Food and Chemical Toxicology 111 (2018) 27–43

Contents lists available at ScienceDirect

Food and Chemical Toxicology

journal homepage: www.elsevier.com/locate/foodchemtox

Individual and combined effects of Fusarium toxins on apoptosis in PK15 T

cells and the protective role of N-acetylcysteine
Wei Zhanga, Shihua Zhanga, Meiling Zhanga, Lige Yanga, Baojing Chenga, Jianping Lia,b,∗,
Anshan Shana,∗∗
a
Institute of Animal Nutrition, Northeast Agricultural University, Harbin, 150030, PR China
b
Key Laboratory of Animal Common Disease Prevention, Northeast Agricultural University, Harbin, 150030, PR China

A R T I C L E I N F O A B S T R A C T

Keywords: Deoxynivalenol (DON), zearalenone (ZEN) and fumonisin B1 (FB1) are among the most toxicologically important
Deoxynivalenol Fusarium toxins commonly found in nature that lead to nephrotoxicity in animals. The present study investigated
Zearalenone that the individual and combined effects of subcytotoxic DON (0.25 μM), ZEN (20 μM) and FB1 (10 μM) on
Fumonisin B1 oxidative stress and apoptosis in porcine kidney cells (PK15). In addition, the protective effect of N-acet-
N-acetylcysteine
ylcysteine (NAC) against the toxicity of Fusarium toxins was also evaluated. Our results showed that the activities
PK15 cells
Apoptosis
of glutathione reductase (GR) and total superoxide dismutase (SOD) were affected by DON, ZEN and FB1, and
this change in activity induced reactive oxygen species (ROS) and malondialdehyde (MDA) production, in-
creased apoptosis and regulated the mRNA expression of Bax, Bcl-2, caspase-3, caspase-9, cytochrome c (cyto c)
and P53. This study demonstrated the complexity of combined mycotoxin infection since the combination of
toxins exhibited more profound defects in the oxidative stress responses and apoptosis. Moreover, NAC reduced
the oxidative damage and inhibited the apoptosis induced by Fusarium toxins. It was concluded that oxidative
damage and apoptosis through the mitochondria-dependent channel were the mechanisms of Fusarium toxin
mediated toxicity, and NAC reversed these damages to some extent.

1. Introduction
Mycotoxins are toxic secondary metabolites produced by a range of
fungi that can lead to numerous adverse health effects in animals and
humans (Wentzel et al., 2016). The Food and Agriculture Organization
of the United Nations (FAO) estimated that up to 25% of the world's
food crop is contaminated with mycotoxins. Aflatoxins, ochratoxins,
trichothecenes, zearalenone, fumonisins, tremorgenic toxins, and ergot
alkaloids are the mycotoxins of greatest agro-economic importance
(Hussein and Brasel, 2001). Among these mycotoxins, DON, ZEN and
FB1 are the most toxicologically important toxins that occur frequently
in food and animal feeds (Martins et al., 2006; Monbaliu et al., 2010;
Garrido et al., 2012).
DON is one of the most common Fusarium trichothecene mycotoxin.
This large family of toxins is generally associated with feed refusal,
vomiting, and lesions of the gastrointestinal tract in animals (Diaz,
2005). Pathophysiologic effects associated with DON include altered
neuroendocrine signaling, proinflammatory gene induction, disruption
of the growth hormone axis, and altered gut integrity (Pestka, 2010).
Moreover, DON significantly affects fetal development and the innate
immune system (Kinser et al., 2005; Collins et al., 2006; Pestka and
Amuzie, 2008).
ZEN is a Fusarium fungal metabolite with oestrogenic properties
(Diaz, 2005). Currently, studies not only focused on ZEN-induced le-
sions of the reproductive organs but also demonstrated the histo-
pathological damage, oxidative stress and inflammatory cytokines
production in pregnant animals and their offspring (Jia et al., 2015; Yin
et al., 2015; Zhang et al., 2015). In addition, intake of ZEN could induce
different degrees of hematotoxicity and negatively affects immune
function (Yang et al., 2016). In vitro studies showed that ZEN induced
obvious apoptosis in endometrial stromal cells (ESCs) via the Bcl-2 fa-
mily and caspases-dependent signaling pathway (Hu et al., 2016).
Fumonisins (FUM) can inhibit lipid synthesis in biological mem-
branes and cause a lethal condition, equine leucoencephalomalacia,
that is characterized by massive atrophy of the brain and sudden death
(Diaz, 2005). Swine are less sensitive to FUM, which is characterized by

∗
Corresponding author. Institute of Animal Nutrition, Northeast Agricultural University, Harbin, 150030, PR China.
∗∗
Corresponding author. Institute of Animal Nutrition, Northeast Agricultural University, Harbin, 150030, PR China.
E-mail addresses: dianjini2012@163.com (W. Zhang), 931048522@qq.com (S. Zhang), 1768385490@qq.com (M. Zhang), ylgpy123456@163.com (L. Yang),
63300674@qq.com (B. Cheng), ljpneau@163.com (J. Li), asshan@neau.edu.cn (A. Shan).

http://dx.doi.org/10.1016/j.fct.2017.10.057
Received 24 April 2017; Received in revised form 19 October 2017; Accepted 30 October 2017
Available online 07 November 2017
0278-6915/ © 2017 Elsevier Ltd. All rights reserved.
W. Zhang et al. Food and Chemical Toxicology 111 (2018) 27–43

pulmonary oedema. FB1 is a potent toxin which causes disorders in lipid Table 1
metabolism, renal filtration perturb, rhabdomyolysis and blood lym- Design matrix from three Fusarium toxins and NAC.
phocyte cell death (Kouadio et al., 2013). Moreover, FB1 causes brain
Group Treatment
hyperexcitability in vivo and mitochondrial dysfunction may represent
a potential underlying mechanism (Poersch et al., 2015). DON ZEN FB1 NAC
NAC, a well-known thiol antioxidant that acts as a glutathione 0.25 μM 20 μM 10 μM 0.5 mM
precursor and reacts with OH, NO2, CO3 (−), and thiyl radicals, is
1 – – – –
widely used in clinical practice (Samuni et al., 2013). It has anti-in- 2 + – – –
flammatory effects, impacts apoptosis and neurogenesis, and reverses 3 – + – –
models of mitochondrial toxicity (Asevedo et al., 2014). Supple- 4 – – + –
mentation with NAC (50 μM) resulted in significant cytoprotection, a 5 + + – –
6 + – + –
reduction in ROS generation, higher antioxidant levels that were similar 7 – + + –
to that of control cells and the inhibition of DNA strand breaks induced 8 + + + –
by hypoxia (Jayalakshmi et al., 2005). Moreover, NAC has protective 9 – – – +
effects against DNA damage and carcinogenesis (Flora et al., 2001). 10 + – – +
11 – + – +
DON, ZEN and FB1 are likely to damage the host simultaneously
12 – – + +
because of their co-occurrence in contaminated cereal grains. As the 13 + + – +
main excretory organ, the kidney may be exposed to high concentra- 14 + – + +
tions of the toxin after the ingestion of mycotoxin-contaminated food. 15 – + + +
Although some researchers have discussed the individual effects of 16 + + + +

DON, ZEN or FB1 in different in vitro models including intestinal porcine

epithelial cell lines (IPEC) (Dänicke et al., 2010), the Chinese Hamster
Ovary (CHO-K1) cell line (Ferrer et al., 2009) and both human and pig
lymphocytes (Mwanza et al., 2009). However, the reports on the
combined and interactive effects of DON, ZEN and FB1 on kidney cell
are limited. Therefore, this research aimed to investigate the individual
and combined effects of DON, ZEN and FB1 on the activity of anti-
oxidant enzymes, the level of MDA and ROS and the mRNA expression
of apoptosis-related genes in PK15 cells. In addition, the protective role
of NAC was investigated.
2. Materials and methods
2.1. Chemicals
+: Mycotoxin/NAC treatment.
−: No mycotoxin/NAC treatment.
then, 100 μl (0.5 mg/ml) of MTT solution was added to each well. After
a 4 h incubation at 37 °C, the MTT solution from each well was dis-
carded and 100 μl of DMSO was added to each well and shaken for
5 min to solubilize the formazan formed in the viable cells. The ab-
sorbance was measured at 570 nm using a GENios microplate reader
(Tecan Austria GmbH, Austria). The viability of the cells treated with
Fusarium toxins was expressed as a percentage compared to the control
(non-mycotoxin treated). From these data, subcytotoxic concentrations
were used for subsequent study. In addition, to assess the protective
role of NAC in Fusarium mycotoxins-induced cytotoxicity, NAC (0.5,
1.0, and 2.0 mM) was co-administered with DON, ZEN or FB1 for 24 h.

