Pesticide Biochemistry and Physiology 84 (2006) 196214

www.elsevier.com/locate/ypest

Anthranilic diamides: A new class of insecticides with a novel

mode of action, ryanodine receptor activation
D. Cordova , E.A. Benner, M.D. Sacher, J.J. Rauh, J.S. Sopa, G.P. Lahm,
T.P. Selby, T.M. Stevenson, L. Flexner, S. Gutteridge, D.F. Rhoades, L. Wu,
R.M. Smith, Y. Tao
DuPont Crop Protection, Stine Haskell Research Center, 1090 Elkton Road, Newark, DE 19714, USA

Received 4 April 2005; accepted 14 July 2005

Available online 19 October 2005

Abstract

Development of insecticides with unique modes of action is necessary to combat widespread insecticide resistance.
A new class of insecticides has been discovered, the anthranilic diamides, that provides exceptional control through
action on a novel target, the ryanodine receptor. Anthranilic diamides potently activate this receptor, releasing stored cal-
cium from the sarcoendoplasmic reticulum causing impaired regulation of muscle contraction. Expression of a recombi-
nant Drosophila ryanodine receptor in a lepidopteran cell line confers sensitivity to anthranilic diamides similar to that
observed with native receptors. Ligand-binding studies with radiolabeled ryanodine and radiolabeled anthranilic diamide
in Periplaneta americana reveal a single, saturable binding site for this chemistry distinct from that of ryanodine. Further,
calcium mobilization studies using mammalian cell lines indicate anthranilic diamides exhibit >500-fold diVerential selec-
tivity toward insect, over mammalian, receptors. Consequently, anthranilic diamides oVer a novel pharmacological tool
for calcium signaling research in addition to a unique alternative to existing pest-management strategies.
2005 Elsevier Inc. All rights reserved.

Keywords: Anthranilic diamide; Anthranilamide; Insecticide; Insecticidal; Ryanodine; RyR; Calcium channel; Mode of action;
Drosophila; PC12

1. Introduction trum pest control, coupled with action at a novel

target site, is a rare event. Currently, 95% of com-
Discovery of crop-protection molecules that are mercial insecticides comprise molecules interfering
characterized by high-eYcacy and broad-spec- with one of Wve processes: acetylcholine receptor
function,
-aminobutyric acid (GABA) receptor
*
Corresponding author. Fax: +1 302 366 5738. function, sodium channel function, mitochondrial
E-mail address: daniel.cordova@usa.dupont.com respiration, or chitin synthesis [13]. Even the most
(D. Cordova). recent broadly commercialized insecticides act

