jae Ceten Food Agence canadienne Ingpection Agency inspection des aliments ATIP Services 140 Mervale Road, TH-0-149, Ortava, Ontaio KIAOYS December 21, 2017 Our File Number: A-2017-00161 / EB ‘Ms. Heather Clemenceau Dear Ms. Clemenceau, This refers to your request pursuant to the Access £o Information Act for copies of “REVISED TEXT as of August 24, 2017: A copy of the records released under file A-2017-00156 which is for: I am seeking records relating to a study commissioned by the CFIA and performed by Assistant Professor Robert Hanner of the University of Guelph about the speciation of sausages. I am requesting the identities on of the companies who manufactured the 100 sausages, the sausages brand names, which retail locations they were bought from and CFIA investigation records related to the 20 sausages that contained undeclared meat, including but not limited to the company that voluntarily shut down that had made a pork sausage that included horse meat. I would like the records in electronic form. SEER EEE HEE EEE HEE AMENDED REQUEST AS OF AUGUST 8, 2017: Recently the CFIA commissioned U of G to report on a sampling of meats found in various sausages. http://guelph.ctynews.ca/horse-meat-found-in-sausages-sold-at-grocery-stores- across-canada-1.3532863#_gus&_gucid=& gup=Facebook&_gse=ke90VKd I am requesting the following informatio 1) What method of analysis was used to determine species found in the sausages? 2) Were the meats sold nationally across Canada or exported also from Canada?” SEHEEE HEHEHE HE ORIGINAL REQUEST: Recently the CFIA commissioned U of G to report on a sampling of meats found in various sausages. http://guelph.ctynews.ca/horse-meat- found-in-sausages-sold-at-grocery-stores-across-canada- 1.3532863#_gus&_gueid=&_gup=Facebooké&_gse=ke9OVKd I am requesting the following information: What method of analysis was used to determine species found in the sausages? Serological, ELISA, Threshold Analysis, Quantitative, Qualitative, or something else? What brands of meat are selling these products? Were the meats sold nationally across Canada or exported also from Canada? T would like copies of emails that theorize whether the meats were mislabeled at the slaughterhouse or mixed with other meats at food processing companies or some combination of this.”, which was received on August 8, 2017. asl Canada2. Enclosed, please find the first interim release package of documents pertaining to your request. Portions of the information have been exempted under sections 16(2)(c), 19(1), 21(1)(@), and 21(1)(b) of the Access to Information Act. Copies of these sections are enclosed for your ease of reference. ‘There has been an application made to the Federal Court for a jud review of our decision to release some records under file A-2017-00156/EB. We are unable to disclose those records until the completion of that court proceeding. As such, some records which may be relevant to your request cannot be released at this time. We will advise you under separate cover as soon as that court proceeding is complete, and will forward to you at that time any additional records that may be released. We will keep your file on hold in our system until the completion of the court proce Please be advised that you are entitled to complain to the Information Commissioner concerning the processing of your request within sixty days of the receipt of this notice. In the event you decide to avail yourself of this right, your notice of complaint should be addressed to: Suzanne Legault, Information Commissioner Office of the Information Commissioner of Canada 30 Victoria Street Gatineau, Québec KIA 1H3 Should you have any questions, please communicate with Emily Blinn at (613) 773-5721 or by e-mail at emily.blinn@inspection.ge.ca. Sincerel EG Kerry Badgley Manager Access to Information and Privacy Encl,information. (@) the Auditor Generel of Canada; (b) the Commissioner of Official Languages for Canada; (©) the Information Commissioner, (6) the Privacy Commissioner 16.2 (1) The Commissioner of Lebbying shall refuse to disclose any record requested under this Actthat contains information tat was tbiained or created by the Commissioner or on the Commissioner's behalf in the course of an investigation conducted by or under the ‘authority of the Commissioner, 16.3 Subject to seotion 544 of the Canada Elections Act, the Chiaf Electoral Oficer may refuse to disclose any record requested under this Act thet contains information that was obtained or created by or on behalf of a person who conducts an investigation, examination or review ip the performance of their functions Under the Canada Elections Act. 2006, ¢:9,8, 145. (a) obtained or created by him or her or on his (or her behalf in the course of an investigation into a disclosure made under the Public Servants Disclosure Protection Act or an investigation commenced under section 33 of that Act; (b) received by a conciliator in the course of attempting to reach a settlement of a complaint filed under subsection 19,1(1) of that Act, 16.5 The head of a government institution shall refuse to disclose any record requested under this Act that contains information created for the purpose of making a disclosure under the Public Servants Disclosure Protection Act or in the course of an investigation into a dlisolosure under that Act. 2005, c. 48, 5. 58; 2006, c. 9, s. 221, 19(1) PERSONAL INFORMATION 19: (1) Subject to subsection (2), the head of a government institution shall refuse to disclose any record requested under this Act that contains personai information as defined in section 3 of the Privacy Act Where disclosure authorized (2) The head of a government institution may disclose any record requested under this Act thet contains personal information if Gendarmerie royale du Canada, si, ala demande de fa province ou de la municipalié, le gouvernement du Canada a consent ne pas divulguer ces renseignements. a) le vérificateur général du Canad: b) le commissaire aux langues officelles du Canada; ©) le Commissaire & Vnformation: 4d} le Commissaire a la protection de la vie privée. 116.2 (1) Le commissaire au lobbying est tenu de refuser de communiquer les documents qui ‘contiennent des renseignements cr8és ou ‘obtenus pat lui ou pour son compte dens fe cadre de touts enquéte faite par lui ou sous son autorité 16.3 Sous réserve de l'article 541 de la Loi lectorale du Canada, le directeur général des ‘ections peut refuser de communiquer les documents qui contiennent des renseignements créés ou obtenus par toute personne qui effectue un examen, une enquéte ‘ou une révision dans Nexercice de ses fonctions sous le régime de cette loi, ou pour son comple. 2006, ch. 9, arl. 145, 2) soit oréés ou obtenus par lui ov pour son compte dans le cadre de toute enquéte menée ur une divulgation faite au titre de la Lol sur fa protection des fonctionnaires divulgateurs Wactes répréhensibles ou de toute enquéte commancée au titre de Particle 33 de cette lal; b) solt recusillis par un conciliateur en vue d’en arriver & un réglement d'une plainte ééposée au titre du paragraphe 19.1(1) de catte loi 16.5 Le responsable ¢une institution fédéral est tenu de refuser de communiquer les documents qui contiennent des Tenseignements créés en vue de faire une divulgation au tire de la Loi sur la protection des fonctionnaires divulgateurs dactes répréhensibles ou dans le cadre d'une enquéte 'menée sur une divulgation en vertu de cette loi, 2005, ch. 46, art. 58; 2006, ch. 9, art. 221. 