DON, ZEN, FB1, NAC, [3-(4,5-dimethylthiazol-2-yl)-2,5- diphe-

2.4. Inscribed central composite design for complete mixtures
nyltetrazolium bromide] (MTT) and dimethyl sulfoxide (DMSO) were
obtained from Sigma Aldrich (St. Louis, MO, USA). DON, ZEN and FB1
An inscribed central composite design including a fractional fac-
were dissolved in DMSO and NAC was dissolved in Dulbecco's modified
torial part was applied with four factors (DON, ZEN, FB1 and NAC) to
Eagle's medium (DMEM) containing high glucose (4.5 g/L) obtained
minimize the number of possible toxin combinations from 44 (all pos-
from GE Healthcare Life Sciences (Beijing, China). Fetal bovine serum
sible combinations of every concentration of each toxin/NAC) to 16.
(FBS) was obtained from Gibco-Life Technology (Eggenstein,
The design matrix is shown in Table 1. The cell viability was de-
Germany). The final concentration of the DMSO used as a solvent in the
termined by MTT assay as described above.
culture medium was 0.5%. All other chemicals were purchased from
Beyotime Biotechnology (Nantong, China).
2.5. Antioxidant enzymes activity assays
2.2. Cell culture
Cells were seeded at a density of 2.4 × 105 cells/well in 6-well
The porcine kidney cell line (PK15) was obtained from the Harbin plates and incubated for 24 h. Subsequently, cells were rinsed with PBS
veterinary research institute (Harbin, China). Cells were cultured in and treated as described in Table 1. After 24 h incubation, protein
DMEM supplemented with 10% FBS and 1% penicillin-streptomycin concentration and the activity of glutathione reductase (GR) and total
solution at 37 °C in a humid atmosphere of 5% CO2. Cells (2 × 105/ml) superoxide dismutase (SOD) were assessed using kits (Beyotime Bio-
were seeded in 5 ml of medium in a 25 cm2 flasks and cultured for 36 h. technology) according to the manufacturer's instructions. The results
Thereafter, the cultured cells were either passaged or used in experi- were expressed as U per mg protein.
ments. Cell monolayers were washed with phosphate-buffered saline
(PBS) and trypsinized with 1 × trypsin/EDTA. 2.6. Lipid peroxidation assay

2.3. Preliminary concentration–response experiment: cell viability assay by
MTT
The MTT assay was performed to assess cell viability (Mosmann,
1983). Cells were seeded at a density of 2000–4000 cells/well in 96-
well plates and incubated for 24 h. Subsequently, the cells were rinsed
with PBS and treated with Fusarium toxins (0.25–8 μM of DON,
5–160 μM ZEN and 5–160 μM FB1) in serum-free media for 24 h. At the
end of the incubation, the cells in each well were washed with PBS, and
The level of lipid peroxidation was measured via the 2-thiobarbi-
turic acid (TBA) color reaction for malondialdehyde (MDA) by using the
kit (Beyotime Biotechnology) according to the manufacturer's instruc-
tions. The results were expressed as nmol per mg protein.
2.7. Evaluation of ROS level
Cells were seeded at a density of 2.4 × 105 cells/well in 6-well
plates and incubated for 24 h. After treatment with or without Fusarium

28
W. Zhang et al. Food and Chemical Toxicology 111 (2018) 27–43

toxins or/and NAC for 24 h, the cells were rinsed 2 times using PBS and
incubated with 10 μM DCFH-DA at 37 °C for 20 min according to the
manufacturer's instructions. DCF fluorescence was detected by a
fluorescence microplate reader (Tecan Austria GmbH, Austria) at the
excitation wavelength of 488 nm and emission wavelength of 525 nm.
The level of ROS was expressed as a percentage of the controls.
least three independent experiments. The relative expressions of the
apoptosis-related gene mRNAs were determined with the 2-△△Ct
method (Livak and Schmittgen, 2001).
2.10. Western blotting

PK15 cells were seeded in 6-well plates and incubated for 24 h. After
2.8. Apoptosis status
the indicated treatment, cells were harvested, washed twice with ice-
cold PBS (pH 7.2) and lysed in ice-cold RIPA buffer containing complete
To analyze the cell apoptosis status, a double-staining assay with
protease inhibitors (PMSF). The lysate was centrifuged at 10,000 rpm
Annexin V-fluorescein sothiocyanate (FITC) was performed. After 24 h
for 10 min at 4 °C, and the supernatant was stored at −80 °C until
incubation with or without Fusarium toxins or/and NAC, the cells were
further analysis. Then equal amounts of lysate (protein samples) were
trypsinized and collected and then rinsed 2 times using PBS. Finally,
loaded onto polyacrylamide gels and transferred onto polyvinylidene
cells were resuspended in 195 μl of binding buffer. Then, 5 μl of
fluoride (PVDF) membranes (Millipore, USA). After blocking with 5%
Annexin V- FITC and 10 μl of propidium iodide (PI) were added to the
milk in TBS containing 0.05% Tween 20 at 37 °C for 2 h, the mem-
tubes that were then gently vortexed. Subsequently, the cells were in-
branes were incubated with the first antibody against targeted protein
cubated for 20 min at room temperature in the dark, and then 1 ml of
at 4 °C overnight. Followed by incubation with the corresponding sec-
binding buffer was added to each tube. Thereafter, the cells were
ondary antibodies (dilution, 1: 5000) for 1 h at room temperature.
analyzed by flow cytometry (Becton, Dickinson and Company,
Membranes were then exposed to a super enhanced chemiluminescence
America) at an excitation wavelength of 488 nm and emission wave-
(ECL) Plus detection system (P1010, Applygen, Beijing, China) and
length of 530 nm.
developed using a Kodak film cartridge and film. The expression of each
protein was normalized to that of β-actin. Antibodies against Bcl-2
2.9. Quantitative real-time PCR (D160117) and caspase-3 (D120074) were purchased from Sangong
Biotech Co., Ltd. (Shanghai, China).
The cells were seeded at a density of 1.2 × 105 cells/well in 12-well
plates and incubated for 24 h. After treatment with or without myco-
toxin or/and NAC for 24 h, the cells were rinsed 2 times using PBS and 2.11. Statistical analysis
collected. Total RNA was extracted from fresh cells by using TRIzol
(Invitrogen China, Shanghai, China) following the manufacturer's in- All experiments were performed at least three independent experi-
structions. The concentration of RNA was measured by using a ments. The statistical analysis was conducted using the Statistical
NanoPhotometer P-Class (IMPLEN, Germany). Total RNA was con- Product and Service Solutions software (SPSS Inc., Chicago, IL, USA),
verted into cDNA by the SYBR Premix Ex Taq kit (Takara, Dalian, and the data were expressed as mean ± SD. The significance of dif-
China) according to the manufacturer's instructions and used for RT- ference between two groups was analyzed by Student's t-test with
PCR. SYBR Green I RT-PCR kit (Takara, Dalian, China) was used to subsequent Bonferroni correction. IC50 and IC10 values were calcu-
measure the mRNA expression of apoptosis-related genes (P53, Bax, lated by using probit regression in SPSS 19.
cytochrome c, caspase-9, caspase-3 and Bcl-2), and the expression level
was expressed relative to the quantity of the β-actin endogenous con-
trol. As shown in Table 2, the primers were designed from published 3. Results
GenBank sequences and were synthesized by Sangon (Shanghai, China).
For analyses on an Applied Biosystems 7500 Real-Tine PCR thermal 3.1. Preliminary concentration–response experiment on cell viability
cycler apparatus (Applied Biosystems, Foster City, CA, USA), PCR re-
actions were performed with 1.0 μl of cDNA and 0.2 μl of each of the To determine the suitable experimental concentrations of Fusarium
primers in a final volume of 10 μl. PCR reactions were initialed at 95 °C toxins for subsequent interaction experiments, the cytotoxic effects of
for 30 s, followed by 40 cycles of denaturing at 95 °C for 5 s and an- the individual toxins on the PK15 cells was first determined by mea-
nealing at 60 °C for 34 s. All of the PCR reactions were performed at suring the cell viability (MTT assay) after incubation for 24 h in the
absence or presence of DON, ZEN or FB1. The results are shown in
Table 2 Fig. 1. DON, ZEN and FB1 reduced the cell viability in a dose-dependent
Primers used for qRT-PCR. manner with statistically significant effects observed at 0.25 μM, 20 μM
and 10 μM, respectively. The IC50 values by the MTT assay were
Genes Sequences (5′→3′) Fragments Accession
size (bp) number 2.08 μM, 210.7 μM and 196.1 μM for DON, ZEN and FB1, respectively.
IC10 values were 0.157 μM, 27.583 μM and 9.882 μM for DON, ZEN
β-actin FP:ATGCTTCTAGGCGGACTGT 211 AY550069 and FB1, respectively. Based on these results, subcytotoxic concentra-
RP:CCATCCAACCGACTGCT
tions close to IC10 of Fusarium toxins [DON (0.25 μM), ZEN (20 μM)
Bcl-2 FP: GCGACTTTGCCGAGATGT 116 AB271960.1
RP: CACAATCCTCCCCCAGTTC and FB1 (10 μM)] were chosen for the subsequent experiments. Cyto-
Bax FP: TTTGCTTCAGGGTTTCATCC 113 XM_ protective actions of NAC on cell death induced by Fusarium toxins were
003127290.3 investigated in the present study. As shown in Fig. 1D, when NAC (0.5,
RP: GACACTCGCTCAACTTCTTGG 1.0, and 2.0 mM) was co-administered with DON (0.25 μM), ZEN
Caspase-3 FP: TTGGACTGTGGGATTGAGAC 121 NM_214131.1
RP: TTCGCCAGGAATAGTAACCAG
(20 μM) or FB1 (10 μM) for 24 h, the cell death induced by Fusarium
Caspase-9 FP: GGACATTGGTTCTGGAGGATT 116 XM_ toxins was prevented in part by NAC (p < 0.05). However, the highest
RP: TGTTGATGATGAGGCAGTGG 013998997.1 NAC concentration (2.0 mM) did not show a greater protective role
P53 FP: CGAACTGGCTGGATGAAAAT 124 AF098067.1 when compared with 0.5 mM NAC. Therefore, 0.5 mM NAC was chosen
RP: GAAGGGACAAAGGACGACAG
to explore its protective role in PK15 exposed to Fusarium toxins in the
Cyto C FP: CTCTTACACAGATGCCAACAA 139 NM_
RP: TTCCCTTTCTCCCTTCTTCT 001129970.1 further study.

