for use in the assay, allowing

approximately 30 l of each chemoattractant dilution. Dilute the
zymosan-activated serum (ZAS) to final concentrations of 1:10,
1:100; 1:1000, and 1:10000; the fMLP to final concentrations of
10-6, 10-7, 10-8, 10-9, and 10-10 M; and the recombinant IL-8 to
concentrations ranging from 50 pg/ml to 1000 ng/ml. Putative
chemoattractant-containing biological samples should be diluted
to 1:10, 1:20, 1:40, 1:80 and 1:160, as first estimates with
unknowns.
3. To the bottom chamber of each well (samples should be run in
duplicate, if not quadruplicate) add sufficient chemoattractant to
completely fill the wells (do not overfill them, as interwell
smearing of chemoattractant may occur when placing the
polycarbonate membrane is step 4 -- a very slight convex
surface to the sample is ideal).
4. Place the PVPF-free Nucleopore membrane (shiny side up) on top
of the wells, being careful not to smear the chemoattractants
between wells. (PVP-containing membranes will not retain cells
that migrate completely through the pores in the assay, allowing
them to drop off the membranes into the bottom chambers after
completely traversing the porous membranes - thus, a complete
assessment of the chemotactic response with these membranes
would require enumerating the cells associated with the
membranes, as well as those in the lower chambers.)
5. Place the plastic gasket on top of the membrane, and the top
half of the apparatus on top of the gasket and firmly screw the
lug-nuts down, such the a tight seal is created in each well.
6. Add 50 l of the responder cell population to each well, being
careful to not generate air bubbles which will create an air-lock
on top of the membranes (and thereby exclude cells from the
membranes). Put the tip of your pipette just at the surface of
the Nucleopore membrane, without contacting it, and quickly
expel the 50 l of chemoattractant - with a bit of practice, this
will become easy for you.
7. Place the chambers in a plastic dish containing damp paper
towels in the 37C CO2 incubator, allowing 90 min for the
32
neutrophils to respond to the chemoattractants. Eosinophils

also respond in this time frame (i.e., 90 min) while monocytes
and lymphocytes will call for 2.5-4 hr incubation times to
respond.
8. Upon completion of the incubation period, disassemble the
apparatus and carefully clamp the ends of the membrane with
"bull-dog" or other suitable clamps, then remove the cells which
settled onto the upper surface of the membranes in each well by
scraping the upper surface across a scraper (e.g., a fairly sharp-
edged glass microscope slide clamped into a ring-stand clamp).
9. Allow the membrane to air-dry, then stain with a suitable
staining solution (e.g., Diff-Quick). After air-drying again, the
membranes can be dipped in xylene to "clear" them and
mounted in "Permount" or other mounting medium on glass
slides. Mount the membranes with the bottom side of the
membranes upper-most, so that the cells which have migrated
completely through the membranes are most apparent. The
nuclei of the cells that are still within the membrane pores will
be visible as dark blue or purple shapes within the otherwise
clear-to-light purple pores.
10. Count the cells with have migrated completely through the
membranes, as well as those within the pores
33
1.8. FceRI-dependent activation of mast cells

Mast cells are found in increased numbers at the host's
interface with its environment (e.g., skin, airways, intestinal tract)
and seem to subserve a number of obvious functions (e.g., allergen-
reactivity), but also perhaps some less obvious ones. For this class,
we will take advantage of the fact that they produce very high levels
of some cytokines and use them as a positive control for some of our
experiments. Cl.MC/C57.1 cells produce higher levels of IL-4 than
purified, fully differentiated Th2 lymphocytes, and higher levels of
TNF than LPS-stimulated macrophages.
Mast cells can be activated by cross-linking (i.e., bridging)
adjacent FceR-bound IgE molecules on the cell surface, so in these
experiments we will sensitize some Cl.MC/C57.1 cells with a
monoclonal IgE anti-DNP antibody, and then challenge with DNP-
conjugated human serum albumin (DNP30-40HSA). The 2 hour 7
supernatants from these cells will contain abundant TNFa, and the
cells will contain very high levels of TNFa mRNA.
Materials
T75 flasks
hemocytometer
polypropylene 4 ml culture tubes
Reagents
DMEM-10% FCS media
Cl.MC/C57.1 cells in DMEM-10% FCS.
MAb IgE anti-DNP (ascites fluid; use at 1:3000 for Cl.MC/C57.1 cells).
7 Expression of the FceRI is inducible in mast cells, and this is at least in part
regulated the concentrations of exogenous IgE, such that in the presence of high
concentrations of IgE, mast cells express more IgE receptors. Thus, freshly
purified tissue mast cells, which will likely have the vast majority of their existing
FceRI occupied by IgE antibodies of irrelevant specificities, can be best sensitized
with IgE of the desired specificity by incubating the cells overnight in high
concentrations of the antibody.
34
DNP30-40HSA(stock solution, 1 mg/ml; use at 50 to 100 ng/ml).
METHOD
1. Obtain some Cl.MC/C57.1 cells and adjust the cell concentration
to 3 X 106 cells/ml. You will only need 0.5 ml of mast cell
supernatant/time point, so set up 3 ml of cells (i.e., 9x106 cells
in 3 ml).
2. Add MAb IgE anti-DNP to the tube of C57 cells to a final IgE
dilution of 1:3000, and incubate the cells for 30 - 60' at room
temperature in order to saturate the cells' high affinity IgE
receptors.
3. Wash the cells two times with DMEM-10% FCS and resuspend
them again at 3x106 cells/ml. Bring the cells to 37C by placing
them in a water bath. Add DNP30-40HSA to the cells to a final
concentration of 10 ng/ml and place the tubes upright and lightly
capped in the 37C CO2 incubator for 15 - 20 min to allow them to
gas (i.e., exchange CO2 into the tube). After this, cap the tubes
tightly and lay them on their side in the incubator (or use a
slowly moving rotator at 37C).
4. At each of the indicated times after allergen challenge (i.e., 0.5,
1, 2, and 4 h), remove a tube of cells from the CO 2 incubator and
sediment the cells by centrifugation (8-10' @ 1500 rpm), and
then aliquot the supernatants into labelled eppendorf tubes (100
l/tube). Freeze the aliquots at -20C (or -80C for longer term
storage). The cells can be either discarded (as in our first
Cl.MC/C57.1 experiment), fixed (e.g., for our in situ hybridization
experiments), or processed for total cellular RNA extraction (e.g.,
our Northern analysis experiments).
35
2.0 ANTIBODIES: PURIFICATION & CHARACTERIZATION:
In the second week of the course, we will grow up anti-mouse

CD4 and anti-mouse CD8 monoclonal antibody-producing hybridoma
cell lines, purify the IgG antibodies from the anti-CD4 cell culture
supernatants by affinity chromatography, and analyse the purified
antibodies and total culture supernatants by polyacrylamide gel
electrophoresis and Western blotting. We will then functionally
characterize the antibodies by using them for negative selection of
CD4 and CD8 cells from mouse splenocyte populations. We will
follow the success of depleting each of these populations using two-
colour fluorescence activated cell sorter (FACS) analysis of the
spleen cells.
2.1 Hybridoma cell culture with production of monoclonal antibodies
Materials
T75 tissue culture flasks
clinical centrifuge and 50 ml polypropylene tubes
Reagents
GK1.5 (anti-CD4) and TIB 211 (anti-CD8) hybridoma cells
RPMI-10% FCS
METHOD
1. Set up two T75 (i.e., 75 cm2) tissue culture flasks, one each for the
TIB 211 and GK1.5 cells. Start each flask as a 40 ml culture, at a
cell density of 105 cells/ml of RPMI-5% FCS medium.
2. Allow the cells to continue growing until the medium has gone
completely yellow (acidic) and the cells have essentially all died
(about 5 - 7 days; terminal cultures).
3. Collect the supernatant from each flask and centrifuge it for 15
min at 12,000 rpm in the RC-5B superspeed centrifuge to sediment
all particulate matter.
36
4. Aliquot the supernatants and either process expeditiously or

store at -20C or -80C (for longer-term storage).
37
2.2 Affinity purification of IgG antibodies
2.2.1 Avid-AL affinity chromatography

AVID-AL is a popular new matrix with a natural affinity for IgG
from a wide array of species, including rat. Thus, we will use it to
purify the rat anti-mouse CD4 IgG antibodies from the GK1.5
hybridoma supernatants. Briefly, we will pour mini-columns of the
Avid-AL matrix and run the hybridoma supernatants over the
columns, thereby binding the IgG antibodies to the matrix. Following
a washing step to remove the non-specifically bound proteins, we
will elute the IgG using a low pH buffer, neutralize the eluate, dialyse
it against PBS and concentrate it if necessary.
Materials
AVID-AL IgG affinity column matrix
10 ml polyprep column, or 5-10 ml syringe and glass wool
dialysis tubing
centrifugal concentrators (e.g., Centricon tubes)
Reagents
AVID-CHROM Ig pure kit for purification of IgG
-column binding buffer (>1M proprietary salt)
-neutral elution buffer (1M Tris [pH 7.4], 20% glycerol)
-regeneration buffer (buffered methanol)
GK1.5 (anti-CD4 hybridoma) cells in RPMI-10% FCS
PBS
METHOD
1. Collect the supernatant from a 4 day culture of GK1.5 cells (see
2.1) and centrifuge it for 15 min at 2,500 rpm in clinical centrifuge
to sediment all particulate matter, and then filter the supernatant
through a 0.45 m filter. pH the supernatant to 7.2 - 7.4.
2. Set up the affinity matrix column by pipetting 1.5 ml of a 50%
matrix slurry into a 15 ml centrifuge tube and add 10 ml of
38
regeneration buffer (methanol). Shake the tube vigorously to

disperse the matrix and then sediment the matrix by
centrifugation. Resuspend the matrix in 5 ml of binding buffer
and pour this into a polyprep column. Wash the column with 10 ml
of binding buffer.
3. Dilute the hybridoma culture supernatant fluid with 2 volumes of
binding buffer (to bring the final salt concentration to 500 mM),
and then run the supernatant through the affinity column matrix
several times to saturate the IgG binding capacity of the matrix.
4. Wash the matrix with 15 - 20 ml of binding buffer, or until the
phenol red from the culture supernatant fluid has leached from the
matrix (it will turn from a brown to the lime-green colour).
5. Elute the IgG from the column by running 4 - 5 ml of the neutral
elution buffer (1 M Tris [pH 7.5], 20% glycerol) through the column,
collecting the eluate into one tube. Regenerate the column with
10 ml of regeneration buffer, and store in either binding salt (very
short term storage; salts will precipitate with long term storage)
or PBS (for longer term storage).
6. Dialyse the elute IgG overnight against three changes of PBS (1
liter ea.). After dialysis, determine the protein concentration of the
eluted IgG solution using a Coomassie Brilliant Blue (AKA Bio-Rad
or Bradford) protein assay (Appendix D) and, if necessary,
concentrate the eluted protein using a centrifugal concentrator.
39
2.2.2 Protein A-Sepharose affinity chromatography

Protein A from Staphylococcus aureus (Cowan strain) is a
molecule with a very high affinity for IgG antibodies, and has
been used for several decades as the protein of choice to purify
these antibodies. We will use recombinant protein A bound to
dextran beads (Sephadex-G50), but in the past people have used
the bacteria themselves (fixed, of course) as affinity matrices for
this purpose. In general, IgG1 antibodies will only bind to
protein A at pH 8.0, while IgG2a and other IgGs will do so a more
physiological pH (i.e., pH 7.2) as well as pH 8.0. The elution pH
optima of IgG from the protein A columns is isotype-specific,
with IgG1 elution being best performed at pH 6.5, IgG2a at pH
4.5, and IgG3 at pH 3.0 (the least hostile or acidic elution
conditions available should be employed to prevent acidic
hydrolysis of the antibodies)
Materials
protein A-Sepharose (Pharmacia, or Sigma)
10 ml polyprep column, or 5-10 ml syringe and glass wool
spectrophotometer or UV monitor (equipped for reading OD 260)
dialysis tubing
Reagents
0.1 M citric acid (pH 4.5)
supernatant from a terminal culture of GK1.5 (rat IgG2a anti-CD4
hybridoma) cells
PBS (pH 7.2)
PBS/20% ethanol
1M Tris (pH 9.0)
METHOD
1. Filter the GK1.5 culture supernatant through a 0.45 m filter and
pH it to 7.2 - 7.4.
2. Pipette 1 ml of the protein A-Sepharose 50% matrix slurry into the
column and wash it with several column volumes of PBS.
40
3. Run the GK1.5 culture supernatant through the column matrix

several times to saturate the IgG binding capacity of the protein A.
4. Wash the column with PBS until no more protein elutes from the
column, using a spectrophotometer or UV monitor (OD 260) to
confirm the end-point.
5. Elute the IgG from the column by running 10 ml of the 0.1 M citric
acid elution buffer through the column, collecting the eluate into
one milliliter fractions (i.e., 1 ml/tube). In order to minimize the
time that the antibodies remain in an acidic environment, we will
elute the column directly into 1 M Tris buffer (pH 9.0).
6. Determine the protein contents of the eluted fractions by either
determining the OD260 of the fractions, or by use of a protein
assay (e.g., Coomassie Brilliant Blue [a.k.a. Bio-Rad, Bradford or
CBB] protein assay; Appendix D), and pool the protein-containing
fractions.
7. Regenerate the column with 10 ml of PBS, and store the matrix in
PBS/20% ethanol.
8. Dialyse the eluted IgG overnight against three changes of PBS (1
liter ea.). After dialysis, determine the protein concentration of the
eluted IgG solution using a and, if necessary, concentrate the
eluted protein using a centrifugal concentrator.
41
2.3 Preparation of IgM antibodies

IgM antibodies do not adhere well to most of the available
immunoglobulin affinity matrices (e.g., protein A, T gel, Avid-
Chrom), so alternate methods must be employed to prepare IgM
antibodies. A number of methods are available, with the
simplest true purification probably being achieved by size
exclusion chromatography (IgM pentamers have a molecular
mass of 750 kD, while IgG and albumin have molecular masses
of 150 & 65 kD, respectively). In this session, we will simply
enrich for IgM antibodies by differentially "salting out" the IgM
protein with ammonium sulfate. High concentrations of
ammonium sulfate will cause the proteins in a solution to
differentially precipitate out from their solubilized state - at 30%
ammonium sulfate saturation, most of the IgM antibodies will
precipitate out of solution, while at 45% saturation most of the
IgG isotypes and the residual IgM antibodies will precipitate out
of solution.
Materials
beaker and stir bar
dialysis tubing
0.45 m filters
pH meter and pH reagents
stir plate
syringe and 20 ga needle
Reagents
culture medium from a terminal culture of TIB211 (IgM anti-CD8)
hybridoma cells
saturated ammonium sulfate solution
borate-buffered saline
Method
42
1. As with the IgG purification, generate a 4-day TIB211 hybridoma

culture supernatant, sediment the particulate matter by
centrifugation, then filter and pH the supernatants as in 2.2.
2. Place the supernatant in a beaker on a stir plate and drip
saturated ammonium sulfate into the supernatant, while
constantly stirring, to a final ammonium sulfate concentration of
30% (i.e., 0.5 volumes of ammonium sulfate into 1 volume of
antibody). Use a syringe and 20-23 ga. needle (as required) to
drip the ammonium sulfate into the antibody culture
supernatant, drop-by-drop.
3. After the 30% ammonium sulfate has precipitated the available
proteins in the hybridoma supernatants, allow the stirring to
continue for an additional 30 min, then sediment the precipitate
by centrifugation (15 min at 2500 rpm).
4. Return the supernatant to the beaker and continue dripping
ammonium sulfate into the supernatant to a final ammonium
sulfate concentration of 45%, and then sediment that as in step
3.
5. Dissolve the precipitated proteins in borate-buffered saline,
dialyse overnight versus an excess of borate-buffered saline,
determine the protein concentration using a CBB assay and
aliquot and freeze.
43
2.4 Analysis & characterization of immunoglobulins

In this section, we will take the anti-CD4 IgG that you have purified,
as well as the TIB211 anti-CD8 IgM antibodies and characterize them
according to their size (molecular mass) and reactivity with anti-IgG
and -IgM antibodies. We will use polyacrylamide gel electrophoresis
(PAGE) for the former, and Western blotting for the latter.
2.4.1 Polyacrylamide gel electrophoresis of immunoglobulins

PAGE is a powerful technique for confirming the presence of
proteins in solutions, although it is lacks the specificity of Western
blots in identifying the proteins (beyond their molecular weights).
However, it is an ideal method to confirm the homogeneity or lack
thereof of purified proteins.
Materials
PAGE mini-gel apparatus and power pack
Reagents
Commercial acrylamide/bisacrylamide solution (40% acryl/0.8%
bisacryl)
Commercial separating and stacking gel buffers
ammonium persulfate 10% solution (freshly prepared)
isobutyl alcohol (H2O-saturated)
PAGE 2x sample prep buffer (for denaturing & reducing the samples)
PAGE 5x SDS/run buffer (dilute 1:5 with H2O before use)
PAGE gel fix solution (25% isopropanol, 10% acetic acid)
rapid Coomassie blue stain (0.006% Coomassie Brilliant Blue G-250 in 10%
glacial acetic acid)
protein samples
biotinylated molecular weight markers (for Western blots)
unstained molecular weight markers (for protein staining gels)
METHOD
1. Clean the glass plates and gaskets, and assemble the PAGE
apparatus. Place a mark on the glass at the 6 cm mark (from
the bottom).
44
2. Mix together in a side-arm flask, 3.9 ml of the

acrylamide/bisacrylamide solution, 3.75 ml of the separating gel
buffer, and 7.2 ml of H2O. Degas the solution under vacuum for
10 - 15 min. Add 150 l of ammonium persulfate, and mix once
again by swirling gently, and pour the acrylamide separating gel
mixture into the PAGE apparatus up to the 6 cm mark, and then
overlay the mixture with H2O-saturated isobutyl alcohol. Allow
the PAGE gel reagents to polymerize, and then pour off the
alcohol overlay and rinse the top of the gel with water.
3. In another side-arm flask, mix together 0.5 ml of the
acrylamide/bisacrylamide solution, 4.5 ml of the stacking gel
buffer, and degas the solution under vacuum for 10 - 15 min. Add
25 l of ammonium persulfate, and mix once again by swirling
gently, and pipette this solution on top of the polymerized
separation gel. Immediately place the well-forming comb in
place, with the teeth submersed in the stacking gel solution.
Allow the stacking gel to polymerize, and then remove the comb
from the top of the stacking gel.
4. Attach the gels/plates to the electrode frame and seal the seams
with agarose. Place this assembly into the PAGE run reservoir
and fill the reservoir and top of the gel assembly with PAGE run
buffer.
5. Prepare samples for the PAGE run while the stacking gel is
polymerizing. To do so, mix the protein sample 1:1 with sample
prep buffer in an eppendorf tube and place in a boiling water
8
bath for 5 min . Remember to run the appropriate molecular

9
8 For non-reducing conditions, the sample prep buffer does not contain 2-
mercaptoethanol, while for reducing condtions, the buffer should contain 10% 2-
mercaptoethanol.
9 Load the proteins such that individual protein bands should contain 1-2 g of
protein. For complex mixtures of proteins, you will need to run greater amounts of
protein in order to visualize the multiple bands in the samples. Thus, for protein A-
purified IgG, you could run only 1-2 g, while for ammonium sulfate precipitated
IgM-containing culture supernatants, you would need to run perhaps 20 g of
protein.
45
weight markers , . Pulse microfuge the tubes to sediment

10 11
samples and hold on ice until running them on the gels.

