Zebrafish Paralog Study: the RNA Isolation, RT-PCR, and Agarose Gel Electrophoresis of the

TBR1 gene, required for normal brain development, in zebrafish embryos at 48 and 96 hours

Haley Brown and Madeline DeAngelo

 Abstract

The zebrafish paralogue study for the gene TBR1 was conducted to determine whether

the gene was present in the 48 hour and 96 hour old embryos of the zebrafish. Identification of

primers using cDNA, RNA Isolation, the RT-PCR amplification of the gene and agarose gel

electrophoresis were the methods used to determine if the gene was present in the embryos.

Reverse Transcription was used to obtain the cDNA and Polymerase Chain Reaction allows the

specific portion of the mRNA relative to the TBR1 gene to be identified. Agarose gel

electrophoresis is how the DNA is visualized and is used to interpret the results of the

paralogue. The results of the gel electrophoresis revealed zero bars from the 48 hour, TBR1a

columns and the 96 hour, TBR1b columns, while the negative control showed distinguishable

bars. This indicates the TBR1 gene is not present in either the 48 hour or the 96 hour embryos.

Our findings reveal that through methods of RT-PCR and gel electrophoresis, the brain

development gene TBR1 is not yet developed in embryos up to 96 hours old.

Introduction

There are seven periods of the development of the zebrafish, with the hatching of the

fish occurring at 72 hours; the development of the zebrafish begins in a zygote period. This

occurs in the first .2 hours to .75 hour marks, where the cytoplasm is directed toward the pole to

begin the formation of the blastodisc. The second period begins with the cleavage of the cells

and up to 64 cells developing in the first 2 hours. Between 2.5 and 5.25 hours the cells

accumulate and begin to form an epiboly in the Blastula period. The Gastrula period begins to

form a full ring and a full epiboly with a bud, occurring from hours 5.3 to 10. From hours 10-24,

the somites form, with 26 somites formed at the 24-hour mark. The Pharyngula period is when

the embryo starts to straighten out and is in high-pec form at 48 hours. The final period is the

hatching period between 48 and 72 hours and is when the fin and protruding mouth are formed.

Zebrafish are used as a model organism for development. There are some of the same

genes in zebrafish as there are in humans, therefore providing humans with insight into the
development of those similar genes. About 70 percent of the zebrafish genome is shared with

the human genome (Your Genome 2014). The zebrafish, however, have two copies of each

gene in comparison to the human gene having just a single copy. These copies are known as

gene A and gene B. There was a genome duplication approximately 400 million years ago that

resulted in having two copies of a single gene (Lab Manual Page 6). Having two copies of a

gene allows researchers to better analyze the genome.

Zebrafish provide a clear view of development since they are a transparent organism

during their larval stages. This entails that when the embryo is developing, the organs of the

zebrafish can be viewed just by looking under a microscope. The complete genome of the

zebrafish has been sequenced and published (Your Genome 2014). This allows for the

organism to be fully understood at a biological level based on their genes. Understanding the

full zebrafish genome lends researches the ability to create mutations in their genome and apply

that to how the human genome would be affected by similar mutations.

The focus of the paralogue is on the gene TBR1, also known as the T-Box Brain 1 gene.

This a protein coding gene located on T-Box binding domain that is essential for normal brain

development in the zebrafish. The presence of this gene is important for knowing those certain

regions of brain development are emerging and doing so properly. When this gene is present

during the embryotic development, it is an indicator that those normal brain developments are

starting or are in progress to start to occur.

The zebrafish genome has a TBR1a and a TBR1b gene, while the human genome has

one copy of this same gene. The TBR1 gene, along with the other genes in the T-Box domain

are all important in some sort of development of the brain. Mutations to this domain can result in

developmental syndromes and certain cancers. This gene and domain proved interesting in how

many areas, not only of the brain but of the body, that they can affect. For instance, researchers

have found that the T-box genes can affect the bodies stem cell populations (Papaioannou

2014).
 Techniques we used to analyze the TBR1 gene were developing primer pairs through a

program called Ensembl that allowed us to look at the zebrafish genome and develop primers

based off of DNA sequences. We then had to isolate the RNA from the zebrafish embryos using

a chromatography technique, in which the RNA is purified using RNAeasy technology. Once the

RNA that we needed was purified from all excess RNA we used a Nano-spectrometer to assess

the concentration of the RNA. Results for both copies A and B are indicated in Figure 2.

