J Gen Plant Pathol (2006) 72:314317
DOI 10.1007/s10327-006-0290-z
FUNGAL DISEASES
Fumihiko Suzuki Michiyoshi Arai Junichiro Yamaguchi
DNA fingerprinting of Pyricularia grisea by rep-PCR using a single primer
based on the terminal inverted repeat from either of the transposable
elements Pot2 and MGR586
Received: August 1, 2005 / Accepted: January 25, 2006
Abstract We investigated the use of single primers comple-
mentary to sequences in the terminal inverted repeat (TIR)
of either Pot2 or MGR586, transposable elements found in
Pyricularia grisea, for DNA fingerprinting by repetitive-
element-based polymerase chain reaction (rep-PCR). Un-
der standard amplification conditions, rep-PCR with each
single primer generated distinct fingerprint patterns among
rice-infecting P. grisea isolates collected in Japan. With the
Pot2-TIR primer, bands ranging in size from 0.2 to 8 kb and
in number from 8 to 13 per isolate were amplified. Although
fewer bands were amplified with the MGR586-TIR primer,
this molecular technique should be more reliable to identify
and classify P. grisea isolates by combining the data of
fingerprint patterns from each TIR primer. In a cluster
analysis based on DNA fingerprints from this rep-PCR with
the Pot2-TIR primer, 10 reference isolates and 12 field iso-
lates from Saga Prefecture in 2002 were separated into six
clonal lineages. We also demonstrated that the 12 field iso-
lates belonged to one clonal lineage. Thus, this rep-PCR
method using the single primer Pot2-TIR will be useful
for the analysis of the population structure of rice blast
pathogens.
Key words Pyricularia grisea Rep-PCR Pot2 MGR586
Terminal inverted repeat Clonal lineage
DNA fingerprinting has been widely used for studying the
population structure of the rice blast fungus Pyricularia
grisea (Cooke) Sacc. [teleomorph Magnaporthe grisea
(Hebert) Barr] (Rossman et al. 1990; Barr 1997). The tech-
niques used include restriction fragment length polymor-
F. Suzuki (*) M. Arai
National Agricultural Research Center for Kyushu Okinawa Region,
2421 Suya, Koshi, Kumamoto 861-1192, Japan
Tel. +81-96-242-7729; Fax +81-96-249-1002
e-mail: fsuzuk@affrc.go.jp
J. Yamaguchi
Saga Agricultural Experiment Research Center, Saga, Japan
The Phytopathological Society of Japan and Springer 2006
Short communication
phism (RFLP), amplified fragment length polymorphism
(AFLP), random amplified polymorphic DNA (RAPD),
and repetitive element-based polymerase chain reaction
(rep-PCR). George et al. (1998) applied rep-PCR using two
outwardly directed primers designed from the sequence of
the transposable element Pot2 (Pot2 rep-PCR) to analyze
the population structure of P. grisea. Compared with other
techniques such as RFLP or AFLP, Pot2 rep-PCR has ad-
vantages with respect to the ease of application, require-
ments for equipment, and low cost. So far, this method has
been used in several studies analyzing the population struc-
ture of P. grisea (Correll et al. 2000; Muramatsu et al. 2003;
Javan-Nikkhah et al. 2004). However, the original protocol
was still not appropriate for the analysis of a large number
of samples in population studies because it required severe
PCR conditions and a long electrophoretic run time (over
7 h) to achieve sufficient results. For characterizing a large
number of isolates of P. grisea, a simpler and more rapid
rep-PCR technique with high fingerprinting ability was
needed.
In this study, we modified the rep-PCR technique with
respect to primer design, amplification conditions, and elec-
trophoretic apparatus. The genome of rice blast pathogen
contains a variety of repetitive DNA elements. Of these
elements, Pot2 and MGR586 have been extensively used as
probes for characterizing populations of blast pathogens,
because multiple copies of these elements exist in the ge-
nome (Kachroo et al. 1994; Hamer et al. 1989). Addition-
ally, they are classified as class II transposable elements,
possessing a terminal inverted repeat (TIR). This prompted
us to consider using outwardly directed primers com-
plementary to sequences in the TIRs of the individual trans-
posable elements for rep-PCR fingerprinting. In this
method, the single TIR-specific primer will allow ampli-
fication of sequences lying between transposable elements,
in a manner similar to the use of two outwardly directed
primers.