Carefully pipette each sample into a well of the gel. 12
6. Run the gel at 150 volts until the bromophenol blue dye front
reaches the bottom of the gel. Turn off the power, disassemble
the PAGE gel apparatus.
7. Incubate the gel for 10 - 15 min in isopropanol fix solution, stain
it in the rapid Coomassie brilliant blue for 2 h to overnight at
room temp, and then destain in several changes of 10% glacial
acetic acid over 5-8 h.
8. For permanent storage, the gel can be dried down using a
commercially available drying apparatus.
2.4.2 Western blotting to detect immunoglobulins

In Western blotting, proteins that have been fractionated on PAGE
gels are electrophoretically transferred to nitrocellulose or other
types of membranes (e.g., derivatized nylon), to which they may
differentially bind, and then the protein bands on the membranes are
visualized immunochemically, using alkaline phosphatase- or horse
radish peroxidase-labelled antibodies and appropriate chromogens.
Western blotting is a very sensitive method of detecting proteins to
which antibodies already exist.
Materials
Western blotting transfer apparatus (wet)
Whatman #1 filter paper
nitrocellulose transfer membrane (do not handle with bare hands)
Reagents
10 Unstained molecular weight markers from Gibco/BRL will contain 1g of each

marker protein per l of solution, so that loading 5 l of marker mix will give you 5
g of each band in the mixture.
11 For Western blots which are to be probed with an avidin-alkaline phosphatase
detection system, load 1.5 l of marker mix/lane (i.e., a 1:20 final dilution of the
mix).
12 The wells of the gels will be able to hold 30 l of sample/sample prep buffer
46
PAGE gel with separated proteins to be transferred (unfixed)

Western blotting transfer buffer
TTBS (Tris-buffered saline with 0.1% Tween 20)
TTBS-5% Carnation skim milk powder
PBST (PBS with 0.05% Tween 20)
bromo-chloryl-indoyl phosphate/nitroblue tetrazolium (BCIP/NBT)
substrate
streptavidin-alkaline phosphatase conjugate (strep-AP; diluted 1:5000
in PBST)
METHOD
1. Equilibrate the gel after electrophoresis to Western blot transfer
buffer by incubation for 45 min. Also equilibrate a sheet of
nitrocellulose (cut to the same size as the half the gel to be used
for Western blotting) to the same buffer.
2. Transfer the gel to the gel blotting bracket, such that the gel is
sandwiched immediately next to the nitrocellulose (with no air
bubbles between the two) and both are sandwiched between two
sheets of filter paper, with two 'brillo' pads flanking the filter
paper. This arrangement of gel, nitrocellulose membrane and
pads (depicted below) is clamped between the Western blotting
electrodes such that the gels is on the negative electrode side
and the nitrocellulose is on the positive electrode side (the
proteins will be negatively charged due to the SDS in the PAGE
sample prep buffer).
47
'brillo' pads
negative Whatman #1 filter

electrode paper
-
PAGE gel +
nitrocellulose
ASSEMBLED positive electrode

TRANSFER
ASSEMBY
3. Set the gel assembly in the gel apparatus, fill it with transfer
buffer and then move the whole apparatus to the cold room. Run
the transfer at 100 volts for 2-3 h (IgM may migrate through the
nitrocellulose membrane in 3 h).
4. Disassemble the transfer assembly and stain the gel as in
2.4.1.
5. Transfer the nitrocellulose membrane into a large weigh boat
containing 15 ml of TTBS-5% Carnation skim milk powder for 2 h to
overnight to block the non-specific binding of other proteins to the
nitrocellulose membrane.
6. Wash the membrane two times for 5 min each with PBST and place
the blot into 15 ml PBST containing biotinylated rabbit anti-rat IgG
and IgM (1:1500 final dilution) for 60 min at room temperature.
7. Wash the blot three times 5 min in PBST and place the blot in 15
ml of PBST containing a 1:5000 final dilution of streptavidin-
alkaline phosphatase conjugate for 90 min at room temperature.
8. Wash the blot three times 15 min in H2O, and then transfer into 15
ml of freshly-prepared TMS -BCIP/NBT mixture. (To prepare the
BCIP-NBT substrate: to 5 ml of 0.1 M Tris (pH 9.5), 0.1 M NaCl, 0.05
M MgCl2, add 22 l BCIP; mix by inverting then add 16.5 l NBT and
again mix). Incubate for 30 - 40 min until the bands become well-
defined, and then wash the blot with H2O and air dry.
9. Plot the relative migration distances of each of the molecular
weight marker proteins on a graph, and use the plot and the
migration distances of the bands in the IgG and IgM lanes to
48
interpolate the relative molecular weights of the proteins

detected, and thereby confirm their identities.
49
3.0 T CELL AND B CELL RESPONSES:
3.1 C'-dependent depletion of CD4+ and CD8+ T Cells

In this exercise, we will learn how to deplete selected populations
of cells from a heterogeneous mixture of cell types. Specifically, we
will use anti-CD4 or anti-CD8 antibodies and C'-dependent cytotoxicity
to deplete all of the CD4+ or CD8+ cells, respectively, in a single cell
suspension of mouse splenocytes. We will confirm this depletion by
using commercially available fluorescein-labelled anti-CD4 and
phycoerythrin-labelled anti-CD8 antibodies to stain the residual cell
populations and then we will analyse the composite phenotype of
these cells using two-colour FACS (fluorescence-activated cell sorter)
techniques.
Materials
single cell suspension of mouse splenocytes (at 1x107 cells/ml;
Appendix D)
clinical centrifuge and 4, 15 and 50 ml polypropylene tubes
Reagents
GK1.5 (anti-CD4 hybridoma) cell supernatants (from a 2-4 day culture)
TIB211 (anti-CD8 hybridoma) cell supernatants (from a 2-4 day culture)
purified GK1.5 IgG antibodies
purified HB121 IgG antibodies (control IgG; specificity: mouse IgG1
anti-human IgE)
fluorescein-labelled anti-mouse CD4 IgG antibodies
phycoerythrin-labelled anti-mouse CD8 IgG antibodies
Low-tox rabbit C' (Cedar Lane)
METHOD
1. Label and set up a series of tubes to receive reagents as follows:
LABEL CELLS ANTIBODY (g/ml) COMPLEMENT (l)

no Ab, no C' 100 0 0; medium only
HB 121 (control) 100 10 100
50
GK1.5 supn't 100 10 100

GK1.5 IgG 100 10 100
100 1.0 100
100 0.1 100
TIB211 supn't 100 10 100
TIB211 IgM (30% 100 10 100
AS)
100 1.0 100
100 0.1 100
TIB211 IgM (45% 100 10 100
AS)
100 1.0 100
100 0.1 100
2. Add 100 l of the splenocyte suspension (i.e., 106 cells) and 100 l
of appropriately diluted antibody (10, 1.0 or 0.1 g protein from the
HB121, GK1.5, or TIB211 preparations) to each tube. Incubate the
cells with the antibody for 30 min at room temperature.
3. Add 100 l of the guinea pig complement to each tube, and
incubate the tubes at 37C for 30 min. Wash the cells two times
with DMEM-10% FCS (8 min at 1500 rpm in the clinical centrifuge).
4. Resuspend the cells to 100 l in DMEM-10% FCS, and add 3 l of
FITC-labelled anti-CD4 and 3 l of PE-labelled anti-CD8 IgG to each
tube and incubate the cells on ice for 30 min.
5. Wash the cells once more with an excess of DMEM-10% FCS and
resuspend to 100 l with DMEM-10% FCS. Add 100 l of 1%
paraformaldehyde and fix the cells on ice for 30 min, then wash
the cells one time with PBS and resuspend to 100 l with PBS.
6. Store the cells in the refrigerator overnight, for FACS analysis the
next day.
51
3.2 MACS purification (or depletion) of CD4+ and CD8+ T Cells

In this complementary exercise, we will learn how to use
antibody-coated paramagnetic beads that are specific for the isotypes
of the anti-CD4 and anti-CD8 antibodies that you generated in 2.1 to
purify all of the CD4+ or CD8+ cells, respectively, from a single cell
suspension of mouse splenocytes. The real advantage of this system
is that the selected populations are not killed or otherwise damaged
by the isolation procedure, so that it may be possible to use them for
functional studies after the purification procedure -- this is what we do
in our lab to purify mast cells from tissues. The potential disadvantage
is that in some cases the cell surface marker employed may well, by
itself, activate or otherwise alter the physiology of the cells (e.g., anti-
CD3 antibodies may activate T cells). We will confirm our depletion by
using commercially available fluorescein-labelled anti-CD4 and
phycoerythrin-labelled anti-CD8 antibodies to stain the residual cell
populations and then we will analyse the composite phenotype of
these cells using two-colour FACS (fluorescence-activated cell sorter)
techniques.
Materials
single cell suspension of mouse splenocytes (at 1x107 cells/ml;
Appendix D)
clinical centrifuge and 4, 15 and 50 ml polypropylene tubes
Mini-MACS separation column (type MS; capacity 107 positive
cells/column)
Mini-MACS column magnet (Miltenyi Biotec Gmbh)
Reagents
GK1.5 (anti-CD4 hybridoma) cell supernatants, purified IgG (2.1)
TIB211 (anti-CD8 hybridoma) cell supernatants, ammonium sulfate ppt.
IgM (2.1)
PBS (pH 7.2), containing 5% FCS & 2 mM EDTA (PBS/EDTA)
mouse anti-rat IgG-conjugated paramagnetic beads (Miltenyi Biotec)
mouse anti-rat IgM-conjugated paramagnetic beads (Miltenyi Biotec)
fluorescein-labelled anti-mouse CD4 IgG antibodies
phycoerythrin-labelled anti-mouse CD8 IgG antibodies
52
METHOD
1. Label and set up a series of tubes to receive reagents as follows:
2. Add 1 ml of the splenocyte suspension (i.e., 107 cells) and 250 l of
appropriately diluted antibody (HB121, GK1.5, or TIB211; i.e., 25 g)
to each tube. Incubate the cells with the antibody for 30 min at
room temperature.
3. Wash the cells one time with DMEM-10% FCS (8 min at 1500 rpm in
the clinical centrifuge) and resuspend to 300 l of PBS/EDTA.
4. While the cells are washing, also wash the Mini-MACS column,
flushing it through with the PBS/EDTA . If air bubbles are present
13
in the column, it may be necessary to back-flush the columns to

get rid of the air bubbles. Mount the column in the magnetic holder
in preparation for the separation in step 7 below.
5. Add 25 l of the anti-IgG paramagnetic beads to the GK1.5 tube
from step 2 (i.e., 1:40 beads:cells), 25 l of the anti-IgM beads to
the TIB211 tube, and 25 l of each to the no antibody and HB121
tubes, and incubate for 30 min at 6-12C (ice-water bath).
6. Wash the cells in PBS/EDTA, resuspending them to 300 l
PBS/EDTA.
7. Apply the washed cells to the column (in the magnetic holder), and
collect the flow through, then wash the column two times with an
additional 1 ml (each time) of PBS/EDTA, collecting the flow-
through each time. Pool the flow through cells, which comprise
the marker depleted populations, and wash and count them.
8. Remove the column from the magnet, clamping it to a ring stand,
and flush the bound cells out of the column with 2 ml of PBS/EDTA,
using the column plunger to assist in this operation, and collecting
the eluted cells in a sterile tube..
9. Wash and count under the hemocytometer the retained cell
populations. You will use these counts to compare with those
obtained by FACS analysis of the total spleen populations (no Ab
treatments).
13The first 10-20 drop to elute from this wash step will appear quite cloudy (due to
elution of matrix residue). You should continue washing at least until the
cloudiness of the eluting buffer diminishes to background.
53
8. Stain the unselected populations from step 6 with the FITC-anti-

CD4 and PE-anti-CD8 antibodies at in 3.1, and fix with
paraformaldehyde for FACS analysis the next day.
54
3.3 Assessment of T cell proliferation (Blast assay)

One of the basic tests in immunology is that of confirming
that T cells are responding to antigens as they should, or
determining the precise levels at which these cells respond to
antigens (specific immunoreactivity of the cells) or mitogens (overall
responsiveness of the T cells). Traditionally, immunologists set up
the target T cell population (e.g., PBL mononuclear cells, lymph node
or spleen cells) in tissue culture, challenged the cells with the
antigen of interest and then measured the proliferation of the T cells
three days later by ascertaining their uptake of a radiolabelled DNA
precursor (e.g., the nucleotide 3H-thymidine). This is a very sensitive
assay, but it calls for the use of equipment and facilities specialized
for use in handling radioisotopes. More recently, many labs have
been using the MTT assay, performed exactly as outlined above for
the LM-1 (IL-1 ASSAY) and 7TD1 (IL-6 ASSAY) cell proliferation
assays, to accomplish the same goal.
In this assay, we will examine the overall responsiveness of
splenic T cells from BALB/c mice, by challenging the splenocytes
with the T cell mitogen concanavalin A (Con A). In order to optimize
the system however, we will need to determine the optimal
concentrations of spleen cells needed for the assay, as well as the
optimal doses of Con A required to induce proliferation. As with
most immune responses, too much or too little of either can be
inhibitory to the responses we wish to examine.
Materials
hemocytometer
55
Reagents
BALB/c mouse splenocytes (5x107 nucleated cells/ml) in DMEM-10%
FCS
DMEM-10% FCS media
Concanavalin A (our stock is a 4 mg/ml solution in DMEM)
MTT 5 mg/ml in PBS)
acidified isopropanol
METHOD
1. In one 96-well plate, set up both cell number-response and Con A
dose-response curves using the plate format indicated below,
and the volumes indicated in the table.
1 2 3 4 5 6 7 8 9 10 11 12
A
B cell number-response
C (cells x10 6 well)
D
cell numbers titration ConA dose-response
E (g ConA/ml)
F medium control
G
H
CELL NUMBERS TITRATION ConA DOSE-RESPONSE CURVE

[CELL] mediu cells ConA [ConA] mediu cells ConA
(x106/well m (l) (l) (g/well) m (l) (l)
) (l) (l)
0.1 178 2 20 0.1 130 50 20
0.25 175 5 20 0.25 130 50 20
0.5 170 10 20 0.5 130 50 20
1.0 160 20 20 1.0 130 50 20
2.5 130 50 20 2.5 130 50 20
5.0 80 100 20 5 130 50 20
7.5 30 150 20 10 130 50 20
56
For the cell numbers titration portion of the experiment, use a

ConA concentration of 2.5 g/ml. For the ConA dose-response
curve, use a splenocyte concentration of 2.5x106 cells/well. Add
sufficient DMEM-10% FCS to each well to bring the well volumes
to 180 l, and then add 20 l of appropriately diluted ConA to
each well (i.e., total well volume of 200 l).
2. Place the plates in the 37C CO 2 incubator for three days.
3. At the end of the three days, examine the cells in each well to
get a feeling for how the cells have responded to the ConA
(strong ConA mitogenic responses will have induced cell
clumping). Next, add 20 l of MTT solution (5 mg/ml) to each
well and return the plates to the incubator for 45 - 90 min.
4. Remove 150 l of medium from each well, taking care not to also
aspirate cells from the bottom of the wells. Add 100 l of
acidified isopropanol to each well and place on the ELISA plate
shaker for 3 - 4 min, and then read the plate at 595 nm
wavelength on the ELISA plate reader.
5. Calculate the mean OD595 (+/- SEM) for each treatment group,
perform the statistical analyses and plot your data using bar
graphs.
57
573.4 Plaque Forming Cell (PFC) assay for IgM-producing cells
Materials
sheep red blood cells (SRBC; 2x108/ml), washed in PBS 14
20% (v/v) SRBC in PBS/10%FCS

syringes & 27 or 30 ga needles
mice
PFC assay chambers
methoxyfluorane (anaesthetic)
Reagents
PBS
H20 & 10x HBSS for hypotonic lysis of spleen RBC
guinea pig serum diluted 1:2 in PBS/10% FCS
Method
1. Inject 0.2 ml of the SRBC suspension (i.e., 4x107 cells) either
intravenously or intraperitoneally into 8-10 week old mice.
2. Euthanize the mice after 4 days if they were immunized
intravenously (or after 5 days if they were vaccinated
intraperitoneally), and generate single cell suspensions from their
spleens. Lyse the residual splenic red blood cells by hypotonic or
ammonium chloride lysis (5.4.8) and bring the nucleated cells to a
final concentration of 5x106 cells/ml
3. To a series of labelled eppendorf tubes, add either 0, 30, 60, or 120
l of the splenocyte suspension, 30 l of the 20% SRBC suspension
(i.e., in PBS/10% FCS), 30 l of diluted guinea pig serum and 240,
210, 180, or 120 l of RPMI-10%, as appropriate to bring the final
volume of each tube to 300 l, and thoroughly mix the contents of
each tube.
4. Load 80 l of the mixture into each assay slide chamber (see
diagram below) and seal each with wax.
14 As an estimate of the numbers of SRBC available from the peripheral blood of a

sheep, 1 ml of heparin-anticoagulated peripheral blood can yield 1x10 10 red blood
cells after 5-6 washes with PBS
58
lower to appose
against bottom slide microscope slide (2)
double-sided
tape gaskets (3)
assembled double-chamber apparatus splenocyte-SRBC mixture
5. Incubate the chambers for 1 - 1.5 h at 37C.

6. Remove the chambers from the incubator and count the numbers of
plaques of red blood cell lysis under the microscope.
59
3.5 ELISPOT assays for single cytokine- or Ab-producing cells

A very powerful method to assess the abilities of animals to
produce antibodies (Ab) or cytokines in response to antigenic
stimulation is the ELISPOT assay. This procedure is used to detect the
abilities of individual B or T (or other) cells to secrete their products.
We will assess the abilities of splenocytes from BALB/c mice that have
been immunized with ovalbumin-alum to produce ovalbumin-specific
antibodies of varying isotypes or those of these mice or SRBC-
vaccinated mice to produce IL-4 or IFN- in response to antigenic
challenge in vitro. Thus, we will in effect by phenotyping the CD4+ T
cell responses (i.e., Th1 or Th2) of the mice to these immunogens.
Materials
splenocyte suspensions from mice vaccinated with:
- ovalbumin/alum (i.p.: on dy 1 and dy 14; harvest cells on dy 21)
- SRBC (i.v.: dy 1, 200 l of 0.1% SRBC; dy 14, 200 l of 1% SRBC)
pipettes/pipettors
clinical centrifuge, 15 ml tubes
96-well ELISPOT plate
Reagents
anti-mouse IL-4 and anti-mouse IFN capture antibodies (1 g/ml
coating buffer stock)
bromo-chloryl-indoyl phosphate/nitroblue tetrazolium (BCIP/NBT)
substrate
biotinylated anti-mouse IL-4 and anti-mouse IFN antibodies (detection
antibodies)
DMEM-10% FCS
ELISPOT blocking solution (DMEM-10% FCS)
ELISPOT coating buffer (carbonate/bicarbonate, pH 9.4)
Lymphocyte separation medium
ovalbumin (5 g/ml coating buffer stock solution)
streptavidin-alkaline phosphatase conjugate (strep-AP; diluted 1:5000
in PBST)
60
METHOD
1. Precoat each of the ELISPOT plates with capture antibodies or
antigen (this can be done several days in advance). To do this, to
each well of the plate, add the purified anti-IL-4 or anti-IFN
antibodies in ELISPOT coating buffer at a concentration of 1 g/ml
or the ovalbumin at a concentration of 5 g/ml. Cover and seal the
plates with parafilm and incubate overnight at 4C.
A
anti-OVA IgG1, IgG2a, IgM, IgE antibody ELISPOT
1 2 3 4 5 6 7 8 9 10 11 12
A con't con't
1x10e6, 1x10e5,
B no Ag, with Ag, no IFNg
G1,G2a,M 1x10e6, G1,G2a,M
C with Ag, no cells
D G1,G2a,M,E no secondary
no a-IL-4
no cells,
E with Ag, no cells
G1,G2a,M anti-IFNg,
F no secondary no Ag,
5x10e5, 1,5,10x10e5
G 1x10e6 cells with Ag, anti-IL-4,
with Ag, G1,G2a,M no Ag,
H no biotin Ab 1,5,10x10e5 no blocking
(OVA) anti-IL-4, -IFNg ELISPOT