FP forward primer, RP reverse primer.

29
W. Zhang et al. Food and Chemical Toxicology 111 (2018) 27–43

Fig. 1. Effects of DON (A), ZEN (B) and FB1 (C) on cell viability and cytoprotective action of NAC (D). (A–C) The cells were exposed to DON (0.25–8 μM), ZEN (5–160 μM) or FB1
(5–160 μM) for 24 h. (D) The cells were incubated with DON (0.25 μM), ZEN (20 μM), FB1 (10 μM) and/or NAC (0.5, 1.0 and 2.0 mM) for 24 h. Cellular viability was determined by the
MTT test. The results are expressed as a percentage of the control. Bars represent mean ± SD of three parallel measurements. #, ##, ### means significantly different from controls at
p < 0.05, p < 0.01 and p < 0.001, respectively. * means statistical significance between cells cultured in the absence and presence of NAC. *p < 0.05.

3.2. Influences of Fusarium toxins and NAC on antioxidant enzyme
activities
3.2.1. GR activity
As shown in Fig. 2A, GR activity of DON treatment and mixture of
DON-ZEN, DON-FB1 and DON-ZEN-FB1 significantly decreased
(p < 0.01), and the lowest GR activity was observed in DON-ZEN-FB1
mix (3.69 ± 0.30 U/mg protein). The GR activity was significantly
lower in the mixtures of DON-ZEN and DON-FB1 relative to mycotoxins
individually (p < 0.05) (Fig. 2B and C). The results showed that the
GR activity of DON-ZEN-FB1 mix was significantly lower than that of
the mixtures of two Fusarium toxins (p < 0.05) (Fig. 2E). The reduction
in GR activity induced by DON-FB1 and DON-ZEN-FB1 was restored by
the treatment of cells with 0.5 mM NAC (Fig. 2F).
3.3. Influences of Fusarium toxins and NAC on lipid peroxidation
The results showed that the MDA level of 0.25 μM DON, 10 μM FB1
and all mycotoxin mixture treatments was significantly higher than that
in the control (p < 0.05), and the highest MDA level was observed in
DON-ZEN-FB1 mix (2.67 ± 0.12 nmol/mg protein) (Fig. 4A). For the
mixtures of two Fusarium toxins, the MDA levels were higher than in the
individual mycotoxin treatments (p < 0.05) (Fig. 4B–D). The MDA
level of DON-ZEN-FB1 was higher than mixtures of ZEN and DON or FB1
(p < 0.001). Treatment with 0.5 mM NAC significantly decreased the
MDA level in cells treated with 0.25 μM DON and DON-FB1
(p < 0.001) (Fig. 4F).
3.4. Influences of Fusarium toxins and NAC on ROS

3.2.2. SOD activity
As shown in Fig. 3A, the SOD activity of DON treatment and all
mixtures significantly decreased (p < 0.05), and the lowest activity
was observed in DON-ZEN-FB1 mix (14.34 ± 0.56 U/mg protein). It
has been noted that SOD activity was significantly lower in cells treated
with mixtures of DON-ZEN and DON-FB1 relative to the individual
mycotoxins treatments (p < 0.05) (Fig. 3B and C). The result showed
that the SOD activity of DON-ZEN-FB1 mix was significantly lower than
that of DON-FB1 and ZEN-FB1 mix (p < 0.001) (Fig. 3E). As shown in
Fig. 3F, the recovery of the reduced SOD activity by NAC supple-
mentation was only observed in the DON-ZEN-FB1 mixture (Fig. 3F).
In the present study, ROS production was monitored as an indicator
of oxidative stress. Intracellular ROS production was significantly in-
creased after 0.25 μM DON, 10 μM FB1 and the mixture of DON-ZEN,
DON-FB1 and DON-ZEN-FB1 treatments (p < 0.01) (Fig. 5A). The ROS
level of DON-ZEN was significantly higher in the groups treated with
mixtures of two Fusarium toxins than that of any of the individual
mycotoxins alone (p < 0.05) (Fig. 5B) and the ROS level of DON-FB1
was significantly higher than FB1 alone (p < 0.01) (Fig. 5C). In ad-
dition, in the mixture of three Fusarium toxins, the ROS level was sig-
nificantly higher than DON-FB1 mix (p < 0.01) (Fig. 5E). The increase
in ROS induced by 0.25 μM DON, 10 μM FB1 and DON-FB1 was restored
by the treating the cells with 0.5 mM NAC (p < 0.05) (Fig. 5F).

30
W. Zhang et al. Food and Chemical Toxicology 111 (2018) 27–43

Fig. 2. Individual and combined effects of DON, ZEN and FB1 and the protective role of NAC on GR activity in PK15 cells. Cells were exposed to individual or combinations of DON
(0.25 μM), ZEN (20 μM) and FB1 (10 μM) and NAC (0.5 mM) for 24 h. The results are expressed as U/mg protein. Each data point represents the mean ± SD of three measurements. #,
##, ### means significantly different from control at p < 0.05, p < 0.01 and p < 0.001, respectively (A). *, **, *** means significant differences between two connected treatments
at p < 0.05, p < 0.01 and p < 0.001, respectively (B–F).