DNA polymorphisms detected by rep-PCR using a single
primer. The outwardly directed primers Pot2-TIR (5
ACAGGGGGTACGCAACGTTA 3) and MGR586-TIR
 315

Table 1. Geographic origin and year of collection of Pyricularia grisea isolates used in this study
Isolate Race Host (cultivar) Origin Year isolated

Field isolates
02-410101 ND Rice (Yumeshizuku) Takeo C. Saga 2002
02-410401 ND Rice (Koshihikari) Chinzei T. Saga 2002
02-410501 ND Rice (Koshihikari) Genkai T. Saga 2002
02-410801 007.0 Rice (Yumeshizuku) Imari C. Saga 2002
02-411703 ND Rice (unknown) Hizen T. Saga 2002
02-411704 ND Rice (unknown) Hizen T. Saga 2002
02-411801 ND Rice (unknown) Genkai T. Saga 2002
02-411903 ND Rice (unknown) Genkai T. Saga 2002
02-412001 007.0 Rice (unknown) Genkai T. Saga 2002
02-412003 ND Rice (unknown) Genkai T. Saga 2002
02-413602 ND Rice (unknown) Genkai T. Saga 2002
02-416001 ND Rice (unknown) Kashima C. Saga 2002
Reference isolates
Ken 54-04 003.0 Rice (Shinriki 1) Gifu 1954
Ken 54-20 003.0 Rice (Kairyoaikoku) Yamaguchi 1954
Ken53-33 137.1 Rice (Kanto 51) Aichi 1953
Kyu 82-625A 011.0 Rice (unknown) Unknown 1982
Hoku 1 007.0 Rice (Norin 20) Hokkaido 1948
Ina 72 031.1 Rice (Kanto 37) Nagano 1957
Ina168 101.0 Rice (Suzuharamochi) Aichi 1958
IW 81-04 437.1 Rice (unknown) Akita 1981
Naga 69-150 007.0 Rice (unknown) Nagano 1969
P-2b 303.1 Rice (unknown) Niigata 1948
ND, not determined

(5 TCCGGGGTCCTGATGAACCACGT 3) were de-

signed from the 45-bp TIR sequence of the 1861-bp
Pot2 (EMBL accession no. Z33638) and the 42-bp TIR
sequence of the 1860-bp MGR586 (EMBL accession no.
MGU60989), respectively. PCR reactions were carried out
in a 20-l volume containing 10 ng genomic DNA, 400 M
each dNTP, 1 Ex Taq buffer, 2 mM MgCl2, and 1 unit of
Taq DNA polymerase (Ex Taq; Takara, Shiga, Japan). PCR
amplifications were performed in a GeneAmp PCR System
9600 (Applied Biosystems, Foster City, CA, USA) pro-
grammed for 2.5 min at 94C followed by 35 cycles of 1 min at
94C, 1 min at 62C, 6 min at 72C, final extension for 15 min at
72C, and holding at 4C. PCR products were separated by
electrophoresis on 1% agarose gels in 1 TBE buffer
[89 mM Tris, 89 mM boric acid, 2 mM ethylenediamine-
tetraacetic acid (EDTA)] by use of a MUPID-2 system with
a 10-cm gel (Cosmo Bio, Tokyo, Japan). Gels were run for Fig. 1. Electrophoretic separation of DNA from nine isolates of
1.5 h at 100 V and stained with ethidium bromide. Nine Pyricularia grisea collected from Saga Prefecture amplified by the re-
petitive sequence-based polymerase chain reaction (rep-PCR) with the
isolates of P. grisea selected from a collection from Saga primer designed from the terminal inverted repeat (TIR) of either of
Prefecture in 2002 were used to verify these experimental the transposable elements Pot2 and MGR586. A Pot2-TIR primer; B
conditions (Table 1). MGR586-TIR primer. After electrophoresis, the bands were stained
with ethidium bromide: lane 1, isolate 02-410101; lane 2, 02-410401;
Rep-PCR with the single primer Pot2-TIR yielded dis- lane 3, 02-410501; lane 4, 02-410801; lane 5, 02-411703; lane 6, 02-
tinct DNA fingerprints for all nine isolates (Fig. 1A). The 411704; lane 7, 02-411801; lane 8, 02-411903; lane 9, 02-412001
amplified fragments were separated in the optimum range
from 0.6 to 6 kb, and nine haplotypes were distinguished.