61
B
OVA mice anti-SRBC mice
1 2 3 4 5 6 7 8 9 10 11
12
A anti-IL-4, no secondary no cells
anti-IL-4
B + ovalbumin, anti-IL-4, no secondary
1,5,10x10e5
C 1,5,10x10e5, anti-IFNg,
+SRBC 1,5,10x10e5,
D no SRBC
anti-IFNg,
anti-IFNg
E + ovalbumin anti-IL-4,
1,5,10x10e5
1,5,10x10e5,
F anti-IFNg,
no SRBC
1,5,10x10e5,
G no anti-IL-4
+SRBC no blocking
H no cells no anti-IFNg
anti-SRBC mice
2. The next morning, remove the capture antibody from the wells by
inverting the plate and sharply flicking it. Rinse out each well with
200 l of blocking solution by pipetting the solution up and down
several times with a multichannel pipetter (do not touch the
bottom of the well with the pipette tips!). Remove the blocking
solution, rinse as above and add 100 l of fresh blocking solution to
each well. Incubate the plates at 37C for a minimum of 1 hour (or
until the cells from the next step are ready).
3. Generate a single cell suspension from the spleens of an OVA- and
SRBC-sensitized mice, and resuspend the cells to 1x107 cells/ml
DMEM-10% FCS.
4. Remove the ELISPOT plate from the incubator and dump out the
blocking solution. Add 100l of spleen cells and 100 l of antigen
(ovalbumin @ 2.5 g/ml or SRBC @ 1.0% suspension) to each well,
and incubate the plates at 37 C for 8 hours. Do not to disturb the
plates while they are incubating, so that each cell secretes all of
its cytokine/antibody in only one location.
5. After 8 h, remove the cells from the plate by first agitating the
plates on the ELISA plate shaker for 3 min, and then inverting
62
them and vigorously flicking the contents from the wells. Continue
washing the wells with 200 l of PBST -- vigorously pipette the
contents up and down, but do not touch the bottom of the wells,
and flick the PBST out as above. Remove the excess PBST by
banging the plate upside down on paper towels. Repeat this wash
procedure 6 times.
6. Add 100 l of biotinylated anti-cytokine or anti-isotype antibody
(diluted to 1 g/ml in PBST) to each well, and incubate the plates
overnight at 4C.
7. Wash the plates 5 times with PBST as in step 6, add 100 l of
diluted strep-AP to each well, and incubate the plates for 1.5 h at
room temperature.
8. Wash the plates 10 times by repeatedly dunking the plate in a
large beaker of distilled-deionized H2O, each time removing all of
the H2O from each well as above (i.e., flicking and banging on
paper towels). Careful washing is important, for it will reduce the
assay background substantially.
9. Add 100 l of freshly prepared BCIP/NBT substrate to each well.
(To 5 ml of 0.1 M Tris (pH 9.5), 0.1 M NaCl, 0.05 M MgCl 2, add 22 l
BCIP, mix by inverting and then add 16.5 l NBT and again mix; for
smaller volumes, use 3.75 ml buffer, 16.5 l BCIP & 12.37 l NBT).
10. Incubate the plates at room temperature in the dark until spots
develop or the plate
background begins to increase (approximately 30-45 minutes).
11. To stop the reaction, flick out the substrate and wash the plates 3
times in H2O by the dunking method. Allow them to dry overnight
(with the lids off), as the background fades dramatically when the
plates dry.
12. Count the spots under low magnification under the dissecting
scope, or using an image analyser
63
3.6 ELISA ASSAYS (Enzyme-linked Immunosorbent Assay)

The ELISA assay is a powerful method for the detection of
specific antigens (be they from pathogens or those specific for
antibodies or cytokines). It can detect many antigens with a
sensitivity of 1 pg/ml, although for many others sensitivities of 100-
200 pg/ml are difficult to achieve. There is very little difference
between the ELISPOT and ELISA assays - the ELISPOT detects
cytokine or antibody production in situ by viable cells while the ELISA
detects proteins which are present in a soluble form in biological
fluids. The former assay is performed in nitrocellulose paper-lined 96-
well plates and utilizes a precipitating indicator dye (so that individual
cell traces are detected), while the latter is performed in high protein-
binding plastic 96-well plates and employs soluble indicator dyes.
While the ELISPOT tells you how many cells are secreting the antigen
being detected, the ELISA will quantify the product precisely.
3.6.1 ELISA assay for detection of antigen-specific antibodies

In the antigen-specific antibody ELISA, the wells are coated with
the non-antigen-specific immunoglobulin standards or the antigen in
question, the latter should capture the antigen-specific antibodies
from the samples. and then blocked. Subsequently, the wells are
blocked with a protein solution that is not recognized by the capture
antigen or standards (e.g., DMEM-10% FCS or 1% bovine serum
albumin), and then the biological samples are applied. The captured
antigen-specific antibodies are then detected precisely as are the
cytokines/antibodies in the ELISPOT assay (3.5)
Materials
Immulon-4 ELISA plates
pipettes/pipettors
Reagents
experimental sera or other putative antibody source (e.g., from ova-
vaccinated mice)
64
ovalbumin for capture of antigen-specific antibodies

IgG1, IgG2a, and IgE standards (commercial or appropriate hybridoma
supn't )
15
biotinylated IgG1, IgG2a, and IgE detection antibodies

ELISA carbonate coating buffer
DMEM-10% FCS
streptavidin-allkaline phosphatase (SA-AP) or SA-horse radish
peroxidase (SA-HRP) 16
3 mM p-nitrophenyl phosphate (in 0.05 M Na2CO3/0.05 mM MgCl 2;

substrate for SA-AP)
2-2'-azino-di[3-ethyl-benzthiazoline sulfonate (6)] with H 2O2 (ABTS;
1 component substrate for SA-HRP)
1% sodium dodecyl sulfate (SDS; optional stop solution for reactions)
METHOD
1. Coat the wells of the Immunolon-4 plates with the antigen to be
used for antibody capture (ovalbumin @ 5 g/ml in carbonate
coating buffer) or with the diluted antibody standards, as
appropriate. Add 100 l per well, then cover the plate(s) and
incubate overnight at 4C.
2. Wash the wells 2 times with PBST. To do this, one can either use a
squirt bottle of PBST or a multichannel pipettor to fill each of the
wells and allow to stand for 30 - 60 seconds, then turn the plate
upside down and flick the wash fluid into a sink, then fairly
forcefully hit the plate upside down on a stack of paper towels to
15 ATCC MAb # (mouse IgG1 anti-human IL-8), ATCC MAb # HB121 (mouse IgG2a
anti-human IgE) and ATCC MAb (mouse IgE anti-DNP) ascites fluids work well for the
antibody ELISA standards, using ascites fluid dilutions ranging from 1:50 >
1:1,000,000. Alternately, one can use high antibody value reference sera generated
by vaccinated of mice with the antigen of interest. For example, BALB/c mice
produce a very strong IgE and IgG1 response following intraperitoneal vaccination
(dy 0) and boosting (dy 14) with 5 g of ovalbumin conjugated to 1 mg of alum. Sera
or plasma from these mice can be used as reference standards.
16 In our hands, the streptavidin-horse radish peroxidase/ ABTS enzyme/substrate
combination gives vastly superior results to those obtained with the SA-AP/p-
nitrophenyl phosphate enzyme/substrate system although, in all honesty, we have
not "played" with the latter system sufficiently to suggest that it could not yield
equivalent results under the correct circumstances.
65
remove the excess fluid from each well. Block the plates by adding
200 l of DMEM-10% FCS to each well and incubate, covered, at
room temperature for 2 hours.
3. Wash the wells 2 times with PBST as in step 2, and to the
ovalbumin-coated sample wells add 100 l of the samples (diluted
1:50 in DMEM-10% FCS) to each well. Add 200 l of PBST to the
antibody standard wells. Cover the plate and incubate overnight at
4 C.
4. Wash the wells 4 times with PBST. Dilute the biotinylated anti-Ig
isotype
antibodies to 0.5 - 2.5 g/ml in PBST (the optimal concentration will
need to be determined empirically), and add 100 l of each per
well, as appropriate for each sample or standard. Cover and
incubate at room temperature for 90 min.
5. Wash the wells 8 - 10 times with PBST, and add 100 l of either SA-
HRP (1:5000 in PBST) or SA-AP (1:5000 in PBST) to each well.
Incubate at room temperature for 90 min.
6. Wash the plates 8 - 10 times with distilled H2O by the dunking
method, making sure to remove the excess fluid as above. Add 100
l of the ABTS substrate (SA-HRP avidin-enzyme conjugate only) or
freshly prepared 3 mMp-nitrophenyl phosphate substrate (SA-AP
avidin-enzyme conjugate only) to each well, then place the plates
in a dark location (e.g., a drawer works well) and allow the
reactions to develop for 20 - 45 min at room temperature. The
17
plates can be read directly at this point, or stop solution may be

added to reduce plate to plate variability when reading multiple
plates. For the ABTS substrate, the stop the reactions by adding
100 l of 1% sodium dodecyl sulfate (SDS) to each well.
7. Read the plates using the ELISA plate reader, set at a reading
wavelength of 405 nm.
17 If the optical densities of the standards or samples does not come up to a

useable level within this 45 min time frame, the plates can be left longer (e.g.,
several hours or even overnight with particularly weak samples). However, during
this time, it is possible that the standards could become overdeveloped, making
calibration of the results difficult or impossible.
66
3.6.2 ELISA assay for detection of cytokines

Rather than using antigen as the capturing agent, the cytokine
ELISA depends on using a cytokine-specific antibody which does not
recognize the same cytokine epitope as the biotinylated detection
antibody. Thus, monoclonal antibody (MAb) pairs are required and are
available routinely from many commercial sources. Alternately, you
can use a monoclonal in conjunction with a polyclonal anti-cytokine
antisera. However, care must be taken to ensure than the
antibodies/antisera employed will only recognize the cytokine of
interest and that they will not inappropriately bind to immunoglobulin
or other assay reagents and thereby give "false-positive" results.
Materials
Immulon-4 ELISA plates
pipettes/pipettors
experimental samples for cytokine assay
Reagents
cytokine capture and biotinylated detection antibody pairs
ELISA carbonate coating buffer
DMEM-10% FCS
SA-horse radish peroxidase (SA-HRP)
2-2'-azino-di[3-ethyl-benzthiazoline sulfonate (6)] with H 2O2 (ABTS;
1 component substrate for SA-HRP)
1% sodium dodecyl sulfate (SDS; optional stop solution for reactions)
METHOD
1. Dilute the capture antibody of each pair to 0.5 - 2.5 g/ml in
coating buffer, as empirically determined, and add 100 l to the
appropriate wells of the ELISA plate. Cover the plate and incubate
overnight at 4C.
2. Wash the wells 2 times with PBST, as above (3.6.1, step 2), and
block the plate by adding 200 l of DMEM-10% FCS to each well
and incubate, covered, at room temperature for 2 hours.
67
3. Wash the wells 2 times with PBST, and add 100 l of the standards
or samples (diluted in DMEM-10% FCS) to each well. The precise
levels of standards to use will depend on the detection limits of the
antibody pairs employed, but will often cover the range of from 1
pg/ml to 1500 pg/ml. Cover the plate and incubate overnight at 4
C.
4. Wash the wells 4 times with PBST. Dilute the biotinylated anti-Ig
isotype
antibodies to an empirically-determined optimal concentration
(usually 0.5 - 2.5 g/ml) in PBST and add 100 l of each per well, as
appropriate. Cover and incubate at room temperature for 90 min.
5. Wash the wells 8 - 10 times with PBST, and add 100 l of the
diluted SA-HRP (1:5000) to each well. Incubate at room
temperature for 90 min.
6. Wash the plates 8 - 10 times with distilled H2O, making sure to
remove excess fluid. Add 100 l of ABTS substrate to each well
and allow the reactions to develop for 20 - 45 min at room
temperature. The reactions can be stopped by adding 100 l of 1%
SDS to each well.
7. Read the plates using the ELISA plate reader, set at a reading
wavelength of 405 nm.
68
3.7 In vivo assessment of T cell responses: Th1 versus Th2 responses
Materials
Ovalbumin- and SRBC-immune mice
Tissue processor (for processing biopsies to paraffin blocks)
1 ml syringes and 30 ga needles
scalpel blades
Reagents
Ovalbumin in Ca++/Mg ++-free HBSS (40 g/ml)
SRBC in Ca++/Mg ++-free HBSS (5% suspension)
In situ hybridization fixative
70% ethanol
METHOD
1. Set up the antigens for the intradermal skin tests in the 1 ml
tuberculin syringes equipped with 30 ga needles. The bevel side of
the needle and the calibrated side of the syringe should be aligned if
you are going to inject defined volumes based on the calibration of
the syringe.
2. Lightly anaesthetize each mouse it turn (i.e., two ovalbumin-
sensitized mice and two SRBC-sensitized mice), so that it can be
injected intradermally in the ear. If this will take some time, also set
up a 15 ml tube (with cotton batting and methoxyfluorane) that you
can use during the procedure, in order to keep the mouse
anaesthetized on the bench.
3. Inject 25 l of the 5% SRBC suspension intradermally into the right
ear of the mouse and inject 25 l of the 40 g/ml ovalbumin solution
intradermally into the left ear.
4. Return the mouse to its cage, making sure that you keep it warm (use
a heat lamp if necessary) and safe (from any overly dominant
littermates) during recovery.
5. At four hours post-injection and then again at 24 h, euthanize one
mouse from each group (i.e., one SRBC- and one ovalbumin-sensitized
mouse) and take biopsies of the reaction sites. To do this, use a fresh
#12 scalpel blade to remove the ear and cut it in half longitudinally,
69
through the middle of the reaction (injection) site. Trim away and
discard the tissue from the outside of the ear, away from the injection
sites.
6. Transfer each half of the ear into ice-cold ISH fixative and fix the
tissue for 3 h on ice.
7. Replace the ISH fixative with ice-cold 70% ethanol and store the
tissue in this solution at -20C until you are ready for tissue
processing.
8. Place the tissues into labelled tissue-tek cassettes and transfer into
the tissue processor at the 70% ethanol step. The processor will
automatically process the tissue through to molten paraffin.
9. Embed the tissues in paraffin such that the ear tissues are standing
straight up in the molds, so that upon sectioning you will obtain
cross-sections of the tissue.
10. Cut 6 m paraffin sections of the tissues and dry them onto slides
overnight at 42C.
11. Stain the sections with Giemsa stain using the stipulated protocol
(6.4.9.1.2), mount with permount and examine the tissues under the
microscope.
70
3.8 Immunohistochemical detection of cytokines in tissues

Immunohistochemistry is a powerful tool for the detection of
single cells which are positive for any marker of interest for which
suitable antibodies exist (e.g., F4/80 antibody-positive M, GK1.5-
positive CD8 cells, cytokine-secreting cells, etc). It is thus similar to
FACS analysis, but has perhaps traditionally been used most often with
fixed tissues or cells, allowing one to assess the prevalence of marker
expression in situ, within the context of ongoing physiological or
pathological processes. The tissues or cells are perhaps best
prepared in fixatives such as Bouins or Carnoys, since formaldehyde
fixation (especially prolonged fixation) can destroy the "antigenicity"
of many epitopes, rendering them much less detectable using standard
protocols. In our laboratory, we often use our in situ hybridization
fixative (5.3) for experiments calling for either in situ hybridization
(ISH) or immunohistochemistry (IHC).
Materials
micropipetters
ISH-fixed cell suspensions or paraffin-embedded 5-7 M tissue sections
Reagents
xylene
graded alcohol baths (i.e., 100%, 90%, 70%, 50%) for hydrating tissue
sections
PBST - PBS containing 0.05% Tween 20
normal goat serum
primary anti-cytokine antibody (suitable for immunohistochemistry;
e.g., rabbit anti-TNF)
biotinylated secondary antibody (e.g., biotinylated goat anti-rabbit IgG
antibody; 3.5)
commercial streptavidin-alkaline phosphatase (SA-AP; 3.5)
BCIP/NBT (see 3.5)
METHOD
1. Run paraffin sections through two xylene baths (10' & 5') to remove
the paraffin, then rehydrate the tissues by passing the slides
71
through the graded ethanol baths (2x100%, 90%, 70%, 50%, each <
1 min), then equilibrate to PBST buffer for 2-3'.
2. Circle the tissue sections with wax pencil to reduce the amount of
reagents required to saturate the tissue sections in each of the
following steps.
3. Incubate the rehydrated tissue sections in 10% normal goat serum
for 2 h @ RT in order to block the non-specific binding capacity of
the tissue immunoglobulin receptors (FcR) for the antibodies to be
used subsequently.
4. Overlay the tissue sections with 75 l of the primary antibody,
using empirically-determined optimal concentrations of the
antibodies (culture supernatants are often used @ 1:5- 1:100;
commercial preparations of purified antibodies @ 1:50-1:250; and
monoclonal antibody ascites fluids @ 1:250-1:10,000) ON @ 4C.
5. Wash the tissue sections three times for 5' each in PBST.
6. Overlay the tissue sections with 75 l of the biotinylated
secondary antibody, again using empirically-determined optimal
concentrations of the antibodies, generally for 2h @ RT.
8. Overlay the tissue sections again, this time with SA-AP diluted to
1:5000 in PBST, and incubate for 90 ' @ RT to label the secondary
antibodies in the tissue sections.
10. Overlay the tissue sections with the commercial solution of
BCIP/NBT for 20 - 40' @ RT (continue staining until the antigen of
interest becomes apparent or until a non-specific general tissue
background staining begins to appear).
11. Transfer slides to H2O and counter-stain with a water-based
counter-stain such as Gill's haemotoxylin ( ) and cover-slip with
aqueous mounting medium.
72
4.0 MOLECULAR ANALYSIS OF CYTOKINE mRNA EXPRESSION :
4.1 Northern blotting

Northern blotting is much like Western blotting, except that instead
of examining the expression of proteins by electrophoretically separating
them according to their size and confirming their identities with specific
antibodies, you will be examining the expression of the mRNA for the
protein by electrophoretically separating them according to their size and
confirming their identities with specific cDNA probes. We will examine
the methods for the purification of the mRNA, for electrophoresing and
blotting it, and for probing the blots.
4.1.1 Purification of cellular RNA

While the protocol outlined herein is for the purification of RNA from
cells, it is essentially the same as that for tissues, except that with
tissues one uses a tissue disrupter or homogenizer. We will be using CsCl
gradients to purify the RNA, but many people instead use an acidic
phenol-chloroform extraction protocol. I use the former method for
purifying large amounts of RNA and the latter for minuscule amounts of
RNA -- there are an increasing number of very good mRNA purification
kits available on the market as well. Finally, while we will not be
isolating mRNA from the total cellular RNA (because our target mRNA
species should be highly expressed), for mRNA species that are only
weakly expressed, you will need to purify the mRNA from the total cellular
RNA pool.
Materials
samples for RNA extraction (tissues or cultured cells)
RNAse-free pipettes, tips, test tubes
micropipetters
single cell suspensions of activated and control Cl.MC/C57.1 cells
(time course of 0, 3 & 6 h)
Reagents
DEPC-H20
20% lauryl sarcosine
73
5.5 M GSCN lysis solution

5.7 M CsCl/sodium acetate
74
METHOD
1. At each time in the activation time course, pellet the appropriate
tubes of C57 cells by centrifugation, then generate a paste on the
tube walls by vigorously flicking the tubes. Add 3 ml of GSCN lysis
solution to each tube, and vortex vigorously for 30 sec - 1 min. 18
2. For samples homogenized by vortexing only, shear the DNA by

forcefully aspirating and ejecting the lysate through an 18 ga. needle,
using a 3 ml syringe, and taking care to avoid frothing the samples
excessively. (When the DNA is shorn sufficiently, the sample will drip
discretely from the tip of the needle rather than coming out as a
viscous linear strand.)
3. Pipette 1.0 ml of CsCl density gradient medium into each of 6
polyallomer ultracentrifuge tubes, and then gently overlay the CsCl
with the cell lysates. Do not allow the CsCl and samples to mix, and
fill the buckets only to 2 mm from the top (you will need to leave
room for the addition of additional GSCN as required for bucket
balancing (step 4).
4. Load the tubes into the SW55Ti rotor buckets and balance the loaded
buckets & caps in pairs (i.e., #1 & 4, #2 & 5, #3 & 6), to within 1/100th
of a gram. Use GSCN lysis solution to balance the buckets by adding
it to each tube with a syringe fitted with an 18 ga needle, one drop at
a time. Tighten the lids down - finger-tight only!
5. Fit the buckets onto the SW55Ti rotor, very carefully place the rotor
on the centrifuge spindle, being very careful not to damage the
overspeed disc on the bottom of the spindle!, and gently close the
weighted door.
6. Switch on or set the following centrifuge control options: vacuum on,
slow acceleration on, brake off, maximum temperature to 30C, run
temperature to 22C, rotor speed to 42,000 rpm, run time to 20 h,
timed operation, and finally, on. Wait for the rotor to come to speed to
confirm that everything is operating smoothly.
18 When extracting RNA from tissues, grind the tissues using a polytron-type
homogenizer in GSCN without sarcosine (to avoid foaming), then add the sarcosine
after the tissue homogenization. Pre-centrifuge the homogenized tissues for 30 min
to 2 hours in the ultracentrifuge to get rid of any insoluble tissue remnants. In place
of a polytron to grind up the tissues, one could also use a mortor and pestle with
liguid nitrogen to accomplish the same thing.
75
7. The next day, after the rotor has stopped, switch off the vacuum, open
the door and remove the rotor from the spindle, and the buckets from
the rotor. Take the tubes from the buckets, wash them out with hot
tap water & dry, and check the "O" rings and lubricate using vacuum
grease, if necessary.
8. Completely aspirate the liquid contents of the tube using a Pasteur
pipette attached to a vacuum apparatus. The last few milliliters are
best gotten by turning the tube upside down to allow the fluid to drain
to the pipette. Stay away from the gelatin-like pellet of RNA at the
bottom of the tube. The pellet will be anywhere from 1 - 8 mm across.
9. One at a time, cut the tubes off about 1 cm above the bottom using a
heated scalpel blade, break up the RNA pellet with the tip of the
eppendorf tip, and dissolve the pellet in 50 - 400 l of DEPC-H 2O
(depending on the size of the pellet) by repeated vigorous pipetting.
If necessary, repeat the H2O step to make sure you get all of the RNA,
transferring both washes into an RNAse-free 1.5 ml eppendorf tube.
Close the tube and transfer it to a 65C H2O bath for 5 min to
completely dissolve the RNA, then briefly microfuge to sediment the
contents.
10. Remove 5 l of the RNA from each tube and transfer to another tube
containing 995 l of H2O. Immediately transfer the stock tubes of
RNA to dry ice and then to the -80C freezer. Determine the optical
density (260 nm and 280 nm wavelength; use quartz cuvettes) of each
of the samples. Calculate the OD260:OD280 ratio and the
concentrations of the stock RNA solutions as follows: The 260:280
ratio should be between 1.5 and 2.0 (pure nucleotide solutions have
an OD260 of 2.0 -- the lower the ratio, the more protein contamination
but, practically speaking, ratios of 1.5 are not uncommon and may
still yield excellent results with Northern analyses). To calculate the
concentration of the stock RNA, multiply the OD260 by 10 to get the
concentration in g/l (i.e., an OD260 of 0.108 would mean that the
stock RNA concentration was 1.08 g/l; for a 300 l solution, that
would mean that you had purified 1.08 x 300 = 324 g of RNA).
11. If your RNA solution is too dilute for subsequent Northern analysis
(e.g., 20 g represent >30 l of RNA), then you will need to
concentrate the samples. To do this, take the calculated volume
76
required for 20 g and transfer it to a new RNAse-free eppendorf tube.