3.5. Influences of Fusarium toxins and NAC on apoptosis mixture of these three Fusarium toxins, cell apoptosis was significantly
higher than in the DON-ZEN and DON-FB1 mix (p < 0.01) (Fig. 6E). As
Flow cytometry results showed that all treatments with mycotoxin shown in Fig. 6F, NAC could decrease the apoptosis induced by Fu-
significantly promoted cell apoptosis compared to the control sarium toxins to some extent.
(p < 0.05), and the highest cell apoptosis was observed in the DON-
ZEN-FB1 treatment (20.97 ± 0.40%) (Fig. 6A). Cell apoptosis in all
mixtures of two Fusarium toxins was significantly higher than that in the
individual mycotoxin treatments (p < 0.01) (Fig. 6B–D). And in the

31
W. Zhang et al. Food and Chemical Toxicology 111 (2018) 27–43

Fig. 3. Individual and combined effects of DON, ZEN and FB1 and the protective role of NAC on SOD activity in PK15 cells. Cells were exposed to individual or combinations treatments of
DON (0.25 μM), ZEN (20 μM) and FB1 (10 μM) and NAC (0.5 mM) for 24 h. The results are expressed as U/mg protein. Bars represent mean ± SD obtained from measurements
conducted in triplicate. #, ##, ### means significantly different from control at p < 0.05, p < 0.01 and p < 0.001, respectively (A). *, **, *** means significant differences between
two connected treatments at p < 0.05, p < 0.01 and p < 0.001, respectively (B–F).

3.6. Influences of Fusarium toxins and NAC on the apoptosis-related mRNA decreased the mRNA expression of Bax in the mycotoxin treatments to
expression some extent (Fig. 7F).

3.6.1. Bax 3.6.2. Bcl-2

Bax levels were significantly up-regulated in 0.25 μM DON, 20 μM
ZEN and all mycotoxin mixture treatments (p < 0.01) (Fig. 7A). In the
DON-ZEN and ZEN-FB1 treatments, the expression of Bax was sig-
nificantly higher than in the mycotoxin alone (p < 0.01) (Fig. 7B and
C). The expression of Bax was significantly increased in DON-FB1 mix
compared to FB1 alone (p < 0.001) (Fig. 7D). While, the Bax expres-
sion of DON-ZEN-FB1 was significantly higher than that of mixtures of
two Fusarium toxins (p < 0.05) (Fig. 7E). Treatment with 0.5 mM NAC
Contrary to Bax mRNA expression, Bcl-2 mRNA expression was
significantly lower in treatments of 0.25 μM DON, 20 μM ZEN and any
mixtures of Fusarium toxins compared to the control (p < 0.001)
(Fig. 8A). The expression of Bcl-2 was significantly lower in ZEN-FB1
mix relative to the groups treated with either of these two mycotoxins
alone (p < 0.001) (Fig. 8D). The expression of Bcl-2 was significantly
decreased in DON-FB1 mix compared to FB1 alone (p < 0.001)
(Fig. 8C). However, in the mixture of DON and ZEN, Bcl-2 expression

32
W. Zhang et al.
was significantly higher than DON alone (Fig. 8B). And the Bcl-2 ex-
pression noted in DON-ZEN-FB1 mix was significantly lower than DON-
ZEN, while higher than ZEN-FB1 (p < 0.05) (Fig. 8E). The reduction of
Bcl-2 expression induced by mixtures of DON-FB1 and ZEN-FB1 was
restored in the cells treated with 0.5 mM NAC (Fig. 8F).
3.6.3. Caspase-3
Treatments with any Fusarium toxins except FB1 alone also induced
a significant up-regulation in caspase-3 (p < 0.05) (Fig. 9A). The
highest expression of caspase-3 was observed in DON-ZEN-FB1
(1.75 ± 0.06) treated cells, and it was significantly higher than that of
any mixtures of two Fusarium toxins (p < 0.001) (Fig. 9E). In DON-
ZEN mix, the expression of caspase-3 was significantly higher than that
these two mycotoxin alone (p < 0.01) (Fig. 9B). The expression of
caspase-3 was significantly increased in DON-FB1 mix compared to FB1
alone (p < 0.05) (Fig. 9C). Treatment with 0.5 mM NAC significantly
decreased the mRNA expression of caspase-3 in DON-ZEN and DON-
ZEN-FB1 (p < 0.05) (Fig. 9F).
3.6.4. Caspase-9
Similar to caspase-3 mRNA expression, caspase-9 mRNA levels were
significantly higher after treatment with any individual or mixture of
Fusarium toxins (p < 0.05) (Fig. 10A). The highest expression of
33
Food and Chemical Toxicology 111 (2018) 27–43
Fig. 4. Individual and combined effects of DON, ZEN and
FB1 and the protective role of NAC on MDA production in
PK15 cells. Cells were exposed to individual or combina-
tions of DON (0.25 μM), ZEN (20 μM) and FB1 (10 μM) and
NAC (0.5 mM) for 24 h. The results are expressed as nmol/
mg protein. Each data point represents the mean ± SD of
three measurements. #, ##, ### means significantly dif-
ferent from control at p < 0.05, p < 0.01 and p < 0.001,
respectively (A). *, **, *** means significant differences
between two connected treatments at p < 0.05, p < 0.01
and p < 0.001, respectively (B–F).
caspase-9 was observed in the DON-ZEN-FB1 treatment (1.83 ± 0.11),
and it was significantly higher than groups treated with mixture of any
two Fusarium toxins (p < 0.01) (Fig. 10E). The expression of caspase-9
was significantly increased in DON-FB1 mix compared to DON alone
(p < 0.01) (Fig. 10C). Treatment with 0.5 mM NAC could significantly
decrease the mRNA expression of caspase-9 in 10 μM FB1 and DON-FB1
mix (p < 0.05) (Fig. 10F).
3.6.5. Cyto c
Compared to the control, cyto c mRNA levels were significantly up-
regulated in the 20 μM ZEN treatment and any mixture of Fusarium
toxins (p < 0.05) (Fig. 11A). The highest expression of cyto c was
observed in DON-ZEN-FB1 (2.41 ± 0.07), and it was significantly
higher than the expression in any of the mixture of two Fusarium toxins
(p < 0.01) (Fig. 11E). The expression of cyto c in DON-ZEN mix was
significantly higher than in the individual mycotoxin treatment
(p < 0.01) (Fig. 11B). The expression of cyto c significantly increased
in DON-FB1 mix compared to DON alone (p < 0.05) (Fig. 11C). The
expression of cyto c significantly increased in ZEN-FB1 mix compared to
FB1 alone (p < 0.01) (Fig. 11D). Treatment with 0.5 mM NAC sig-
nificantly decreased the mRNA expression of cyto c in DON-ZEN and
DON-ZEN-FB1 treatments (p < 0.05) (Fig. 11F).
W. Zhang et al.
3.6.6. P53
Treatments with 20 μM ZEN, 10 μM FB1 and any mixtures of
Fusarium toxins also induced a significant up-regulation of P53
(p < 0.01) (Fig. 12A). The P53 mRNA was significantly lower in DON-
ZEN mix relative to ZEN treatment alone (p < 0.001) (Fig. 12B). In
addition, the expression of P53 in the DON-FB1 treatment was sig-
nificantly higher relative to DON treatment alone (p < 0.001)
(Fig. 12C). Compared to the individual mycotoxin treatments, P53
mRNA expression in the ZEN-FB1 treatment was significantly up-regu-
lated (p < 0.001) (Fig. 12D). While, the P53 expression in the DON-
ZEN-FB1 treatment was significantly higher than DON-ZEN and DON-
FB1 (p < 0.01) (Fig. 12E). Treatment with 0.5 mM NAC could sig-
nificantly decrease the mRNA expression of P53 in DON-ZEN and ZEN-
FB1 (p < 0.05) (Fig. 12F).
3.7. Influences of Fusarium toxins and NAC on the Bcl-2 and Caspase-3
expression
To analyze the effect of Fusarium toxins and NAC on the expression
of Bcl-2 and Caspase-3, PK15 cells were treated with individual or
combined Fusarium toxins or/and NAC for 24 h followed by Western
blot analysis. Compare to control, all combined treatments and 0.25 μM
DON significantly increased Caspase-3 levels, while only 0.25 μM DON
and DON-ZEN-FB1 mix significantly decreased Bcl-2 levels (Fig. 13B
and H). And for the mixture of two Fusarium toxins, significant
34
Food and Chemical Toxicology 111 (2018) 27–43
Fig. 5. Individual and combined effects of DON, ZEN and
FB1 and the protective role of NAC on ROS production in
PK15 cells. Cells were exposed to individual or combina-
tions of DON (0.25 μM), ZEN (20 μM) and FB1 (10 μM) and
NAC (0.5 mM) for 24 h. The results are expressed as a
percentage of the control. Bars represent mean ± SD ob-
tained from measurements conducted in triplicate. #, ##,
### means significantly different from control at
p < 0.05, p < 0.01 and p < 0.001, respectively (A). *,
**, *** means significant differences between two con-
nected treatments at p < 0.05, p < 0.01 and p < 0.001,
respectively (B–F).
difference of Bcl-2 and Caspase-3 between individual and combined
toxin treatment were observed in DON-FB1 mix and DON-ZEN, re-
spectively (Fig. 13C–E and I–K). Treatment with 0.5 mM NAC could
significantly increase Bcl-2 expression in all mycotoxin treatments ex-
cept DON-ZEN-FB1 and decrease Caspase-3 expression in all mycotoxin
treatments except 10 μM FB1 (p < 0.05) (Fig. 13G and M).
4. Discussion
Fusarium toxins are extremely toxic to rapidly dividing cells leading
to hepatotoxicity, nephrotoxicity, neurotoxicity, immunotoxicity, and
reproductive toxicity in the hosts. Several researchers have discussed
the individual effects of DON, ZEN or FB1 using different in vitro models
including intestinal porcine epithelial cell lines (IPEC) (Dänicke et al.,
2010), Chinese Hamster Ovary (CHO-K1) cell line (Ferrer et al., 2009)
and human and pig lymphocytes (Mwanza et al., 2009). However, the
reports on the combined effects of DON, ZEN and FB1 on kidney cells
are limited. In the present study, we have shown the nephrotoxic ac-
tivity of DON, ZEN and FB1 using PK15 cell line.
4.1. Effects of Fusarium toxins and NAC on cell viability
Mycotoxin has been proven to be cytotoxic. Similar to those re-
ported by Kouadio et al. (2005), DON, ZEN and FB1 decreased the
viability of PK15 cells in a dose dependent manner. However, the
W. Zhang et al. Food and Chemical Toxicology 111 (2018) 27–43