49(1) RENSEIGNEMENTS PERSONNELS 18. (1) Sous réserve du paragraphe (2), le responsable d'une institution féderale est tenu de refuser la communication de documents contenant les renseignements Personnels visés a l'article 3 de la Loi eur la(2) the individual to whom itretates consents to the disclosure; {b) the information is publicly available; or (0) the disclosure is in accordance with section B of the Privacy Act 21(1) OPERATIONS OF GOVERNMENT 21. (1) The head of a govemment institution may refuse to disclose any record requested under this Act that contains {2) advice or recommendations developed by ‘or for 2 government institution or 2 minister of the Crown, (b) an account of consultations or deliberations involving officers or employees of a government institution, a minister of the Crown ‘or the staff of a minister of the Crown, (€) positions of plans developed for the purpose of negatiations carried on or to be Cartied on by or on behalf of the Govemment of Canade and considerations relating thereto, or (d) plans relating to the management of personnel or the administraion of a government institution that have not yet been put into operation, protection des renseignements personnels. Cas out la divulgation est autorisée {2} Le responsable d'une institution fedérale peut donner communication de documents contenant des renseignements personne!s dans les cas ou : a) Vindividu quils concernont y consent; b) le pul ¢} la communication est conforme & latticle & de la Loi sur la protection des renseignements personnels. 24(1) ACTIVITES DU GOUVERNEMENT 21. (1) Le responsable d'une institution féderale peut refuser la communication de documents datés de moins de vingl ans lors de la demande et contenant : (@) des avis ou recommandations élaborés par ‘ou pour une institution fédérale ou un ministre; (0) des comptes rendus de consultations ou délibérations oli sont concernés des cadres ou ‘employés d'une institution fédérale, un ministre ‘ou son personnel; (c) des projets préparés ou dos renseignements portant sur des positions envisagées dans fe cadre de négociations menées ou a mener par le gouvernement du Canada ou en son nom, ainsi que des renseignements portant sur les considerations ui y sont liées; (@) des projets relatifs & la gestion du personne! ou a administration d'une institution {féderale et qui n’ont pas encore été mis en oeuvre, yaaceds;(let) cesasan oe, ence canadionn inspocon Agony es arvens 8.21(1}(b) PRM 018509 MOE THE PI IDENT & CUTIVE VICE-f SA IEAT AUTHENTICITY STUDY (For Information) PURPOSE To provide information on @ sausage meat authenticity joint study conducted by the Biodiversity Institute of Ontario (University of Guelph) and the CFIA. ‘SUMMARY * Following events for mislabeled ground meats and sausage meat found to be on the Canadian market, the CFIA engaged the Biodiversity institute of Ontario (BIO, University of Guelph) as part of the Federal Assistance Program (FAP) initiative conduct a study on the authenticity of sausage meat sampled at retail locations across Canada. +. Amanuscript has been prepared for publication in a peer-reviewed scientific journal describing the results of this study, a first report for this kind of food product in Canada. + The study determined an overall mistabelling rate of 20%, Minor levels of contamination were encountered in multiple products. BACKGROUND + Asa result of events of mistabelling of ground meat and prepared sausage products, a collaborative project under the auspices of the FAP and the Research Memorandum of Understanding of Guelph, Biodiversity Institute of Ontario (BIO), was undertaken to determine the levet of mislabelling of Sausage products in Canada. Canada ‘00005s.21(1)(b) 2 The CFIA initiated the project during Q4 of Fiscal Year 16-17 and all ‘sampling and testing of products were completed in advance of fiscal year end. A total of 100 sausage products were collected by samplers (at retail) under contract to the CFIA, in four major cities. A scientific manuscript describing the study and its findings has been prepared for submission to the journal Food Control, an Elsevier group publication which is an official scientific journal of the European Federation of Food Science and Technology (EFFoST) and the Intemational Union of Food Science and Technology (iUFeST). Operations, Policy and Programs, and Communications and Public Affairs have been consulted (see Transmittal Slip for IBD018415, enclosed). CURRENT STATUS The manuscript is at the final stages before submission to the Joumal by the lead investigators at the University of Guelph (UoG). Communications staff at both the UoG and the CFIA are Identified and meetings are scheduled to initiate development of media lines and Q's&A’s. This briefing package includes @ copy of the manuscript for your information. ISSUES There are four key findings from this investigation: ° ‘© Detection of horse meat in a single sample of pork sausage albeit ata low level. This finding could not’be followed up on as the firm has apparently ceased operation. Given concerns during the issue in Europe over horsemeat contamination in a wide variety of products as well as a burger contamination event in Montreal (Angus beef burgers contaminated with horse meat June 2016), there may be queries concerning this detection in sausage meal. Additional sampling in 2017 did not reveal any products contaminated with horsemeat, 13s21tVa) s.2t(t}tb) xs ‘© Minor levels of contamination in multiple products may be a more general concem with respect to labelling. Values above 1% would be considered to constitute adventitious contamination (based on Published literature) suggesting inadequate separation of inputs or cleaning of equipment between production runs. Values above 5% could be interpreted as deliberate adulteration. Two of 27 beef ‘sausage samples contained greater than 5% pork meat while five other samples contained between 1% and 5% pork. Similarly two of 38 samples of pork sausage contained between 1% and 5% beef meat. For poultry products, one sample of chicken sausage contained between 1% and 5% beef meat; four samples of chicken ‘sausage contained turkey meat (two samples with between 1% and 5% turkey; two samples with greater than 8% turkey). Options for responding to both the 2016 and 2017 survey results are being developed at the present time. © The overall mislabelling rate was 20% in this study. White higher than anticipated, mislabeliing in other studies and jurisdictions has ranged as high as 70%. CONSIDERATIONS ‘The CFIA and BIO are conducting a second round of sampling and testing now (started week of January 16, 2017): The issue of adultered food or food fraud is current as the Subway restaurant chain has been identified as using large amounts of soy in its chicken products (CBC Marketplace, see CBC.ca, March 1, 2017). The ‘CFIAVBIO co-publication could be seen as positive by the consuming public and media, and highlight to industry that the Government of Canada takes the issue seriously and is monitoring the situation proactively, As this is a research endeavour, no official results are reported. wl (0000079.24(t}a) Sears, .21(1}(0) Sencar A combination of proactive and reactive communications activities are recommended to highlight that new technologies, including DNA Barcoding, will allow the CFIA, industry and our partners to detect issues earlier, address the concems raised in the report, educate the public about food safety testing procedures used by the CFIA, raise awareness of the importance of food labelling, touching on food fraud and nutrition, and demonstrate that Canada has a relatively high level of compliance internationally. NEXT STEPS Proceed with BIO for preparation of Q’s&A's and Media Lines In anticipation of publication and pick-up by media outlets. Publication by the journal could be as early as June 2017. Continue to monitor results of the second round of testing and follow-up accordingly. All testing was completed by March 31, 2017. Preliminary results suggest issues with about 10% of products; largely at the grocery store/specialty butcher counter-level. Gne sample from a specially shop is problematic in that approximately 50% of the meat in the sample could not be identified and was distinct from the labelled species. SB is developing additional testing scenarios with BIO to identify the species. Primal Silva Enclosure(s) 00008Name! of originating officer: Cytif Lutze-Wallace Branch: Science Division/Directorate: Food Safety Science Directorate ‘Telephone number and extension: 613-773-5200 RDIMS ss): 9174451 Date: March 15, 2017 Name of Reviser: Juleen Green Date Revised: March 16, 2017 Minor Formatting Name of Reviser: Martine Sawvé Date Revised: March 17, 2017 ‘Minot Formating ‘Name.of Reviser: Juleen Green Date Revised: March 20, 2017 VP changes as requested RDIMS #9174151 v.48 Name of Reviser: Martine Sauvé Date Revised: March 31, 2017 President's office changes as raquestad RDIMS # 9174151 v.6 ‘Name of Revisor: Cyril Lutze-Wallace Date Revisod: Apdi 13, 2017 ‘Clarification of Considerations section RDIMS # 9174151 v.7 Name of Reviser: Cyril Lutze-Waltace Date Revised: April 27, 2017 Response to questions from President's Office ROIMS #9174181 v8 Name of Reviser: Cyril Lutze-Wallace Dale Revised: May 11, 2017 - Response to questions from Presidant’s Office ROIMS # 9174181 v.9 Name of Reviser: Cyt! Lutze-Wallace Date Revised: May 24, 2017 Response to questions from President's Office ROIS # 9174151 v.10 Name of Reviser: Cyl Cutze-Wallace Date Revised: June 8, 2017 Response fo questions from Preskdent’s Office RDIMS #9174151 v.11 Name of Roviser: Julven Groen Date Revised: June 8, 2017 Roformatting ROIMS # 9174151 v.12 90009s.A8(2}fe) Ses? Lutze-Wallace, Cyel (CFLAVACIA) 2017-06-12 1207 PM White, Jodi (CFAVACIA) Yehia, Rola (CFIA/ACIA) Subject: RE: Discussion Options for follow-up for sausage meat study Nelther have | (Lol)! Rick Hutfloetz cannot make itso it will be you (or Rola), Martin and myself. 1t might only be 30 minutes this week and another meeting next week. From: White, Jodi (CFIA/ACIA) Sent: 2017-06-12 12:05 PM ‘Ta: Lutze-Wallace, Cyril (CFIA/ACIA) ce: Rola (CFIA/ACIA) ‘Subject: RE: Discussion Options for follow-up for sausage meat study Hicyril, Rola Yehia indicated she can be our regular contact on this. | will try to defegate Thursday's meeting to her— haven't found that function yet in Outlook! Jodi ——Original Appointment —- From: Lutze-Waliace, Cyril (CFIA/ACIA) ‘Sent: 2017-06-12 10:30 AM To: Hutfloetz, Rick (CFIAVACIA); Appelt, Martin (CFIA/ACIA); White, Jodi (CFIAYACIA); Lutze-Weallace, Cyril (CFIA/ACIA) ‘Subject: Discussion Options for follow-up for sausage meat study ‘When: 2027-06-15 10:30 AM-11:30 AM (\JTC-05:00) Eastern Time (US & Canada). Where: 725-260 Good morning Re-booking with Outlook, hopefully tt reaches you all, Rick Hutfloetz: use my conference call line please. Neither Rick Grant or Jag Dhanda are available. 1-877-413-4788 conf code Cyril 00010DOL) PES Sibeten de nen — s.214t)(b) PRM 018509 MEMORANDUM TO THE PRES CUTIVE VICE-PRESIDE! SAUSAGE MEAT AUTHENTICITY STUDY (For Information) PURPOSE ‘To provide information on a sausage meat authenticity joint study conducted by the Biodiversity Institute of Ontario (University of Guelph) and the CFIA. SUMMARY + Following events for mislabeled ground meats and sausage meat found to be on the Canadian market, the CFIA engaged the Biodiversity Institute of Ontario (BIO, University of Guelph) as part of the Federal Assistance Program (FAP) initiative conduct a study on the authenticity __ of sausage meat sampled at retail locations across Canada. + Amahuscript has been prepared for publication in a peer-reviewed scientific journal describing the results of this study, a first report for this kind of food product in Canada. + The study determined an overall mislabelling rate of 20%, Minor levels of contamination were encountered in multiple products. BACKGROUND + Asa resuit of events of mislabelling of ground meat and prepared sausage products, a collaborative project under the auspices of the FAP and the Research Memorandum of Understanding of Guelph, Biodiversity Irstitute of Ontario (BIO), was undertaken to determine the level of mislabelling of sausage products in Canada. Canadil ‘00012S241) See 2 * The CFIA initiated the project during Q4 of Fiscal Year 16-17 and all Sampling and testing of products were completed in advance of fiscal year end. A total of 100 sausage products were collected by samplers (at retail) under contract to the CFIA, in four major cities. * _ Asscientific manuscript describing the study and its findings has been Prepared for submission to the joumsal Food Control, an Elsevier group Publication which is an official scientific joumal of the European Federation of Food Science and Technology (EFFoST) and the Intemational Union of Food Science and Technology’ (IUFoST). * Operations, Policy and Programs, and Communications and Public Affairs have been consulted (see Transmittal Slip for 1BD018415, enclosed). CURRENT STATUS * The manuscript is at the final stages before submission to the Journel by the lead investigators at the University of Guelph (UoG). Communications staff al both the UoG and the CFIA are identified and meetings are ‘Scheduled to initiate development of media lines and Q’s&A's, * This briefing package includes a copy of the manusoript for your information. ISSUES * There are four key findings from this investigation: ° © Detection of horse meat in a single sample of pork sausage albeit ata [ow level. This finding could not be followed up on as the firm has apparently ceased operation. Given concerns during the issue in Europe over horsemeat contamination in a wide variety of products as well as a burger contamination event in Montreal (Angus beef burgers contaminated with horse meai June 2016), there may be queries conceming this detection in sausage meat. ofB. 900013site) s.21¢1(0) & ‘©. Minor levels of contamination in multiple products may be a more general concem with respect to labelling. Values above 1% would be considered to constitute adventitious contamination (based on published literature) suggesting inadequate separation of inputs or cleaning of equipment between production runs. Values above 5% could be Interpreted as deliberate adulteration. Two of 27 beef sausage samples contained greater than 5% pork meat while five other samples contained between 1% and 6% pork. Similarly two of 38 samples of pork sausage contained between 1% and 5% beef meat. For poultry products, one sample of chicken sausage contained between 1% and 5% beef meat; four samples of chicken sausage contained turkey meat (two samples with between 1% and 5% turkey; two samples with greater than 5% turkey). co The overail mislabelling rate was 20% in this study. White higher than anticipated, mistabelling in other studies and jurisdictions has ranged as high as 70%. CONSIDERATIONS + The CFIA and BIO are conducting a second raund of sampling and testing now (started week of January 16, 2017) + The issue of adultered food or food fraud is current as the Subway restaurant chain has been idenitfied as using large amounts of soy in its chicken products (CBC Marketplace, see CBC.ca, March 1, 2017). The CFIAIBIO co-publication could be seen as positive by the consuming public and media, and highlight to industry that the Goverment of Canada takes the issue seriously and is monitoring the situation proactively. + Asthis is a research endeavour, no official results are reported. wl 00014s21(0Xa) s.21(1}(6) 4 ‘A combination of proactive and reactive communications activities are recommended to highlight that new technologies, including DNA Barcoding, will allow the CFIA, industry and our partners to detect issues earlier, address the concerns raised in the report, educate the public about food safety testing procedures used by the CFIA, raise awareness of the importance of food labelling, touching on food fraud and nutrition, and demonstrate that Canada has a relatively high level of compliance internationally. NEXT STEPS Proceed with BIO for preparation of Q’'s&A’s and Media Lines in anticipation of publication and pick-up by media outlets. Publication by the journal could be as early as June 2017. Continue to monitor results of the second round of testing and follow-up accordingly. All testing was completed by March 31, 2017. Preliminary results