Add 0.1 volumes of 3M sodium acetate (pH 7.0) and 2.5 volumes of
100% RNAse-free ethanol, vortex briefly to mix and put in the -80C
freezer overnight. The next day, microfuge the RNA at 4C for 30 min,
carefully aspirate the supernatant (avoid the minuscule pellet!) and
wash the pellet with 500 l of ice-cold 70% ethanol. Re-microfuge
for 15 min at 4C, aspirate the supernatant again and leave the tubes
open on the bench for 30 - 60 min to dry. When the ethanol has
dried, resuspend the pellet in the required volume of H2O or Northern
blot RNA sample prep buffer and dissolve at 65C, as above. Store at
-80C, or on dry ice, until ready to use.
77
4.1.2 Electrophoresis of RNA & transfer to membranes

It is critical that the electrophoresis apparatus used is more-or-less
free from RNAse contamination. Therefore, it should be reserved for RNA
work and should not be used for preparation or analysis of plasmids, a
protocol that often depends heavily on the use of RNAses.
Materials
RNAse-free horizontal gel electrophoresis gel apparatus & power-pack
Zeta-bind transfer membrane (or other)
RNAse-free glass or plastic pipettes
micropipetters & tips
filter paper (e.g., Whatman #1) & absorbent paper (e.g., paper towels)
Reagents
agarose
DEPC-H20
ammonium acetate
formaldehyde
5X MOPS,
10xSSC
1.2% agarose gel
10 mg/ml ethidium bromide
0.03% methylene blue in 0.3M ammonium acetate
RNA sample prep solution (for denaturation of RNA prior to
electrophoresis)
RNA sample dye/loading solution (for visualization of progress during run)
METHOD
1. Wash the Northern blotting apparatus with DEPC-H2O, and then pour
a 1.2% agarose/formaldehyde/MOPS gel (appendix , pg 94) to a depth
of about 8-10 mm (since the RNA samples will be negatively charged
and will migrate towards the positive electrode, make sure that you
position the gel with the wells closest to the negative electrode).
When the gel is fully solidified (this can be expedited by doing the
last of the cooling step in a refrigerator), remove the comb from the
78
gel and fill up the chamber with 1x MOPS running buffer, covering the
gel to a depth of 2-3 mm with buffer.
2. To eppendorf tubes containing 20 g samples of RNA in a volume of
10 - 20 l of H2O, add 15 l of the RNA sample prep buffer and 2 l
of RNA load buffer/dye. Incubate the samples in a 65C water bath for
10 min, then briefly pulse microfuge the tubes and hold on ice until
ready to use.
3. Load the RNA samples into the wells in the gel, being careful to not
puncture the very fragile bottoms of the wells with the pipette tips.
Run two sets of samples, one for Northern blotting, and a separate
set for staining with ethidium bromide (for confirmation that the RNA
samples are intact). When all the samples are loaded, run the gel
until the leading dye front is approximately 50 - 75% down the gel.
(The leading dye front will migrate just in front of the 18s rRNA, while
the trailing dye front will migrate just behind the 28s rRNA in each
sample.)
4. Remove the gel from the gel apparatus and carefully cut it to
separate the Northern blotting portion from that destined for ethidium
bromide staining. Transfer both 'halves' into DEPC-H2O, and incubate
the gel in the water bath for 20 min with gentle rocking. For the half
of the gel to be transferred to the nylon membrane, follow steps 5 - 7,
for the portion to be stained with ethidium bromide, follow alternate
steps 5a - 6a.
5. Equilibrate the half for transfer to 10xSSC, by incubating in 10x SSC
for 20 min with gentle rocking.
5a. The portion to be stained with ethidium bromide should be incubated
for another 20 min in H2O.
6. Assemble the northern blotting apparatus as follows: Cut a wick of 4
- 5 layers of Whatman #1 filter paper that can run the full length of
the gel apparatus gel platform and extend down into the fluid
reservoirs. Place the gel, upside-down onto this wick, making sure
that there are no air bubbles trapped underneath. Apply a piece of
the Zeta-bind membrane (cut the overlap the gel by a few millimeters)
directly to the gel, and then apply several more pieces of filter paper,
cut to the size of the membrane, directly on top of the transfer
membrane, and cover this whole construct with 4-5 inches of paper
79
towel, which will absorb the buffer that wicks through the gel and
Zeta-bind membrane. Next, cut some large pieces of parafilm
membrane and place them around the gel, so that the transfer buffer
can only wick into the paper towel by going through the gel. Finally,
place a weight on top of the paper towel (e.g., a 500 ml reagent bottle
that is half full) and secure in place.
paper towel
filter paper
nylon membrane
gel for blotting
filter paper wick
10x SSC
gel/blotting apparatus
6a. To the portion of the membrane to be stained with ethidium bromide,

transfer the gel into 0.1 M ammonium acetate solution for another 20
min, and then into 0.1 M ammonium acetate containing 0.5 g/ml
ethidium bromide. Stain the gel for 45 min and then examine under
UV light. If the background is not too high, photograph the gel as is,
but if necessary the background can be decreased by further washing
with water.
7. For the portion of the gel that was blotted, disassemble the transfer
apparatus the next morning and bind the RNA to the membrane by UV
cross-linking using the Strata-linker. Place the damp blot on damp
filter paper into the irradiation apparatus and set it to automatically
deliver the correct energy to the membrane (auto-crosslink). After
cross-linking, the RNA is completely stable, such that the blots can
be stored indefinitely at room temperature or in the freezer. (Stored
in this manner, they can be successfully probed up to several years
later).
8. Assess the integrity of the RNA and the efficiency of transfer by
staining the blots in 0.03% methylene blue in 0.3M sodium acetate
80
(pH 5.2) for 45 seconds (or more, if required), then destaining the
blots in DEPC-treated distilled water for 2 minutes. If the RNA is
intact and transferred efficiently, you will readily see the 18s and 28s
ribosomal RNA bands on the blots, as well as a subtle smear of mRNA
that runs from above the 28 s rRNA band to below the 18 s rRNA band.
(If the rRNA bands are not crisp and sharp looking, then some RNA
degradation has taken place the extent of the degradation can be
judged readily in this manner.)
81
4.1.3 32P-labelledcDNA probe synthesis

The probes used to detect the mRNA species of interest are
generated by in vitro labeling of individual cDNAs specific for each mRNA,
using the random hexamer method. In this method a solution containing
essentially all possible nucleotide hexamers is used to prime the
synthesis of secondary stands of cDNA from the denatured primary
strands in a reaction in which one of the component deoxynucleotides is
32P-dCTP. The labelled cDNA is then purified from the unbound dCTP by
chromatography through Sephadex G-50.
Materials
cDNAs for each mRNA of interest
Plexi-glass 32P-energy-blocking safety shield
glass pipettes
plastic wrap
Geiger counter
Reagents
32P-labelled dCTP (Mandel-New England Nuclear; 3000-8000 Ci/mmol)
Oligolabelling kit (Pharmacia) containing the random hexamer primers

and the Klenow fragment of DNA polymerase.
METHOD
1. Mix together 500-1000 ng of purified cDNA and H2O, to a final volume
of 34 l, then denature the cDNA by heating to 90C for 10-15 min.
Transfer the cDNA to a 37C incubator for 5 min.
2. Add 10l of the oligolabelling reaction mixture (i.e., NTPs/random
hexamer soup), 5 l of 32P-dCTP, and 1 l of Klenow fragment.
3. Incubate the reaction mixture overnight at room temperature (or for
>3 h @ 37C).
4. Purify the 32P-labelled cDNA from the unbound probe by column
chromatography (see accompanying diagram). Run the 50 l reaction
mixture over an 8 ml Sepharose G-50 column, carefully chasing the
50 l reaction into the matrix with 2 sequential 1 ml aliquots of STE
buffer, and eluting the labelled cDNA with STE. Follow the isotope
using a Geiger counter, masking from the Geiger counter the column
82
itself and the collection vessel, but not the elution tubing. Thus the
Geiger counter will detect all of the elution of label from the column
(both that incorporated into the cDNA and that still unincorporated).
poly-prep column beta energy shield

(with window @ elution
Seph G-50 tubing)
unincorporated
32P beta energy
bound 32P
elution tubing
gieger counter
collection tubes
5. Once labelled material begins to read on the Geiger counter (i.e., is in

the column elution tubing), begin to collect all of the eluate into one
new tube, continuing to do so until this first peak of labelled material,
which comprises the 32P-cDNA in its entirety, has eluted. Either
collect any residual activity into a second, discard, tube or simply do
not elute it from the column, discarding it instead with the column
and matrix.
6. Determine the radioactivity present in the labelled cDNA by adding a
5 or 10 l aliquot of the cDNA to 4 ml of liquid scintillation cocktail
and counting it in a counter.
83
7. Calculate the volume of column eluate required to yield 1.5x107 cpm

of 32P-cDNA, then aliquot and freeze the labelled material until ready
for use.19
8. Clean up your work area, making sure to monitor all pipettes, shields
benches, etc, for 32P contamination. Wipe test all surfaces and
equipment to confirm your Geiger counter survey and clean up any
remaining contamination using a detergent such as Count-Off (New
England Nuclear). Enter your wipe test results in the lab log books.
19 32Pis a highly unstable isotope, so that the labelled probes cannot be stored for
any more than 3 days to a week without decaying beyond usefulness.
84
4.1.4 Pre-hybridization, hybridization, and washing (Zeta-Bind nylon

membranes)
Materials
Plexi-glass 32P-energy-blocking safety shield
U.V. irradiation apparatus (e.g., Stratalinker) or vacuum oven
rotary hybridization oven with hybridization tubes
(or water bath, heat-sealable bags, & heat-sealing unit)
glass pipettes
plastic wrap
Geiger counter
Reagents
0.1x SSC/0.5% SDS
2x SSC/0.1 % SDS
0.2x SSC/0.1% SDS
pre-hyb/hybridization solution
32P-labelled cDNA probes (TGF, TNFa & actin)
METHOD
1. After transfer of the RNA from the gel to the Zeta-bind membrane,
cross-link the RNA onto the membranes either by U.V. irradiation or by
baking the blot in a vacuum oven (50C for 4 h).
2. Block the non-specific 32P-cDNA-binding sites on the membranes by
incubating the blot in the hybridization oven for 60 min at 65C in 15
ml of 0.1X SSC/0.5% SDS.
3. Remove the Northern blot blocking solution from the blot and replace
it with 15 ml of hybridization solution. Pre-hybridize the blots in this
solution for 3 h to overnight at 42C.
4. Next, add 1.5x107 cpm of 32P-labelled cDNA probe (250 - 1000 l
volume) to the 15 ml of hybridization solution containing the blot. The
probe must be boiled before addition to the blot to denature the
double-stranded DNA (and allow the anti-sense strand to hybridize to
the mRNA on the blots), and should not be allowed to cool before
85
addition to the blot. Incubate the blots with the probe again
overnight at 42C, making sure that the oven rotator is operating.
5. The next day, remove the very radioactive hybridization solution from
the hybridization bottles (discard in the 32P-liquid waste canister),
and rinse the bottles twice for 5 min each with 2xSSC/0.1% SDS,
discarding the spent washing into the 32P-liquid discard canister.
6. Add 25 - 50 ml of 0.2xSSC/0.1% SDS to each bottle and incubate for
30 min at 42C. Repeat this 30 min/42C wash a second time, and
discard the spent washings into the 32P-liquid discard canister.
7. Remove the blot from the bottle and lay it flat out on a piece of
plastic-wrap. Do not allow it to dry at this point, as drying will
permanently fix all of the (i.e., specifically and any residual non-
specifically bound) 32P-labelled cDNA probe to the blot. Using the
Geiger counter, scan the blot to determine whether most, if not all, of
the radioactivity is associated with bands at the expected position
(molecular mass) on the blot. If it is not, then you need to continue
washing the blot(s), increasing the stringency of the washes (i.e.,
decreasing the SSC concentration &/or increasing the wash
temperature) but, most of the time, 60 min at 42C in 0.2xSSC/0.1%
SDS wash is adequate. If the counts appear to be specifically bound,
wrap the blot completely in plastic wrap and either store it in a
freezer until ready to proceed or place in the autoradiography
exposure cassette (again, do not allow the blot to dry!).
86
4.1.5 Detection of mRNA bands by autoradiography
Materials
autoradiography exposure cassettes ('enhancing screens' highly
desirable)
Kodak X-OMAT AR x-ray film
automated x-ray film processing unit (or hand processing
equipment/solutions)
Reagents
none, unless processing by hand
METHOD
1. In the laboratory, and for autoradiography cassettes without built-in
'enhancing screens', place two 'enhancing screens' into the cassette
on top of each other (as in a sandwich), such that their shiny surfaces
face one another. Place the probed, plastic-wrapped blot in the
cassette, outside of the enhancing screen sandwich.
2. In the dark-room, under safelight illumination, place a sheet of x-ray
film inside the enhancing screen 'sandwich' (i.e., not in contact with
the blot), and then close and lock the cassette. For the much less
expensive 'leatherette' cassettes, clamp sheets of plywood or
plexiglass to the outside of the cassettes to hold all layers of the
assembled exposure apparatus tightly together.
3. Place the exposure cassette in a -80C freezer until you are ready to
develop the film. The length of time will vary depending on the
intensity of the specific mRNA signal (roughly determined with the
Geiger counter [see step 7, NORTHERN BLOTTING: Pre-hybridization,
Hybridization, and High-stringency Washing ]). If the signal is readily
detectable with the Geiger counter, then a 1 - 3 day exposure is
usually adequate, but if it is not easily detectable, then the exposure
time may need to be extended to 1 - 3 weeks. You may need to do a
short exposure to get a feel for the intensity of the signal, and then
adjust the time to get an optimal signal intensity.
4. For development of the film, remove the cassette from the -80C
freezer and allow it to come to room temperature (this avoids
87
condensation on the film later on). Under safelight illumination, open

the cassette, remove the film from between the enhancing screens
and feed it into the x-ray film processor. Do not turn on the lights or
exit the processing room until you are sure that the film has
completely entered the processor (usually there is a signal from the
machine).
5. Provided the mRNA signals on the blot are not over-exposed (i.e.,
have not photographically saturated the film), perform a
densitometric analysis of the band intensities of each mRNA band, for
both the housekeeping control mRNA (e.g., actin) and the
experimental mRNA (e.g., TNFa). Determine the relative signal
intensities of each experimental mRNA band by expressing it in terms
of the relative amounts of actin mRNA in each lane (ideally, the actin
signals will not vary between lanes -- if they do, it is because you
loaded different amounts of RNA in each lane).
88
4.2 In Situ hybridization (ISH)

In the experimental procedure that we will follow, we will probe
activated Cl.MC/C57.1 cells for the expression of TNFa and TGF, using
35S-labelled TNFa sense and anti-sense and TGF anti-sense cRNA
probes. Thus we will be probing cytocentrifuge preps. The cells are

fixed in ISH fixative for as short a period as is consistent with good
cytoarchitecture, are hydrolysed in HCl and digested with protease to
make the mRNA more available to the cRNA probes, briefly fixed again
to neutralize any RNAse activity, and blocked with acetic anhydride to
reduce non-specific sulfhydryl bond formation between the 35S-labelled
probe and the tissues. The tissues are probed and washed at a
relatively high temperatures to prevent non-specific annealing of the
cRNA probe to other tissue mRNA species, and finally, the mRNA-bound
35S-cRNA probes are detected at the cellular level by dipping the
slides in a liquid film emulsion and performing in situ autoradiography.