Fig. 6. Individual and combined effects of DON, ZEN and FB1 and
the protective role of NAC on apoptosis in PK15 cells. Cells were
exposed to individual or combinations of DON (0.25 μM), ZEN
(20 μM) and FB1 (10 μM) and NAC (0.5 mM) for 24 h. The results are
expressed as percentage. Bars represent mean ± SD of three parallel
measurements. #, ##, ### means significantly different from
control at p < 0.05, p < 0.01 and p < 0.001, respectively (A). *,
**, *** means significant differences between two connected treat-
ments at p < 0.05, p < 0.01 and p < 0.001, respectively (B–F).

35
W. Zhang et al. Food and Chemical Toxicology 111 (2018) 27–43

Fig. 7. Individual and combined effects of DON, ZEN and FB1 and the protective role of NAC on relative expression of Bax mRNA of PK15 cells. Cells were exposed to individual or
combinations of DON (0.25 μM), ZEN (20 μM) and FB1 (10 μM) and NAC (0.5 mM) for 24 h. The results are expressed as a percentage of the control. Each experimental point represents
the means ( ± SD) obtained with four parallel cultures. #, ##, ### means significantly different from control at p < 0.05, p < 0.01 and p < 0.001, respectively (A). *, **, *** means
significant differences between two connected treatments at p < 0.05, p < 0.01 and p < 0.001, respectively (B–F).

sensitivity of different cells to the same mycotoxin was not the same. A
significant decrease in cell viability was observed after 24 h treatment
at DON concentrations of 0.25 μM, ZEN concentrations of 20 μM and
FB1 concentrations of 10 μM. In addition, the IC50 values by the MTT
assay were 2.08 μM, 210.7 μM and 196.1 μM for DON, ZEN and FB1,
respectively. These values were not completely consistent with previous
reports discussed below. One in vitro study indicated that the applica-
tion of DON concentrations of 500 ng/ml or higher decreased the via-
bility of intestinal porcine epithelial cells in a dose dependent manner
after 48 h and 72 h incubations (Diesing et al., 2011). The IC50 values
were estimated at 1.2, 1.3 and 3.0 μM for porcine peripheral blood
mononuclear cells (PBMC), IPEC-1 and IPEC-J2, respectively (Dänicke
et al., 2010). After ZEN treatment, cell proliferation was reduced in a
dose-dependent manner as attested by the MTT assay with different
IC50 values (100 μM on human hepatoma cells (HepG2), 79.40 μM on
CHO-K1) (Ayed-Boussema et al., 2008; Ferrer et al., 2009). After a 48 h
treatment of FB1, the viability of rat spleen mononuclear cells was
significantly decreased at 40 μM, and had an IC50 value of 230 μM
(Mary et al., 2012). The reason for these differences insensitivity to
DON, ZEN and FB1 among various animal species may be explained by
differences in the modes of action and the metabolic biotransformation
of these toxins (Wan et al., 2013). To study the effects of subcytotoxic
DON, ZEN and FB1 on cell injury, concentrations close to the IC10 of the
Fusarium toxins [DON (0.25 μM), ZEN (20 μM) and FB1 (10 μM)] were

36
W. Zhang et al. Food and Chemical Toxicology 111 (2018) 27–43

Fig. 8. Individual and combined effects of DON, ZEN and FB1 and the protective role of NAC on the relative expression in Bcl-2 mRNA of PK15 cells. Cells were exposed to individual or
combinations of DON (0.25 μM), ZEN (20 μM) and FB1 (10 μM) and NAC (0.5 mM) for 24 h. The results are expressed as a percentage of the control. Bars represent mean ± SD of four
parallel measurements. #, ##, ### means significantly different from control at p < 0.05, p < 0.01 and p < 0.001, respectively (A). *, **, *** means significant differences between
two connected treatments at p < 0.05, p < 0.01 and p < 0.001, respectively (B–F).

chosen for subsequent experiments.
Simultaneously, the cells were incubated with DON (0.25 μM), ZEN
(20 μM) or FB1 (10 μM) and NAC (0.5, 1.0 and 2.0 mM) for 24 h to
assess the cytoprotective effect of antioxidant NAC. The decreased cell
viability induced Fusarium toxins was significantly prevented by NAC
(Fig. 1D). Also, the 2.0 mM NAC did not shown a higher cell viability
than 0.5 mM NAC (p > 0.05), demonstrating that NAC should be at a
proper concentration for its positive role (He et al., 2012).
4.2. Effects of individual and combined Fusarium toxins and NAC on
oxidative stress
The extent of the oxidative damage on biomolecules reflects the
actual balance between pro- and antioxidant activities along with the
effectiveness of cell-damage repair mechanisms (Mary et al., 2012). To
the best of our knowledge, enzymes, comprising of GR and SOD, etc, are
a source of protection against oxidative stress. The GR enzyme works to
reduce GSSG to GSH to scavenge excess hydrogen peroxide and SOD
enzymes catalyze the dismutation of superoxide radical into hydrogen
peroxide (H2O2) and molecular oxygen (O2) and consequently present
an important defense mechanism against superoxide radical toxicity

37
W. Zhang et al. Food and Chemical Toxicology 111 (2018) 27–43

Fig. 9. Individual and combined effects of DON, ZEN and FB1 and the protective role of NAC on the relative expression of caspase-3 mRNA in PK15 cells. Cells were exposed to individual
or combinations of DON (0.25 μM), ZEN (20 μM) and FB1 (10 μM) and NAC (0.5 mM) for 24 h. The results are expressed as a percentage of the control. Bars represent mean ± SD of four
parallel measurements. #, ##, ### means significantly different from control at p < 0.05, p < 0.01 and p < 0.001, respectively (A). *, **, *** means significant differences between
two connected treatments at p < 0.05, p < 0.01 and p < 0.001, respectively (B–F).