suggest issues with about 10% of products; largely at the grocery store/speciaity butcher counter-level. One sample from a specialty shop is. problematic in that approximately 50% of the meat in the sample could not be identified and was distinct from the labelled species. SB is developing additional testing scenarios with BIO to identify the species. Primal Silva Enclosure(s) 000015Name of originating officor Gye Lutza-Wallace Branch: Science Division/Ditectorate: Foad Safety Sclence Directorate Telephone number and extension: 613-773-£290 ROIMS Hs): 9174151 Date: March #6, 2017 ‘Name of Reviser:Juleen Green Date Revised: March 16, 2017 Minor Formatting Name of Roviser: Martine Sawvé Date Revised: March 17, 2017 Minor Formatting Namo of Reviser: Juleen Green Date Revised: March 20, 2017 ‘VP changes es requested ROIMS #9174151 vt Name of Reviser: Martine Save Date Revised: March 31, 2017 President's offce changes as requested RDIMS #9174161 v6 Name of Reviser: Cys Lutze-Wallace ‘Date Revised: April 13, 2017 Clarification of Considerations section ROIMS #9174951 v7 Name of Reviser: Cyl Lutze-Wallece Date Revised: April 27,2017 Response to questions from President's Office ROIMS #9174161 v8 Name of Reviser: Cyr Lutze- Wallace Date Revised: May 11, 2017 Response to questions from Presidents Office ROINS #9174151 v.9 Nama of Reviser: Cyr Lutze-Wallace Date Revised: May 24, 2017 ‘Response to questions irom President's Office ROIMS #9174151 v.10 ‘90016Grant, Rick (CFIA/ACIA) From: Sent: To: Subject: Attachments: Importance: Follow Up Flag: Flag Status: Hikevin Rick Grant 2017-05-24 11:19 AM Kevin Urbanic PRESO briefing BN - sausage meat authenticity study CCFIA_ACIA - #9174251 - v10 - PRM 018509 - BN to PresO re Sous 1.00¢ High Foltow up Flagged The sausage study willbe included in the Program Issues briefing tomorrow for the President. The attached BN indicates ‘that the two main non-compliance were followed up but is silent on the multiple samples with minor levels of ‘contamination, The BN points to SCL/ PP / OPS discussions planned for Q2-Q3 on how to proceed, Isitt safe to assume that the field has not (yet) made any adjustments in inspection approach or focus as there has not bbeen any change in Program Diraction? Inspection tasks already exist to verify industry controls for product formulations, labels, and cross-contamination so what would be needed by the inspectorate to cause change? From an (OPS branch perspective, are you comfortable with a status quo approach unti after the planned discussions take piace? Thanks Rick 00017()Se0) epeebonAgeney athopecton ces arene 5.24(4)(0) PRM 018609 MEMORANDUM TO THE PRESIDENT & EXECUTIVE VICE-PRESIDENT, SAUSAGE MEAT AUTHENTICITY STUDY {For Information) PURPOSE To provide information on a sausage meat authenticity joint study conducted by the Biodiversity Institute of Ontario (University of Guelph) and the CFIA. SUMMARY + Following events for mistabeled ground meats and sausage meat found to be on the Canadian market, the CFIA engaged the Biodiversity Institute of Ontario (BIO, University of Guelph) as part of the Federal Assistance Program (FAP) initiative conduct a study on the authenticity of sausage meat sampled at retail locations across Canada. + Amanuscript has been prepared for publication in a peer-reviewed scientific journal describing the results of this study, a first report for this kind of food product in Canada, + The study determined an overall mislabelling rate of 20%, Minor levels of contamination were encountered in multiple products. BACKGROUND + Asa result of events of mislabelling of ground meat and prepared sausage products, a collaborative project under the auspices of the FAP and the Research Memorandum of Understanding of Guelph, Biodiversity Institute of Ontario (BIO), was undertaken to determine the level of mislabelling of sausage produets in Canada. Canadii 00018s.24(4)(0) The CFIA initiated the project during Q of Fiscal Year 16-17 and all ‘sampling and testing of products were completed in advance of fiscal year end. A total of 100 sausage products were collected by samplers (at fetal) under contract to the CFIA, in four major cities. A scientific manuscript describing the study and its findings has been prepared for submission to the joumal Food Control, an Elsevier group Publication which is an official scientific journal of the European Federation ‘of Food Science and Technology (EFFoST) and the International Union of Food Science and Technology (IUFoST), Operations, Policy and Programs, and Communications and Public Affairs have been consulted (see Transmittal Slip for 1BD018415, enclosed). CURRENT STATUS The manuscript is at the final stages before submission to the Journal by the lead investigators at the University of Guelph (UoG). Communications staff at both the UoG and the CFIA are identified and meetings are Scheduled to initiate development of media lines and Q's8A’s. This briefing package includes @ copy of the manuscript for your information. ISSUES, There are four key findings from this investigation: ° © Detection of horse meat in a single sample of pork-sausage albeit at a low level. This finding could not be followed up on as the firm has apparently ceased operation. Given concems during the issue in Europe over horsemeat contamination in a wide variety of products as well as a burger contamination event in Montreal (Angus beef burgers contaminated with horse meat June 2016), there may be queries.conceming this detection in sausage meat. oonot9s2t¢iya) s.21(1)(0) 3 © Minor levels of contamination in multiple products may be a more general concem with respect to labelling. Values above 1% would be considered to constitute adventitious contamination (based on published literature) suggesting inadequate separation of inputs or ‘cleaning of equipment between production runs. Values above 5% could be interpreted as deliberate adulteration. Two of 27 beef ‘sausage samples contained greater than 5% pork meat while five other samples contained between 1% and 5% pork. Similarly two of 38 samples of pork sausage contained between 1% and 5% beef meat. For poultry products, one sample of chicken sausage contained between 1% and 5% beef meat, four samples of chicken sausage contained turkey meat (two samples with between 1% and 5% turkey; two samples with greater than 5% turkey). ‘© The overall misiabelling rate wes 20% in this study. While higher than anticipated, misiabelling in other studies end jurisdictions has ranged as high as 70%. CONSIDERATIONS +The CFIA and BIO are conducting a second round of sampling and testing now (started week of January 16, 2017) +. The issue of adultered food or food fraud is current as the Subway restaurant chain has been identified as using large emounts of soy in its chicken products (CBC Marketplace, see CBC.ca, March 1, 2017). The CFIA/BIO co-publication could be seen as positive by the consuming public and media, and highlight to industry that the Government of Canada takes the issue seriously and is monitoring the situation proactively. + Asthis is a research endeavour, no official results are reported. wels.24(t}fa) s.24(1}(8) 4 * - Acombination of proactive and reactive communications activities are recommended to highlight that new technologies, including DNA Barcoding, will allow the CFIA, industry and our partners to detect issues earlier, address the concerns raised in the report, educate the public about food safety testing procedures used by the CFIA, raise awareness of the importance of food labelling, touching on food fraud and nutrition, and demonstrate that Canada has a relatively high level of compliance internationally. NEXT STEPS * + Proceed with BIO for preparation of Q's&A’s and Media Lines in anticipation of publication and pick-up by media outlets. Publication by the journal could be as early as June 2017. * Continue to monitor results of the second round of testing and follow-up accordingly. Ali testing was completed