0048-3575/$ - see front matter 2005 Elsevier Inc. All rights reserved.
doi:10.1016/j.pestbp.2005.07.005
 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214
upon previously exploited targets, albeit at unique
binding sites, as exempliWed by indoxacarb and
spinosad, which perturb voltage-gated Na+ chan-
nels and nicotinic acetylcholine receptors, respec-
tively [4,5]. With pest resistance to existing
insecticides developing rapidly, the discovery of
new insecticidal compounds with unique modes of
action is critical to the ongoing success of crop
protection.
It has been conjectured that insect calcium
channels would oVer an excellent pesticide target
for commercial exploitation [6,7]. Calcium homeo-
stasis plays a key role in multiple biological pro-
cesses including cell signaling, muscle contraction,
neurotransmitter release, and fertilization [8]. The
process of muscle contraction involves modulation
of two distinct channel types; voltage-gated chan-
nels, which regulate external calcium entry, and
ryanodine receptor channels (RyRs) which regu-
late release of internal calcium stores [911]. RyRs
derive their name from the natural product, ryano-
dine, found in trees and shrubs of the genus Ryania
[12]. Ryanodine and related extracts from the bark
of these shrubs interfere with muscle contraction
through alteration of the channels conductance
state [13,14].
Previous eVorts to exploit RyRs as a commer-
cial insecticide target have not proven successful.
Ryanodine, either alone or in a mixture with rote-
none and pyrethrum has been sold as an organic
alternative to synthetic insecticides. However,
pesticide registration of ryanodine-containing
products has been voluntarily cancelled in the
United States [15]. The cost and mammalian toxic-
ity associated with ryanodine restrict its agronomic
utility. Further, attempts to enhance the insecti-
cidal potency and selectivity of ryanodine through
structural modiWcation have yielded limited suc-
cess [16,17]. Moreover, discovery of synthetic
chemistry with superb potency against invertebrate
RyRs, has been elusive; thus realization of com-
mercial pesticides that exploit the RyR has proven
daunting.
Here, we describe anthranilic diamides, hereaf-
ter referred to as anthranilamides, the Wrst example
of a safe and highly eVective class of insecticides
possessing a RyR mode of action [18,19]. The most
potent anthranilamides provide plant protection at
197
use-rates signiWcantly lower than current commer-
cial insecticides. Using in situ muscle preparations
together with calcium mobilization studies on
native and recombinant cell systems, we demon-
strate that anthranilamides selectively activate
ryanodine receptors. Radioligand-binding studies
suggest that these compounds bind to a unique site
on the receptor distinct from that of ryanodine.
Further, comparative studies with mammalian cell
lines that endogenously express RyRs, demon-
strate that the most potent anthranilamide tested
exhibits greater than a 500-fold diVerential selec-
tivity for insect receptors over that of mammalian
receptors. Consequently, anthranilamides repre-
sent a new class of insecticidal chemistry oVering
great promise for pest-management strategies.
2. Materials and methods
2.1. Lepidopteran toxicity assay
Compounds were sprayed to run-oV using an
atomized air-assist sprayer (10 psi) on a rotating
turntable (10 rpm) onto 4-week-old soybean and
cotton plants for Spodoptera frugiperda and Helio-
this virescens testing, respectively. Once plants
dried, a leaf (or trifoliate) was cut into 2.5 cm pieces
and each piece was placed into a well of a 16-well
plastic HIS tray (Mullinix Packages, Fort Wayne,
IN). Each well also contained a 2.5 cm2 of moist-
ened chromatography paper to prevent desicca-
tion. A 3rd instar larva was placed in each cell and
tested at 6 rates (24 replicates/rate) along with sol-
vent-treated and untreated controls. Test units
were maintained at 26 C, under a 16:8 h light:dark
(L:D) light cycle. Larval mortality was assessed at
96 h post-infestation with LC50 values determined
by Probit analysis using a custom statistical analy-
sis program developed by Stanley (DuPont, 2002)
which includes ECx calculation with conWdence
intervals, using maximum quasi-likelihood curve
Wtting [20].
2.2. Periplaneta americana injection assay
American cockroaches, P. americana, were
raised in the dark at 27 C in a Plexiglas chamber
198 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214
and fed a diet of dog chow and water. Injections
were conducted on adult males (average weight of
1 g). Prior to compound injection (12 h) roaches
were injected with 1 l of the multifunction oxidase
inhibitor, piperonyl butoxide (50 g) solubilized in
dimethylsulfoxide (DMSO), to inhibit possible
test-compound metabolism. SpeciWed concentra-
tions of test compounds were solubilized in DMSO
with a 1-l volume injected dorso-laterally between
two abdominal segments. Treated roaches were
observed for behavioral eVects over a 72-h period.
2.3. Heart (dorsal vessel) recording assay
Impedance recordings of dorsal vessel contrac-
tions were conducted using the method of Smits
et al. [21], with minor modiWcation. Manduca
sexta larvae were raised in a growth chamber at
25 C under a 16:8 h L:D light cycle and fed an in-
house formulated diet. Fourth-instar larvae (2.2 g
average body weight) were anesthetized by chill-
ing on ice for 20 min. Two electrodes (40 gauge
steel wire) were inserted on each side of the dorsal
vessel approximately 12 mm beneath the cuticle
and anchored with a drop of cyanoacrylate adhe-
sive. Upon recovery from anesthesia, electrodes
were attached to an impedance meter (UFI
Model 2991; Morro Bay, CA) and the DC output
recorded using a Digidata 1322A digitizer and
pClamp software (Axon Instruments; Foster
City, CA). Once a stable baseline beat frequency
was obtained, test compounds (1 l/g body weight
in DMSO) were injected into the abdominal pro-
leg using a 30-gauge micro-syringe. Impedance
was monitored for 30 min following compound
injection.
2.4. Skeletal muscle contraction assay
To assess anthranilamide eVects on skeletal
muscle, an in situ lepidopteran preparation was
used. M. sexta larvae (5th instar) were dissected
along the dorsal midline, pinned open and rinsed
with physiological saline having the following
composition (mM): NaCl 172; KCl 13.3; CaCl2 4;
MgCl2 3; sucrose 37; Hepes 3; with pH adjusted to
7.1. Under a dissecting microscope the gut was
carefully excised and the preparation rinsed with
saline after which the preparation was held in
approximately 500 l of saline with longitudinal
muscles clearly visible. Excision of the ventral
nerve cord led to rapid cessation of spontaneous
muscle contractions. After the longitudinal muscle
Wbers maintained stability for several minutes, a
saline solution (500 l) containing either
anthranilamide + DMSO (0.3%), or DMSO (0.3%)
alone, was gently applied directly above a segment
of longitudinal muscle using a pipette. The muscle
segment was observed to determine if the test solu-
tion stimulated a contraction within a 1-min
period. Unless otherwise stated, all tests were con-
ducted with six replicates.
2.5. Ca2+ imaging and spectrophotometric studies
2.5.1. Cell culture methods
Embryonic neuronal cultures of P. americana
were established, with minor modiWcations, follow-
ing previously described methods [22,23]. Unless
otherwise stated all culture media were obtained
from Invitrogen Life Technologies (Carlsbad, CA).
BrieXy, oothecae (2627 day old) were collected,
surface-sterilized and cut open one-third of the dis-
tance below the dorsal midline. The heads were
removed and placed in Schneiders Drosophila
medium. Brains were individually removed and
placed in a small glass vial containing 5 + 4
medium (containing 5 parts Schneiders Drosophila
medium and 4 parts modiWed Eagles basal
medium) prepared as described in [23]. Brains were
dissociated using a Pasteur pipette with tip Xamed
to slightly less than half of its original diameter.
One drop of the cell suspension was placed on the
bottom of a Falcon 50-mm tight-seal petri dish
(BectonDickinson Labware, Franklin Lakes, NJ)
and a poly-L-lysine coated coverslip placed on top
with three small drops of petrolatum/glass bead
suspension between the coverslip and the bottom
of the petri dish.
The petri dish was inverted to allow cells to
attach to the coverslip, then turned upright after
1 h, and placed in a humid incubator at 29 C.
After 4 days the medium was exchanged with a 1:1
mixture of Leibovitzs L-15 medium and Yunkers
modiWed Graces medium (prepared as described
in [23]) to allow neuronal diVerentiation.
 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214
The S. frugiperda cell line, Sf9, and Sf-900 II
SFM medium was obtained from Invitrogen Life
Technologies (Carlsbad, CA). Wild-type and
recombinant Sf9 cells were grown at 26 C in
shaker Xasks in Sf-900 II SFM media and split
every 34 days.
PC12 cells (rat pheochromocytoma cell line)
were obtained from American Type Culture Col-
lection (Manassas, VA) and grown in F-12K
medium (Invitrogen Life Technologies, Carlsbad,
CA). At each passage, cells were passed through a
30-gauge needle to prevent clumping. At least 4 h
prior to Ca2+ imaging studies, cells were plated
onto poly-L-lysine coated coverslips and main-
tained at 37 C.
2.5.2. Calcium imaging protocol
Cells attached to a coverslip were rinsed in stan-
dard physiological saline having the following
composition (mM): NaCl 190; CaCl2 9; KCl 3.1;
Tris buVer 10; pH adjusted to 7.2 for P. americana
embryonic neurons, NaCl 130; KCl 5.4; MgCl2 1.2;
CaCl2 1.0; NaHCO3 4.2; NaH2PO4 7.3; glucose
10.0; sucrose 63.0; MES 20.0; pH adjusted to 6.3
for Sf9 cells, and NaCl 145; KCl 5; CaCl2 3;
MgSO4 1; NaH2PO4 1.2; glucose 10; Hepes 20; pH
adjusted to 7.3 for PC12 cells. Cells were loaded for
3045 min in saline containing the dye Fura-2 AM
(23 M) with 0.002% Pluronic F-127 (dispersing
agent) at room temperature (2428 C). After dye
loading cells were again rinsed in standard physio-
logical saline and placed in a sealed experimental
chamber in which the base was formed by the cov-
erslip upon which cells were grown. Calcium ratio
imaging studies were conducted using the Meta-
Xuor imaging system (Universal Imaging, West
Chester, PA) coupled to an inverted Xuorescence
microscope with a Fluor 40 oil immersion objec-
tive (NA 1.3). Cells were excited at 340 and 380 nm,
and the 510 nm Xuorescence emission acquired
using either a VS4-1845 ICCD (Videoscope Inter-
national, Dulles, VA) or an Orca ER digital cam-
era (Hamamatsu Photonics, Hamamatsu City,
Japan). Calibration of intracellular free calcium
concentration ([Ca2+]i) was carried out using the
Grynkiewicz equation with a calculated dissocia-
tion constant (Kd) of 145 nm for Fura-2 and a vis-
cosity correction factor with a value of 0.67 [24,25].
199
All compounds investigated were delivered by
bath application using a peristaltic pump and
switching valve. Due to the heterogeneous nature
of P. americana embryonic neurons, calcium mobi-
lization threshold values for anthranilamides were
determined by calculating the [Ca2+]i increase
(mean SEM) from cells that responded to a con-
trol caVeine challenge (20 mM, 40 s) with a [Ca2+]i
increase exceeding 25 nM.
2.5.3. Plate-based Ca2+ spectrophotometric protocol
Wild-type and recombinant Sf9 cells were
diluted to 1.4 106 cells/ml and suspension-loaded
with Fura-2 AM (2 M), in Sf-900 II SFM media
containing Pluronic F-127 dispersing agent
(0.002%) for 45 min at room temperature. After
loading, cells were centrifuged for 2 min (1000 rpm
or 215gmax), re-suspended in fresh media to
remove dye and the centrifugation repeated. Cells
were then re-suspended in physiological saline.
Dye-loaded cells (1.4 105 cells/well) were plated
out into a 96-well Costar UV plate (Corning, Corn-
ing, NY) and allowed to attach for 30 min prior to
testing in a FlexStation II plate reader (Molecular
Devices, Sunnyvale, CA). Test compounds, pre-
pared in physiological saline, were added to wells at
a 1.5:1 dilution ratio to achieve the desired concen-
tration. The Xuorescence emission was monitored
at 510 nm with excitation at 340 and 380 nm. All
data are reported as peak ratio increase over a
2-min period following compound addition.
2.6. Radioligand-binding studies
2.6.1. Periplaneta americana muscle membrane
preparation
The procedure for preparing membranes from
P. americana legs was essentially as described in
[26]. Mid and hind legs from 6- to 9-week-old cock-
roaches were excised and immediately placed in
liquid nitrogen. Excised legs could be stored at
80 C for several months, if necessary, prior to
further fractionation. Typically, membrane prepa-
rations started with approximately 55 g (wet
weight) of excised legs. All subsequent steps were
carried out at 4 C.
TrisHCl (50 mM), pH 7.4 was added at a ratio
of 9 ml buVer to 1 g (wet weight) of legs. In some
200 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214

membrane preparations, a protease inhibitor cock-
tail, Complete EDTA-free Protease Inhibitor
Cocktail Tablets (Roche Diagnostics, Indianapo-
lis, IN) was included with the buVer (1 tablet/
50 ml), though they did not result in any detectable
diVerences in binding for any of the saturation
binding or displacement studies. Legs were homog-
enized on ice using a Polytron (Brinkmann Instru-
ments, Westbury, NY) for 2 min at Setting #3. The
homogenate was passed through two layers of
cheesecloth on one layer of glass wool overlaid
onto two layers of additional cheesecloth. The
Wltrate was collected in 50-ml centrifuge tubes and
centrifuged at 1950gmax for 20 min. The collected
supernatant was centrifuged for 30 min at
30,000gmax and the resulting pellet re-suspended in
buVer A, having the following composition (mM):
KCl 1500; sucrose 300; CaCl2 0.5; TrisHCl 20;
with pH adjusted to 8.0. Protein concentration of
the suspension was determined as in [27]. The
membrane suspension was adjusted to 4 g pro-
tein/l by addition of buVer A and stored at
80 C.
2.7. Radioligand-binding assays
Ryanodine was obtained from Sigma (St. Louis,
MO). The structures for the following compounds
are shown in Table 1. Anthranilamides DP-002,
DP-010, and DP-012 were prepared at DuPont
(Wilmington, DE). [3H]Ryanodine (Ryanodine
[9,21-3H(N)]), at 56 Ci/mmol (>97% purity), was
obtained from Perkin-Elmer Life Sciences (Boston,
MA) and [3H]DP-010 was prepared at 21 Ci/mmol
(99.0% purity) by Perkin-Elmer Life Sciences (Bos-
ton, MA).
2.8. [3H]DP-010 binding to P. americana femoral
muscle membranes
For saturation binding assays, the assay mixture
(200 l total volume/glass tube; VWR, 13 100 mm

Table 1
Comparative biological activity of anthranilamides and commercial lepidopteran insecticides
CF 3 CF 3 CF 3
X R4
N N N
O Y O O O
R1 R1 N R1 N R1 N
Me R3 R3
NH R3 NH NH NH
X
Y
O O O O