(Assady et al., 2011). Our results showed that the treatments with in-
dividual DON and most mixtures could decrease the activities of GR and
SOD to different degrees, while the lowest observed in DON-ZEN-FB1.
Moreover, the GR and SOD activity of the combined toxin treatment
was lower than that of the individual toxin, except for ZEN-FB1, sug-
gesting that they had worse O2− radical scavenging ability. Similar
results correlating to antioxidative system activity induced by in-
dividual mycotoxin were also reported by other researchers (Dinu et al.,
2011; Li et al., 2014).
The generation of ROS is involved in important physiological
functions of aerobic organisms. However, the formation of ROS in ex-
cess, can lead to a disturbance in metabolic pathways, the depletion of
cellular antioxidants and damage to macromolecules, including DNA,
proteins and lipids, creating oxidative injury that results in the reduc-
tion of differentiation and proliferation or the promotion of the cell
death process (Ferrer et al., 2009). ROS include both free radicals, such

38
W. Zhang et al. Food and Chemical Toxicology 111 (2018) 27–43

Fig. 10. Individual and combined effects of DON, ZEN and FB1 and the protective role of NAC on relative expression of Caspase-9 mRNA in PK15 cells. Cells were exposed to individual or
combinations of DON (0.25 μM), ZEN (20 μM) and FB1 (10 μM) and NAC (0.5 mM) for 24 h. The results are expressed as a percentage of the control. Bars represent mean ± SD of four
parallel measurements. #, ##, ### means significantly different from control at p < 0.05, p < 0.01 and p < 0.001, respectively (A). *, **, *** means significant differences between
two connected treatments at p < 0.05, p < 0.01 and p < 0.001, respectively (B–F).

as superoxide (O2−), nitric oxide (NO) and hydroxyl radical (OH) and
other molecular species, such as hydrogen peroxide (H2O2) and per-
oxynitrite (ONOO-). ROS can induce peroxidation of membrane lipids.
The degree of oxidative damage to lipids is often estimated by mea-
suring the MDA levels, one of the peroxidation end-products. Our re-
sults demonstrated that individual DON and FB1 and almost all mix-
tures could significantly increase ROS and MDA production, and a
greater enhancement was observed in the combination treatments.
These are in agreement with some previous studies (Yang et al., 2014;
Stockmann-Juvala et al., 2004a, 2004b; Ferrer et al., 2009; Li et al.,
2014). These results strongly suggest that the ROS generation was due
to decreased antioxidant enzyme activities, which increased H2O2 le-
vels and membrane damage. In addition, the increases of MDA levels
might be due to the elevation of ROS level observed in our study. 10 μM
FB1 resulted in almost unchanged activities of GR and SOD but sig-
nificantly increased ROS and MDA generation, which was perhaps due
to the action of other enzymes in antioxidant system.
NAC is a well-established thiol antioxidant which can be used as
alleviate glutathione (GSH), which functions as a reactive oxygen in-
termediate scavenger (Nazıroğlu et al., 2014). High glucose levels
promoted apoptosis by affecting mitochondria-dependent caspase ac-
tivity through elevation of ROS production could also be reversed by

39
W. Zhang et al. Food and Chemical Toxicology 111 (2018) 27–43

Fig. 11. Individual and combined effects of DON, ZEN and FB1 and the protective role of NAC on relative expression of cyto c mRNA in PK15 cells. Cells were exposed to individual or
combinations of DON (0.25 μM), ZEN (20 μM) and FB1 (10 μM) and NAC (0.5 mM) for 24 h. The results are expressed as a percentage of the control. Bars represent mean ± SD of four
parallel measurements. #, ##, ### means significantly different from control at p < 0.05, p < 0.01 and p < 0.001, respectively (A). *, **, *** means significant differences between
two connected treatments at p < 0.05, p < 0.01 and p < 0.001, respectively (B–F).

the antioxidant NAC (Park et al., 2015). Our study showed that ad-
ministration of NAC tends to restore the porcine kidney cell peroxides
and ROS induced by partial Fusarium toxin, primarily in treatments of
larger difference. These results suggested that the combination of sub-
cytotoxic Fusarium toxin induced stronger oxidative stress, and some of
them could be relieved by NAC.
4.3. Effects of individual and combined Fusarium toxins and NAC on
apoptosis
To investigate whether DON, ZEN and FB1 impact PK15 cells death
process, we detected the level of apoptosis and the expression of genes
associated with apoptosis. Apoptotic cell death is a genetically pro-
grammed mechanism that allows the cells to commit suicide. It has
been reported that DON was able to induce apoptosis, which is ac-
companied by the up-regulation of apoptosis-related genes including
caspase-3, caspase-8, caspase-9, and AIFM1 in DF-1 cells (Li et al.,

40
W. Zhang et al.
2014). Moreover, it has been demonstrated previously that DON re-
duced the mitochondrial transmembrane potential, up-regulated the
concentrations of p53, Bax, and Bak-1, and down-regulated the con-
centrations of Bcl-2 (Bensassi et al., 2009, 2012; Ren et al., 2015). ZEN
was found to induce apoptosis in human leukemic HL-60 and U937 cells
via the endoplasmic stress and mitochondrial pathway such as the ac-
tivation of mitochondrial release of cyto c, transmembrane potential
reduction, activation of caspase-3 and -8, production of reactive oxygen
species and an altered expression level of 22 membrane proteins such as
apoptosis inducing factor and the endoplasmic reticulum (ER) stress
proteins including endoplasmic reticulum protein 29 (ERp29), 78 kDa
glucose-regulated protein, heat shock protein 90 and calreticulin
(Banjerdpongchai et al., 2010). Furthermore, p53 and JNK/p38 played
a key role in the ZEN induced cytotoxicity in mouse macrophage
RAW264.7 cells via apoptosis-inducing factor- (AIF) and ROS-mediated
signaling (Yu et al., 2011). For FB1, the increase in caspase-3 activity
preceding changes in the apoptotic index showed that the cytotoxic and
apoptotic effects on PK15 cells were in a concentration- and time-de-
pendent manner (Klarić et al., 2008). The involvement of the TNF
signal transduction pathway was another pathway of FB1 induced
apoptosis, and the tumor suppressor gene p53 was not required (Jones
et al., 2001). In this study, after treatments with Fusarium toxins, alone
or combined, significant increase in apoptosis were observed. In gen-
eral, all mycotoxin treatments up-regulated the mRNA expression of
41
Food and Chemical Toxicology 111 (2018) 27–43
Fig. 12. Individual and combined effects of DON, ZEN and
FB1 and the protective role of NAC on relative expression of
P53 mRNA in PK15 cells. Cells were exposed to individual
or combinations of DON (0.25 μM), ZEN (20 μM) and FB1
(10 μM) and NAC (0.5 mM) for 24 h. The results are ex-
pressed as a percentage of the control. Bars represent
mean ± SD of four parallel measurements. #, ##, ###
means significantly different from control at p < 0.05,
p < 0.01 and p < 0.001, respectively (A). *, **, ***
means significant differences between two connected
treatments at p < 0.05, p < 0.01 and p < 0.001, re-
spectively (B–F).
P53, Bax, Cyto c, Caspase-3 and -9 and down-regulated Bcl-2 mRNA
expression except FB1, although some differences were not significant.
The mRNA expression of Bax and Bcl-2 didn't change after treated with
10 μM FB1. Moreover, the protein expression of Bcl-2 in treatments of
DON, ZEN, DON-ZEN and DON-ZEN-FB1 decreased and Caspase-3
protein expression of all mycotoxin treatments increased to some ex-
tent. As Bcl-2 family member, Bcl-2 acts to inhibit cyto c translocation
and Bax is a potent proapoptotic molecule that, on translocation from
cytosol to mitochondria, triggers the activation of terminal caspases by
increasing mitochondrial membrane permeability and resulting in the
release of apoptosis-promoting factors, including cyto c. The release of
cyto c may trigger the interaction of Apaf1, a mammalian CED-4
homolog, and Caspase-9, which in turn results in the activation of
Caspase-9. Activated Casp9 then cleaves and activates pro-Caspase-3,
an event that leads to the cleavage of other death substrates, cellular
and nuclear morphological changes, and ultimately causes cell death (Li
et al., 1998). The tumor suppressor protein p53 is known to function as
a key player in mediating apoptosis through modulating the Bax to Bcl-
2 ratio and the regulation of mitochondrial ROS generation (Gosslau
et al., 2005). Taken together, our results suggested that Fusarium toxins
induced apoptosis through the mitochondria-dependent channel, and
Bcl-2 and Bax were not essential pathways for FB1 to induce apoptosis.
It has been suggested that NAC could inhibit apoptosis in some
systems. Anuradha et al. have reported that antioxidants NAC protected
W. Zhang et al. Food and Chemical Toxicology 111 (2018) 27–43

Fig. 13. Individual and combined effects of DON, ZEN and FB1 and the protective role of
NAC on protein expression of Bcl-2 and Caspase-3 in PK15 cells. Cells were exposed to
individual or combinations of DON (0.25 μM), ZEN (20 μM) and FB1 (10 μM) and NAC
(0.5 mM) for 24 h. This graphical representation also includes the relative density of
protein levels in PK15 cells, which were normalized to those of β-actin. Bars represent
mean ± SD obtained from measurements conducted in triplicate. #, ##, ### means
significantly different from control at p < 0.05, p < 0.01 and p < 0.001, respectively
(B and H). *, **, *** means significant differences between two connected treatments at
p < 0.05, p < 0.01 and p < 0.001, respectively (C-G and I-M).

the cells from loss of mitochondrial membrane potential and there was
no cytochrome c exit or Bcl-2 downregulation (Anuradha et al., 2001).
In the present study, NAC supplement reversed the Fusarium toxins-
induced apoptosis to a certain extent, particularly in treatments of
DON, FB1, ZEN-FB1 and DON-ZEN-FB1, although the difference was not
significant. For expression of genes associated with mitochondrial
apoptotic pathways, NAC partially regulated the change induced by
Fusarium toxin, most of which were combined toxins. These results were
consistent to those of oxidative stress.