by March 31, 2017. Preliminary results suggest issues with about 10% of products; fargely al the grocery store/specialty butcher counter-level. One sample from a specialty shop is problematic in that approximately 50% of the meat in the sample could not be identified and was distinct from the labelled species, SB is developing additional testing scenarios with BIO to identify the species. Primal Silva Enclosure(s) 00021Name of originating officer: Cyril tutze-Watlace Branch: Science Divislon/Directorate: Food Safety Science Directorate ‘Telephone number and extension: 613-773-5200 ROIMS #(5): 9174151 Date: March 15, 2017 Name of Roviser. Juleen Green Date Revised: March 16, 2017 Miner Formating Namo of Reviser: Martine Sauvé Date Revised: March 17, 2017 ‘Miner Formatting Name of Reviser Juleen Green Date Revised: March 20, 2017 VP changes as requested RDIMS ¥ 8174154 val Name of Reviser: Martine Sauvé Date Revised: March 31, 2097 President's offce changes as requested ROIMS #9174151 v5 Name of Reviser: Cyril Lutze-Wallace Date Revises: Apt 13, 2017 ‘Clarification of Considerations section RDIMS #9174461 v.7 Name of Reviser: Cyfi Lutze Wallace Date Revised: Apri 27, 2017 Rasponse to questions from President's Office ROIMS #9174151 v8 Name of Raviser: Cyril Lutze- Wallace Date Revieod: May 11, 2017 Response to questions ftom President's Office ROIMS #9174151 v9 Nama of Reviser: Cyl Lutze Wallace Date Revised: May 24, 2017 ‘Response to quastions from President's Office RDIMS #9174161 v.10 900022Grant, Rick (CFLA/ACIA) ‘Gyr Lutze-Wallace 2017-05-24 11:18 AM Rick Grant Re: Updated BN sausage paper Jan 25-2017.docx Follow Up Flag: Follow up Flag Status: Flagged Here is the manuscript. As for the briefing tomorrow, I believe Aline is handling it. >>> Rick Grant 2017-05-24 10:50 AM >>> Hi Oy ‘Thanks for this. Is it possible to fp me the manuscript? I did not make a copy when you circulated it few months ago. ‘What is the plan for the briefing tomorrow? The meeting appointment was delegated to me from Harpreet 0 I would like to know how this will unfold. From an OPS perspective, we can anticipate being asked if the non-compliant results were followed up. 1 do not recall how this was done. Rick, >>> Cyril Lutze-Wallace 2017/05/24 10:08 AM >>> Sorey T missed your call Rick, Please see the attached updated as of this morning. 900023Nowe wne 10 a 2 B 4 15 16 7 18 39 2 2 2 28 %6 7 Complementary molecular methods detect undeclared species in sausage products at retail markets in Canada Amanda M. Naaum™, Hanan R.'Shehata®™*, Shu Chen’, Jiping Li‘, Nicole Tabujara’, David Awmack’, Cyril Lutze-Wallace® and Robert Hanner** “Department of Integrative Biology, University of Guelph, Ontario, Canada *Biodiversity Institate of Ontario, University of Guelph, Guelph, Ontario, Canada “Microbiology Department, Faculty of Pharmacy, Mansoura University, Mansoura, Egypt “Laboratory Services Division, University of Guelph, Guelph, Ontario, Canada SCanadian Food Inspection Agency Food Safety Science Directorate, Science Branch, Ottawa, Ontario Corresponding author: Robert Hanner (rhanner@uoguelph. 0002428 29 30 31 22 33 34 35 36 7 38 39 40 a a2 44 45, 46 a7 48 49 50 st 52 53 Abstract Accurate food labelling is of utmost importance for food safety end consumer choice in the food chain, Complete or partial substitution, whether intentional or unintentional, may introduce food pathogens or allergens to a product. Beyond health impacts, substitution may also interfere with personal or religious beliefs. Processed meat products such as ground meat or sausage are maore prone to mislabeling of contents than other types of products, Several studies around the world have reported different degrees of species substitution in meat products but no similar studies have been conducted in the Canadian market for sausage products, In this study, 100raw meat sausage samples that were labelled as single meat species products were collected from retail establishments across Canada and were surveyed for the presence of a panel of non-labeled species. The sausage samples included beef, pork, chicken and turkey. Fits, the predominant meat species were determined using DNA barcoding by targeting the cytochrome oxidase subunit I (CON gene. All samples contained the predominant species matching the label species except for five turkey sausage samples which contained chicken es the predominant species, Second, contaminant or unclaimed meat species were detected using digital droplet PCR using species specific primers and probes. This analysis showed that 6% of beef sausages also contained pork, 20% of chicken sausages contained turkey and 5% contained beef, and 5% of pork sausages also contained beef. In the five turkey samples that contained chicken as the main ‘componenit, no turkey meat was detected. Furthermore, all samples were tested for horse meat using real-time PCR and one pork sample was found to contain horse meat, The overall ‘islabelling rate detected in this study was 20%. This isthe first survey of mistabelling of sausage products in Canada, Keywords: DNA barcoding, ddPCR, qPCR, meat mislabeling, sausage, meat species quantification 00002854 55 56 7 58 59 et 2 6 6a 6 66 67 68 69 70 m1 n a 74 1 76 ” 78 79 80 a1 82 83 Introduction “The accuracy of food labeling is an integral part of food safety and quality in the food chain. Species authenticity of sold products is an important component to ensure foad safety, authenticity and to support consumer choice, Substituted species, whether trace adventitious contaminants or a product of economically motivated adulteration (EMA), may introduce toxins, pathogens, or allergens into products (Spink & Moyer, 2011). Public safety measures and testing, procedures are put into place by regulatory agencies based on the declared product contents. Consumers may also choose products labeled free from certain species for personal or religious reasons. The availability of reliable testing methods helps to identify and address issues of ‘undeclared meat species. For example, the increased and improved testing for horse in meat produets throughout Europe has brought light to, and helped mitigate, one of the largest food scandals in recent history (O'Mahony, 2013). Food authenticity tests often target DNA as it can survive processing associated with many food products, in contrast to protein-dependent methods (Ballin, 2010). Various DNA-based methodologies can be employed to identify the component species of meat products. Studies of species identification of commercial meat products have been conducted using DNA based methods, in several countries including Thailand (Kitpipit, et al 2014), Turkey (Ulea, et al, 2013), Iran (Doosti, et al., 2014; Mehdizadeh, et al., 2014), the United States (Kane & Heliberg, 2016; Quinto, et al., 2016), South Africa (Cawthor, et al., 2013; D'Amato, et al, 2013), Spain (Rodriguez, et at., 2003), China (Cai, et al, 2014), Germany and the Netherlands Floren, et a., 2015; von Bargen, et al., 2014), the United Arab Emirates (Premanandh et al. 2013) and Ireland (O'Mahony, 2013) with a heavy focus on processed meat products like ground ‘meat or sausage where the opportunity for mislabeling is higher. These studies have revealed levels of mistabeling of up to 70%, where products are either wholly or partially substituted with species not listed on the label including pork, horse, chicken and others. Although there are examples where little to no mislabeling was found, products with undectared ingredients were found in almost all published studies. 