NH NH NH NH
R2 R2 R2 R2
I II III IV
Compound Formula R1 R2 R3 R4 X Y S.frugiperda H.virescens Ca2+ Mobilization
LD50 (ppm) LD50 (ppm) Threshold (M)
DP-001 I CH3 iC3H7 H OCF3 C C 51.60 >500 8.5
DP-002 I CH3 iC3H7 iC3H7 CF3 N N 45.20 51.4 26.6
DP-003 I CH3 iC3H7 C2H6 CF3 C N 51.30 77.5 35.5
DP-004 I Cl iC3H7 CH3 CF3 C N 57.4 48.0
DP-005 II CH3 iC3H7 48.80 130.1 99.8
DP-006 III Cl iC3H7 H 2.90 17.0 2.3
DP-007 III Cl iC3H7 Br 5.6 0.32
DP-008 III Cl iC3H7 Cl 0.44 3.5 0.3
DP-009 IV Cl iC3H7 CH3 N N 18.4 8.9
DP-010 IV CH3 iC3H7 F C C 0.52 2.3 0.46
DP-011 IV CH3 CH3 Cl N C 0.26 0.8 0.38
DP-012 IV CH3 iC3H7 Cl N C 0.12 0.4 0.27
Cypermethrin Commercial standard 5.30 13.48
Indoxacarb Commercial standard 0.33 0.6
 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214
culture tubes) contained 163 l of buVer B (having
the following composition (mM): KCl 375; sucrose
300; CaCl2 0.5; TrisHCl 20; with pH adjusted to
8.0), 10 l of various concentrations of [3H]DP-010
in DMSO, and 2 l of DMSO. For determination
of non-speciWc binding, the DMSO was replaced
by 2 l of a combined solution (in DMSO) of
1 mM ryanodine plus DP-012, at a concentration
1000-fold excess that of DP-010, in the corre-
sponding total binding tube. The assay was initi-
ated by adding 25 l of P. americana leg
membranes at 2 g/l (diluted from 4 g/l by
addition of an equal volume of buVer B), and incu-
bation was carried out for 60 min at 25 C. Assays
were carried out in triplicate.
Displacement of [3H]DP-010 by selected com-
pounds was as follows: to each well containing
163 l of buVer B, 2 l of 1 mM ryanodine (in
DMSO) and 25 l of roach leg membranes (at 2
g/l prepared as described above), was added 2 l
of various concentrations of the selected test com-
pound in DMSO. The test compound was allowed
to pre-incubate with the membranes for 10 min at
25 C. Following pre-incubation, 8 l of 625 nM
[3H]DP-010 in DMSO was added and incubation
was allowed to proceed for 60 min at 25 C. Assays
were carried out in triplicate.
Following incubation, assays were quenched
with 5-ml ice-cold buVer B and immediately
Wltered on pre-wetted Whatman 25 mm GF/F glass
microWbre Wlters (Whatman International, Maid-
stone, England). Each assay tube was further
rinsed two times each with 5 ml ice-cold buVer B
per rinse. All three rinses were collected on the
same Wlter disc. For each tube, quenching, Wltra-
tion, and washing were completed within 20 s. The
Wlters were then transferred to plastic scintillation
vials containing 5 ml Ecolume scintillation Xuid
(ICN Biomedicals, Costa Mesa, CA) and counted
for 2 min on a Beckman LS 3801 scintillation
counter (Beckman Coulter, Fullerton, CA).
2.9. [3H]Ryanodine binding to P. americana leg
membranes
For saturation binding assays, the assay mixture
(200 l total volume/glass tube; VWR, 13 100 mm
culture tubes) contained 155 l of buVer A, 10 l of
201
various concentrations of [3H]ryanodine in etha-
nol, and 10 l of DMSO. For determination of
non-speciWc binding, the DMSO was replaced by
10 l of ryanodine (in DMSO) at a concentration
1000-fold excess that of [3H]ryanodine in the corre-
sponding total binding tube. The assay was initi-
ated by adding 25 l of roach leg membranes at
2 g/l (prepared by thawing and addition of an
equal volume of buVer A), and incubation was car-
ried out for 60 min at 25 C. Assays were carried
out in triplicate.
Displacement of [3H]ryanodine by selected com-
pounds was investigated as follows. To each tube
containing 155 l of buVer A and 25 l of roach leg
membranes (at 2 g/l prepared as described
above) was added 10 l of various concentrations
of the selected compound in DMSO. The com-
pound was allowed to pre-incubate with the
membranes for 10 min at 25 C. Following pre-
incubation, 10 l of 200 nM [3H]ryanodine in
ethanol was added and incubation was allowed to
proceed for 60 min at 25 C. Assays were carried
out in triplicate.
Following incubation, assays were quenched
with 5-ml ice-cold buVer B and processed similarly
to [3H]DP-010 assays. Graphical analysis and
curve Wtting was conducted using GraphPad Prism
v4.0 (GraphPad Software, San Diego, CA).
2.10. Construction and expression of the Drosophila
ryanodine receptor gene
Based on the published ryanodine receptor gene
sequence of Drosophila melanogaster (NCBI acces-
sion number D17389), two primers were designed:
Primer1: ACCACCTTAATTAATTCCGATTTG
GAGGCGCTGCG and Primer2: GCCTCCGTT
TAAACGACCGTCCAGTGCCAGTGTGAAG.
Based on the high GC content identiWed in the ini-
tial and stop codon regions of the Drosophila ryr
gene, primers were designed to facilitate polymer-
ase chain reactions (PCR) eYciency. Primer1 con-
tains a PacI site and a Drosophila ryr cDNA
sequence upstream of the initial codon. Primer2
contains a PmeI site and a Drosophila ryr cDNA
sequence downstream of the stop codon. These
two primers were used for PCR following the pro-
tocol in the Expand Long Template PCR System
202 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214
kit (Roche Diagnostics, Indianapolis, IN) with a
cDNA library from adult D. melanogaster (Clon-
tech, Palo Alto, CA) as the template. A two-stage
PCR protocol was used with the following reac-
tion conditions: 94 C incubation for 5 min fol-
lowed by 10 cycles of a denaturation (at 92 C,
10 s) and annealing and elongation (68 C,
14 min). The second stage consisted of 15 cycles
of a denaturation (at 92 C, 10 s) and annealing
and elongation (68 C, 14 min), with each elonga-
tion cycle incremented by 20 s. This resulted in
production of the full-length gene with the unique
restriction sites, PacI and PmeI, at the 5 and 3
ends, respectively.
A 15.6 kb DNA fragment was cloned into a
pCR-XL-TOPO vector (Invitrogen Life Technolo-
gies, Carlsbad, CA). The complete sequence for the
Drosophila ryr gene was obtained by standard
sequencing method using plasmid and PCR prod-
ucts. The full-length genes subsequently sub-cloned
into a pIBV5His vector modiWed between the
BamHI and XbaI sites of the MCS of the vector
with PacI and PmeI sites.
The S. frugiperda cell line, Sf9, used for trans-
fection studies, was maintained in Sf-900 II SFM
medium (Invitrogen Life Technologies) at an
approximate density of 3 106 cells/ml in T75
Xasks at 27 C with constant agitation. Prior to
transfection, cells were diluted to 0.5 106 cells/
ml in the above medium with a 4-ml suspension
seeded onto a 60-mm tissue culture dish and
incubated overnight at 27 C. Transient transfec-
tion was carried out using Cellfectin reagent
(Invitrogen Life Technologies) and following the
InsectSelect BSD System manual (Invitrogen
Life Technologies). In short, medium was
removed from the culture dish followed by addi-
tion of 2.5 ml of the transfection solution con-
taining 6 g DNA and 18 g Cellfectin. The
culture dish was incubated at room temperature
over 4 h with gentle rocking. After incubation,
the transfection media was replaced with 4 ml of
fresh media and the cells were maintained at
27 C until testing. Stable Sf9-DRyR cell lines
were selected for 3 months using blasticidin
(10 g/ml) and individual lines tested by func-
tional assay (Ca2+ ratio imaging or Xuorimetric
plate reader).
2.11. Western blot of Drosophila RyR
Peptide LRARAILRSLVPLEDLQGV corre-
sponding to Drosophila RyR protein 25452563
was synthesized for polyclonal antibody produc-
tion (Sigma-Genosys, The Woodlands, TX); the
antiserum was further puriWed by an antigen col-
umn according to the methods in [28]. Sf9 cells
transfected with pIB-Dryr-15B were harvested and
the whole cell lysate obtained as described in Xu
et al. [29]. Protein samples were separated on a pre-
cast 4% SDSPAGE gel (Invitrogen Life Technol-
ogies) and proteins transferred to a PVDF
membrane in transfer buVer with 10% methanol at
35 V for 1 h. The gel was blotted with horseradish
peroxidase-linked to a secondary antibody against
insect RyR, using the ECL plus Western Blotting
Detection System (Amersham Biosciences UK
Limited, Little Chalfont, UK).
3. Results
3.1. Lepidopteran chemical structureactivity
relationship
The earliest anthranilamide compounds, char-
acterized by 2-methyl aryl or 2-methyl heteroaryl
diamides of formulae I, and II (Table 1), exhibited
moderate lepidopteran toxicity, with LD50 values
between 40 and 80 ppm observed for DP-001, DP-
002, and DP-003 against S. frugiperda and
H. virescens. Substitution at R1 was found to be
essential for activity with methyl and halogen
groups preferred. Heteroaryl groups, such as pyr-
idyl (where X D N, Y D CH) and pyrimidinyl
(where X, Y D N) exhibited equivalent lepi-
dopteran toxicity, whereas the corresponding
methyl pyrazole analogs (II) were less potent. The
phenylpyrazole series (III) provided a considerable
improvement in biological activity. Replacement
of the methyl group with a 1-phenyl substituent on
the pyrazole ring signiWcantly improved LD50 val-
ues to below 20 ppm for both lepidopteran species.
The ortho-position was found to be the optimal
location for the R3 group with halogen substitu-
ents preferred. ModiWcation of the 1-phenylpyraz-
oles to a 1-pyridylpyrazole group, such as those of
 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214 203