5. Conclusion

In conclusion, the results of this study confirmed that individual and

combined Fusarium toxins induced different degrees of oxidative stress
response and apoptosis, with greater change in combinations and most
potent toxic effect in DON-ZEN-FB1 mix. The expression of mitochon-
drial apoptotic pathway-related genes species were regulated differen-
tially by Fusarium toxins, and these findings suggest that mitochondrial
pathway played an important role in Fusarium toxins induced apoptosis.
Moreover, NAC reversed the oxidative damage and apoptosis of
Fusarium toxins to some extent, especially in combinations. Overall,
these findings suggest that antioxidant such as NAC are important for
treating and preventing the toxicity of Fusarium toxins.

Conflict of interest

The authors declare no competing financial interests.

Acknowledgments

This work was supported by the National Key R & D Program

(2016YFD0501207), the China Agriculture Research System (CARS-35)
and the Key Laboratory of Animal Common Disease Prevention Open
Project of Heilongjiang Province (120103).

Transparency document

Transparency document related to this article can be found online at

http://dx.doi.org/10.1016/j.fct.2017.10.057.

References

Anuradha, C.D., Kanno, S., Hirano, S., 2001. Oxidative damage to mitochondria is a
preliminary step to caspase-3 activation in fluoride-induced apoptosis in HL-60 cells.
Free Radic. Biol. Med. 31, 367.
Asevedo, E., Mendes, A.C., Berk, M., Brietzke, E., 2014. Systematic review of N-acet-
ylcysteine in the treatment of addictions. Rev. Bras. Psiquiatr. 36, 168–175.
Assady, M., Farahnak, A., Golestani, A., Esharghian, M., 2011. Superoxide dismutase
(SOD) enzyme activity assay in Fasciola spp. parasites and liver tissue extract. Iran. J.
Parasitol. 6, 17.
Ayed-Boussema, I., Bouaziz, C., Rjiba, K., Valenti, K., Laporte, F., Bacha, H., Hassen, W.,
2008. The mycotoxin Zearalenone induces apoptosis in human hepatocytes (HepG2)
via p53-dependent mitochondrial signaling pathway. Toxicol. In Vitro 22,
1671–1680.
Banjerdpongchai, R., Kongtawelert, P., Khantamat, O., Srisomsap, C.,
Chokchaichamnankit, D., Subhasitanont, P., Svasti, J., 2010. Mitochondrial and en-
doplasmic reticulum stress pathways cooperate in zearalenone-induced apoptosis of
human leukemic cells. J. Hematol. Oncol. 3, 50.
Bensassi, F., El Golli-Bennour, E., Abid-Essefi, S., Bouaziz, C., Hajlaoui, M.R., Bacha, H.,
2009. Pathway of deoxynivalenol-induced apoptosis in human colon carcinoma cells.