Next we ran Reverse Transcription- Polymerase Chain Reaction in order to generate

cDNA from the RNA and then adding the primers we designed to the cDNA. The primers adhere

to the specific areas of cDNA. We finally analyzed those specific regions, where the gene is

located, through gel electrophoresis. The gel electrophoresis gives us our final results of the

gene expression. This experiment was preformed to understand the development of zebrafish

and to more specifically look into the development of the gene TBR1 during the embryonic

periods of 48 and 96 hours in the zebrafish.

Methods and Materials

Primer Design

The initial step into analyzing our gene was to design the primers for that gene. The

purpose of the primers is to determine the specificity of the PCR process and to define the exact

locations of the gene on the DNA. We used a software program called Ensembl to access the

genome of the zebrafish. Once finding our specific gene, TBR1, we accessed the gDNA and the

cDNA sequences. The gDNA is the full genomic DNA of the gene and includes introns and

exons, while the cDNA is the complementary DNA and only contains the exons of the gene.

For locating the primers, we used the cDNA sequence since we do not want introns

when preforming PCR. A left and right primer are required for both A and B copies. The left

primer will adhere to one side of the sequence and the right on the other side to indicate the

gene on the DNA. We used a website to generate possible left and right primers and had to
analyze our cDNA sequences to determine the correct pairs (Butler 2012). Once we had a total

of two primer pairs, we ordered them to be used in the PCR part of our experiment.

RNAeasy (RNA isolation)

The isolation of the RNA is used to generate the total RNA from zebrafish at 48 and 96

hours. This total RNA is what we used to generate the cDNA from and then for use in the PCR

lab. Total RNA is all of the RNA in a cell and includes all the different kinds of RNA. The kit used

is RNAeasy purification technology that excludes RNA molecules that are under 200 base pairs

long and purifies those that are over 200 base pairs long. Those that are longer than 200 base

pairs adhere to a silica-based membrane. It was important to inactivate RNases, since they are

enzymes that cleave the RNA necessary to our experiment. A denaturing lysate buffer was used

to inactive the RNases and extra precautions were taken to ensure no RNases from the

environment were introduced into the sample.

The use of a spin column allows for the appropriate total RNA to attach to the

membrane. Our final step in the procedure was to use a Nano-spectrometer to obtain the

concentrations of each of the RNA for genes A and B. Once our total RNA was produced using

the RNA isolation procedure, it can be used to in the RT-PCR process to generate the cDNA

from the total RNA and then to amplify the specific gene. See Figure 1 for the RNA

concentration amounts.

RT-PCR

RT-PCR stands for Reverse Transcription-Polymerase Chain Reaction. The Reverse

Transcription is a separate process from the Polymerase Chain Reaction. This is used to obtain

the gene expression based on the presence of a specific mRNA encoded by that gene. Reverse

Transcription is a process used to generate complimentary, cDNA, from mRNA. The mRNA

needed is located in total RNA and the enzyme reverse transcriptase is used to produce the

cDNA. This is used as a template to generate the single stranded DNA. DNA polymerase is the
used to create the double-stranded DNA. The left and right primers are used to initiate the

reverse transcription.

Polymerase Chain Reaction, the second process in RT-PCR, is used to generate

multiple copies of the gene sequence. It is similar to DNA replication in the form of its

techniques. PCR requires DNA polymerase, this is used to make the DNA, nucleotides, primers

for the replication of the DNA, and buffer components. The primers consist of the left and right

primer set for the specific gene being assayed. The buffer components allow for the polymerase

to be active. The primers are used to anneal to the ends of the segment of the DNA in which the

gene is located. This is so that the DNA polymerase will specifically copy the region located

between the two primers.

There are three main steps to PCR, all of which involve a process of heating and cooling

to obtain the replicated DNA sequences. The first step in this process is the denaturation step,

which breaks the DNA hydrogen bonds, forming a single stranded DNA sequence. This step

uses high temperatures of 94 degrees Celsius for approximately 45 seconds to 1 minute to

break the bonds (Table 2). The second step in the annealing of the DNA primers to the single-

stranded DNA sequence. Both of the primers in the primer pair bind to their complimentary area.