When rep-PCR was carried out with MGR586-TIR as the copies of Pot2 in their genomes (Kachroo et al. 1994),
primer with the same nine isolates, distinct fingerprint pat- whereas they have 45 to 50 copies of MGR586 (Hamer et al.
terns were also detected for the nine haplotypes, even 1989). Although fewer bands were amplified from the
though there were fewer fragments than with Pot2-TIR as MGR586-TIR primer, the banding patterns for P. grisea
the primer (Fig. 1B). The difference between the numbers appeared to be as diverse as those from Pot2-TIR primer.
of amplified fragments with Pot2-TIR and MGR586-TIR is By combining the data of fingerprint patterns from each
likely due to the difference in their copy number in the P. TIR primer, this molecular technique should be more reli-
grisea genome; isolates from rice have approximately 100 able for identifying and classifying P. grisea isolates.
316
Fig. 2. Agarose gel electrophoresis of rep-PCR products using Pot2-
TIR primer. I, Eight field isolates collected from Saga Prefecture in
2002; II, ten reference isolates collected during 19481982 in Japan.
Amplified DNA was separated by electrophoresis followed by staining
with ethidium bromide. Isolate names and lineage affiliations are noted
above the respective lanes
Phylogenic relationships among Japanese isolates based on
rep-PCR analysis. Furthermore, the 10 reference isolates
and the 12 field isolates of P. grisea collected from Saga
Prefecture in 2002 were subjected to DNA fingerprinting by
the rep-PCR technique using the Pot2-TIR primer for
analysis of the lineage structure (Table 1). The reference
isolates yielded 8 to 13 discrete bands, while the 12 field
isolates gave 9 to 11 discrete bands (Figs. 1A, 2). The
presence or absence of each band was scored manually. A
matrix of similarities between all pair of isolates was
constructed based on Dices coefficient. Cluster analysis
was performed on the similarity coefficients by the
unweighted pair-group method with arithmetic averages
(UPGMA) using the program PHYLIP (Felsenstein 1989).
Bootstrap analysis of the data was performed with 1000
replications by the Winboot program (Yap and Nelson
1996). From these analyses, six groups of isolates sharing
similar profiles (putative lineages) were identified at 70%
similarity level (Fig. 3). Each putative lineage was desig-
nated A to F, and the bootstrap values ranged from 66% to
100% (Fig. 3).
Sone et al. (1997) reported that P. grisea isolates col-
lected from all over Japan were separated into five clonal
lineages by phylogenic analysis combining the RFLP data
from two probes, MGR586 and pMG6015. Compared with
the groupings based on our rep-PCR method and those
obtained by RFLP, a close correspondence was observed;
that is, lineages B, C, E, and F defined based on rep-PCR
Fig. 3. Dendrogram generated by unweighted pair group method with
arithmetric average (UPGMA) analysis based on fingerprint data of
rep-PCR using primer Pot2-TIR with 22 Japanese isolates of
Pyricularia grisea. The numbers on the main branches represent the
bootstrap values based on 1000 iterations. Each cluster formed with
70% DNA profile similarity was designated as a lineage. Lineage
designations are on the right
corresponded to lineages JBLA-K04, JBLA-INA, JBLB-
HK1, and JBLC-P2B defined based on RFLP, respectively.