ISH is extremely specific, inasmuch as you can detect and identify
individual cytokine mRNA-positive cells, but its sensitivity is perhaps
one-tenth of that of Northern blotting.
4.2.1 Probe synthesis & purification
Materials
micropipetters & tips
RNAse-free eppendorf tubes
Reagents
in vitro transcription kit or reagents
RNAid RNA purification kit
35S-UTP (12.5 mCi/ml; 1000 Ci/mmol)
uridine 5'[a-thio] triphosphate (or, thio-UTP)

DEPC-H2O
linearized template (i.e., in vitro transcription vector containing cDNA)
METHOD
1. Synthesize the cRNA probes by transcribing the cDNA in the
linearized in vitro transcription vector (i.e., a vector with SP6, T3 or
89
T7 RNA polymerase recognition sites upstream of the cDNA

sequences of interest). For each experiment you will need to
generate both sense and anti-sense (reciprocal transcriptional
orientation) probes. To accomplish this, for each probe to be
prepared add the following ingredients (in order) to a 1.5 ml
microcentrifuge tube on the benchtop
2.1 l 5X transcription salts buffer
1.0 l 1M DTT
0.5 l RNAsin
0.5 l NTP cocktail [10 mM @ ATP, CTP, GTP, and 250
M UTP]
1.4 l nuclease-free H2O
briefly mix the ingredients before adding the template (the spermidine
in the 5x salts could precipitate the DNA in the template if not
thoroughly dispersed)
2.0 l template (linearized plasmid)
2.0 l 35 S-UTP
1.0 l appropriate RNA polymerase
10.5 l total volume
Briefly vortex the tube, pulse microfuge, and place in a 37C H 2O

bath for 90'.
2. Remove the DNA template from the reaction mixture by digestion
with RNase-free DNase I. To do this add,
2 l yeast tRNA
1 l DNAse
1 l RNAsin
briefly vortex the tube and sediment the liquid by a 3" pulse-spin
incubate the reaction tubes for an additional 15 min @ 37C.
3. Add 86 l DEPC-H2O, vortex, and pulse-spin as above. Remove 1 l
of each reaction mixture and dot it onto a filter paper disc (labelled
A), which you then transfer into an empty scintillation vial (also
labelled A, for -counting; below).
4. Purify the 35S-UTP-labelled cRNA from the reaction mixtures using
the RNAid RNA purification kit. Add 300 l of RNA-binding salt to
each tube and vortex.
90
5. Add 2 l RNAid-kit 'glass milk' and vortex each tube to disperse the
'glass milk' evenly. Incubate the tubes for 5 min @ room
temperature to allow the RNA to bind to the scintered glass.
6. Pulse-spin the tubes for 4 counts (i.e., 4 sec; spinning too long
will pack the glass into too hard a pellet for subsequent dispersal)
and remove and discard the highly radioactive supernatant using a
1 ml pipetman set at 500 l.
7. Add 400 l of RNAid kit wash solution to each tube and resuspend
the pellet by repeatedly vigorously expelling and not too vigorously
aspirating the 400 l wash solution with a P200 micropipetter set
at 150 l (too vigorous an aspiration action will 'bump' the solution
up onto the end of the micropipetter, inside the tip, leaving you
with RNAse contamination of your purified preparation). Vortex
and pulse-spin the tubes for 4 counts, and remove and discard the
highly radioactive supernatant using a 1 ml pipetman set at 500 l,
as above. Repeat step 7 for a total of three washes.
8. Resuspend the pellet in 25 l of DEPC-H2O (this time notice that
the pellet can be resuspended very easily), and place the tubes in
a 55C water bath for 3 min. During this incubation, set up some
new, labelled Eppendorf tubes with 25 l of deionized formamide
(this will be the final storage tube for the purified 35S-cRNA).
9. Microfuge the tubes for 3 - 5 min (full speed) to pellet the 'glass
milk' and carefully remove the 35S-cRNA (supernatant)) from each
tube. It is critical to avoid aspirating any glassmilk at this point,
so remove the supernatant 10 l at a time using your 1 - 10 l
pipetter. Transfer this eluted cRNA into the deionized formamide-
Eppendorf tubes (step 8), so that you should now have a total 35S-
cRNA (i.e., probe) volume of 50 l.
10. Remove 1 l of this purified probe from each tube, and dot it onto a
filter paper disc (labelled B). Transfer the paper disc into another
scintillation vial (labelled B) for -counting.
11. Transfer the purified probe to a -70C freezer until you are ready to
use it.
12. Add 4 ml of aqueous-miscible scintillation cocktail to scintillation
vials A and B, cap them securely and use a liquid scintillation
counter to determine the 35S counts in each tube.
91
13. Calculate the reaction yields (i.e., ng cRNA synthesized and

purified) for each probe generated, as follows (this is a typical in
vitro transcription result):
You purchased 1 mCi of 35S-UTP (concentration, 1000 Ci/mmol =

1000 mCi/mol) in a 80 l volume. The 12.5 mCi/ml of the
purchased product equates to 12.0 pmol/l of isotope, and you used
4 l or 48 pmol of 35S-UTP/reaction. In addition, the 1 l of
nucleotide cocktail for your in vitro transcription reaction
contained 250 pmol of non-radioactive UTP, so that the entire
reaction contained 298 pmol of (hot + cold) UTP -- 6.2 times the
amount of UTP you would detect if you were measuring
radioactivity alone. Since we are interested in calculating the
amount of cRNA synthesized, not just the UTP content, we must
also take into account that the mass of cRNA synthesized contains
all four nucleotides (UTP, ATP, CTP & GTP), so that the actual
amount of cRNA synthesized will be approximately 6.2 x 4 = 24.8
times the levels of 35S-UTP incorporated (this calculation assumes
that UTP comprises 25% of the total nucleotide content).
Now, using the cpm measured in the 1 l aliquots taken from the
transcription reactions (steps 3 & 10; the total cpm put into the
reaction & the total cpm actually incorporated into the cRNA,
respectively), we will determine the amounts of cRNA synthesized.
The raw data obtained from the 1 l aliquots taken in steps 3 & 10 is:
probe step 3 (cpm) step 10 (cpm)

TGFas 569150 576280
TNFs 823920 768370
TNFas 596450 494110
92
specific pmol pmol

total activity of total 35S cRNA ng No.
probe cpm per 35S cpm incorp. synth. cRNA slides
rx. (cpm/pmol incorp. into the (pmol synth. (11.5 ng
(x107) ) into cRNA 35S x (pmol/2) cRNA
x106 cRNA probe 24.8) ea.)
(x106)
TGFa-s 5.69 1.18 28.8 24.4 605.8 302.9 26.3
TNF-s 8.24 1.72 38.5 22.4 556 278 24.2
TNFa-s 5.96 1.24 24.5 19.75 490.4 245.2 21.3
Thus, for these in vitro transcription reactions, we can probe between

21 and 26 slides for each of the cRNAs.
93
4.2.2 Preparation of slides for hybridization
Materials
37C water bath
60C water bath
90C water bath
slide-staining apparatus (12 'coplin' jars are adequate)
10 ml glass pipettes (baked or commercial disposable)
micropipetters (P200 & P2000) and tips
50 ml graduate centrifuge tubes (adequate for measuring reagents)
pH paper strips (0.5 pH unit sensitivity is fine).
Reagents
10 M NaOH
xylene
ethanol (100%, 90%, 70%, & 50%)
DEPC-treated H2O (500 ml)
0.2 M HCl (16 ml concentrated HCl in 984 ml DEPC-H2O)
TE buffer (10mM Tris/1 mM EDTA in H2O)
PBS
proteinase K (1 - 40 g/ml in TE; prepare immediately before use, from
frozen stocks).
0.2% glycine in PBS (3 ml of 10% glycine IN 147 ml PBS)
4% paraformaldehyde in PBS (dissolve at 60C at high pH, then adjust
pH to neutral).
0.1 M triethanolamine (prepare just before use)
acetic anhydride
METHOD
1. Normally, when you are doing ISH with paraffin sections, you need
to first de-wax and rehydrate the sections with sequential
treatments with xylene and ethanol. Since cytocentrifuge
preparations are not embedded in paraffin and are stored already
in 70% ethanol, they enter the process at the 70% ethanol stage,
and then are treated as with the paraffin sections protocol.
94
Therefore process your slides as appropriate by running them

through the following baths (in order and for the specified times):
xylene #1- 10 min
xylene #2- 5 min
100%, 90%, 70%, & 30% ethanol - (4 baths total, 30
seconds each).
2. Hydrolyze the overly extensive protein cross-linking in the
formaldehyde-fixed tissues by incubating them in 0.2 M HCl for 20
min (this increases the access of your ISH probes to the mRNA).
3. During the 20 min 0.2 M HCl incubation period (i.e., step 2),
prepare a fresh solution of 4% paraformaldehyde by adding 6 g of
paraformaldehyde to the 150 ml of preheated 60C PBS. The
paraformaldehyde will not dissolve until the PBS is made basic
(i.e., increase the pH) by adding 6 drops of 10 M NaOH. Swirl the
basic the paraformaldehyde suspension until all of the
paraformaldehyde is dissolved, and then neutralize the pH (to 7 -
8) by adding 600 l of 1 M HCl. Check the pH of the solution with
pH paper (do not dip the paper in the solution, but instead remove
20 - 40 l aliquots and drop these onto the paper). When the
paraformaldehyde is at the correct pH, move it to an ice bath to
cool.
4. After the 20 min HCl hydrolysis step, transfer the slides into a TE
bath for 5 min
5. Further break down the protein-protein cross-linking (to increase
access of the probe to the mRNA) by digesting the cells/tissues
with the highest levels of proteinase K that they can take without
disintegrating due to over digestion. For cytocentrifuge cells it is
often acceptable to use the lower concentration of proteinase K,
while for paraffin sections you should use the highest
concentration that does not damage the integrity of the tissue
(often 25 - 40 g/ml). Thus, after the TE equilibration (step 4),
transfer slides into the proteinase K/TE bath for 15 min @ 37C.
6. Neutralize the progression of the proteinase K tissue digestion by
immersing the slides in 0.2% glycine in PBS for 2 min
7. Equilibrate the cells/tissues to PBS for 3 min.
95
8. Neutralize the newly-exposed RNAses in the tissues by "post-

fixing" them in the freshly-prepared 4% paraformaldehyde in PBS
(from step 3) for 5 - 20 min on ice. While the tissues are in the
paraformaldehyde, prepare the triethanolamine solution for the
tissue blocking step below. To prepare the 0.1 M triethanolamine,
add 3.71g triethanolamine powder to 200 ml DEPC-H2O, and then
adjust the pH to 7.5 - 8.0 by adding 200 l of 10M NaOH (additional
NaOH may be needed; again, use pH paper, not a pH meter).
9. Rinse the paraformaldehyde out of the cells/tissues by immersing
in PBS for 5 min.
10. Block the non-specific binding sites of the 35S-labelled probes by
incubating the cells/tissues in 0.1M triethanolamine containing
0.5% acetic anhydride for 10 min. It is critical that the complete
triethanolamine/acetic anhydride blocking solution is prepared
fresh immediately (i.e., seconds) before use. Therefore, during the
last few seconds of the step 9 PBS rinse, add 1 ml acetic
anhydride to the 150 ml bath of 0.1M triethanolamine and
immediately immerse the slides in this mixture. After 5 min,
briefly remove the slides, add another 500 l of acetic anhydride
(acetic anhydride is extremely labile and 'goes off' within minutes),
and continue the blocking step for another 5 min (i.e., total
blocking time, 10')
11. Transfer the slides to a 2xSSC bath and hold in this solution until
you are ready for the probe application to the tissues (i.e.,
hybridization step; below).
96
4.2.3 Hybridization of 35S-cRNA riboprobes to cellular mRNA
Materials
40 - 65C hybridization oven
90C water bath
micropipetter (P200) and tips
pH paper strips (0.5 pH unit sensitivity is fine).
Reagents
DEPC-treated H2O (500 ml)
ISH hybridization buffer
thio-UTP (non-radioactive; for additional blocking of non-specific
binding of 35S-UTP)
35S-UTP-labelled sense and anti-sense cRNA probes (concentrations
known)
METHOD
1. Calculate the amounts of probe, thio-UTP and hybridization buffer
that you will require for your experiment. Base these calculations
on:
-using a final probe concentration of 0.25 ng of probe/l of final
hybridization cocktail/kilobase of cRNA probe complexity. For
a 1 kilobase cRNA probe, and applying 45 l of final
hybridization cocktail to each slide, then you will need 45 x
0.25 ng x 1.0 kb = 11.25 ng/slide;
-the 45 l for each slide must include 1.25 l of thio-UTP
-the balance of the 45 l for each slide comprises hybridization
buffer
A typical set of calculations for a ISH procedure in which you are going
to probe 8 sense (negative control) slides and 20 anti-sense
(experimental) slides with 35S-TNF cRNA probes that have cRNA
concentrations of 5 ng/l is as follows:
Vol. Volume Volume hyb.

cRNA # slides Tot. hyb. vol. thio-UTP cRNA probe* buffer
(45l ea.) (1.25 l/slide) (11.5 ng/slide) (tot-thio-probe)
97
TGF:
anti- 26 1170 32.5 50 1087.5
sense
TNF:
sense 24 1080 30 50 1000
TNF:
anti- 21 945 27 50 868
sense
2. Add each required reagent to labelled Eppendorf tubes, vortex

briefly and hold on ice until ready to use. A few minutes prior to
using each probe, place it in a 80 - 90C water bath for 2 min to
denature the cRNA, then transfer it back onto ice to quench the
renaturation process.
3. One at a time, remove the slides to be probed from the 2xSSC bath,
briefly dry the back and the sides of the slides with a clean Kim-
wipe (e.g., Kleenex), and place on hybridization tray (over 50%
formamide-2xSSC-soaked paper towels in a Tupperware container).
Apply 45 l of the final hybridization mixture to each slide,
carefully using the pipette tip to cover most of each tissue section
(for cytocentrifuge preps simply placing the 45 l in the centre of
the cell 'patch' is adequate).
4. Use some RNAse-free forceps to carefully overlay the tissue/cells
with a baked, siliconized coverslip, taking care to avoid air
bubbles.
5. Repeat this procedure in turn with each of the slides and, when
finished, cover and seal the hybridization chamber (Tupperware
container) and place it in the 45C hybridization oven overnight.
98
4.2.4 Post-hybridization washing & autoradiography
Materials
37C water bath
47C water bath
2 coplin jars
bath for removing cover slips
Geiger counter
plexi-glass shield for working with 35S
isotope disposal bins
Reagents
2x SSC
50% formamide/2xSSC/10 mM 2-mercaptoethanol
4xSSC/TE
RNAse A (10 mg/ml)
ethanol (i.e., 30, 50, 70, & 90%) each containing 0.3 M ammonium
acetate
100% ethanol
METHOD
1. Remove each of the slides from the hybridization chamber and
place, back-to-back, in the metal slide holder (as much as possible,
handle the slides by their frosted ends, away from the radioactive
area). Immerse the slides in a bath of 2xSSC until each of the
coverslips has fallen off of the slides.
2. Transfer slides to a tissue-tek holder and incubate for 30 min at
50C in 50% formamide-2xSSC-10mM 2-mercaptoethanol. After 30
min repeat this step, for a total time of 60 min. Discard the 2xSSC
solution from step 1, as well as the used contents of the two
reagent baths from step 2 in the liquid 35S waste bucket.
3. Equilibrate slides for 15 min at 37C in 4X SSC-TE
[4X SSC containing 10mM Tris and 1 mM EDTA]
4. Digest the single-stranded 35S-cRNA that is non-specifically bound
to the tissues (i.e., not hybridized to mRNA) with RNAse A, by
incubating the slides for 30 min at 37C in RNAse (20 g/ml) in
99
4xSSC-TE. Discard the used RNAse digestion buffer in the liquid

35S waste bucket.
5. Wash the residual RNAse from the slides for 30 min at 37C in
4xSSC-TE
6. Perform one final high stringency wash to remove non-specifically
bound, digested 35S-UTP (or larger nucleotides) by incubating the
slides for 60 min at 50C in 50% formamide-2X SSC-10mM 2-
mercaptoethanol. Discard the used wash solutions in the liquid
35S waste bucket.
7. Equilibrate the slides to 2xSSC by incubating them for 3-5 min (at
room temperature) in this solution, and then dehydrate them by
sequentially transferring them through a graded series of ethanol
baths (30%, 50%, 70%, and 93%; each containing 0.3M ammonium
acetate), keeping the slides in each for 30 sec.
8. Complete the dehydration process in a 100% ethanol bath (30 sec)
and then transfer the slides to a paper towel on the bench and
allow them to air dry for 5 -10 min.
9. With the slides laid out flat on paper towels, scan each with a
Geiger counter to get a feeling for the levels of radioactivity
associated with each (this will determine roughly the exposure
times for the autoradiography -- short or long exposure time), and
label each of them with some sort of identification number. These
numbers will need to be visible in the darkroom, under safelight
illumination, so they are best done with a magic marker, on a clear
section of the glass that will not be come in contact with the
autoradiography emulsion (i.e., immediately adjacent to the
painted or frosted surface of the slide). Return the slides to tissue-
tek holder(s), clearly separated into "early" and "late" development
groups. Since all subsequent steps are performed in the darkroom
under safelight illumination, remember clearly exactly how you
have allocated your slides.
Subsequent steps are performed in the darkroom under safelight
illumination:
10. Place an aliquot of emulsion in alight-proof holder (half-filled with
water) within a 42-45C water bath. Allow 10-15 min for the
emulsion to melt. Also prewarm a the slide mailer.
100
11. When the emulsion is melted, fill vertical slide mailer with
emulsion.
12. Dip a clean (blank) slide in the emulsion and check for smooth,
"bubble-free" coating. One at a time, gently dip each experimental
slide in the emulsion, withdraw it and wipe the back with a glass
slide or razor blade and then standing vertically against the inner
sides of drying boxes. Place the covers on the boxes so that they
are light-proof (which will allow you to open the door of the
darkroom and walk out) and allow slides to dry for 30 min. Return
the unused emulsion from the mailer tube to the centrifuge tube
and return it to the refrigerator.
13. When the slides are dry, place each into black slide boxes, wrap in
2 layers of foil, label with tape, and store in a -20C freezer.
101
4.2.5 Autoradiograph development & counter-staining
Materials
staining coplin jars
slide staining rack
cover slips
Reagents
Kodak D19 developer (diluted 1:1 with H2O)
H 2O
Kodak rapid fixer
running water bath
60% ethanol bath
0.2% toluidine blue in 60% ethanol bath
acetone bath (2)
xylene bath (2)
entellen or permount mounting medium
METHOD
1. Remove slides to be developed from the freezer and allow the still
foil-wrapped boxes to come to room temperature.
2. In the darkroom, under safelight illumination, transfer the slides to
a tissue tek slide holder, and then place them first in the D19
developer for 2.5 min, then in the H2O for 15 sec, and finally in the
fixer for 5 min. (Within a minute or two of transferring the slides
into the fixer, it is safe to turn on the lights).
3. Soak the slides in gently running water for 2 hours.
4. Transfer slides into 60% ethanol for 30 sec, then into the 0.2%
toluidine blue in 60% ethanol for 30 sec
5. Dip the slides in the water bath 3 times and then transfer to the
first acetone bath for 2.5 min, followed by a second acetone bath
for another 2.5 min.
6. Transfer to xylene #2 for 2.5 min, then to xylene #1 for 2.5 min
(complete submersion is required to remove all H 2O, which will irreversibly turn
the dehydrated emulsion opaque)
102
7. Place a drop of permount on the slides and coverslip carefully,

avoiding air bubbles.
103
4.3 Semi-quantitative RT-PCR to detect cytokine mRNA
Polymerase chain reaction (PCR) amplification of cDNA from

reverse-transcribed mRNA is perhaps the most powerful method of
detecting transcripts in cells. PCR primers for most of the human and
mouse cytokines are readily available commercially, either as pre-
packaged or as custom-synthesized products. The sequences for
custom synthesis are obtained from the scientific literature. The
protocol proposed herein is a generic one which is based on the
GIBCO/BRL product instruction manual for their PCR kit (Cat. No.
18089-011). Protocols specific for individual cytokines (see 5.5,
Appendix E: Human cytokine RT-PCR primers) are usually published
with the sequences in the literature, and using these will often
circumvent your having to develop your own protocol. The method is
made semi-quantitative by virtue of amplifying cDNA for both the
cytokine of interest, as well as that of a house-keeping gene of interest
(e.g., actin -- many propose that the levels of actin mRNA change little
as a result of cellular stimulation), then comparing the signals of each
reaction after the PCR amplification. The ratios of the cytokine signal
to that of actin will change if the mRNA levels for the cytokine were
altered as a result the original cell or tissue stimulus or
pathophysiologic process(es).
Materials
thermocycler
42 & 70C water baths & an ice bath
micropipetter (0.5-10l) and tips
horizontal gel electrophoresis apparatus and powerpac
Reagents
purified total cellular RNA (see 4.1.1)
oligo(dT)
DEPC-treated H2O
10x PCR buffer ()
50 mM MgCl2
10 mM dNTP mix (dATP, dCTP, dGTP & dTTP)
104
100 mM dithiothreitol (DTT)

M-MLV RT (murine Moloney Leukemia Virus reverse transcriptase; 200
U/ l)
3' & 5' oligonucleotide primers (target mRNA-specific; e.g., actin &
cytokine primers)
Taq DNA polymerase
agarose
TAE buffer ( mM Tris/ mM sodium acetate/ mM EDTA; pH )
ethidium bromide (10 mg/ml)
DNA sample prep buffer
100 bp DNA oligonucleotide ladder (molecular weight standards)
4.3.1 First strand cDNA Synthesis using Oligo(dT) priming

This procedure is designed to convert 1 to 5g of total RNA into first
strand cDNA
1. Prepare RNA/primer mixtures in sterile 0.5 ml tubes as follows:
1 to 5g total RNA x l
oligo(dT) 1 l
DEPC water to 12 l (total volume),
then mix and spin briefly.
2. Incubate each sample at 70C for 10 min to denature the mRNA and
then incubate on ice for at least 1 min.
3. Prepare the following reaction mixture, adding each component in
the indicated order (for n samples -- but prepare the reaction mix
for n+1 reactions to ensure sufficient levels for all reactions.)
Component Each reaction (l)
10X PCR buffer 2
50 mM MgCl2 1
10mM dNTP mix 1
0.1M DTT 2
DEPC H2O 1
4. Add 7 l of reaction mixture to each RNA/primer mixture, mix gently,
and collect by brief centrifugation.
5. Incubate at 42C for 5 min.
105
6. Add 1 l (200 units) M-MLV RT to each tube, mix and incubate at