0002685 86 a7 39 91 2 93 95 96, 7 100 101 02 103 108 105 106 107 208 109 110 mi 112 113 ua 415 DNA barcoding is one method that has particular promise for species identification in food (Galimberti, et al., 2013). For animals, this method consists of sequencing of a ~650bp fragment of the COI gene (Hebert, Ratnasingham, et al, 2003), While used successfully to identify mislabeling of meat products (D’ Amato, et al., 2013; Kane & Hellberg, 2016; Quinto, etal. 2016)), it cannot be reliably used on its own to identify species in mixtures and can only detect whole substitution, In addition, like other qualitative methods, it can only detect the presence of another species and not how much is present. This makes it difficult to differentiate trace contamination from the production process, which is almost impossible to eliminate, from a significant presence of undeclared species that may indicate EMA. However, the extensive availability of DNA barcode sequences for commercial and game meat species allows for development of other types of testing that require DNA sequence information for development of primers and probes. This includes droplet digital PCR, which can identify the presence of undeclared species from a mixture and also quantify the amount of that species, allowing separation of cases of adventitious presence from adulteration (Shehata et al., unpublished). Despite the fact that ingredient species must be listed in Canadian food, a market survey looking at incidence of mislabeling in sausage meat products has not been conducted. In this study, we provide a baseline for occurrence of species mislabeling in sausage products purchased on the Canadian market using a combination of DNA barcoding, digital PCR and real-time PCR. This tiered approach allows the identification of whole substitution, using DNA bercoding, as well as ‘destification of undeclared species from a panel of @PCR assays and one real-time PCR assay. ‘The €PCR approach also provides a measure of the level of adulteration to differentiate cases that are likely purposeful, from adventitious cases. The study focuses on four species commonly found in sausage: pork, beef, chicken and turkey. We also test for the presence of horsemeat. Materials and Methods Sample collection Samplers under contract to the Canadian Food Inspection Agency (CFIA) were utilised to collect total of 100 sausage samples in three major Canadian cities (Montreal n=40, Toronto n=25 and Calgary n=35) at various retsil locations. All sampling took place between January 17 and 4 ‘900027116 17 18 a9 120 aa we 123 124 125 126 127 128 129 120 131 132 133 134 135 136 137 138 139 140 uaa 142 143 144 145 146 February 25, 2016. Products were purchased from national grocery store chains, regional and local grocery stores, and speciality stores. Sausages contained only pork, beef, chicken or turkey as per package labels (Pork n=38, Beef n=27, Chicken n=20, and Turkey n=15)-and did not include more than a single source animal species as identified on the ingredients list, Wieners (“hot dog”), Vienna sausages and sausages containing cheese were excluded from the survey. ‘Sausages were raw, fresh or previously frozen, ready-to-cook, in casings that were pre-packaged, or partitioned in-store. No bulk sausage meat samples (without casings) were selected for this study. Digital images of labels and packaging were taken at the time of submission to the laboratory along with details of purchase, and submitted electronically to the CFIA office. Samples were shipped directly to the laboratory in coolers with cold packs. Ninety samples originated from Canada while five samples were imported from the USA and five samples were from unknown origin (Fable 1). Simple preparation and controls ‘The sausage samples were removed from casing, cut into ~ 1.0-1.5 em pieces, and then ~ 25-30 1g of representative sample pieces were homogenized in a Cuisinart® grinder for 3-5 minutes. “The grinder was cleaned and treated with 20% bleach to remove residual DNA between samples. ‘The homogenized samples were then used for DNA extraction. An artificial DNA fragment cloned into a plasmid was used as an intemat control to monitor ddPCR procedures (Shehata et al,, unpublished), For d4PCR, pure bovine, pork, chicken and turkey muscle meat tissues were used as reference materials. For each of the four meat species, five representative single meat species sausage samples, as verified by DNA barcoding and species-specific ddPCR assays, were pooled to establish calibration curves between ddPCR ovtpot (copies) and DNA amount (ng) ia sausages. Fortified samples with known concentrations of the targets were used as positive controls. A fish tissue sample, reagent blank and sterile water were used as negative controls. DNA extraction ‘A representative portion (~500 mg) of each homogenized sausage sample was used for DNA. extraction. Genomic DNA was extracted using DNeasy Blood and Tissue® Kit (Qiagen, Mississauga, ON) according to the manufacturer's protocol for “Purification of Total DNA fom Plant/Animal Tissue”. DNA concentrations and quality (Azsoan and Aztons) Were determined 00028147 148 14g 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 wa 72 173 174 ws 176 uw using both NanoDrop ND-2000 UV-Vis Spectrophotometer (Thermo Fisher Scientific, Ottawa, ON) and Qubit® Fluorometer with the Qubit® dsDNA BR Assay Kit (Thermo-fisher Scientific). ‘The DNA samples were diluted to 10-20 ng/L, and then were either tested directly or were frozen at -20°C for testing at a later date. Identification of the predominant meat species using DNA barcoding Primers (Table 2) targeting the mitochonérial cytochrome oxidase subunit 1 (COD) gene were designed using the PrimerQuest Tool (htps:/Avenw.idtdna.conv/Primerquast/Home/index). Each PCR reaction mix (25 uL) contained 1x HotSturTaq Master Mix (Qiagen), 0.5 uM of each of the primers (COt-animal-F4 and COL-animal-R716) (Table 2), 0.15 yg of BSA and 20-40.ng of template DNA. PCR thermal cycling was conducted using a GeneAmp™ PCR System 9700 (Applied Biosystems, Foster City, CA). ‘The PCR eyeling conditions were 95°C for 15 min, 40 cycles of 94°C for 20 sec, 52°C for 20 sec and 72°C for I min, followed by 72°C for 7 min. To confirm successful amplification of target gene, PCR products were visualized on 2% agarose gels. PCR products were then purified using NucleoFast® 96 PCR clean-up kit according to the manufacturer's protocol (Macherey-Nagel, Duren, Germany). The purified PCR fragments were sequenced bidirectionally with the same primers as for PCR using an ABI 3730 Genetic Analyzer (Applied Biosystems). The rettoved sequences were analyzed using ABIPrism™ Sequencing Analysis software (Applied Biosystems) to obtain a single high quality consensus sequence for each sample (Q>20 and length > 650 bp), The consensus sequences were queried ‘gniast the Barcode of Life Data (BOLD) species ID engine and were queried against NCBI GenBank using BLASTN to get the taxonomic identification. Positive tissue samples with confirmed ferget animal species) and negative (reagent blank) controls were included and analyzed with each batch of test samples, Detection and quantification of contaminant or unclaimed meat species using droplet digital polymerase chain reaction (ddPCR) Species-specific primers and probes (Table 2) were used to amplify mitochondrial DNA sequences of the bovine, porcine, chicken and turkey genomes based on the 5*-nuclease assay chemistry. Where applicable, primers and probes were designed using the Primer Express Software v3.0.1 (Applied Biosystems). The probes were labeled with 6-carboxyfluorescein (6-178 179 180 1e1 182 183 184 185 186 187 188 189 190 aot 192 193 194 195 196 197 198 199 200 201 202 203, 204, 205 206 207 208 FAM) as the reporter for the animal species targets or with CAL Fluor Orange for the internal control, and BHQ-1 as the quencher. Bach PCR reaction mix (25 L/reaction) contained 1x ddPCR Supermix for Probe (Bio-Rad, Mississauga, ON), 96 nM each of the primers and 64 nM probe for the animal targets, 40 nM each of the primers and 32 nM probe for the internal control and 50-80 ng of template DNA. QX200 Droplet Generator (Bio-Rad) was used to generate PCR ‘droplets where 20 uL from each PCR reaction mixture were mixed with 70 pI. of droplet generation oil (Bio-Rad) in a DGS Cartridge; and 40 uL from each droplet