formula IV (Table 1), further increased eYcacy Table 2

resulting in LD50 values of 0.1 and 0.4 ppm for Anthranilamide induced attenuation of dorsal vessel contrac-
tion frequency in M. sexta larvae (4th instar)
DP-012 in S. frugiperda and H. virescens, respec-
tively. Lepidopteran potency for such anthranila- Anthra- Concentration Heart rate SEM n
nilamide (ng/g body weight) change (%)
mides was comparable to commercial insecticide
standards such as cypermethrin or indoxacarb. DP-002 100 3.8 3.2 3
300 0.5 2.8 4
1000 54.0 1.1 3
3.2. Symptomology and in situ studies
DP-010 10 1.2 4.0 5
30 61.0 0.8 4
Anthranilamide symptomology in lepidopteran 100 62.8 4.0 5
larvae included rapid feeding cessation, lethargy,
DP-012 1 4.2 2.5 4
partial paralysis, and occasionally regurgitation.
3 27.1 10.1 6
Absence of hyper-excitatory symptoms suggested a 10 55.0 6.1 3
mode of action distinct from that of excitatory
All measurements obtained 30 min after injection.
commercial insecticides such as carbamates, neoni-
cotinoids, N-phenylpyrazoles, or pyrethroids. This
was further supported by a lack of activity against In addition to cardiac muscle, skeletal muscle
in vitro assays for acetylcholinesterase, acetylcho- contractility was impacted by anthranilamides. In
line receptors, GABA receptors, voltage-gated a longitudinal skeletal muscle preparation, pipette-
sodium channels, and mitochondrial electron application of physiological saline containing
transport in insects (data not shown). Even the anthranilamide stimulated an immediate tetanic
most potent anthranilamide, DP-012, exhibited no contraction. Such contractions were observed
activity against these targets (up to 30 M). when larvae were challenged with DP-012 at
In situ studies employing cardiac and skeletal concentrations 7 3 M (100 and 67% for 10 and
muscle in the model lepidopteran, M. sexta, pro- 3 M, respectively). In contrast, challenges with
vided insight to the neuromuscular basis of DMSO alone (n D 10) or DP-012 (1 M) failed to
anthranilamide toxicity. Insects possess an open stimulate a muscle contraction in all larvae tested.
circulatory system where hemolymph is pumped Based upon the in situ Wndings, voltage-gated Ca2+
through the dorsal vessel, the insects cardiac channels (muscle action potential generation), and
organ. With the exception of neurohemal endings ryanodine receptor channels (excitationcontrac-
of the alary muscles, the larval dorsal vessel of tion coupling) were considered likely targets.
M. sexta does not receive neuronal innervation.
Instead, neurohormones coupled with the myo- 3.3. Anthranilamide eVects on intracellular calcium
genic property of cardiac cells regulate contrac-
tion frequency [3033]. Impedance recordings of More detailed mode-of-action studies were
dorsal vessel contractions revealed a rapid car- conducted using an in vitro preparation from the
dio-inhibitory response to anthranilamides. Lar- American cockroach, P. americana, which exhib-
vae (4th instar) had a mean basal contraction ited poisoning symptoms similar to those observed
frequency of 48.7 1.1 beats/min (n D 17). As in Lepidoptera. Isolated P. americana neurons
shown in Table 2, injection with anthranilamides challenged with anthranilamides exhibited a dose-
decreased the contraction frequency within dependent increase in [Ca2+]i with a peak rise of
30 min. DP-012 at 10 ng/g (body weight) and 172 43 nM over basal levels (63 2 nM) as seen
3 ng/g (body weight) attenuated the contraction for DP-012 in Fig. 1A (inset). With a 3-min anthra-
frequency by 27 and 55%, respectively. This car- nilamide challenge, [Ca2+]i increased transiently
dio-inhibitory eVect showed dose dependence, with restoration to basal levels upon compound
with anthranilamide rank activity comparable washout (Fig. 1A, inset). Doseresponse curves
to insecticidal potency among H. virescens: were generated for DP-002, DP-010, and DP-012
DP-012 > DP-010 > DP-002. with EC50 values of 0.95 and 0.39 M for DP-010
204 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214

Fig. 1. Calcium imaging studies conducted on embryonic P. americana neurons loaded with Fura-2 AM show a linear relationship
between anthranilamide toxicity and the release of ryanodine-sensitive Ca2+ stores. (A) Ca2+ mobilization dose response curves for
anthranilamides DP-012 (), DP-010 (), and DP-002 (). Due to limited aqueous solubility, the maximum concentration tested for
DP-002 was 100 M. Inset: a typical Ca2+ response of P. americana embryonic neurons challenged with DP-012 (3 min followed by
washout). (B) The Ca2+ mobilization threshold in P. americana embryonic neurons, as deWned in Section 2, and lepidopteran larval
toxicity reveal a linear relationship. For the anthranilamides listed in Table 1, linear Wt correlation coeYcients, r2, of 0.91 and 0.86 were
obtained for S. frugiperda () and H. virescens (), respectively. DP-001 is not included in the H. virescens correlation plot as its LC50
value could not be determined.

and DP-012, respectively. Due to limited aqueous
solubility, a full doseresponse for DP-002 could
not be generated. However, an EC50 value of 80 M
was estimated assuming a maximal response simi-
lar to that found with DP-012. Again, the relative
activity of these three anthranilamides was consis-
tent with that observed for dorsal vessel contrac-
tion attenuation and for lepidopteran toxicity.
The relationship between Ca2+ mobilization and
toxicity was further investigated for the series of 12
anthranilamides shown in Table 1. As maximal
Ca2+ mobilization could not be determined for
many of the less potent anthranilamides (due to
limited aqueous solubility), the concentration nec-
essary to stimulate a 20 nM increase in [Ca2+]i was
determined for each anthranilamide (Table 1). As
 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214 205

shown in Fig. 1B, perturbation in calcium homeo-
stasis appeared to have a strong toxicological rele-
vance given the correlation between Ca2+
mobilization in P. americana neurons and S. fru-
giperda (r2 D 0.91) or H. virescens (r2 D 0.86) toxic-
ity. Consequently, mechanisms that regulate Ca2+
homeostasis in these neurons, including voltage-
gated Ca2+ channels and internal Ca2+ stores,
located in the endoplasmic reticulum, were consid-
ered as the possible site of action.
To discount Ca2+ entry through voltage-gated
channels located on the plasma membrane, the
anthranilamide-induced response was investigated
under Ca2+-free conditions. As shown in Fig. 2A,
brief application of DP-012 continued to stimulate
a transient elevation in [Ca2+]i in the absence of
external Ca2+. This demonstrated that internal
Ca2+ stores were released by anthranilamides.
Release of internal Ca2+ stores was also supported
by the response attenuation observed with
repeated stimulation under Ca2+-free conditions
(Fig. 2A). Reintroduction of standard saline
allowed depleted Ca2+ stores to become reWlled
and thereby available for the next anthranilamide
challenge. Furthermore, complete inhibition of the
anthranilamide response was observed following
pre-treatment with cyclopiazonic acid (CPA), a
smooth endoplasmic reticulum ATPase (SERCA)
pump inhibitor (data not shown).
Insect cell lines originating from the lepi-
dopteran, S. frugiperda (Sf9), and Drosophila (S2),
were employed to discriminate between intracellu-