42
W. Zhang et al.
Toxicology 264, 104–109.
Bensassi, F., Gallerne, C., El Dein, O.S., Lemaire, C., Hajlaoui, M.R., Bacha, H., 2012.
Involvement of mitochondria-mediated apoptosis in deoxynivalenol cytotoxicity.
Food Chem. Toxicol. 50, 1680–1689.
Collins, T.F., Sprando, R.L., Black, T.N., Olejnik, N., Eppley, R.M., Hines, F.A., Rorie, J.,
Ruggles, D.I., 2006. Effects of deoxynivalenol (DON, vomitoxin) on in utero devel-
opment in rats. Food Chem. Toxicol. 44, 747–757.
Dänicke, S., Hegewald, A.-K., Kahlert, S., Kluess, J., Rothkötter, H.-J., Breves, G., Döll, S.,
2010. Studies on the toxicity of deoxynivalenol (DON), sodium metabisulfite, DON-
sulfonate (DONS) and de-epoxy-DON for porcine peripheral blood mononuclear cells
and the Intestinal Porcine Epithelial Cell lines IPEC-1 and IPEC-J2, and on effects of
DON and DONS on piglets. Food Chem. Toxicol. 48, 2154–2162.
Diaz, D.E., 2005. The Mycotoxin Blue Book. Nottingham University Press.
Diesing, A.-K., Nossol, C., Panther, P., Walk, N., Post, A., Kluess, J., Kreutzmann, P.,
Dänicke, S., Rothkötter, H.-J., Kahlert, S., 2011. Mycotoxin deoxynivalenol (DON)
mediates biphasic cellular response in intestinal porcine epithelial cell lines IPEC-1
and IPEC-J2. Toxicol. Lett. 200, 8–18.
Dinu, D., Bodea, G.O., Ceapa, C.D., Munteanu, M.C., Roming, F.I., Serban, A.I.,
Hermenean, A., Costache, M., Zarnescu, O., Dinischiotu, A., 2011. Adapted response
of the antioxidant defense system to oxidative stress induced by deoxynivalenol in
Hek-293 cells. Toxicon 57, 1023–1032.
Ferrer, E., Juan-García, A., Font, G., Ruiz, M., 2009. Reactive oxygen species induced by
beauvericin, patulin and zearalenone in CHO-K1 cells. Toxicol. In Vitro 23,
1504–1509.
Flora, S. De, Izzotti, A., D'Agostini, F., Balansky, R.M., 2001. Mechanisms of N-acet-
ylcysteine in the prevention of DNA damage and cancer, with special reference to
smoking-related end-points. Carcinogenesis 22, 999–1013.
Garrido, C.E., Pezzani, C.H., Pacin, A., 2012. Mycotoxins occurrence in Argentina's maize
( Zea mays L.), from 1999 to 2010. Food Control 25, 660–665.
Gosslau, A., Chen, M., Ho, C., Chen, K.Y., 2005. A methoxy derivative of resveratrol
analogue selectively induced activation of the mitochondrial apoptotic pathway in
transformed fibroblasts. Br. J. Cancer 92, 513.
He, S.J., Hou, J.F., Dai, Y.Y., Zhou, Z.L., Deng, Y.F., 2012. N-acetyl-cysteine protects
chicken growth plate chondrocytes from T-2 toxin-induced oxidative stress. J. Appl.
Toxicol. 32, 980–985.
Hu, J., Xu, M., Dai, Y., Ding, X., Xiao, C., Ji, H., Xu, Y., 2016. Exploration of Bcl-2 family
and caspases-dependent apoptotic signaling pathway in Zearalenone-treated mouse
endometrial stromal cells. Biochem. Biophys. Res. Commun. 476, 553–559.
Hussein, H.S., Brasel, J.M., 2001. Toxicity, metabolism, and impact of mycotoxins on
humans and animals. Toxicology 167, 101–134.
Jayalakshmi, K., Sairam, M., Singh, S., Sharma, S., Ilavazhagan, G., Banerjee, P., 2005.
Neuroprotective effect of N-acetyl cysteine on hypoxia-induced oxidative stress in
primary hippocampal culture. Brain Res. 1046, 97–104.
Jia, Z., Yin, S., Liu, M., Zhang, Y., Gao, R., Shi, B., Shan, A., Chen, Z., 2015. Modified
halloysite nanotubes and the alleviation of kidney damage induced by dietary zear-
alenone in swine. Food Addit. Contam. Part A 32, 1312–1321.
Jones, C., Ciacci-Zanella, J.R., Zhang, Y., Henderson, G., Dickman, M., 2001. Analysis of
fumonisin B1-induced apoptosis. Environ. Health Perspect. 109, 315.
Kinser, S., Li, M., Jia, Q., Pestka, J.J., 2005. Truncated deoxynivalenol-induced splenic
immediate early gene response in mice consuming (n-3) polyunsaturated fatty acids.
J. Nutr. Biochem. 16, 88–95.
Klarić, M.Š., Rumora, L., Ljubanović, D., Pepeljnjak, S., 2008. Cytotoxicity and apoptosis
induced by fumonisin B1, beauvericin and ochratoxin A in porcine kidney PK15 cells:
effects of individual and combined treatment. Arch. Toxicol. 82, 247–255.
Kouadio, J., Moukha, S., Brou, K., Gnakri, D., 2013. Lipid metabolism disorders, lym-
phocytes cells death, and renal toxicity induced by very low levels of deoxynivalenol
and fumonisin b1 alone or in combination following 7 days oral administration to
mice. Toxicol. Int. 20, 218.
Kouadio, J.H., Mobio, T.A., Baudrimont, I., Moukha, S., Dano, S.D., Creppy, E.E., 2005.
Comparative study of cytotoxicity and oxidative stress induced by deoxynivalenol,
zearalenone or fumonisin B1 in human intestinal cell line Caco-2. Toxicology 213,
56–65.
Li, Honglin, Zhu, Hong, Xu, Chijie, Yuan, Junying, 1998. Cleavage of BID by caspase 8
mediates the mitochondrial damage in the fas pathway of apoptosis. Cell 94, 491.
Li, D., Ye, Y., Lin, S., Deng, L., Fan, X., Zhang, Y., Deng, X., Li, Y., Yan, H., Ma, Y., 2014.
Evaluation of deoxynivalenol-induced toxic effects on DF-1 cells in vitro: cell-cycle
arrest, oxidative stress, and apoptosis. Environ. Toxicol. Pharmacol. 37, 141–149.
43
Food and Chemical Toxicology 111 (2018) 27–43
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2− ΔΔCT method. Methods 25, 402–408.
Martins, H.M., Guerra, M.M., Bernardo, F., 2006. Zearalenone, deoxynivalenol and fu-
monisins in mixed-feed for laying hens. Mycotoxin Res. 22, 206.
Mary, V.S., Theumer, M.G., Arias, S.L., Rubinstein, H.R., 2012. Reactive oxygen species
sources and biomolecular oxidative damage induced by aflatoxin B1 and fumonisin
B1 in rat spleen mononuclear cells. Toxicology 302, 299–307.
Monbaliu, S., Poucke, C.V., Detavernier, C., Dumoulin, F., Velde, M.V.D., Schoeters, E.,
Dyck, S.V., Averkieva, O., Peteghem, C.V., Saeger, S.D., 2010. Occurrence of myco-
toxins in feed as analyzed by a multi-mycotoxin LC-MS/MS method. J. Agric. Food
Chem. 58, 66–71.
Mosmann, T., 1983. Rapid colorimetric assay for cellular growth and survival: application
to proliferation and cytotoxicity assays. J. Immunol. Methods 65, 55–63.
Mwanza, M., Kametler, L., Bonai, A., Rajli, V., Kovacs, M., Dutton, M.F., 2009. The cy-
totoxic effect of fumonisin B1 and ochratoxin A on human and pig lymphocytes using
the Methyl Thiazol Tetrazolium (MTT) assay. Mycotoxin Res. 25, 233–238.
Nazıroğlu, M., Şenol, N., Ghazizadeh, V., Yürüker, V., 2014. Neuroprotection induced by
N-acetylcysteine and selenium against traumatic brain injury-induced apoptosis and
calcium entry in hippocampus of rat. Cell. Mol. Neurobiol. 34, 895–903.
Park, J.H., Kang, S.-S., Kim, J.Y., Tchah, H., 2015. The antioxidant N-acetylcysteine in-
hibits inflammatory and apoptotic processes in human conjunctival epithelial cells in
a high-glucose environment effect of NAC on conjunctiva in a high-glucose en-
vironment. Invest. Ophthalmol. Vis. Sci. 56, 5614–5621.
Pestka, J.J., 2010. Deoxynivalenol: mechanisms of action, human exposure, and tox-
icological relevance. Arch. Toxicol. 84, 663–679.
Pestka, J.J., Amuzie, C.J., 2008. Tissue distribution and proinflammatory cytokine gene
expression following acute oral exposure to deoxynivalenol: comparison of weanling
and adult mice. Food Chem. Toxicol. 46, 2826–2831.
Poersch, A.B., Trombetta, F., Souto, N.S., de Oliveira Lima, C., Braga, A.C.M.,
Dobrachinski, F., Ribeiro, L.R., Soares, F.A.A., Fighera, M.R., Royes, L.F.F., 2015.
Fumonisin B1 facilitates seizures induced by pentylenetetrazol in mice. Neurotoxicol.
Teratol. 51, 61–67.
Ren, Z., Wang, Y., Deng, H., Deng, Y., Deng, J., Zuo, Z., Wang, Y., Peng, X., Cui, H., Shen,
L., 2015. Deoxynivalenol induces apoptosis in chicken splenic lymphocytes via the
reactive oxygen species-mediated mitochondrial pathway. Environ. Toxicol.
Pharmacol. 39, 339–346.
Samuni, Y., Goldstein, S., Dean, O.M., Berk, M., 2013. The chemistry and biological ac-
tivities of N-acetylcysteine. Biochim. Biophys. Acta Gen. Subj. 1830, 4117–4129.
Stockmann-Juvala, H., Mikkola, J., Naarala, J., Loikkanen, J., Elovaara, E., Savolainen,
K., 2004a. Fumonisin B 1-induced toxicity and oxidative damage in U-118MG glio-
blastoma cells. Toxicology 202, 173–183.
Stockmann-Juvala, H., Mikkola, J., Naarala, J., Loikkanen, J., Elovaara, E., Savolainen,
K., 2004b. Oxidative stress induced by fumonisin B1 in continuous human and rodent
neural cell cultures. Free Radic. Res. 38, 933–942.
Wan, L.Y.M., Turner, P.C., El-Nezami, H., 2013. Individual and combined cytotoxic ef-
fects of Fusarium toxins (deoxynivalenol, nivalenol, zearalenone and fumonisins B1)
on swine jejunal epithelial cells. Food Chem. Toxicol. 57, 276–283.
Wentzel, J.F., Lombard, M.J., Du, P.L., Zandberg, L., 2016. Evaluation of the cytotoxic
properties, gene expression profiles and secondary signalling responses of cultured
cells exposed to fumonisin B1, deoxynivalenol and zearalenone mycotoxins. Arch.
Toxicol. 1–18.
Yang, L., Yang, W., Feng, Q., Huang, L., Zhang, G., Liu, F., Jiang, S., Yang, Z., 2016.
Effects of purified zearalenone on selected immunological measurements of blood in
post-weaning gilts. Anim. Nutr. 2, 142–148.
Yang, W., Yu, M., Fu, J., Bao, W., Wang, D., Hao, L., Yao, P., Nüssler, A.K., Yan, H., Liu, L.,
2014. Deoxynivalenol induced oxidative stress and genotoxicity in human peripheral
blood lymphocytes. Food Chem. Toxicol. 64, 383–396.
Yin, S., Meng, Q., Zhang, B., Shi, B., Shan, A., Li, Z., 2015. Alleviation of zearalenone
toxicity by modified halloysite nanotubes in the immune response of swine. Food
Addit. Contam. Part A 32, 87–99.
Yu, J.-Y., Zheng, Z.-H., Son, Y.-O., Shi, X., Jang, Y.-O., Lee, J.-C., 2011. Mycotoxin
zearalenone induces AIF-and ROS-mediated cell death through p53-and MAPK-de-
pendent signaling pathways in RAW264. 7 macrophages. Toxicol. In Vitro 25,
1654–1663.
Zhang, Y., Gao, R., Liu, M., Shi, B., Shan, A., Cheng, B., 2015. Use of modified halloysite
nanotubes in the feed reduces the toxic effects of zearalenone on sow reproduction
and piglet development. Theriogenology 83, 932–941.