However, isolates Ken 54-20 and Ken 53-33 belonging to
lineage JBLB-K33 defined by Sone et al. (1997) separated
into lineages A and D, respectively, in our analysis. This
difference is also consistent with Sone et al. (1997), in which
isolates Ken 54-20 and 53-33 clustered differently between
the MGR586 tree and pMG6015 tree, when the data from
both probes were not combined. On the other hand, all 12
field isolates from Saga Prefecture had similar fingerprint
patterns and belonged to lineage B, which corresponded to
lineage JBLA-K04. Sone et al. (1997) showed that all field
isolates collected from all over Japan in recent years be-
longed to lineage JBLA-K04. Our data may indicate that
the population of P. grisea from Saga Prefecture consists of
closely related isolates that are classified into one clonal
lineage. Furthermore, the cluster analysis indicated that
there is no correspondence between lineages and
pathotypes in the Japanese rice blast population. This result
agrees with a previous study by Don et al. (1999). Changes
in virulence on many rice cultivars may occur rapidly rela-

tive to the genomic changes that led to the divergence of
Pot2-defined lineages of P. grisea.
These results show that rep-PCR using the single primer
Pot2-TIR is highly effective for analysis of the genetic diver-
sity of the rice blast pathogen. Because this method does
not require long-PCR conditions for DNA amplification or
highly specialized equipment for electrophoresis, it will be
applicable for characterizing a large number of P. grisea
isolates.
References
Barr ME (1977) Magnaporthe, Teimenella, and Hyponectria
(Physosporellaceae). Mycologia 69:952966
Correll JC, Harp TL, Guerber JC, Zeigler RS, Liu B, Cartwright RD,
Lee FN (2000) Characterization of Pyricularia grisea in the United
States using independent genetic and molecular markers. Phytopa-
thology 90:13961404
Don LD, Kusaba M, Urashima AS, Tosa Y, Nakayashiki H,
Mayama S (1999) Population structure of the rice blast fungus in
Japan examined by DNA fingerprinting. Ann Phytopathol Soc Jpn
65:1524
317
Felsenstein J (1989) Phylogeny inference package. Cladistics 5:164
166
George MLC, Nelson RJ, Zeigler RS, Leung H (1998) Rapid popula-
tion analysis of Magnaporthe grisea by using rep-PCR and endog-
enous repetitive DNA sequences. Phytopathology 88:223229
Hamer JE, Farrall L, Orbach MJ, Valent B, Chumley FG (1989) Host
species-specific conservation of a family of repeated DNA sequences
in the genome of a fungal plant pathogen. Proc Natl Acad Sci USA
86:99819985
Javan-Nikkhah M, McDonald BA, Banke S, Hedjaroude GA (2004)
Genetic structure of Iranian Pyricularia grisea populations based on
rep-PCR fingerprinting. Eur J Plant Pathol 110:909919
Kachroo P, Leong SA, Chattoo BB (1994) Pot2, an inverted repeat
transposon from the rice blast fungus Magnaporthe grisea. Mol Gen
Genet 245:339348
Muramatsu K, Fuji S, Furuya H, Naito H (2003) Population structure
of rice blast fungus prevalent in Akita Prefecture in 2000 and 2002.
Ann Rep Plant Prot North Jpn 54:1822
Rossman AY, Howard RJ, Valent B (1990) Pyricularia grisea, the
correct name for the rice blast disease fungus. Mycologia 82:509512
Sone T, Abe T, Yoshida N, Suto M, Tomita F (1997) DNA fingerprint-
ing and electrophoretic karyotyping of Japanese isolates of rice blast
fungus. Ann Phytopathol Soc Jpn 63:155163
Yap IV, Nelson RJ (1996) Winboot: a program for performing boot-
strap analysis of binary data to determine the confidence limits of
UPGMA-based dendrograms. IRRI Discussion Paper Series No. 14,
International Rice Research Institute, Manila, Philippines