A 3 M
DP-012

Ca2+-free saline

50 nM
4 min

B KCl

DP-012

Caff Caff
1 M ryanodine
100 nM

4 min

Fig. 2. Characterization of anthranilamide-stimulated Ca2+ responses in P. americana embryonic neurons. (A) Repeated challenges
with DP-012 (3 M) in standard and Ca2+-free saline (1 mM EGTA with CaCl2 omitted) indicate activation of an internal Ca2+ store
release mechanism. In the absence of external Ca2+ the initial challenge with the DP-012 stimulates a similar [Ca2+]i increase to that
observed with standard saline. A subsequent challenge with DP-012, in the absence of external Ca2+, results in an attenuated response
that can be recovered with reintroduction of standard saline. The trace is representative of 55 cells tested. (B) Repeated challenges with
caVeine (20 mM) or DP-012 (1 M) in standard saline stimulate transient [Ca2+]i increases. Perfusion with ryanodine (1 M) alone does
not eVect basal [Ca2+]i. However, in the presence of ryanodine, DP-012 stimulates a prolonged Ca2+ response while subsequent chal-
lenges with either DP-012 or caVeine fail to elicit a response. The [Ca2+]i increase stimulated by depolarization with KCl (100 mM)
remains unaVected, demonstrating that while anthranilamides stimulate release of RyR-mediated Ca2+ stores, voltage-gated Ca2+
channels are unaVected. The trace is representative of 18 cells tested.
206 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214

lar Ca2+ channels. These lines possess endogenous
IP3R-mediated Ca2+ stores maintained by
SERCA, but not endogenous RyRs [34,35]. The
anthranilamides, DP-010 and DP-012 (up to
30 M), failed to mobilize Ca2+ in either cell line
(data not shown) suggesting a lack of direct IP3R
activation or SERCA inhibition. Use of ryano-
dine and 2-aminophenylborate (2-APB), known
to act on RyRs [36] and IP3Rs [37,38], respec-
tively, allows pharmacological discrimination
between these intracellular Ca2+ channels.
Anthranilamide-induced Ca2+ mobilization in P.
americana neurons was unaVected by 2-APB
(data not shown). In contrast, ryanodine (1 M)
results in a prolongation of the initial anthranila-
mide-induced Ca2+ release followed by an inabil-
ity of subsequent anthranilamide or caVeine (a
known RyR agent) challenges to mobilize Ca2+
(Fig. 2B).
3.4. Radioligand-binding studies
Membranes prepared from adult P. americana
legs, of which the primary constituent is muscle,
were used to characterize binding of [3H]ryanodine
and [3H]DP-010. A saturable, speciWc component
of [3H]ryanodine binding was measured, with at
least 90% of the total binding being speciWc when
1000-fold excess ryanodine was used to estimate
non-speciWc binding. A representative saturation
binding curve and Scatchard plot is shown in
Fig. 3A. Scatchard analysis of the binding data
obtained from multiple membrane preparations
indicates a Kd value of 10.4 2.7 nM and Bmax

Fig. 3. Saturable, speciWc binding of [3H]ryanodine and [3H]DP-010 to membranes from P. americana leg membranes. (A) Saturable,
speciWc binding of [3H]ryanodine to a single preparation of membranes from roach legs as described in Section 2. Each data point rep-
resents the mean of triplicate determinations with SEM values typically less than 5%. Inset represents the Scatchard transformation of
the data with Kd D 12.4 nM and Bmax D 10,294 fmol mg1 protein. (B) SpeciWc binding of [3H]DP-010 to a single preparation of mem-
branes from roach legs in the absence (), or presence (), of 10 M ryanodine as described in Section 2. Each data point represents
the mean of triplicate determinations with SEM values typically less than 5%. (C) Scatchard transformation of the binding data
obtained in the presence of 10 M ryanodine ( in B, above) yielded Kd D 44 nM and Bmax D 9,687 fmol mg1 protein. (D) Enhance-
ment of [3H]DP-010 binding was determined by addition of the indicated ryanodine concentrations at a Wxed concentration (25 nM) of
[3H]DP-010. The control level of binding was 430 fmol mg1 protein. Each data point represents means SEM of two separate
experiments.
 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214
value of 10,000 1080 fmol mg1 protein for
[3H]ryanodine. An associated Hill coeYcient of
0.74 0.03 was obtained, suggesting the absence of
multiple binding sites. These results are consistent
with earlier studies using membrane fractions from
P. americana, where Kd and Bmax values of 4.4 nM
and 2520 fmol mg1, respectively, were obtained
[16]. Studies of anthranilamide eVects on [3H]ryan-
odine binding were conducted with DP-010 and
DP-012 over a concentration range of 0.01
100 M. Both anthranilamides failed to displace or
enhance binding suggesting that these compounds
bind to a site unique from that of ryanodine.
Initial membrane-binding studies with [3H]DP-
010 were challenging, in part due to the physical
properties of the molecule limiting its water solu-
bility. SpeciWc binding was measurable and Scat-
chard analysis indicated a Kd greater than 100 nM
(data not shown). However, the speciWc binding
was typically less than 30% of the total binding
thus limiting the extent to which conclusions could
be made regarding binding parameters. Investiga-
tion of the eVects of ryanodine on [3H]DP-010
binding revealed that the presence of ryanodine
actually enhanced the amount of [3H]DP-010
bound to the membranes. In the presence of 10 M
ryanodine, high-aYnity, saturable [3H]DP-010
binding to P. americana membranes was readily
measurable (Fig. 3B). At least 80% of the total
binding was speciWc when 1000-fold excess DP-012
(a more soluble anthranilamide) was used to esti-
mate non-speciWc binding. Scatchard analysis of
the binding data obtained (in the presence of
10 M ryanodine) from multiple membrane prepa-
rations indicates that [3H]DP-010 has a Kd value of
28.2 2.9 nM and a Bmax value 8410
1710 fmol mg1 protein (Fig. 3C). The calculated
Hill coeYcient of 0.70 0.07 provided no evidence
for the existence of multiple binding sites. Interac-
tion at the DP-010 binding site in P. americana leg
membranes is reXective of functional eVects in neu-
rons as evidenced by comparison of IC50 values (5,
0.024, and 0.022 M) with Ca2+ mobilization EC50
values (80, 0.95, and 0.39 M) for DP-002, DP-010,
and DP-012, respectively.
Further analysis of the [3H]DP-010 binding
enhancement observed with ryanodine indicated a
dose-dependent increase in binding over the con-
207
centration range 0.00110 M ryanodine, with a
maximal eVect (8-fold enhancement) at concentra-
tions above 1 M (Fig. 3D). The basis of this ryan-
odine interaction with the anthranilamide binding
site is presently unclear. As caVeine has been
shown to enhance [3H]ryanodine binding [39,40], it
was tested in anthranilamide binding studies.
CaVeine (up to 40 mM) failed to displace or
enhance [3H]DP-010 binding (results not shown).
This lack of activity and the above ryanodine-
dependent enhancement is further evidence sug-
gesting that anthranilamides bind to a unique site
on the receptor.
3.5. Anthranilamide activity on cloned insect RyRs
Cloning and expression of the insect ryanodine
receptor gene (ryr) was undertaken to genetically
validate anthranilamide action at the RyR. Ampli-
Wcation of the full-length ryr gene from a
Drosophila cDNA library was accomplished using
a one-step Expand Long Template PCR System
kit. To avoid potential mutations created by PCR,
multiple clones were analyzed by DNA sequencing.
Selected clones were then expressed in Sf9 cells and
analyzed for RyR protein expression and function-
ality using Western blot analysis and Ca2+ imaging.
One full-length clone, named DRyR-15B, tested
positive by Western blot analysis for RyR protein
expression (Fig. 4A). Ca2+ imaging studies with Sf9
cells 24 h after transfection with DRyR-15B dem-
onstrated a lack of sensitivity to the RyR agent,
caVeine (10 mM). However, within 72 h, 2030% of
transfected cells exhibited a robust caVeine-induced
[Ca2+]i increase (Fig. 4B). CaVeine (10 mM) stimu-
lated a rapid rise in [Ca2+]i that reversed prior to
stimulus washout. While full recovery was observed
under standard saline conditions, repeated caVeine
challenges in Ca2+-free saline stimulated succes-
sively attenuated responses with eventual extinc-
tion of the caVeine-stimulated [Ca2+]i increase (data
not shown). Ca2+ responses to caVeine resumed
upon reintroduction of standard saline. Given the
caVeine response in the absence of external Ca2+,
and that Ca2+ failed to mobilize following store
depletion, these Wndings are in agreement with
expressed receptors being coupled to internal Ca2+
stores, rather than the plasma membrane.
208 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214

B 800 Caff Caff Caff Caff Caff CPA

Calcium Concentration (nM)

3 M ryanodine
600
A
560 kDa
400

200

1 2 3
0
0 5 10 15 20 25
Time (min)

C 600

Caff DP-012 CPA

Calcium Concentration (nM)

D 250
400
Normalized Response
(% Caffeine Maximum) 200

150

200 100

50

0 0
0 5 10 15 -8 -7 -6 -5 -4 -3 -2 -1
Time (min) Concentration (log M)

Fig. 4. Expression and activity of the full-length Drosophila ryr gene. (A) Western blot demonstrating expression of Drosophila RyR
(DRyR-15B) protein (arrow) in the S. frugiperda cell line, Sf9, harvested 72 h after transfection with pIB-Dryr-15B. Lane 1, P. ameri-
cana muscle membrane (10 g); lane 2, pIB-Dryr-15B transfected Sf9 cells (25 g); lane 3, wild-type Sf9 cells (25 g). (B) A typical trace
of Sf9 cells showing caVeine (10 mM) sensitivity 72 h after lipid transfection with pIB-Dryr-15B. Ryanodine (3 M) application has no
eVect on basal [Ca2+]i but in the presence of caVeine RyR channels do not fully close as demonstrated by a sustained [Ca2+]i elevation.
After initial receptor activation, 10 mM caVeine and 10 M cyclopiazonic acid (CPA), a SERCA pump inhibitor, are ineVective due to
internal Ca2+ store depletion. (C) A typical DP-012 response from Sf9 cells exhibiting (solid line) and lacking (dashed line) functional
Drosophila RyR expression. DP-012 (3 M) stimulates a sustained [Ca2+]i response in caVeine-sensitive cells while having no eVect on
caVeine-insensitive and lipid controls cells (DNA). (D) Ca2+ mobilization dose response for Sf9-DRyR-15B cells challenged with
caVeine and anthranilamides. Ca2+ measurements were obtained from cells in a 96-well plate using a FlexStation plate reader as
described in Section 2. EC50 values of 0.37, 0.55, 40, and 4400 M were obtained for DP-012 (), DP-010 (), DP-002 (), and caVeine
(), respectively. Data points correspond to peak response (mean SEM) measured over 2 min for 3 wells and normalized to the max-
imal response obtained for caVeine.