42C for 50 min.
7. Terminate the reactions at 70C for 15 min. Chill the tubes on ice.
The samples are now ready for PCR amplification reaction.
106
4.3.2 PCR amplification of the target cDNA

The first cDNA may be amplified directly using PCR. Use only 10%
of the first strand reaction for PCR. Adding larger amounts of the first
strand reaction may actually decrease the amount of product
synthesized.
1. Make the 2x stock buffer (recipe for 500l):
100l 10x PCR buffer
30l 50 mM MgCl2
20l 10mM dNTP mix
350l DEPC H2O
2. Prepare the following reaction mixture (for n samples), and mix
well.
25 x n l 2x stock buffer
0.5 x n l 3'-primer
0.5 x n l 5'-primer
21.5 x n l H2O
0.5 x n l Taq DNA polymerase
for each reaction, add 2 l RT reaction product to 48 l of above
mixture (use 0.5-ml tubes) and mix well.
3. Place the samples in the thermocycler, programmed as follows:
1 cycle 94C 3 min (initial denaturation)
30 cycles: 94C 30 sec (cycle internal denaturation)
55C 30 sec (primer-target annealing
temp)
72C 1 min (primer extension rx)
hold at 72C for 7 min to complete the last extension,
then hold indefinitely
at 4C until ready to analyse.
4. Analyze 5-20 l of the amplified sample by agarose gel
electrophoresis.
107
4.3.2 Detection of RT-PCR products

1. Pour a 1.2% agarose-TAE buffer gel, approximately 7 mm thick, with
sufficient lanes to run each of the samples and a 100 bp DNA
oligonucleotide ladder. (Be sure to allow the gel to polymerize
sufficiently such that the bottoms of the well do not break when
removing the well-forming comb.)
water 32.3 ml
agarose 0.26 g
40x TAE buffer 0.825 ml
10 mg/ml ethidium bromide 3.3 l
Heat the water/agarose to boiling in a microwave to dissolve the
agarose, then cool this solution to 56C and add the TAE and
ethidium bromide . 20
2. Prepare the actin and companion cytokine PCR reaction products

and 100 bp molecular size standards for gel analysis by heating to
65C for 10 min in DNA sample prep buffer containing 1l ethidium
bromide.
5-20 l of the amplified sample
5-10 l DNA sample prep buffer
1 l ethidium bromide
3. Load the samples and 100 bp ladder into the wells and run at 50-70
mA until the lead dye front has migrated approximately 2/3 of the
way through the gel.
4. Place the gel on an ultraviolet light-box, and examine the banding
patterns and relative amounts of PCR products in each lane using
computer-assisted image analysis of the illuminated gel (or
alternately by eye). Be sure that the individual band signals have
not reached the saturation point for the image analyser, or
accurate band comparisons will not be possible.
20At temperatures above 56C the gel apparatus will warp badly, so do not pour the
gel into the mold until it is sufficiently cool
108
APPENDICES:
5.1 APPENDIX A -- GENERAL METHODS
5.1.1 Anti-sheep RBC antisera (preparation of)

Mouse anti-SRBC antiserum can be prepared as follows:
1. Inject BALB/c mice with 200 l of a10% suspension of SRBC in PBS.
2. Two weeks later inject them again with 200 l of a 10% SRBC
suspension.
3. Approximately one week later collect blood from the mice, and allow it to
clot in a glass tube, first for 1 h at room temperature and then overnight
at 4C.
4. Inactivate the complement (C') cascade activity of the serum by heating
it to 56C for 60'.
5. Titrate the serum for SRBC agglutination activity.
5.1.2 Cell counting with a hemocytometer

Materials
hemocytometer & coverslip
single cell suspension of cells to be counted
20 l micropipetter and tips
eppendorf tubes 0.5 ml
push button counter
microscope
Reagents
0.4% trypan blue in saline
METHOD
1. Cap and gently invert or otherwise swirl cells several times to ensure an
even cellular distribution
2. Withdraw 20 ul of cells to a 0.5 ml eppendorf tube and add an equal
volume of 0.4% trypan blue
3. Pipette mixture up and down several times to mix the cells
4. Transfer 10 - 20 l of the cell suspension to the hemocytometer (with
coverslip in place). Capillary activity will draw the cells under the cover
slip and thereby fill the viewing chamber
5. Examine the cells under the microscope, first at low power setting and
when you have your bearings under the scope, switch to higher
magnification for actual cell counting.
6. You will note that the chamber is divided up into 9 larger squares, each of
which is in turn subdivided. Count the total numbers of cells in each of 5
of the larger squares (e.g., central , left, right, top and bottom ones),
noting the cell count in each. You should count all cells that lie inside the
boundary lines of the squares, and you should also count the cells that
fall on top of the lines delineating two of the four sides (for consistency,
pick whichever ones are easiest for you to remember, e.g., I always
include those on the top and left-hand side lines).
109
HEMOCYTOMETER FIELD
square cell count

1 4
2 3
3 1
4 2
5 4
mean 2.8
7. Determine the numbers of non-viable cells by counting the numbers of

cells with nuclei that are stained intensely blue (trypan blue is a vital
stain for dying, but not healthy cells).
8. Calculate the mean number of cells (both viable and non-viable) in each of
the 5 larger squares. Each of these squares contains total volume of 0.1
mm3 (or 10-4 cm3). In addition, since you used equal volumes of cell
suspension and trypan blue for counting, you have diluted your cells two-
fold. Therefore, to calculate the cell concentration (in cells/ml) in your
original cell suspension, take the mean numbers of cells in the large
squares and multiply by 2 (your dilution factor) and by 104 (volume
adjustment). For example, if you had a mean of 24 cells/large square, the
concentration of your original cell suspension would be:
24 x 2 x 104 = 48 x 104 cells/ml
9. To calculate the cellular viability in your preparation, use the following
formula:
# unstained cells 100

viability (% ) =
total # stained + unstained cells
10. Clean your hemocytometer immediately after use, using H 2O followed by
70% ethanol, and allow to air dry.
N.B. If your cell preparation includes clumps of cells, you have to decide
whether you can get an accurate estimate of the cell numbers with the
clumps present. If you feel that the clumps are evenly distributed in your
original cell suspension, then you might simply vigorously pipette the
cells in the eppendorf tube (i.e., the trypan blue/cell mixture) to disperse
the clumped cells and then recount. However, if the cells are very badly
clumped, you will have to disperse the cells in the stock suspension,
either by vigorous pipetting (which is very inefficient) or by re-
centrifuging and dispersing the cell pellet correctly.
5.1.3 C3b opsinization of yeast (zymosan A)

110
1. Activate the zymosan A by boiling for 10 min in PBS and then washing
with PBS. Resuspend to a final concentration of 10 mg/ml.
2. To coat the zymosan beads with C3b, add 200 l of fresh mouse serum to
2 mg 'activated' zymosan and incubate for 15 min at 37C.
3. Wash the yeast with PBS and store at 4C until ready to use.
5.1.4 Cytocentrifuge preparations

The cytocentrifuge is simply a centrifuge that deposits cells from a
suspension culture directly onto a microscope slide, usually in an area
about 6 -8 mm in diameter. It is an ideal way to prepare the cells for
microscopic examination. Ideally, you want to have somewhere in the
order of 5x104 - 105 cells/slide.
Materials
cytocentrifuge (with chambers, clamps, filters, etc...)
glass microscope slides
METHOD
1. prepare cell suspension of 5x105 - 106 cells/ml
2. assemble centrifuge chambers with labeled slides and filters in correct
orientation and load chambers into the centrifuge.
3. add 50 - 200 l of cells to each chamber (depending on the cell numbers,
concentrations, etc...)
4. centrifuge the cells for 4 - 5 min at 1500 rpm
5. when the rotor stops, remove slides from the chambers (being careful not
to scrape the cells off of the slides in this process) and allow the cells to
air dry (alternately, you can fix the cells in acetone or alcohol for 15 sec
and then air dry)
6. clean the disassembled chambers and clamp assemblies with H 2O and
allow to air dry after use.
7. the air-dried cells can be stained immediately or, depending on their
purpose, stored either at room temperature or in the freezer.
Dialysis tubing (preparation)

Dialysis tubing can be prepared well in advance and stored in the refrigerator
for extended periods of time. It is sometimes to convenient to prepare a very
large batch so that you will have it on hand whenever you need it. Most
dialysis tubing has been treated with glycerol by the manufacturer in order to
prevent excessive drying out (and cracking) during storage -- for most
purposes, this glycerol should be removed from the tubing before use.
Materials
hot plate
beakers
dialysis tubing of required size (and molecular weight cut-off)
Reagents
0.05% EDTA (0.5 g/l; or 3.4 ml of 0.5 M stock/996.6 ml H 2O)
0.05% Na2CO3 (0.5 g/l H2O)
distilled H2O
111
50%ETOH
METHOD
1. cut tubing to suitable sizes, allowing for tying or clamping ends or
prepare large sections
2. boil the sections of tubing for 10' in 0.05% EDTA
3. boil a second time for 10' in 0.05% Na2CO3.
4. boil a third time for 10' in 0.05% NaCO3.
5. rinse several times with H2O and, finally, store at 4C in 50% ethanol
(keep the beaker covered with parafilm)
5.1.6 Fixation of tissues for ISH or IHC.

Fix 3-6 mm blocks of tissue for 3 h (or cell suspensions for 30 min) on ice in ISH
fix (5.3), then transfer the tissues/cells to 70% ethanol and store at -20C until
ready to process to paraffin blocks by routine methods.
N.B. The signals from both ISH and IHC procedures seem to be superior if the
tissues are processed to paraffin expeditiously rather than holding them for
prolonged periods in 70% ethanol.
5.1.7 Lung cells (single cell suspension)

Single cell suspensions of lung cells are very useful for the determination of
immunologic reactivity of the lung associated immune compartment. The
lungs of animals undergoing strong pulmonary challenges with allergen or
other disease agents often contain very high numbers of perivascular and
peribronchial lymphoid cells, and in some species these animals also
develop discreet collections of BALT. The immunologic reactivity of the
lung tissues can be profoundly different than that of the spleen or other
non-pulmonary lymphoid organs.
Materials
mice, anaesthetic, surgical instruments, hemocytometer
CO2 incubator, 15 ml polypropylene tubes
Reagents
DMEM-10%, MEM
density gradient media (e.g., Lymphocyte Separation Medium, Percoll...;
optional)
collagenase (Worthington Scientific); hyaluronidase (Worthington Scientific)
MEM containing 1.5 mg/ml collagenase and 0.75 mg/ml hyaluronidase
METHOD
1. Obtain lung tissues and dice them finely (to 0.5 mm 3) with a scalpel, in
MEM medium.
2. Transfer the tissues into fresh MEM containing
collagenase/hyaluronidase (1 g tissue/10 ml enzyme cocktail) and
incubate at 37C for 60 min, ideally on a rocker platform.
3. Disperse any undigested fragments of tissue by repeated aspirating
through a 20 ga. needle on a10 ml syringe.
4. Filter the digested tissues through 4 layers of sterile gauze to remove
undigested tissue fragments, and wash the dispersed cells in DMEM-
10%.
5. Either use the cells directly or, if necessary, carry on with the
purification, fractionating the cells by density gradient centrifugation.
112
6. Determine the cell yield and viability by direct counting of trypan blue-
treated cells using a hemocytometer.
5.1.8 Lysis of red blood cells

There are a number of options available for lysing contaminating RBC's in a
cell preparation, including commercially available preparations. One of the
most simple is hypotonic lysis, which takes advantage of the fact that red
cells undergo lysis in H2O very quickly, while nucleated cells are damaged
much more slowly. Therefore, a very brief pulse with H2O will lyse all of the
red cells and leave the WBC intact. Alternately, you can lyse them by
incubation in ammonium chloride lysis solution for 5 min
5.1.8.1 Hypotonic lysis with H2O

1. Sediment all of the cells in your preparation by centrifugation, and
aspirate all of the medium from the cell pellet.
2. Briskly flick the tube to resuspend the cell pellet (to an even paste on
the walls of the tube).
3. Start a countdown timer set to 25 or 30 seconds and, when it reaches
15 seconds, add 9 volumes of double distilled H 2O to the cells and
vortex the tube by hand to rapidly disperse the cells throughout the
H2O.
4. When the clock reaches 0 seconds, add 1 volume of 10x HBSS to the
H2O suspension of cells and rapidly disperse it throughout the cell
suspension by swirling or inverting the (capped) tube. TIMING IS
CRITICAL!
5. Wash the cells two times in DMEM-0% FCS to get rid of the RBC ghosts
(plasma membranes).
5.1.8.2 Lysis with ammonium chloride

1. Perform steps 1 & 2 as above in the hypotonic lysis protocol
2. Resuspend the cells in 5 ml of ammonium chloride lysis solution and let
stand for 5 min.
3. Wash the cells two times in DMEM-0% FCS, as above
5.1.9 Opsinization of SRBC with antibody

1. Generate a 0.5% suspension (vol/vol) of sheep red blood cells 21 (SRBC) in
PBS.
2. To coat the cells with anti-SRBC, add 50 l of heat-inactivated mouse anti-
SRBC serum to 300 l of the SRBC suspension, and incubate for 30 min at
room temperature. (anti-SRBC antiserum can be generated by
vaccinating a mouse with 0.2 ml of 0.1% SRBC, and bleeding it 3 wk
later).
3. Wash the cells with medium and store at 4C until ready to use.
21 SRBC are obtained by venipuncture (usually the jugular vein) of sheep directly
into EDTA-containing syringes or alternately into regular syringes followed
directly by transfer of the blood into EDTA-containing tubes. The cells are
washed two times with Alsevers solution (see Appendix C) and resuspended in
Alsevers solution, which is a good long-term storage reagent for SRBC.
113
5.4.10 Protein assay in microtiter plates

Materials
pipettes, tips, multichannel pipetter
96 well plate
microplate reader
filter paper Whatman #1
Reagents:
Bio-Rad concentrated dye reagent
protein standard (we will use bovine serum albumin; BSA)
METHOD:
1. dilute dye reagent 1:5 with H2O (ie. 1 part reagent + 4 parts H 2O), and
filter through Whatman #1 filter paper. (store at 4C; stable for 2 weeks)
2. dilute BSA standards to a range that should bracket that of the unknowns
-- try standards of 5.0, 10, 25, 50, and 100 g/ml.
3. Pipette 160 l of standard and sample solution into separate wells of the
microtitre plate
4. Add 40 l of the diluted dye reagent to each well and mix the samples
thoroughly by repeated pipetting. Incubate the plates at room
temperature for at least 5 min, but no more than 1 h.
5. Measure the absorbance at a wavelength of 595 nm.
5.1.11 Splenocytes (single cell suspensions)

Materials
BALB/c mouse
clinical centrifuge, 15 ml centrifuge tubes (polypropylene [pp], not polystyrene
[ps])
Reagents
DMEM/10% FCS (Appendix B)
70% ethanol
optional:
sterile surgical tools (scissors, forceps)
METHOD:
1. Euthanize a mouse (e.g., BALB/c) by inducing surgical-level anaesthesia
with methoxyfluorane and dislocating the cervical spinal column. To
dislocate the cervical spine effectively, place the mouse down on the
bench in sternal recumbancy (belly down), firmly place an instrument
(e.g., forceps or closed scissors) across the back of the neck and holding
the mouse in position with this instrument, firmly, but not too forcefully,
pull the mouse backwards by the tail. You will hear a popping sound as
the neck dislocates.
2. When the mouse ceases breathing (very shortly after step 1), lay it on its
right side, and soak the left side with 70% ethanol. Holding the skin over
the spleen up into a tent, incise it with a pair of scissors, and then grasp
114
both sides of the incision firmly between the thumb and forefinger of each
hand. Pull the skin open and reflect it full back, both dorsally and
ventrally.
3. Open the body wall over the spleen with the scissors, pull the spleen up
from the other viscera and clip away the vascular attachments and fat.
Place the spleen in a petri dish containing DMEM-0%FCS and tease the
tissues apart using two pairs of fine, curved forceps. Continue teasing
until all of the tissue clumps are dispersed as much as possible.
4. Using a pipette aid (electrical pipetting device) and a 10 ml pipette,
vigorously pipette the cells 20 - 25 times, to completely break up the
clumps. Filter the dispersed spleen cell preparation through 3 - 4 layers
of sterile gauze drawn across the top of a 15 ml centrifuge tube. Remove
20 l of the filtrate (now a single cell suspension) for hemocytometer
counting.
5. Wash the cells once by centrifuging and resuspending to the desired final
concentration in the desired medium. For our purposes, this will usually
be 3x106 cells/ml of DMEM-10% FCS. From one normal mouse spleen, you
may obtain anywhere from 2 - 12x106 nucleated cells.
5.1.12 Splenocytes (spleen cell-conditioned medium)

Materials
single cell suspension of spleen cells
clinical centrifuge, 15 ml centrifuge tubes (polypropylene [pp], not polystyrene
[ps])
Reagents:
DMEM/10% FCS (Appendix B)
concanavalin A (4 mg/ml stock solution in PBS, or DMEM or RPMI, etc..)
METHOD
1. Generate a single cell suspension of spleen cells from a normal mouse
with a cell concentration of 3x106 cells/ml of DMEM-10% FCS. Set up the
cells in a T75 flask.
2. Add ConA to the cultures to a final concentration of 4 g/ml and place the
cells in the CO2 incubator for 4 days.
3. Prior to harvesting the cells, examine the cultures to confirm that the
cells have aggregated as they should following ConA stimulation.
Provided the cells appear as they should, transfer them to 50 ml
centrifuge tubes and sediment the cells by centrifugation for 10 min at
1500 rpm.
4. Aliquot the supernatants and store at either -20C or -80C. This
conditioned medium will keep its activity for many months.
115
5.1.13 Staining Protocols
5.1.13.1 Giemsa stains
5.1.13.1.1 Wrights-Giemsa staining and morphologic identification of

PBL
Materials
cytocentrifuge cell preparations, etc..
Wrights-Giemsa stain (10% Wrights-Giemsa solution in buffer)
neutral buffered water
METHOD
1. Apply 50 - 100 l of stain to the cells on each slide, and allow to sit for 10
min.
2. flush the scum from the slide with 0.5 ml of buffered water
3. Add 100 l of neutral buffered water to the cells, incubate for 1 min, then
air dry standing up.
4. Mount coverslips on the slides with Permount or Entellen
5. Examine the cells under 40x - 100x power using a compound microscope.
The cells can be differentiated based on their staining and morphology, as
in figure x.
Results
The appearances of the different types of mouse PBL following Giemsa
staining are demonstrated below. In effect:
POLYMORPHONUCLEAR CELLS (all have highly lobulated nuclei)
--eosinophils have rather large, red-stained cytoplasmic granules that fill
all of the extranuclear compartment of the cells.
-- neutrophils have rather small, pale pink-stained cytoplasmic granules
that fill the extranuclear compartment of the cells.
--in the mouse, basophils are present in such low numbers that some
authors state that mice do not have basophils. They appear much like
monocytes, with one or two medium-sized deep purple-staining granules.
You probably will never see a mouse basophils (unless you begin working
with these cells.
MONONUCLEAR CELLS (all have round to slightly indented nuclei)
-- lymphocytes are present in substantial numbers in a number of
compartments. Most circulating lymphocytes are unstimulated ones and
appear as very small cells that contain large nuclei. In fact, often the
cytoplasm appears as a small rim of powder blue-coloured cytoplasm.
Activated lymphocytes (plasma cells) tend to be large, with nuclei the
same size as that of the small lymphocytes, but they have abundant
cytoplasm. The nuclei are usually very round, with few if any
indentations.
- monocytes are much like large lymphocytes, but the nuclei are
usually indented.
These are very simplified descriptions of the WBC, but they will probably serve
to fulfill most of your needs as far as differentiating these cells.
5.1.13.1.2 Giemsa staining of tissue sections