mix were then transferred to a 96-well PCR plate (Bio-Rad). The plate was sealed with a foil heat seal using, Px1™ PCR plate Sealer (Bio-Rad). The GeneAmp™ PCR System 9700 (Applied Biosystems) was used for thermal cycling. The PCR reaction conditions used were initial denaturation at 95°C for 10 min, followed by 48 cycles of 20 s at 95°C and 40 s at 59-60°C, followed by final extension at 98°C for 10 min, and thea a holding step at 10°C until reading, Each PCR reaction ‘was run in duplicate. When the PCR was complete, the QX200™ Droplet Reader (Bio-Rad) was sod to read the amplification signals, and QuantaSot software (Bio-Rad) was used to analyze the data, The data wore then recorded as copies/uL and then converted into % by DNA mass based on copy numbers obtained from pools of 5 representative sausage types for each of the ‘sausage meat species (Figure 1). Positive and negative controls were inctded for testing with cach batch of samples. Results were accepted only if all QC had passed. Real-time PCR for detection of horse For all samples, extracted DNA was tested for the presence of horse meat using the InstantLabs Horse Real-Time PCR kit (InstantLabs, Baltimore, USA), which included both a probe for detecting horse meat and an intemal control to monitor reaction success. For initial tests on all samples, manufacturer instructions were followed for real-time PCR, with the exclusion of the DNA extraction steps. Samples that initially tested positive were re-tested in triplicate starting from the tissue sampling stage. Samples were run on the Cepheid Smart Cycler Il system according to cycling parameters suggested by the manufacturer of the horse meat kit. ‘900030209 210 24 22 213 au 215 216 217 218 aig 20 221 22 223 224 225 226 227 228 229 230 231 232 233 234 235, 236 237 238 239 ‘See Sree Results and Discussion A total of 100 raw meat sausages were tested for the predominant meat species using DNA barcoding based on COI gene sequences and also for potential contamination with other meat species mixed with the claimed species on the labels using ddPCR assays for bovine, chicken, porcine and turkey meats (Supplementary Table 1). A cut-off value of 1% (by DNA/mass) was used to distinguish the samples where undeclared species detection may be due to adventitious contamination rather than purposeful substitution. Where the quantity of undeclated species was more thar 1%, two ranges (1%-5% and more than 5%) were used to identify the proportion of the sample containing these species. Providing ranges, rather than exact percentages, helped to 1itigate some of the potential issues related to copy number in different tissue types that may arise when using a mitochondrial marker for quantification (Floren, ct al, 2015). Generally, a Proportion of more than 1% undeclared species may indicate some breakdown in proper production or purposeful adulteration, rather than trace contamination (Premanandh et al. 2013). All sausage samples labelled as beef, chicken or pork (total n=85) contained the predominant species matching the label on the sample packages. For turkey sausage (n=15), ten samples contained turkey as the predominant meat species while five samples contained chicken as the predominant species. Out of 100 sausage samples, 95% contained the predominant species ‘matching the label (Table 4). All 100 raw meat sausages were also tested for potential contamination with other meat species mixed with the claimed species on the labels using aaPCR assays for bovine, chicken, porcine and turkey meats. From 27 beef sausages, seven samples also contained pork. Two of these contained more than 5% pork. From 20 chicken sausages, four contained turkey and one sample contained beef, Two out of the 38 pork sausages were mixed with beef. Overall, the rate of mislabeliing of 20% was similar to another study of ground meat products in North America (Kane & Hellberg, 2016) and showed that undeclared meat species are present in 4 significant percentage of products in the Canadian market, Our results suggest that the vast majority of products contain mostly the declared species. This is encouraging, but even small ‘amounts of undeclared species can have potential human health implications. For example, the g 200031240 241 242 243 245 246 207 248 249, 280 254 252 253 254 255 256 287 258 259 260 261, 262 263 264 265 266 267 268 269 270 presence of beef in one chicken and two pork products was unexpected as beef is a more expensive meat. This could mean thet “waste” beef products that may not otherwise be consumed are being introduced 2s a cheap addition to these sausage products. Altematively, it could mean that insufficient cleaning between grinding of different meats is occurring. Rither ‘way this could represent 4 means for pathogens to enter the food supply as beef products, particularly by-product, would be subject to different screening, specifically soreening for E. colt 0157:H7. In the event ofa recall, products where beef is present, but undeclared, would not be removed from sale, presenting another potential health risk, In addition, a third of turkey produets were found to be wholly substituted with chicken. The price of ground turkey in Canada for 2016 was more than that for ground chicken, suggesting that these instances of substitution may be economically motivated or that a gross mistabelling event occurred during production or packaging. One of the major drivers for testing for the presence of unlabeled pork is due to religious ‘concerns. For example, a number of studies have focused on identifying the presence of pork in Halal products, which is 2 concern to some religious communities (e.g: Nakyinsige, etal., 2012). In this study, 6% of the beef samples collected contained pork, confirming that this is an ongoing issue that requires monitoring. Interestingly, elthough chicken was found to be a common ‘undeclared ingredient in beef and pork products tested in other studies (Cawthom, et al., 2013; Mehdizadch, et al., 2014; Ulea, et al. 2013), we found no examples of undeclared chicken or turkey in non-poultry products. Though rare, allergies to poultry meat have been deseribed (Zacharisen, 2006), so the absence of evidence of poultry in beef or pork products is encouraging, Finally, horse was also detected in one sample of pork sausage among the 100 sausage samples analyzed in this study. This result was confirmed after multiple real-time PCR tests of original DNA extract and of new DNA extracts taken from homogenized new tissue samples from the original sausage sample. Additional testing using an independent traditional PCR assay also confirmed the result (results not shown). According to Canadian regulations, horse can be sold for human consumption but must be labeled on packages as with other ingredients. 00032an 272 273 274 275 276 ca 278 279 280 281 282 283 284 286 287 288 289 290 Conclusion ‘Meat mislabelling continues to be an issue withia the food chain and was studied here for the first time in sausage products sold in Canada, This is also the first application of ddPCR to not only identify species present in commercial meat products, but also to differentiate turkey and chicken in commercial samples. Though the primary species in most products was as labeled, the presence of undeclared species was detected. The analysis showed that these were present in levels above what would be considered adventitious and therefore provided a baseline estimate ‘of potential adulteration in meat products in Canada. This work, completed in partnership with the CFIA, provided an opportunity for a baseline assessment of authenticity in sausage meat and highlighted the need for ongoing monitoring of these products. Overall, digital PCR provides a powerful tool to determine the component species of processed meat products. Additional availability of assays for more common meat species and potential adulterants will further strengthen the utility of this tool for regulatory testing. Acknowledgments Funding for this project was provided to the Biodiversity Tastitute of Ontario by the Canadian Food Inspection Agency under contract H0575/3000598334. 