The recombinant Sf9 cells were tested to ensure stimulate Ca2+ release as the internal Ca2+ stores
that the DRyR-15B response to ryanodine was become depleted (Fig. 4B).
analogous to that observed with native insect In addition to conferring caVeine-sensitivity,
RyRs. Ryanodine (3 M) had no eVect on basal expression of DRyR-15B conferred anthranila-
[Ca2+]i, however, caVeine application in the pres- mide sensitivity to Sf9 cells. Ca2+ release by this
ence of ryanodine stimulated a Ca2+ response chemistry and caVeine appears to be positively cor-
which did not fully return to basal levels (Fig. 4B). related, in that all cells responsive to caVeine exhib-
The ryanodine eVect observed with recombinant ited anthranilamide sensitivity, while cells
Sf9 cells reXects those seen with P. americana neu- unresponsive to caVeine lacked an anthranilamide
rons, consistent with ryanodine locking channels response. Whereas the caVeine response in cells
open, either partially or fully. Accordingly, subse- expressing DRyR-15B was transient in nature,
quent challenges with caVeine or CPA, failed to anthranilamides induced a sustained Ca2+
 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214
elevation as shown with 3 M DP-012 (Fig. 4C).
This sustained [Ca2+]i elevation required more than
20 min of saline rinse to return to basal levels. Sub-
sequent challenges with caVeine, anthranilamide,
or CPA during this sustained period either failed
to induce a Ca2+ response, or induced a greatly
attenuated response that ultimately became extin-
guished. Introduction of Ca2+-free saline induced a
return to basal [Ca2+]i followed by a resumption to
elevated levels with standard saline reintroduction
(data not shown).
Through blasticidin selection pressure, an indi-
vidual colony of cells expressing the recombinant
RyR, Sf9-DRyR-15B, was generated after several
months. Using a FlexStation, a Xuorimetric plate
reader with integrated Xuidics, the stable cell line
was shown to have EC50 values of 40, 0.55, and
0.47 M for DP-002, DP-010, and DP-012, respec-
tively; values comparable to those observed with
P. americana neurons (Fig. 4D). Interestingly,
anthranilamides DP-010 and DP-012 stimulated
maximal Ca2+ responses that were approximately
twice that observed with caVeine.
3.6. Anthranilamide activity on mammalian RyRs
Since the amino acid sequences of insect and
mammalian RyRs vary considerably, one might
anticipate diVerential receptor pharmacology.
Mammals express three isoforms of ryanodine
receptor; RyR1 and RyR2, distributed predomi-
nately in skeletal and cardiac muscle, respectively,
and RyR3 distributed more heterogeneously.
Insects, by contrast, express a single form of the
receptor, sharing 47% homology with mamma-
lian RyRs [41]. UndiVerentiated PC12 cells (rat
pheochromocytoma cell line) have been shown to
endogenously express RyR1 and RyR2 [42,43].
Interestingly, this cell line was weakly sensitive to
anthranilamides. As shown in Fig. 5A, DP-012
failed to stimulate Ca2+ mobilization at 10 M
with only slight activity observed at 30 M.
Higher concentrations of DP-012 were required
to strongly activate Ca2+ mobilization with the
response being monophasic in nature and revers-
ible. Due to solubility limits however, DP-012
testing could not be conducted at concentrations
greater than 200 M.
209
Comparative doseresponse curves for DP012
are shown in Fig. 5B, with an estimated EC50 value
of 220 M for PC12 cells. This value was based on
the assumption that maximal response is similar to
that for caVeine; thus the EC50 value could reXect
an underestimate if DP-012 were to stimulate a
stronger response than caVeine, as was observed
with insect cells. Meanwhile, EC50 values for
caVeine were found to be 10.8, 11.5, and 4.4 mM for
PC12, P. americana, and Sf9-DRyR-15B cells,
respectively. Additional studies currently under-
way with C2C12 cells, a mouse myoblastoma cell
line that endogenously expresses RyR1 [42], simi-
larly indicate weak anthranilamide sensitivity
(data not shown).
4. Discussion
There are a limited number of insect targets
which have provided suYcient crop protection
properties for successful commercialization. Given
the innate ability insects possess to develop resis-
tance to existing products, there is a continuous
demand for discovery of insecticides with novel
modes of action. The anthranilamides, an exciting
new class of insecticides discovered at DuPont, are
such an example. These compounds provide lepi-
dopteran control at signiWcantly lower rates than
current commercial insecticides. The most potent
anthranilamides investigated in this study were of
the 1-pyridylpyrazole group, with DP-012, being
50-fold more active against S. frugiperda than the
pyrethroid, cypermethrin, and 3-fold more active
than the recently commercialized insecticide, ind-
oxacarb.
Evidence supporting RyR-activation as the
anthranilamide mode of action is compelling. The
paralysis observed in anthranilamide-poisoned
lepidopteran larvae and the in situ cardiac and
skeletal muscle eVects are consistent with ryano-
dine poisoning. In the cockroach, P. americana,
and the adult moth, Hyalophora cecropia, ryano-
dine has been shown to induce Xaccid paralysis in
skeletal muscle and contractile failure in cardiac
muscle without aVecting nerve conduction [44,45].
Though anthranilamides and ryanodine exhibit
distinct actions at a receptor level, one might
210 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214

A 10 mM 10 M 30 M 100 M 200 M
Caff DP-012 DP-012 DP-012 DP-012

100 nM
3 min

B
200

150
Normalized Response
(% Caffeine Maximum)

100

50

0
-8 -7 -6 -5 -4 -3 -2 -1
Concentration (log M)

Fig. 5. Anthranilamide response of the rat pheochromocytoma cell line, PC12. (A) DP-012 fails to induce a response below 10 M,
however compound application of 30200 M stimulates a reversible and concentration-dependent [Ca2+]i increase. (B) Comparative
caVeine (open symbols) and DP-012 (closed symbols) doseresponse curve for P. americana neurons (), Sf9-DRyR-15B (), and
PC12 () cells. DP-012 concentrations higher than 200 M were not investigated due to limited aqueous solubility.