Temperatures are lowered to between 50-60 degrees Celsius for approximately 45 seconds to 1

minute during this step to allow the annealing (Table 2). The final step of PCR is the elongation

of the DNA, where the DNA polymerase replicates the DNA multiple times based on the location

of the specific primers. Temperatures are set specific to be ideal for the replication. The

elongation temperature used was 72 degrees Celsius for approximately 1-2 minutes.

Gel Electrophoresis

Agarose gel electrophoresis is the final step of the zebrafish paralogue and is used to

produce the gene expression results. It is used to separate the PCR product of DNA sequences

from the rest of the macromolecules. Agarose gel separates molecules by size, therefore the

higher percentage of agarose allows for the smaller poors of DNA. The DNA is a negatively
charged sequence and therefore it will move towards the positive electrode during the

electrophoresis.

The buffer contains formulations that allow for conductivity and keeps the DNA soluble. It

also prevents the activity of nucleases. The loading buffer contains glycerol, to weigh the DNA

down and two tracking dyes. Migration of the dyes is dependent on the percentage of agarose.

The compound Ethidium Bromide is used to fluoresce the band on the agarose gel that contains

the DNA. This is used to observe the DNA because the EtBr intercalates in between the base

pairs. The gel chamber contains wells that the 9 tubes are placed into using pipets. The wells

will fluoresce once put under a UV light box if they are expressed at that time period (see Figure

2).

Results

Oligo Design

The results of the primer design lab were found using the cDNA and the gDNA of the

gene TBR1. There are primer pairs for both TBR1a and TBR1b, making a total of four primers.

The specific primers were located by looking at the cDNA. See Table 1 for the two primer pairs.

RNA Isolation

The RNA isolation lab produced the results of the concentrations of the total RNA of the

TBR1a and TBR1b genes. The concentration of TBR1a RNA was 0.032 l. The concentration of

TBR1b RNA was 0.022 l. TBR1a had a higher concentration of the total RNA than TBR1b,

meaning that TBR1b would have less cDNA generated than TBR1a. See Figure 1 for

concentrations of TBR1a and TBR1b.

Electrophoresis results

The results of each of the wells for the agarose gel electrophoresis lab were varied

among the primers. The first well is the ladder that is a positive control and indicates where all

the bands will be. Wells 2-4 contain the Beta Actin primers. Wells 5-7 contain the TBR1a
primers. Wells 8-10 contain the TBR1b primers. Wells 1,4, 7 and 10 do not contain RNA. Wells

2,5, and 8 contain 48-hour RNA. Wells 3, 6, and 9 contain 96-hour RNA. See Figure 2 for gel

electrophoresis image.

The fluoresce of the bands pertaining to their wells indicate that the gene in present at

that time. The B-Actin was our negative control since it actin is present in all time periods of the

zebrafish. We knew it was guaranteed to fluoresce at 48 and 96 hours. Since nothing was in the

first well, being the ladder, it did not fluoresce. The B-Actin bands showed bright fluorescence

indicating the genes presence. The bands of TBR1a, wells 5-7, did not fluoresce. Based off of

our positive control, this implies that the gene is not present at 48 or 96 hours. The bands of

TBR1b, wells 8-10, did not fluoresce as well. This signifies this gene was also not present at 48

or 96 hours. There was some slight fluorescence in the TBR1b bands, however, this did not

specify a clear presence of the gene.

Discussion

The importance of the results of the primer design are significant for the process of the

paralogue. They are the first step in establishing knowledge about the gene and are important

for the PCR steps. Without the primer pairs, the specific gene sequence would not be located

and pointed out during PCR.

The RNA isolation results concluded the importance of the concentrations of the total

RNA for both gene copies. The higher the concentration, the more DNA. Our concentrations

both seemed to be slightly low, however, there was still enough DNA to attribute to the RT-PCR

and then to specify the fluoresce of the genes with the gel electrophoresis. Knowing

concentration is important for understanding if there is enough total RNA for the RT-PCR and

gel electrophoresis to work and give proper final results of expression.

Results of the gel electrophoresis lab provide the final answer to the whole paralog study

of the zebrafish. The main questions of the whether or not TBR1a and TBR1b are expressed at

48 and 96 hours are answered by these results. The B-Actin bands indicated gene presence, as
expected. The was important for showing the procedure worked and for indicating that actin is

present in all stages of embryotic development. The bands of TBR1a and TBR1b both did not

show fluoresce. This is significant in understanding that this gene develops after 96 hours.