000033291 Table 1: Raw meat sausage sample declared species, origin, and sampling regions 292 ‘Sausage species ‘Sampling region (As labelled) ‘No of samples Beef (n=27) 1 15 a Chicken (n=20) Canada 7 6 ‘Unknown, 3 7 Calgary 7 Pork (n=38) Canada 32 Toronto iW USA 5 ‘Montreat 7 Unknown 1 Calgary 0 Turkey (a=15) Canada 15 Toronto 7 Montreal 1 Calgary 1 293 294 295 296 u 900034297 Table 2: Primers used in this study for DNA barcoding and ddPCR Recession Primermame Sequence (8-3) eng Reference umbers COlanimalF4 —-TCRTHAAYCGHTGAYTATWYTC RTIsse72, ~eorn Kress, BE CObabima costars, THY 3 CCRAARAATCARAAYARRTGTTG " 4 ans EFIS3719 Hovine F810 CCATATACTCTOCITGGTOAC RemirE Lue Rencove, Bovine-R8357__ GTAGGCTTGGGAATAGTACGA 210 2m Keisie7s ‘TAGACACGTCAACATGACTGACAATO *Bovine-probe a, Arc unpublished) Chicken Cyb-F _ TCTGGGETTAACTCICATACTCAGG ——— eee anabe, et CGT ETCAGTOOTTTITERT ue al, *Chickenprote CATTCCTAAGACTAGCOCTA § “Swine 7773 CHCAATGGTATGCCACAACTAG (Kromar & = _ Rencova, Swine-R8064 CATTGTTGGATCGAGATTGTGC 2003) 3B arosass e : ACTCARAETACTEAIADCCAGCANG & *Swine probe . occa unpublished) ‘(abizinada, Turkey-I2SFW CCACCTAGAGGAGCCTGTICTGTAAT 12015 etal, Twrkey2SRV2 TIGAGCICACTATTGATCYTTCATITT 122 -KPITITO7 —_(Shchataet nn a, ‘Tutkey-probe_ TCCACCCAACCACCTCTTGCCAACAC ‘uspublished) 1Forward— AAGACATTGTGGATOCAGATGAGTA (Sheba eee I FiGkves TaGcanaTécaTecrocte oo a, SeyeaeCHSRGCIOCIGRIGTAGEAGLE i “IC probe CTTGTCECTGCTGTTGGTACTAGAGA wmoublshed) 298 299 *Probes were labeled with FAM or Cal Fluor Orange (for IC) at $* and BHOQ-1 at 3°, 000038300 301 302 303 304 ‘Table 3: Summary of predominant meat species identified in sausage samples Sausage species No of samples No of samples (Species __No of samples (species not (astabelled) _ tested matehed with label) matched with label) Beef, 27 27 (100%) 00%) Chicken 20 20 (100%) 00%) Pork 38 38 (100%) 00%) Turkey 15 10 (66.7%) 5 (33.3%)* Total 100) 95 (95%) 56%) *Chicken was the predominant species in these samples. B305 307 308 309 320 BLL 342 313, 314 315 Table 4: Summary of undeclared meat species identified in sausage samples” Sausage species Detection target (as labelled) Bovine ‘Chicken Porcine ‘Turkey Beef (0-27) 27 0 PF O%) 0 Chicken (n=20) 1° (5%) 20 0 4° (20%) Pork (n=38) 26%) “6 38 9 Turkey (n=15) 0 533.3%)" 0 10 *A cutoff value of 1% was used to indicate presence of an undeclared species. * Five samples contained 1-5% pork while two samptes contained >5% pork © The sample contained 1-5% beef. * Two samples contained 1-5% turkey while two samples contained >5% turkey * Both samples contained 1-5% beef. ‘Chicken was the predominant species in these samples. ‘000037316 317 38 319 320 321 322 323 324 Seana poe Fig 1 A & 40000- B con0o- 3 Esto} Resa. se87 ee f0.9090 3 20000 & 3 oo ei ea coo; oa” 03— A ng NA ng DNA c Boom D § 40000. r Hows] scorers sooce: g S g 20000: Emo 2 © saooo: Bone 5 ° - o 3 00 ot 02 03 4 5 00 on 02 03 Od ng DNA ng ONA Figure 1. Relationship between ddPCR output (copies) and DNA amount (ng) from single species sausages of beef (A), pork (B}, chicken species sausage samples (types) were pooted for extraction from the pooled sausage samples for (©) and turkey (D). Five representative single each of the four meat species; and DNA was cach of the species to establish the relationships. 5 00038325 326 327 328 329 330 331 332 333 334 335, 336 337 338, 339 3a 342 343, 344 345 346 347 3g, 349, REFERENCES Abuzinadah, O. H., Yacoub, H. A., El Ashmaoui, H.M., & Ramadan, H. A. (2015). Molecular detection of adulteration in chicken products based on mitochondrial 12S :RNA gene. Mitochondrial DNA, 26(3), 337-340, Ballin, N. Z. (2010). Authentication of meat and meat products, Meat Sei., 86(3), 577-587, Cai, Y.C., Li, X., Lv, R,, Yang, J. L., Li, J., He, ¥. P., & Pan, b. W. (2014). Quantitative analysis of pork and chicken products by droplet digital PCR. BioMed Res, Int, 2014(1), 1-6. Cawthora, D.-M., Steinman, H. A., & Hoffman, L. C. (2013). A high incidence of species substitution and mislabetling detected in meat prodnets sotd in South Affica, Food Control, 32(2), 440-449, D'Amato, M. E., Alechine, E., Cloete, K. W., Davison, S., & Corach, D. (2013). Where is the game? Wild meat products authentication in South Aftica: a case study. Investigative genetics, 4(1), 1. Doosti, A., Dehkordi, P. G., & Rahimi, E. (2014). Molecular assay to fraud identification of meat Products. J. Food Sei. Technol,, 511), 148-152. Floren, C., Wiedemann, I., Brenig, B., Schutz, E., & Beck, J. (2015). Species identification and ‘quantification in meat and meat products using droplet digital PCR (ddPCR). Food Chem., 173, 1054-1058, Galimberti, A., De Mattia, F., Losa, A., Bruni, L, Federici, S., Casiraghi, M,, Martellos, S., & Labra, M. (2013). DNA barcoding as a new tool for food traceability. Food Res, Int, 50(1), 55-63. Hebert, P. D., Cywinska, A., & Ball, S. L. (2003). Biological identifications through DNA barcodes. Proc. R. Soc. Lond. B. Biol, Sci,, 270(1512), 313-321. 16 00039350 351 352 353 354 355, 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 a7 37 373 376 Hebert, P. D., Ratnasinghaim, S., & de Waard, J. R. (2003). Barcoding anima life: cytochrome ¢ oxidase subunit 1 divergences among closely elated species. Proc. R. Soc. Lond, Ser. Br Biol. Sci., 270(Suppl 1), $96-899 Kane, D. B., & Heliberg, R. S. (2016). Identification of species in ground meat products sold on the US commercial market using DNA-based methods. Food Control, 59, 158-163. Kitpipit, T., Sittichan, K., & Thanakiztkrai, P, (2014). Direct-multiplex PCR assay for meat species identification in food products. Food Chem., 163(1), 77-82. Kremar, P., & Rencova, E. (2003). Identification of species-specific DNA in feedstuffs. J. Agric. Food Chem., 51(26), 7655-7658. Mehdizadeh, M., Mousavi, S., Rabiei, M., Moradian, K., Eskandari, 8., Abbasi Fesarani, M., Rastegar, H., & Alebouyeb, M. (2014). Detection of chicken meat adulteration in raw hamburger using polymerase chain reaction, J food gual hazards control, 1(2), 36-40. Nakyinsige, K., Man, Y.B. C., & Sazili, A. Q. (2012). Halal authenticity issues in meat and meat products, Meat Sci,, 91(3), 207-214. ‘O'Mahony, P. J. (2013). Finding horse meat in beef products—a global problem. QJM, 106(6), 595-597. Premanandh, J., Sabbagh, A., & Maruthamuthu, M. (2013). Misdeseription of packaged foods: a case study from the United Arab Emirates. Food Addit’Contam: Part A, 30(12), 2022- 2026. Quinto, C. A., Tinoco, R., & Heliberg, R. S. (2016). DNA barcoding reveals mislabeling of game meat species on the US commercial market. Food Control, 59, 386-392. Rodriguez, M. A., Garcia, T., Gonzalez, L, Asensio, L., Mayoral, B., Lapez-Calleja, I, HemAndez, P. E., & Martin, R. (2003). Identification of goose, mule duck, chicken, turkey, and swine in foie gras by species-specific polymerase chain reaction. J. Agric. Food Chem. 51(6), 1524-1529. 7 ‘000040375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 Spink, J., & Moyer, D. C. (2011). Defining the public health threat of food fraud. J. Food Sei, 76(9), R157-R163 ‘Tanabe, 8., Hase, M., Yano, T., Sato, M., Fujimura, T., & Akiyama, H, (2007). A real-time Quantitative PCR detection method for pork, chicken, beef, mutton, and horseflesh in foods. Biosci. Biotechnol. Biochem., 71(12), 3131-3135. Uke, P., Balta, H., Cagin, f., & Senyuva, H. Z. (2013). Meat species identification and Halal authentication using PCR analysis of raw and cooked traditional Turkish foods. Meat Sci, 94(3), 280-284. ‘von Bargen, C., Brockmeyer, J., & Humpf, H.-U. (2014), Meat authentication: a new HPLC- MS/MS based method for the fast and sensitive detection of horse and pork in highly processed food. J. Agric, Food Chom., 62(39), 9428-9435, Zacharisen, M. C. (2006). Severe allergy to chicken meat. Wis. Med. J., 105(5), 50-52, 18 con041