anticipate similar gross poisoning symptoms. In with a lack of activity on other known insecticide
muscle, ryanodine locks RyR channels in a sub- targets. Anthranilamides therefore represent the
conductance state upon their activation by plasma Wrst example of a synthetic insecticide shown to
membrane voltage-gated Ca2+ channels. In con- provide commercial-level pest control through
trast, anthranilamides directly activate RyRs. In RyR activation.
both cases, as RyR channels remain open, internal Membranes from P. americana legs were used
Ca2+ stores become depleted, interfering with to investigate anthranilamide binding. Results
muscle contraction and ultimately resulting in from these studies describe a speciWc, high-aYnity,
paralysis. saturable binding site for DP-010. The inability of
The linear relationship between lepidopteran anthranilamides to displace or enhance [3H]ryano-
toxicity and Ca2+ store release in P. americana neu- dine binding strongly suggests that the anthranila-
rons (Fig. 1B) and the selectivity for RyR-medi- mide-binding site is quite distinct from that of
ated Ca2+ stores (Fig. 2B) conWrms anthranilamide ryanodine. The mechanism of [3H]DP-010 binding
activation of insect RyRs. The most deWnitive enhancement (up to 8-fold) observed with ryano-
evidence for a RyR mode of action is the anthra- dine (Fig. 3D) remains unclear; it is diYcult to
nilamide-sensitivity conferred upon Sf9 cells trans- explain without postulating separate sites for
fected with the Drosophila RyR (Fig. 4), coupled ryanodine and anthranilamide binding that are
 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214
allosterically linked. Another possibility is that the
binding enhancement reXects the dependence of
DP-010 binding on the channel state. RyR chan-
nels would have a high probability of being in the
open state given the relatively high Ca2+ concen-
tration (0.5 mM) in these binding studies. As ryan-
odine locks channels in a sub-conductance state,
enhancement of [3H]DP-010 binding could suggest
that higher anthranilamide binding occurs with
channels in a sub-conductance state versus the
open state. Future experiments exploring the
dependence of anthranilamide binding on Ca2+
concentration would further characterize the bind-
ing site and might help to clarify the mechanism of
binding enhancement.
A limited number of molecules have been
reported to stimulate release of RyR-mediated
Ca2+ stores. Molecules such as methylxanthines
(caVeine), 4-chloro-m-cresol, and derivatives of the
marine toxin, eudistomin D, activate RyRs
through a Ca2+ sensitization of the channel. These
molecules potentiate [3H]ryanodine binding in a
Ca2+-dependent manner [46,47]. The present study
revealed that caVeine does not displace or enhance
[3H]DP-010 from roach membranes. Lehmberg
and Casida [16] found that in P. americana muscle,
caVeine failed to stimulate [3H]ryanodine binding
under standard conditions, though caVeine
enhanced binding under low [Ca2+] conditions. As
we did not investigate caVeine eVects under a vari-
ety of binding conditions, additional studies are
needed before concluding a lack of caVeine interac-
tion with the binding site of anthranilamides.
In addition to describing the mode of action for
anthranilamides, this study describes functional
expression of a full-length Drosophila RyR in an
insect cell line. Expression of Drosophila RyR was
previously demonstrated in CHO cells [28], and
although the Ca2+ channel was functional, detailed
studies were only possible when just the pore-
forming region (20%) of the ryr gene was
expressed. In the present study, expression levels
were suYcient to characterize anthranilamide
action and to generate a stable cell line. This repre-
sents the Wrst known example of a stable insect cell
line that expresses a functional, full-length insect
RyR. Moreover, comparable caVeine and anthra-
nilamide EC50 values were observed between
211
P. americana neurons and Sf9-DRyR-15B cells. In
the recombinant cells, anthranilamides such as
DP-012 stimulate a Ca2+ response comprising two
components, an initial Ca2+ transient followed by a
sustained Ca2+ elevation. Whereas the transient
component is attributed to release of RyR-medi-
ated internal Ca2+ stores, external Ca2+ entry is
responsible for the sustained component (Fig. 4),
the sustained component can be attributed to
capacitative calcium entry, a mechanism by which
depletion of internal Ca2+ stores triggers activation
of voltage-independent Ca2+ channels [48,49]. Typ-
ically, capacitative calcium entry enables rapid
reWlling of internal Ca2+ stores making them avail-
able for the next stimulated release. In anthranila-
mide-treated Sf9-DRyR-15B cells, RyR channels
appear to remain open, either fully or partially for
greater than 20 min, triggering capacitative cal-
cium entry upon depletion of internal Ca2+ stores.
The distinct Ca2+ response kinetics (compare
Figs. 1 and 2 vs. Fig. 4) suggests that there are
functional diVerences in RyR activity between
P. americana and the recombinant Sf9 cells. There
may be several reasons for such diVerences; one
possibility is that Drosophila receptors exhibit dis-
tinct channel kinetics from those of P. americana,
as they belong to diVerent orders, Diptera and
Dictyoptera, respectively. However, given the
recombinant nature of DRyR-15B, it is unclear
whether Ca2+ kinetics for the native receptor is
accurately reXected in this study. In native systems,
RyR interaction with accessory proteins, such as
the FK binding protein or calmodulin, alters chan-
nel kinetics. Co-expression of rabbit FKBP12 and
RyR1 in Sf9 cells signiWcantly decreased the dura-
tion of caVeine-induced Ca2+ release when com-
pared to RyR expression alone [5052]. Brillantes
et al. [52] did not detect endogenous FKBP12 in
Sf9 cells by either Northern hybridization or
immunoplots. In a separate study by Goel et al.
[53] a small but detectable level of endogenous
FKBP has been shown in Sf9 cells with immunore-
activity at a molecular mass of 48 kDa. To what
extent native insect RyR channels interact with
accessory proteins or whether DRyR-15B channels
interact with FKBP is uncertain.
The demonstration that full-length insect RyR
can be stably expressed in a recombinant cell line
212 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214
oVers a powerful tool, not only for discovery of
other molecules that interact at this receptor, but
also for investigation of the importance of acces-
sory proteins that modulate channel function and
comparative pharmacology of RyRs from diVerent
insect pests. Indeed, cloning and expression of mul-
tiple lepidopteran and homopteran RyRs has been
successful and is the basis for a recent patent appli-
cation Wling [19]. Future planar lipid bilayer stud-
ies will enable further characterization of insect
RyR function at the single-channel level and allow
an understanding of the mechanistic nature of
receptor activation by anthranilamides.
As RyRs are found among vertebrates, we
investigated anthranilamide eVects in mammalian
cells. Preliminary studies with, PC12 and C2C12
cell lines, revealed that anthranilamides exhibit low
potency for mammalian RyRs (Fig. 5B). The most
potent anthranilamide in this study, DP-012,
exhibited >500-fold lower potency in PC12 cells
than was observed with insect cells. Bennett et al.,
have shown that undiVerentiated PC12 cells
express both RyR1 and RyR2 whereas only RyR1
is expressed in C2C12 cells [46]. Accordingly, one
would expect the mammalian RyR results in this
study to reXect RyR1 and RyR2 activity; however,
to what extent each isoform contributes to the
overall Ca2+ response is unclear.
There are limited synthetic molecules known to
activate RyRs, particularly with the potency dem-
onstrated in insect cells for DP-012. Consequently,
anthranilamides oVer a novel pharmacological
tool for characterization of vertebrate and inverte-
brate RyRs and related calcium signaling mecha-
nisms. More importantly, with the combined
attributes of exceptional lepidopteran potency,
novel mode of action, and insect selectivity,
anthranilamides hold great promise for pest-man-
agement strategies.
Acknowledgments
The authors wish to acknowledge C. Bellin,
C. Clark, E. Esrey, H. Krikelis, B. Myers, and B.
Smith for their excellent technical support and T.
Fuesler for review of the manuscript.
References
[1] R. Nauen, T. Bretschneider, New modes of action of insec-
ticides, Pesticide Outlook 6 (2002) 241245.
[2] T. Narahashi, Nerve membrane ion channels as the target
site of insecticides, Mini Rev. Med. Chem. 2 (2002) 419
432.
[3] M.A. Dekeyser, Acaricide mode of action, Pest Manag. Sci.
61 (2005) 103110.
[4] K.D. Wing, M. Sacher, Y. Kagaya, Y. Tsurubchi, L. Mulde-
rig, M. Connair, M. Schnee, Bioactivation and mode of
action of the oxadiazine indoxacarb in insects, Crop Prot.
19 (2000) 537545.