Due to the lab only having been performed once, these results cannot be conclusive to

whether TBR1 is present at 48 and 96 hours. Our results indicated it was not, however, further,

repeated experiments could provide different results. Further experiments could entail not just

the expression of the TBR1 gene, but possibly if some of the other T-Box genes are present at

48 and 96 hours and if so, how the relate to the lack of presence of the TBR1 gene.

On a larger scale is the relation of this gene in human development. Since both

zebrafish and humans share the TBR1 gene, knowing that it is not present in the first important

stages of the zebrafish and how that would relate to its presence in the first stages of humans is

significant. These results could indicate the gene does not show up in humans until later stages

and what that could mean for normal brain development. Further study of the presence of the

gene, among other T-Box genes in zebrafish could provide insight into how the gene functions

in humans and how important it is for regular functioning.

 Figures

Figure 1: RNA Isolation Concentration Images

a.

b.

Figure 1: The concentration of RNA in the TBR1a and TBR1b samples. Results of total RNA in

units of microliters. Image a. refers to the concentration of TBR1a at 0.032 l. Image b. refers to

the concentration of TBR1b at 0.022 l.

Figure 2: Agarose Gel Electrophoresis

Figure 2: This figure shows the results of the gel electrophoresis experiment. There are a total

of 9 filled wells. All wells except 1, 4, 7, and 10 contain RNA. Wells 2, 5, and 8 contain the 48-

hour RNA. Wells 3, 6, and 9 contain the 96-hour RNA. Wells 2-4 contain the B-Actin primers;

these are at the south of the figure. Wells 5-7 contain the Student Primer Set 1, which is the

TBR1a gene. Wells 8-10 contain the Student Primer Set 2, which is the TBR1b gene and these

are at the north of the figure. See Table 3 for a complete description of the wells. The B-Actin

wells are fluoresced indicating the presence of the gene. The TBR1a wells and TBR1b wells are

not fluoresced indicating no gene expression. The slight fluoresce of the TBR1b genes proves

insignificant for gene expression.

 Tables

Table 1: Primer Pairs

TBR1a TBR1b

Left Primer TAATTCTGGCGGATCCAAAC ATTGCTGTCACCGCATATCA

Right Primer GCTTCCAGCAACAACACTCA GACTGGTTCTTTCCTGCAGG

Table 2: RT-PCR Steps

PCR Table1 Step Temperature Time

(In Degrees)

1 Reverse 50 C 30 minutes

Transcription

2 Activation Step 95 C 15 minutes

3 Denaturation 94 C 45 sec- 1 minute

4 Annealing 50-60 C 45 sec- 1 minute

5 Elongation 72 C 1-2 minutes

Repeat 3-5 Cycling 30 cycles

6 Final Extension 72 C 10 minutes

7 Hold 4C As long as

needed
Table 3: Gel Electrophoresis Table

Well PCR Reaction Expected Product Observed Product

# Size Size

1 Kb Ladder

2 48 hpf RNA + B-Actin Primers 290 0

3 96 hpf RNA + B-Actin Primers 290 0

4 No RNA + B-Actin Primers 0 0

5 48 hpf RNA + Student Primer Set 1 205 0

6 96 hpf RNA + Student Primer Set 1 205 0

7 No RNA + Student Primer Set 1 0 0

8 48 hpf RNA + Student Primer Set 2 190 0

9 96 hpf RNA + Student Primer Set 2 190 0

10 No RNA + Student Primer Set 2 0 0

 References

Matt, C. Et. all. Molecular Cloning and Recombinant DNA Technology. Guide to Research

Techniques in Neuroscience. 2015: 219-237.

Butler, John M. PCR Amplification: Capabilities and Cautions. Advanced Topics in Forensic

DNA Typing: Methodology. 2012: 69-97.

Your Genome. Why use the zebrafish in research? Your Genome Facts: Animals and Plants.

2014.

Papaioannou, Virginia E. The T-box gene family: emerging roles in development, stem cells and

cancer. NCBI. 2014: 3819-3833.

The lab provided Lab Manual was a source for all four lab parts of the paralogue.