Materials
116
tissue sections on slides

Giemsa stain
xylene, 100% ethanol (& 95, 70, & 50%)
isopropanol
METHOD
1. Deparaffinize and rehydrate the tissue sections (2x 5' in xylene; 2x 30"
100% ethanol; 1x 30" 95% ethanol; 1x 30" 70% ethanol; 1x 30" 50%
ethanol.
2. Transfer the slides into the Giemsa stain bath & hold for 1 - 2 h . After
one hour, rinse the slides with water as in step 3 and briefly look at the
sections under the microscope. If they appear sufficiently stained,
proceed with step 4, if not continue staining until the desired intensity of
stain is achieved.
3. Briefly rinse the slides in tap water.
4. Dehydrate the slides by transferring through three baths (2.5 min each) of
isopropanol, one bath (2.5 min) isopropanol/xylene [1:1]; and two baths of
xylene (5 min each).
5. Mount coverslips on the slides with Permount or Entellen
5.1.13.2 Gills hematoxylin for IHC

Materials
Gill's hematoxylin solution (1:5 dilution of commercial stain in H 2O)
10% methanol, Tris-buffered saline (TBS), H2O
Aqueous mounting medium
METHOD
1. Transfer the IHC-stained slides from H2O into the Gill's stain for 45 sec
2. Transfer the slides quickly through 10% methanol (three quick dips to get
rid of excess stain).
3. Transfer the slides into the TBS for 1 min (to blue or differentiate the
stain), then into the H2O bath until ready for cover-slipping.
4. Cover-slip the slides with aqueous mounting medium.
5.1.13.3 Toluidine blue staining (ISH counter-stain)

Materials
0.2% toluidine blue in 60% ethanol
xylene, 60% ethanol, isopropanol,
50% isopropanol/50% xylene
METHOD
1. Place the water-washed, developed ISH slides into the 60% ethanol bath
for 3 min
2. Transfer the slides to 0.2% toluidine blue in 60% ethanol and hold for 30
seconds, then quickly rinse the excess stain from the slides by dipping in
water.
117
3. Transfer the slides through two changes of isopropanol (2.5 min each),
one change of 1:1 isopropanol:xylene (2.5 min), and finally two changes of
xylene (also 2-3 min each).
4. Cover-slip the slides with permount.
5.1.14 Standard curves (e.g., cytokines)

For a number of different assays, you will need to perform serial dilutions to
generate standard curves. Depicted is a typical set of dilutions (this one
for TNFa, for use in the L929 cell cytotoxicity assay).
1. Label a series of eppendorf tubes (in this case, 40, 4, 0.4, 0.04, & 0.004
U/well), and add 199 l of standard dilution medium (DMEM-0% FCS/ActD)
to the first and 180l to the others.
2. To the first tube, add 1 l of stock cytokine (in this case, 1 l of stock
TNFa = 400 U), such that 20 l of the resulting solution will contain the
amount of cytokine needed for your highest standard concentration (here,
20 l of the '40' tube will now contain 40 U TNF). Serially transfer 20 l
from each tube to the next tube in the row, such that you are performing
serial 10-fold dilutions. Each time you add the 20 l to the next tube,
make sure that you thoroughly mix the tubes before withdrawing the 20 l
for the next step. You don't need to change pipette tips between tubes.
1 l 20l 20l 20l 20l
TNF 40 4 .4 .04 .004

stock
final, TNF U/well: 40 4.0 0.4 0.04 0.004

Vol TNF/eppendorf: 1 l 20l 20l 20l 20l
Vol. DMEM/ActD: 199 l 180l 180l 180l 180l
3. To add the standards to the plate, start adding the most dilute one to the
replicate wells, and sequentially move up the concentration gradient.
This way you won't have to change pipette tips for each standard in the
series, unless you contaminate a tip in the process.
5.1.15 TESPA-treatment of glass slides for in situ hybridization or

histology
Loss of tissue sections from glass slides during ISH or routine histology
can be a real problem. Fortunately, it is one that also is easily overcome
by pretreating the slides with TESPA (aminopropyltriethoxysilane or
organosilane)
1. Load slides into the glass racks and bake for 3 h at 300C. Since the glass
racks are of cast glass, they break very easily with rapid heating and cooling,
118
so warm and cool them gradually - that means put them in a cold oven and then
turn on the heat and also allow them to cool completely before removing them
from the oven.
2. Wash the slides in a 2% solution of organosilane in high-grade acetone for 1
min with gentle agitation.
3. Rinse the slides in high-grade acetone for 1 min and air-dry.
4. Store the slides at room temperature indefinitely.
(N.B. If section or cell loss from the slides is still a problem, even greater
adhesiveness can be achieved by treating the dried slides after step 3
with a 10% formaldehyde solution for 60 min, followed by air drying)
119
5.2 APPENDIX B -- REAGENTS & SOLUTIONS
CELLULAR IMMUNOLOGY REAGENTS

Acidified isopropanol, for use in solubilizing the water-insoluble formazan
precipitate formed within the mitochondria of cells cultured in the presence
of MTT. To prepare acidified isopropanol, add 376 l of concentrated HCl to
100 ml of isopropanol. Store at room temperature in an amber or foil-
wrapped bottle.
Actinomycin D is a potent transcription inhibitor that is used routinely in the TNF

assay to increase the sensitivity of the L929 cells to the cytotoxic effects of
TNF. We prepare it as a 5 mg/ml solution (or perhaps more accurately
suspension) in 95% ethanol. It should be agitated by vigorous pipetting
before aliquots are removed for use.
Alsevers solution
Recipe for 1 liter
To 900 ml of H2O, add:
20.5 g dextrose (>114 mM)
7.9 g sodium citrate-2H2O (> 27 mM)
dissolve the reagents & adjust pH to 6.1 with 1M citric acid
Add H2O to 1000 ml & filter sterilize
Ammonium chloride
For lysis of red blood cells.
Recipe for 1 litre:
2.42 g Tris
7.56 g NH4Cl
pH to 7.2 with HCl
Ammonium sulfate (saturated solutions)

Recipe for 100 ml:
76 g of ammonium sulfate
bring to a near boil
allow to cool & then sit overnight at room temperature.
(the solubility of ammonium sulfate is 76 g/100 ml at 100C)
Borate-buffered saline
For dialysis with purified IgM antibodies.
Recipe for 1 liter
5.72 g sodium borate
8.76 g sodium chloride
pH to 8.5 with 1 M NaOH
ELISPOT & ELISA Carbonate Coating buffer

Recipe for 1000 ml
120

1.6 g Na2CO3 (>15 mM)
2.9 g NaHCO3 (>35 mM)
0.2 g NaN3 (>3.1 mM)
dissolve the reagents & adjust the pH to 9.5 with NaOH.
Autoclave to sterilize.
121
Isotonic Percoll Density Gradient Medium

To prepare any amount of isotonic Percoll, mix together:
9 volumes of stock Percoll (purchased from Pharmacia as a 100% solution)
1 volume of 10x HBSS (Ca++ and Mg++-free)
This will make the Percoll isotonic with the cells to be fractionated on the
gradients.
PAGE running buffer (5x; Tris-glycine)

Recipe for 1 litre
To 800 ml of H2O , add:
15.1 g Tris base
72 g glycine
5.0 g SDS
dissolve contents and add H2O to 1 liter (do not adjust pH)
store at 4C and dilute 5x with H2O before use
PAGE 2x sample prep buffer (denaturing, but not reducing)

Recipe for 25 ml
To 10 ml of H2O , add:
6.25 ml of PAGE 4x stacking gel buffer
5 ml glycerol
1 g SDS
0.25 mg bromophenol blue
add H2O to 25 ml final volume and mix.
aliquot and store at -70C
PAGE gel fix buffer

25% (vol/vol) isopropanol
10% (vol/vol) acetic acid
(can be stored indefinitely at room temperature)
Phosphate-buffered saline (PBS)

Recipe for 1000 ml
0.23 g NaH2PO4 (anhydrous; > 1.9 mM)
1.15 g Na2HPO4 (anhydrous; > 8.1 mM)
9.0 g NaCl (>154 mM)
dissolve the reagents & adjust the pH to 7.2-7.4 with 1 M NaOH or 1 M HCl.
Autoclave to sterilize.
It may be convenient for you to make this up as a 10x PBS solution, that can
simply be diluted 10-fold and used as is.
Giemsa Stain (prepare fresh each time)

Recipe for 125 ml
To 100 ml of distilled water, add:
2.5 ml of Giemsa stock solution
3.0 ml of methanol
11.0 ml of 0.1 M citric acid
6.0 ml of 0.2 M disodium phosphate buffer
122
Briefly stir to mix ingredients before use.
Giemsa Stock Solution (for Giemsa stain)

Recipe for 100 ml
To 25 ml of glycerol, add:
3.8 g Giemsa powder
Heat the glycerol to 60C for 2 h, and work the stain into the glycerol
(either with a mortar and pestle or stirring)
Add 75 ml methanol and continue stirring overnight.
Store at room temperature indefinitely
0.4% Trypan Blue (in PBS) is a vital dye (i.e., is used with live cells) that is not taken up
by viable cells, but is taken up by effete cells. The nuclei of these cells stain an
intense blue colour, while fully dead cells or live ones take up no dye. The dead
ones can usually be distinguished morphologically from the live ones. For use in
hemocytometer counting of cells, dilute the cell samples 1:1 with 0.4% trypan
blue.
MOLECULAR BIOLOGY REAGENTS

Agarose/formaldehyde/MOPS gel (for electrophoresis of RNA)
Recipe for 220 ml gel (scale down as necessary):
137 ml of DEPC-treated H2O
2.64 g agarose
dissolve the agarose in the water in the microwave or a boiling water bath
&
allow the solution to cool to 56C, then add:
39 ml of formaldehyde
44 ml of 5x MOPS buffer
pour the 56C solution into the gel casting apparatus, &
allow to cool completely before removing the well combs.
Cesium Chloride (for isolation of total cellular RNA)
Recipe for 100 ml of CsCl:
95.97 g CsCl
0.83 ml 3M sodium acetate (pH 6.0)
Add H2O to 100 ml, DEPC-treat and autoclave
DEPC-treated water (& other solutions)

All water and solutions for use with RNA must be treated with
diethylpyrocarbamate (DEPC) before coming into contact with the RNA. To treat a
solution, just add DEPC directly to the solution to 0.1% final concentration with a
pipette and shake the solution vigorously to disperse the DEPC (allow any built up
pressure to escape from the vessel periodically, i.e., every minute), then allow the
treated solution to sit 12 h at room temperature or at 37C, then autoclave to
hydrolyze the residual DEPC.
(Tris containing solutions cannot be treated with DEPC, which reacts rapidly with
the amines in the Tris)
Dithiothreitol (DTT; 1 M) is used in many solutions to prevent non-specific interactions

between sulfhydryl groups. It is heavily used for the in situ hybridization protocols
123
employing 35S-UTP probes. For the washing steps of the ISH protocols, 2-
mercaptoethanol can be substituted.
EDTA (0.5M); pH 8.0

To prepare 100 ml of 0.5 M EDTA, to 18.61 g of EDTA, add 90 ml of H 2O. To
dissolve the EDTA, pH the solution to>pH 8.0 (by adding 10M NaOH). After dissolution
of the EDTA, re-adjust pH to 8.0.
Guanidinium Isothiocyanate (GSCN); 5.5 M

Recipe for 100 ml of 5.5 M GSCN:
64.98 g. guanidine thiocyanate
0.735 g. sodium citrate
0.5 g. sarcosine
add DEPC-H2O to 98.6 ml & adjust the pH to 7.0
add 1.39 ml 2-mercaptoethanol
and filter sterilize
(ref: Okayama, Kawaichi et al., Meth Enzymol 154:3-29)
ISH 10x salts (store @ -20 or -70C)

To prepare 10 ml, sequentially add to a 15 ml polypropylene centrifuge tube
124
ISH hybridization buffer (store @ -20 or -70C)

To prepare 2.5 ml, sequentially add to a 15 ml polypropylene centrifuge tube:
1200 l of deionized formamide
480 l of 50% dextran sulfate (to decrease viscosity,
pre-warm in microwave oven, & use a 5 ml pipette)
(vortex vigorously at this point to thoroughly disperse the dextran
sulfate)
240 l of 10X salts (vortex before pipetting)
24 l 1M DTT
24 l yeast tRNA (10 mg/ml)
480 l DEPC-H20
2448 l ( total volume)
vortex vigorously again to completely mix the reagents &
check/adjust the pH (with paper) to 5.5 - 6.0 (use about 10-12 l of 1M
HCl)
ISH fixative (prepare fresh each time)

To prepare 100 ml, add together:
85 ml of 100% ethanol (RNAse-free)
10 ml of 40% stock formaldehyde (use a high grade of chemical)
5 ml of glacial acetic acid
briefly mix, then store on ice until ready for use. Fix 3-6 mm blocks of
tissue for 3 h on ice (or cell suspensions for 30 min), then transfer the
tissues/cells to 70% ethanol and store indefinitely at -20C -- although it seems to
be better to process tissues to paraffin blocks (by routine methods) than to
hold them for prolonged periods in 70% ethanol.
Northern blotting pre-hyb/hybridization solution

To prepare 30 ml, mix together:
15 ml of deionized formamide
375 l of salmon sperm DNA (s.s. DNA; boiled)
(add the hot DNA to the formamide and vortex vigorously to completely
disperse it, and then continue adding the rest of the ingredients
3 ml of 1 M HEPES
1.5 ml of 10 M NaCl
300 l of 0.5M EDTA (pH 8.0)
3 ml 50X Denhardt's
3 ml of 10% SDS
1.5 ml of 10% Na pyrophosphate
2.32 ml of DEPC-H2O
MOPS (1 M)
231.28 g MOPS powder
add DEPC-H2O to 1000 ml, and filter sterilize (0.45 m filter)
5X MOPS Buffer
MOPS 0.2 M (200 ml 1M)
sodium acetate 50 mM (16.6 ml 3M; pH 7)
EDTA (pH 8.0) 5 mM (10 ml 0.5 M)
Add DEPC- H2O to 1000 ml
Phenol (salt-saturated)
125
this recipe produces a very stable phenol solution. It stability largely arises from the
extra anti-oxidants added relative to many other recipes (recipe, Dan Tenen, Harvard
Medical School)
100g phenol (heat in a 56C water bath to melt the phenol
45.4 ml 2 M Tris pH 7.5
59.02 ml DEPC-treated H2O
11.35 ml m-cresol
454 l 2-mercaptoethanol
227 mg hydroxyquinolone
Reagents for purifying DNA from agarose gels (store in the dark at 4C)
NaI solution to dissolve agarose gel. To prepare 100 ml, add together:
90.8 g NaI
1.5 g Na2SO3
add DEPC-H2O to 100 ml & mix the solution
filter through Whatman #1 filter paper and then
place 0.5 g Na2SO3 into a piece of dialysis tubing, tie off the ends &
drop it into NaI solution (to keep it sodium sulfate-saturated.
Ethanol wash solution (store at -20C)
50% EtOH
0.1 M NaCl
10 mM Tris (pH 7.5)
General purpose restriction endonuclease buffers

(no, low, medium & high salt)
salt level .
reagent none low medium high
Tris/HCl (pH 7.5) 100 mM 100 mM 100 mM 100 mM
MgCl2 100 mM 100 mM 100 mM 100 mM
dithiothreitol 10 mM 10 mM 10 mM
10 mM
BSA (mg/ml) 1 1 1 1
NaCl 0M 0.5 M 1.0 M 1.5 M
RNA sample prep buffer (Northern analysis)

5X MOPS 200 l
formamide 484 l
formaldehyde 61 l
H 2O 186 l
denature RNA in sample prep solution for 15' @ 65C
RNA sample dye/loading buffer (for visualization of progress during Northerns)

glycerol (final - 50%) 5 ml
0.5M EDTA (pH 8.0) (final - 1 mM)20l
bromophenol blue (final - 0.4%) 40 mg
xylene cyanol (final - 0.4%) 40 mg
DEPC-H2O 5 ml
add 2 l of loading solution to each sample
126
RNAse A (heat-inactivated to remove DNAse activity; 10 mg/ml)

Prepare 10 mg/ml RNAse solution in 10 mM Tris (pH 7.4), 15 mM NaCl. Heat-inactive the
DNAse by incubating for 15 min at 70C & then aliquot and store @ -20C.
Salmon sperm DNA

weigh out DNA, wet with a little EtOH, then add sufficient H 2O to bring the DNA to a final
concentration of 10 mg/ml. Shear the DNA by forceful passage through a18 ga
needle & denature it by boiling for 10 min. Aliquot and store at -20C. (boil again
before use)
Sodium acetate (3M)

40.8g sodium acetate
H2O, qs to 100 ml; pH > 6.0
treat with 0.1% DEPC, and autoclave
127
20X SSC (4 liters)

NaCl 701.2 g
Na citrate 352.9 g
add H2O to 3 liters, pH to 7.0, and then H2O qs to 4 liters.
STE buffer
Tris 10 mM (0.5 ml of 2M)
EDTA 1 mM (200l of 0.5M)
NaCl 0.1 M (1 ml of 10M)
H 2O qs to 100 ml
128
5.3 APPENDIX C -- TISSUE CULTURE MEDIA
Click's medium, 10% FCS, 2 mM L-glutamine, 1% antibiotic/antimycotic solution

(Gibco; stock: 100 U/ml penicillin G, 100 g/ml streptomycin sulfate, and 0.25
g/ml amphotericin B), 5x10-5 M 2-mercaptoethanol, and 10% Con A-
stimulated mouse spleen cell-conditioned media)
DMEM (Dulbecco's modified eagles medium; AKA Dulbecco's minimal essential
medium). This is a general purpose medium, which can be purchased either
pre-made or as a powder, from GIBCO. We generally have ours made up from
powder by the Glassware & Media Preparation (GMP) laboratory in the
department. In general, they prepare it with a bicarbonate buffer and L-
glutamine, so that it is ready to be used as is. However, since L-glutamine
degrades at 4C, then after a few weeks of storage, you need to supplement
the DMEM stocks with L-glutamine.
DMEM-0% FCS. For use in situations wherein you don't want any serum in your
medium. Use the stock GMP DMEM: to 980 ml of DMEM, add 10 ml of 100x
antibiotic/antimycotic solution from GIBCO (stock: 100 U/ml penicillin G, 100
g/ml streptomycin sulfate, and 0.25 g/ml amphotericin B), 10 ml of 5x10-3M
2-mercaptoethanol (and, if the medium is old, 10 ml of 100x L-glutamine).
DMEM-10% FCS. To 900 ml of DMEM-0% FCS, add 100 ml of heat-inactivated fetal
calf serum. Heat-inactivate by incubating the pre-warmed serum in a 56C
waterbath for 30-45 min. For DMEM-5% FCS, etc, reduce the amounts of FCS
proportionately, and increase the amounts of DMEM-0% FCS.
DMEM-10% normal horse serum. With the exception that the serum source is
different (i.e., normal horse vs fetal calf), this medium is the same as
indicated for DMEM-10% FCS. DMEM-10% normal horse serum is used for the
L929 cells in the TNF assay.
HBSS (Ca++ and Mg++-free) This can either be purchased from GIBCO or prepared
from scratch. A recipe for this reagent can be found in Current Protocols in
Immunology. It is very convenient to purchase this as a 10x concentrated
solution, for use in hypotonic lysis of red blood cells or in diluting Percoll
MEM (minimal essential medium) This is an alternate general purpose medium,
which can be purchased either pre-made or as a powder, from GIBCO. As
with our DMEM, we have ours made by GMP, with bicarbonate buffer and L-
glutamine.
RPMI 1640 (Roswell Park Memorial Institute medium #1640). This is an alternate
general purpose medium, which can be purchased either pre-made or as a
powder, from GIBCO. As with our DMEM, we have ours made by GMP, with
bicarbonate buffer and L-glutamine.
RPMI-0% FCS. For use in situations wherein you don't want any serum in your
medium. Use the stock GMP RPMI: to 980 ml of RPMI, add 10 ml of 100x
antibiotic/antimycotic solution from GIBCO (stock: 100 U/ml penicillin G, 100
g/ml streptomycin sulfate, and 0.25 g/ml amphotericin B), 10 ml of 5x10-3M
2-mercaptoethanol (and, if the medium is old, 10 ml of 100x L-glutamine).
RPMI-10% FCS. To 900 ml of RPMI-0% FCS, add 100 ml of heat-inactivated fetal
calf serum. Heat-inactivate by incubating the pre-warmed serum in a 56C
waterbath for 30-45 min. For RPMI-5% FCS, etc, reduce the amounts of FCS
proportionately, and increase the amounts of RPMI-0% FCS.
129
5.4 APPENDIX D -- MAINTENANCE OF CELL LINES
7TD1 cells (for assay of IL-6). 7TD1 cells are an IL-6 dependent murine hybridoma
cell line that can be purchased from the American Type Culture Collection
(ATCC #CRL ). They are maintained in RPMI 1640, 10% FCS, L-glutamine,
antibiotics, 5x10-5M 2-Me and require a source of IL-6. 7TD1 cells are
normally adherent, and are passaged with versene and trypsin. They must be
maintained in a subconfluent state (i.e., 1x105 cells/ml), or they will lose
their IL-6 responsiveness. In our hands, these cells are responsive to bovine,
equine, murine and human IL-6. We maintain our cells in recombinant human
IL-6.
Cl.MC/C57.1 cells (C57 mast cells). Cl.MC/C57.1 cells are an FceRI-positive,