[5] T.C. Sparks, G.D. Crouse, G. Durst, Natural products as
insecticides: the biology, biochemistry and quantitative
structure-activity relationships of spinosyns and spino-
soids, Pest Manag. Sci. 57 (2001) 896905.
[6] J.R. Bloomquist, Ion channels as targets for insecticides,
Annu. Rev. Entomol. 41 (1996) 163190.
[7] L.M. Hall, D. Ren, G. Feng, D.F. Eberl, M. Dubald, M.
Yang, F. Hannan, C.T. Kousky, W. Zheng, Calcium chan-
nel as a new potential target for insecticides, in: J.M. Clark
(Ed.), Molecular Actions of Insecticides on Ion Channels,
American Chemical Society, Washington, DC, 1995, pp.
162172.
[8] M.J. Berridge, P. Lipp, M.D. Bootman, The versatility and
universality of calcium signaling, Nat. Rev. Mol. Cell Biol.
1 (2000) 1121.
[9] G. Meissner, Ryanodine receptor Ca2+ release channels
and their regulation by endogenous eVectors, Ann. Rev.
Physiol. 56 (1994) 458508.
[10] W. Melzer, A. Herrmann-Frank, H.C. Luttgau, The role of
Ca2+ ions in excitation contraction coupling of skeletal
muscle Wbres, Biochim. Biophys. Acta 1241 (1995) 59116.
[11] B.E. Flucher, C. Franzini-Armstrong, Formation of junc-
tions involved in excitation-contraction coupling in skele-
tal and cardiac muscle, Proc. Natl. Acad. Sci. USA 93
(1996) 81018106.
[12] E.F. Rogers, F.R. Koniuszy, J. Shavel Jr., K. Folkers, Plant
insecticides. I. Ryanodine: a new alkaloid from Ryania
speciosa Vahl, J. Am. Chem. Soc. 70 (1948) 30863088.
[13] R. Coronado, J. Morrissette, M. Sukhareva, D.M.
Vaughan, Structure and function of ryanodine receptors,
Am. J. Physiol. 266 (1994) 14851504.
[14] E. Buck, I. Zimanyi, J.J. Abramson, I.N. Pessah, Ryanodine
stabilizes multiple conformational states of the skeletal
muscle calcium release channel, J. Biol. Chem. 267 (1992)
2356023567.
[15] Environmental Protection Agency Reregistration Eligibil-
ity Decisions (R.E.D) Fact sheet, EPA-000-F-99-002
(1999).
[16] E. Lehmberg, J.E. Casida, Similarity of insect and mamma-
lian ryanodine binding sites, Pest Biochem. Phys. 48 (1994)
145152.
[17] P.R. JeVries, J.E. Casida, Ryanoid chemistry and action, in:
P. Hedin, J.J. Menn, R.M. Hollingworth (Eds.), Natural
 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214
and Engineered Pest Management Agents, Oxford Univer-
sity of Press, Oxford, 1994, pp. 130144.
[18] G.P. Lahm, B.J. Myers, T.P. Selby, T.M. Stevenson, PCT
Int. Appl. WO 01/070671 (2001).
[19] S. Gutteridge, T. Caspar, D. Cordova, J.J. Rauh, Y. Tao, L.
Wu, R.M. Smith, US Patent Appl 20040171114 (2004).
[20] P. McCullagh, J.A. Nelder, Generalized Linear Models,
second ed., Chapman and Hall, London, 1989 , pp. 1511.
[21] A. Smits, W. Burggren, D. Oliveras, Developmental
changes in in vivo cardiac performance in the moth Mand-
uca Sexta, J. Exp. Biol. 203 (2000) 369378.
[22] G. Lees, D.J. Beadle, Dihydroavermectin B1: actions on
cultured neurons from the insect central nervous system,
Brain Res. 366 (1986) 369372.
[23] S. Dewhurst, D.J. Beadle, Cell and tissue culture from the
insect nervous system, in: H. Breer, T.A. Miller (Eds.), Neu-
rochemical Techniques in Insect Research, Springer-Ver-
lag, New York, 1985, pp. 207222.
[24] G. Grynkiewicz, M. Poenie, R.Y. Tsien, A new generation
of Ca2+ indicators with greatly improved Xuorescence
properties, J. Biol. Chem. 260 (1985) 34403448.
[25] M. Poenie, Alteration of intracellular Fura-2 Xuorescence
by viscosity: a simple correction, Cell Calcium 11 (1990)
8591.
[26] M. Schmitt, A. Turberg, M. Londershausen, A. Dorn,
Binding sites for Ca2+-channel eVectors and ryanodine in
Periplaneta americanapossible targets for new insecti-
cides, Pestic. Sci. 48 (1996) 375385.
[27] O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall,
Protein measurement with Folin phenol reagent, J. Biol.
Chem. 193 (1951) 265275.
[28] E. Harlow, D. Lane, ImmunoaYnity puriWcation of anti-
bodies on an antigen column, in: Antibodies: A Labora-
tory Manual, Cold Spring Laboratory, New York, 1988,
pp. 313315.
[29] X. Xu, M.B. Bhat, M. Nishi, H. Takeshima, J. Ma, Molecu-
lar cloning of cDNA encoding a drosophila ryanodine
receptor and functional studies of the carboxy-terminal
calcium release channel, Biophys. J. 78 (2000) 12701281.
[30] N.J. Tublitz, Insect cardioactive neuropeptides: peptidergic
modulation of the intrinsic rhythm of an insect heart is
mediated by inositol 1,4,5-trisphosphate, J. Neurosci. 8
(1988) 43944399.
[31] L.T. Wasserthal, W. Wasserthal, Innervation of heart and
alary muscles in Sphinx ligustri L. (Lepidoptera). A scan-
ning and transmission electron microscopic study, Cell Tis-
sue Res. 184 (1977) 467486.
[32] N.J. Tublitz, J.S. Truman, Insect cardioactive peptidesI.
Distribution and molecular characteristics of two cardioac-
celeratory peptides in the tobacco hawkmoth, Manduca
sexta, J. Exp. Biol. 114 (1985) 365579.
[33] T.A. Miller, Structure and physiology of the circulatory
systems. in: G.A. Kerkut Swatton, S.A. Morris, F. Wissing,
C.W. Taylor, Functional Properties of and L.I. Gilbert
(Eds.), Comprehensive Insect Physiology, Biochemistry
and Pharmacology, Pergamon Press, Oxford, 3, 1985, pp.
289353.
213
[34] Swatton, S.A. Morris, F. Wissing, C.W. Taylor, Functional
properties of Drosophila inositol trisphosphate receptors,
Biochem. J. 359 (2001) 435441.
[35] V. Raymond-Delpech, P.R. Towers, D.B. Sattelle, Gene
silencing of selected calcium-signalling molecules in a Dro-
sophila cell line using double-stranded RNA interference,
Cell Calcium 35 (2004) 131139.
[36] J.M. Fill, J.A. Copella, Ryanodine receptor calcium release
channels, Physiol. Rev. 82 (2002) 893922.
[37] H.-T. Ma, R.L. Patterson, D.B. van Rossum, L. Birnbau-
mer, K. Mikoshiba, D.L. Gill, Requirement of the inositol
trisphosphate receptor for activation of store-operated
Ca2+ channels, Science 287 (2000) 16471651.
[38] D. Cordova, V.R. Delpech, D.B. Sattelle, J.J. Rauh, Spa-
tiotemporal calcium signaling in a Drosophila melano-
gaster cell line stably expressing a Drosophila
muscarinic acetylcholine receptor, Invert. Neurosci. 5
(2003) 1928.
[39] R. Zucchi, S. Ronca-Testoni, The sarcoplasmic reticulum
Ca2+ channel/ryanodine receptor: modulation by endoge-
nous eVectors, drugs and disease states, Pharm. Rev. 49
(1997) 151.
[40] I.N. Pessah, R.A. Stambuk, J.E. Casida, Ca2+-activated
ryanodine binding: mechanisms of sensitivity and intensity
modulation by Mg2+, caVeine, and adenine nucleotides,
Mol. Pharmacol. 31 (1987) 232238.
[41] Takeshima, M. Nishi, N. Iwabe, T. Miyata, T. Hosoya, I.
Masai, Y. Hotta, Isolation and characterization of a gene
for a ryanodine receptor/calcium release channel in Dro-
sophila melanogaster, FEBS Lett. 337 (1994) 8187.
[42] F.W. Johenning, M. Zochowski, S.J. Conway, A.B. Holmes,
P. Koulen, B. Ehrlich, Distinct intracellular calcium tran-
sients in neuritis and somata integrate neuronal signals, J.
Neurosci. 22 (2002) 53445353.
[43] D.L. Bennett, T.R. Cheek, M.J. Berridge, H. De Smedt, J.B.
Parys, L. Missiaen, M.D. Bootman, Expression and func-
tion of ryanodine receptors in nonexcitable cells, J. Biol.
Chem. 271 (1996) 63566362.
[44] F.V. McCann, Z.J. Penefsky, The eVects of ryanodine, ace-
tylcholine and epinephrine on electrical and mechanical
activity in insect heart, Comp. Biochem. Physiol. C 70
(1981) 185193.
[45] P.N.R. Usherwood, The action of alkaloid ryanodine on
insect skeletal muscle, Comp. Biochem. Physiol. 6 (1962)
181199.
[46] A. Herrmann-Frank, M. Richter, S. Sarkozi, U. Mohr, F.
Lehmann-Horn, 4-Chloro-m-cresol, a potent and speciWc
activator of the skeletal muscle ryanodine receptor, Bio-
chim. Biophys. Acta 1289 (1996) 3140.
[47] A. Seino, M. Kobayashi, J. Kobayashi, Y. Fang, M. Ishib-
ashi, H. Nakamura, K. Momose, Y. Ohizumi, 9-Methyl-7-
Bromoeudistomin D, a powerful radiolable Ca++ releaser
having caVeine-like properties, acts on Ca++-induced Ca++
release channels of sarcoplasmic reticulum, J. Pharm. Exp.
Ther. 256 (1991) 861867.
[48] J.W. Putney Jr., Capacitative calcium entry in the nervous
system, Cell Calcium 34 (2003) 339344.
214 D. Cordova et al. / Pesticide Biochemistry and Physiology 84 (2006) 196214
[49] J.W. Putney Jr., R.R. McKay, Capacitative calcium entry
channels, BioEssays 21 (1999) 3846.
[50] S.O. Marx, J. Gaburjakova, M. Gaburjakova, C. Henrik-
son, K. Ondrias, A.R. Marks, Coupled gating between car-
diac calcium release channels (ryanodine receptors), Circ.
Res. 88 (2001) 11511158.
[51] S.O. Marx, K. Ondrias, A.R. Marks, Coupled gating
between individual skeletal muscle Ca2+ release channels
(ryanodine receptors), Science 281 (1998) 818821.
[52] A.B. Brillantes, K. Ondrias, A. Scott, E. Kobrinsky, E.
Ondriasova, M.C. Moschella, T. Jayaraman, M. Landers,
B. Ehrlich, A.R. Marks, Stabilization of calcium release
channel (ryanodine receptor) function by FK506-binding
protein, Cell 77 (1994) 513523.
[53] M. Goel, R. Garcia, M. Estacion, W.P. Schilling,
Regulation of Drosophila TRPL channels by
immunophilin FKBP59, J. Biol. Chem. 276 (2001)
3876238773.