transformed murine mast cell line, that was ostensibly originally derived from
the liver of a C57/Bl6 mouse. Recent molecular phenotyping evidence
indicates that these cells arose instead from BALB/c mice. They are
maintained in DMEM-10% FCS, and are a very potent source of many
cytokines. These were the cells originally used to examine the production of
many cytokines in mast cells.
L-929 cells (for TNF bioassay). The line of L-929 cells that we are using are
exquisitely sensitive to the effects of TNFa (ATCC # ). TNF will kill these
cells with the kinetics observed with natural cytotoxic cells (i.e., 18 h), as
opposed to natural killer cells (which require much less time to kill their
targets). L929 cells are maintained in DMEM, 10% normal horse serum, L-
glutamine, penicillin, streptomycin, fungisone (PSF), and 5x10-5 M 2-
mercaptoethanol. The cells are necessarily maintained at sub-confluent
levels (over-growth dramatically diminishes their sensitivity to TNF). They
comprise an adherent cell line, that is best split by minimal trypsin digestion
in medium lacking FCS, followed quickly thereafter by washing with regular
growth medium to prevent over-digestion of the cells.
LM-1 cells (for assay of IL-1). LM-1 cells comprise a sub-clone of the IL-1-responsive
ATCC cell line D10.G4.1. They were sub-cloned by the immunologists at VIDO (U
of S), and were selected in part because, unlike thymocytes, they do not require
sub-mitogenic doses of mitogens (e.g., ConA or PHA) in order to respond to IL-1.
They are maintained in Clicks-10% FCS, supplemented with 10% Con A-
stimulated mouse spleen cell-conditioned medium.
Pu5-1.8 cells (macrophage cell line) subconfluent monolayer cultures of Pu5-1.8

cells (ATCC #) in DMEM-10% FCS. Pu5 cells were one of the lines originally
used to clone murine TNFa, primarily because of the fact that they produce
enormous amounts of the cytokine relative to most macrophages or
macrophage cell lines. Unlike more cell lines, Pu5 cells always look horribly
unhealthy in culture.
130
5.5 APPENDIX E -- Binding affinities of Immunoglobulin G binding

matrices
IgG Binding Matrix

SPECIES
AVID AL TM
Protein A Protein
G
HUMAN ++ ++ ++
RABBIT ++ ++ ++
MOUSE ++ ++ ++
GUINEA PIG ++ ++ ++
BOVINE ++ ++ ++
PIG ++ ++ ++
RAT ++ - +
GOAT ++ - ++
HORSE ++ - ++
SHEEP ++ - ++
CHICKEN ++ - -
131
5.6 APPENDIX F -- HUMAN CYTOKINE RT-PCR PRIMERS
PCR
PRODUCT
CYTOKINE 5' PRIMERS 3' PRIMERS (BP)
IL-1a22 5'-ATGGCCAAAGTTCCAGACATGTTTC 5'-GGTTTTCCAGTATCTGAAAGTTCAGT 868

IL-1 5'-AGCTGATGGCCCTAAACAGATGA 5'-GATCTACACTCTCCAGCTGTAGA 533
IL-2 5'-ATGTACAGGATGCAACTCCTGTCTT 5'-GTTAGTGTTGAGATGATGCTTTGAC 420
IL-3 5'-AATCCAAACATGAGCTGCCTGCC 5'-GGCCCAGAGAGAGAGCTGGAG 496
IL-4 5'-TCACATTGTCACTGCAAATCGACA 5'-TCAGCTCGAACACTTTGAATATTTCT 493
IL-5 5'-ATGCACTTTCTTTGCCAAAGGCAA 5'-GGTTTACTCTCCGTCTTTCTTCT 365
IL-6 5'-TATCTCCCCTCCAGAAGCCCAG 5'-TCTGAGGAGAGCGCGGTCGT 685
IL-7 5'-TCTTTTAGGTATATCTTTGGACTTC 5'-TTTTCAGTGTTCTTTAGTGCCCATC 462
IL-8 5'-GCTTCTAGGACAAGAGCCAGGAAG 5'-CTTGGATACCACAGAGAATGAATTTTT 389
IL-10 5'-TCCTAGAGTCTATAGAGTCGCC 5'-AAGGCATGCACAGCTCAGCACT 625
IL-11 5'-ACATGGCTGTGTTTGCCGCCT 5'-TAAGATCTGGCTTTGGAAGGA 606
IL-13 5'-AAGCCACCCAGCCTATGCATCCG 5'-GATGCTTTCGAAGTTTCAGTTGAACC 471
IRAP 5'-GAATTCCGGGCTGCAGTCAC 5'-AACAGGCAGGCCTGGGCAGTA 578
eotaxin 5'CCCAACCACCTGCTGCTTTAACCTG
23
5'TGGCTTTGGAGTTGGAGATTTTTGG 207
G-CSF 5'-CTGTGGCACAGTGCACTCTGG 5'-GGAGGGCTTGGCTCAGGGCT 573
GM-CSF 5'-ATGTGGCTGCAGAGCCTGCTGC 5'-TCCAGCCTCATCGGCCGGT 456
LIFa 5'-TCTGAAGTGCAGCCCATAATGAAGGT 5'-
CCTCGGTTCACAGCACACACTTCAAGA 659
M-CSF 5'-AAAGTGAAAGTTTGCCTGGGTCCT 5'-GGCCACACACTCACCAGCCG 340
MCP-3 5'-ACCTGCAGATTTATCAATAAGAAAATCCC 5'-
CCCGGTCCTGAAATACTTCGTGGACCAGTGGTT 178
MIP-1a 5'-CAGACAGTGGTCAGTCCTTTC 5'-CCCTCAGGCACTCAGCTCTA 379
MIP-2 5'-GCTTCCCGACGCGTCTGCTGA 5'-GTAAGGGCAGGGACCACCCTG 417
22eaaa
IL-1 , IL-3, -4, -5, -6, -7, -8, -10, -11, &
-13, and IRAP, G-CSF, GM-CSF, LIF, M-CSF, MIP1a, MIP2, SCF & TNFa can be found in
Oka et al. (1995). Cytokine mRNA expression patterns in human esophageal
cancer cell lines. J Interf. & Cytokine Res 15: 1005-09.
23 The RT-PCR protocol for amplifying eotaxin mRNA is available in Bartels et al.
(1996). Human dermal fibroblasts express eotaxin: molecular cloning, mRNA
expression, and identification of eotaxin sequence variants. Biochem Biophys Res
Commun 25: 1045-51
132
RANTES 5'-GCTGTCATCCTCATTGCTAC 5'-CTCTACTCGATCCTACCTCT 260

SCF 5'-CTGCTCCTATTTATTCCTCTCGTC 5'-TTACACTTCAAACTCTCTCTCTTT 822
TNFa 5'-CTTCTGCCTGCTGCACTTTGGA 5'-TCCCAAAGTAGACCTGCCCAGA 598
133
5.7 APPENDIX G -- WORLD WIDE WEB Immunology sites of interest
The following comprises a list of potentially useful web sites for

immunologists.
Immunology (medical Specialties)...................
http://galaxy.einet.net/galaxy/Medicine/MedicicalSpecialties/Immunology.htmi
The World Wide Web Virtual Library: Immunology
(Biosciences)..http://golgi.harvard.edu/biopages/immuno.htmi
Medical Research Council of Canada ........................................
..http://www.mrc.gc.ca/title.html
Society homepages
American Association of Allergy, Asthma and

Immunology...........http://execpc.com/~edi/aaaai.htmi
American Association of
Immunologists.........................................http://glamdring.ucsd.edu/others/aal/
Australasian Society for
Immunology.............................................http://www.wehi.edu.au/societies/ASI/ASI.htmi
British Society for
Immunology.......................................................http://www.blackci.co.uk/society/bsi/
CanadianSociety for
Immunology..................................................http://www.csi.ucalgary.ca/csiweb.nsf
Federation of Immunological Societies of Asia-Oceania.......................
http://www.microbiology.adelaide.edu.au/fimsa.htm
International Society of Experimental Hematology.........................http://www.kcj.com/hema/
National Academy of Science (US).................................................http://www.nas.edu
Online services and databases
American Type Culture Collection (ATCC)...........................................http://www.atcc.org/

Bionet Electronic Newsgroup Network for Biology (BIOSCI)................http://www.bio.net
Centre for Protein Engineering: Home Page (MRC-CPE)....................http://www.mrc-
cpe.cam.ac.uk/
European Collection of Animal Cell Culture
(ECACC)..........................http://www.ist.unige.it/cldb/descart5.htmi
GeneBank (Searches address)....................................................
http://www.ncbi.nlm.nih.gov/Web/Search/index.html
Immunogenetics database (IMGT
Database).......................................http://www.ebi.ac.uk/contrib/imgt/top-imgt.htmi
Jackson Laboratories (source of mice)..http://www.jax.org/jaxmice
Journal of Immunology.........................................................................http://ji.journals.at-
home.com/JI
Kabat Database of Sequences of Immunological
Interest...................http://immuno.bme.nwu.edu
Linscott's Directory of Immunological and Biological
Reagents....................................................... ..................
.......http://ourworld.compuserve.com/homepages/LINSCOTTSDIRECTORY/
134
National Center for Biotechnology Information

(NCBI).........................http://www.ncbi.nim.nih.gov
National Institutes of Health (NIH)........................................................http://www.nih.gov
National Library of Medicine (USNLM).................................................http://www.nim.nih.gov/
NCBI WWW Enerez
Browser...............................................................http://www3.ncbi.nim.nih.gov/Entrez/index.htm
i
Vbase: a Directory of Human Immunoglobulin V Genes.........................................
..........................http://www.mrc-cpe.cam.ac.uk/imt-
doc/vbase-home-page.htmi
Services provided by individuals homepages
Cytokines and receptors....................http://www.Imb.uni-

muenchen.de/groups/ibelgaufts/cytokines.htmi
Cytokines and
receptors..........................................................http://www.ocms.ox.ac.uk/~smb/cyt_web/
Immunoglobulin structure and function..................................
http://www.path.cam.ac.uk/~mrc7/mikeimages.htmi
Immunoglobulin structure and sequences..............................
http://www.biochem.ucl.ac.uk/~martin/antibodies.htmi
MHC structure and fanction, CD antigens.............................. http:/histo.cryst.bbk.ac.uk/
Tissue
typing............................................................................http://www.umds.ac.uk/elsewhere/tissue
/whatl.htmi
135
Veterinary Immunology and Immunopathology 71: (1999)
pp 115-123
Differential complement activation by bovine IgG2 allotypes
FD Bastida-Corcuera, LB Corbeil
pp 143-149
Binding of bovine IgG2a and IgG2b allotypes to protein A, protein G,
and Haemophilus somnus IgBPs
FD Bastida-Corcuera, LB Corbeil
136
5.7 APPENDIX G -- SELECTED TEMPLATES FOR 96--WELL PLATES
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
137
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
138
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
1
IL-6 activity 21
INDEX immunohistochemistry 58
in situ hybridization 72
10xSSC 63 intradermal skin test 56
32P-labelled cDNA probe
isopropanol fix 39
synthesis 66 isotonic Percoll 9
5X MOPS 63 L-929 cells 23
7TD1 cells 21 lauryl sarcosine 60
actinomycin-D 23
activation of macrophages 16
ammonium persulfate 38
anaesthetic 8, 12, 100 leukocyte/platelet-rich plasma 9
antibody-dependent lipopolysaccharide 16
phagocytosis 14 LM-1 cells 18
antibody-coated cells 14 low-tox rabbit C' 42
ADCC 14 LPS 16
anticoagulant 8 Lymphocyte separation medium
AVID-AL IgG affinity columns 32 50
blast assay 46 mast cells 29
bromophenol blue dye 39 monoclonal antibodies 31
C'-dependent cytotoxicity 42 monocyte/macrophage
capture antibodies 50 monolayers 14
cell counting 96 monokine bioassays 18
cellular RNA 60 morphologic identification of
cellular viability 97 PBL 101
Concanavalin A 46 MTT 18
CsCl/sodium acetate 60 neutrophil chemotaxis assay 25
cytocentrifuge preparations 97 neutrophils 8
cytotoxicity assay for TNFa 23 nitrocellulose 40
density gradient systems 8 Northern blot blocking solution
detection antibodies 50 68
detection of mRNA bands 70 Northern blotting 60
ELISPOT 50 Northern blotting apparatus 63
ELISPOT plates 50 PAGE 2x sample prep buffer 91
fluorescein-labelled anti-CD4 42 PAGE running buffer 91
Giemsa stain 57 paraffin section 57
Gill's hematoxylin 102 paraformaldehyde 43
GK1.5 (anti-CD4) 31 PBST 50
GSCN lysis solution 60 percoll 9
H2O-saturated isobutyl alcohol. peripheral blood 8
38 phycoerythrin-labelled anti-CD8
hemocytometer 96 antibodies 42
heparin 8 platelet 9
IgE anti-DNP antibody 29 PMN 8
IL-1 activity 18
2
polyacrylamide gel
electrophoresis 38
polymorphonuclear cells 8
pre-hybridization (Northerns) 68
radioactive hybridization
solution 68
rapid Coomassie blue stain 38
rapid Coomassie brilliant blue
39
RBC sedimentation buffer 9
recombinant human IL-6 21
RNA sample dye/loading solution
63
RNA sample prep solution 63
rouleaux 9
separating gel (PAGE) 38
stacking gel (PAGE) 39
streptavidin-AP conjugate 40, 50
Synthesize the cRNA probes 72
T cell responses 56
Th1 versus Th2 responses 56
TIB 211 (anti-CD8) 31

tissue processor 57
TNF activity 24
TNFa standards 23
two-colour FACS 42
unit of TNF activity 24
web sites for immunologists 105
Wrights-Giemsa staining 101
x-ray film 70
Zeta-bind transfer membrane 63
1
A PRACTICAL GUIDE TO
CELLULAR AND MOLECULAR
RESEARCH METHODS IN IMMUNOLOGY
John R. Gordon, Ph.D.

Department of Veterinary Microbiology,
University of Saskatchewan,
Saskatoon, CANADA
SECOND EDITION
1998, John R. Gordon

tel: 306-966-7214; FAX: 306-966-7244
email: gordon@sask.usask.ca
---------------------------------------------------------------------------
Front cover:
top left - In situ hybridization autoradiography of mouse skin tissues undergoing
a passive cutaneous anaphylaxis response following intravenous allergen
challenge. The tissue was harvested at 8 h post-challenge and was probed with
a 35S-a1 (I) collagen cRNA probe, which hybridizes specifically with fibroblasts
activated by mast cell TNFa and TGF (Gordon & Galli, J Exp Med 180: 2027,
1994).
top right - Northern blot autoradiograph of mRNA from Cl.MC/C57.1 mast cells
challenged via the FceRI for varying periods of time. The blot was probed with a
32P-TNFa cDNA and washed at high stringency (Gordon & Galli, J Exp Med 174:
103, 1991).
2
bottom left - Antigen-driven IFN and IL-4 production in splenocyte cultures from
BALB/c mice vaccinated (dy 0) and boosted (dy 14) with a range of doses of
ovalbumin (0.05 - 10 g) in the context of alum (taken from Schneider & Gordon,
manuscript in preparation)
bottom right - Chemotaxis assay of the eosinophil chemotactic activities of
extracts from the skin of an eosinophilic epitheliotropic T cell lymphoma
patient. The tissues contained high levels of MCP-3, and moderate levels of
RANTES & GM-CSF (Hull, Saxena & Gordon, manuscript in preparation)

A Practical Guide To Cellular and Molecular Immunology

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

A Practical Guide To Cellular and Molecular Immunology

Uploaded by

Copyright:

Available Formats

1

2.0 ANTIBODIES: PURIFICATION & CHARACTERIZATION

3.0 T CELL AND B CELL RESPONSES

4.0 MOLECULAR ANALYSIS OF CYTOKINE mRNA EXPRESSION

4.1 Northern blotting...........................................................55

4.2 In Situ hybridization......................................................67

4.3 Semi-quantitative RT-PCR to detect cytokine mRNA....79

5.1.13.1.2 Giemsa staining of tissue

5.2 APPENDIX B -- REAGENTS & SOLUTIONS

CELLULAR IMMUNOLOGY REAGENTS........................92

MOLECULAR BIOLOGY REAGENTS

RNA sample prep buffer (Northern analysis).....96

5.3 APPENDIX C -- TISSUE CULTURE MEDIA

5.4 APPENDIX D -- MAINTENANCE OF CELL LINES

5.6 APPENDIX F -- Human cytokine RT-PCR primers.........101

1.1 Purification of mononuclear and polymorphonuclear cells from

will form rouleaux (chains of RBC's) that will sediment out of

(1000 rpm for 10') , . Aspirate the platelet-rich medium, avoiding

the cell pellet, and then resuspend the cells by vigorously

flicking the tube and then adding a large volume of medium. If

spin percoll PMN & RBC

6. Wash both cell preparations (i.e., PMN and mononuclear cells) as

1.1a ALTERNATE PROTOCOL 1 (for rapid mononuclear cell

clinical centrifuge (i.e., 400xg).

6. Harvest the mononuclear cells as a band from the top of the

1.1b ALTERNATE PROTOCOL 2 (fractionation of leukocyte sub-

TABLE . Examples of useful density ranges for fractionating various

1-3. Obtain leukocyte/platelet-rich plasma as in the Percoll procedure

5. When the gradient formation is complete, very carefully load the

resuspended, great care may to be needed to avoid mixing of the

1.2 Isolation of cells from the peritoneal cavities of mice.

3. Slowly withdraw the fluid using a 23 ga needle on a 10 ml

1.3 Adherence purification of monocytes or macrophages

scraping the bottom of the dish with a cell scraper, 90 - 95% of

1.4 Antibody- or C3b-dependent phagocytosis by macrophages

cells using the phase contrast condenser of the inverted

0 min 60 min 1-4h

1.5 Activation of macrophages with bacterial lipopolysaccharide

1.6 Monokine Bioassays:

1.6.1 Assay for IL-1 activity

MTT, (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide), 5

3. Add 80 l of Click's-10% FCS-CM-, and 20 l of appropriately

1.6.2 Assay for IL-6 activity

4. Return the plates to the 37C CO2 incubator for 3 days.

1.6.3 Cytotoxicity assay for TNFa bioactivity

1.7. Neutrophil chemotaxis assay

2. Prepare the chemoattactants for use in the assay, allowing

neutrophils to respond to the chemoattractants. Eosinophils

1.8. FceRI-dependent activation of mast cells

DNP30-40HSA(stock solution, 1 mg/ml; use at 50 to 100 ng/ml).

2.0 ANTIBODIES: PURIFICATION & CHARACTERIZATION:

In the second week of the course, we will grow up anti-mouse

2.1 Hybridoma cell culture with production of monoclonal antibodies

4. Aliquot the supernatants and either process expeditiously or

2.2 Affinity purification of IgG antibodies

2.2.1 Avid-AL affinity chromatography

regeneration buffer (methanol). Shake the tube vigorously to

2.2.2 Protein A-Sepharose affinity chromatography

3. Run the GK1.5 culture supernatant through the column matrix

2.3 Preparation of IgM antibodies

1. As with the IgG purification, generate a 4-day TIB211 hybridoma

2.4 Analysis & characterization of immunoglobulins

2.4.1 Polyacrylamide gel electrophoresis of immunoglobulins