Role of Androgen Receptor in Folate Receptor - Regulation and in

The University of Toledo
The University of Toledo Digital Repository

Theses and Dissertations
2012
Role of androgen receptor in folate receptor α

regulation and in prostate cancer
Suneethi Sivakumaran
Follow this and additional works at: http://utdr.utoledo.edu/theses-dissertations
Recommended Citation
Sivakumaran, Suneethi, "Role of androgen receptor in folate receptor α regulation and in prostate cancer" (2012). Theses and
Dissertations. 431.
http://utdr.utoledo.edu/theses-dissertations/431
This Dissertation is brought to you for free and open access by The University of Toledo Digital Repository. It has been accepted for inclusion in Theses
and Dissertations by an authorized administrator of The University of Toledo Digital Repository. For more information, please see the repository's
About page.
A Dissertation
Entitled
Role of Androgen Receptor in Folate Receptor α Regulation and in Prostate Cancer
by
Submitted to the Graduate Faculty as partial fulfillment of the requirements for the
Doctor of Philosophy Degree in Biomedical Sciences
___________________________________________________________
Dr. Manohar Ratnam, Committee Chair
____________________________________________________________
Dr. Beata Lecka-Czernik, Committee Member
____________________________________________________________
Dr. Cynthia M. Smas, Committee Member
____________________________________________________________
Dr. Ivana De La Serna, Committee Member
____________________________________________________________
Dr. Lirim Shemshedini, Committee Member
____________________________________________________________
Dr. Robert J. Trumbly, Committee Member
____________________________________________________________
Dr. Patricia R. Komuniecki, Dean
College of Graduate Studies
December, 2012
Copyright 2012, Suneethi Sivakumaran
This document is copyrighted material. Under copyright law, no parts of this document
may be reproduced without the expressed permission of the author
An Abstract of
Role of Androgen Receptor in Folate Receptor α Regulation and in Prostate Cancer
by
Submitted to the Graduate Faculty as partial fulfillment of the requirements for the
Doctor of Philosophy Degree in Biomedical Sciences

June 2012
Folic acid is an essential water soluble vitamin required for nucleic acid and
protein biosynthesis. The first trimester of pregnancy needs constant folate transport from
maternal circulation to support rapid fetal cell division, growth and proliferation. Folate
receptor α mediates the transplacental folate transport and facilitates normal embryonic
growth. Female sex hormones, estrogen and progesterone regulate the complicated
process of embryogenesis. Estrogen and progesterone through their receptors regulate
folate receptor α, but the role of androgens that increase during first trimester in folate
receptor α regulation is unknown.
We show that androgen/androgen receptor increases folate receptor α mRNA and
protein expression. We utilized folate receptor α promoter deletion and mutant constructs
to identify the androgen receptor binding sites. We show that androgen receptor and
CAAT enhancer binding protein α bind the folate receptor α promoter regions and cause
promoter activation. Co-immunoprecipitation studies show that androgen receptor and
CAAT enhancer binding protein α interact in placental trophoblast cells. These results
suggest that androgen receptor and CAAT enhancer binding protein α interact, bind the
iii
folate receptor α promoter and regulate folate receptor α gene in cancer and placental
trophoblast cells.
In normal prostate, androgen-bound androgen receptor activates its target genes
by binding to cis androgen response elements. This is the classical mechanism of
androgen receptor action. In prostate cancer, androgen receptor exerts its growth
promoting effects by tethering to other transcription factors. We identified Elk-1
transcription factor that needs androgen receptor for its transcriptional activation. Co-
immunoprecipitation and mammalian two-hybrid assays show that Elk-1 interacts with
N-terminal domain of androgen receptor. Microarray analysis and gene validation show
that Elk-1 and androgen receptor association regulates genes involved in cell growth.
Growth assays show that Elk-1 and androgen receptor association is required to support
prostate cancer growth. Chromatin immunoprecipitation studies identified chromosomal
regions at which Elk-1 and androgen receptor are recruited. These results show that Elk-1
tethers androgen receptor to target gene promoters and suggest Elk-1 mediated androgen
receptor tethering supports prostate cancer growth.
iv
Dedicated to my family who have supported and egged me on
Acknowledgements
First and foremost, I thank my major advisor Dr. Manohar Ratnam for providing
me an opportunity to work in his laboratory and specifically for making decisions
keeping my best interests in mind. I am thankful to the scientific committee members Dr.
Cynthia Smas, Dr. Ivana De La Serna, Dr. Beata Lecka-Czernick, Dr. Robert Trumbly
and Dr. Lirim Shemshedini for their support, encouragement and comments on the
research project. My committee members molded me scientifically and prepared me for
the competitive scientific world through challenges. They made me aware of the realities
of science. I thank Dr. De La Serna for her continuous support, genuine feedback, and for
all our discussions. I thank Dr. Smas for encouraging me to exert maximum efforts and
be the best. I thank Dr. Lecka-Czernick for her feedback and comments during the
committee meetings. I thank Dr. Trumbly for patiently answering my questions and for
being helpful at times of need. I thank Dr. Shemshedini for agreeing to be on my
committee at the last moment and for being helpful by sharing plasmids and reagents for
the project. I like to thank the entire faculty who took time and enormous effort to
provide us the basic foundations through coursework. I extend special thanks to Dr. John
David Dignam with whom I have had several interesting scientific discussions. Dr.
Dignam helped me in several ways professionally and encouraged me to shoot beyond
the horizon. His genuine feedbacks are my best gifts. He and Dr. De La Serna played
very important roles when I started applying for post-doctoral positions. They provided
vi
guidance and advice at every possible step. I thank Dr. Randall Ruch who supported in
several ways and made sure the journey during Ph.D. is as comfortable as possible. I
thank Dr. William Maltese for being very supportive, particularly during the last several
months of Ph.D. I like to thank my former lab members Mesfin Gonit and Marcella
D’Alincourt Salazer who made me at ease when I joined the lab and taught several
technical aspects, and my present lab members Venkatesh Chari for his support and
Mugdha Patki. I like to thank Mesfin Gonit for allowing me to challenge his scientific
perspectives, for intellectually stimulating arguments. I thank him for his encouragement,
feedback on my technical expertise and scientific knowledge, and for being my well
wisher.
I thank my mother, sister and brother for their patience, support, encouragement,
and understanding and for challenging me with scientific questions from a common man
point of view. I thank my friends for their support and suggestions.
vii
Table of Contents
Abstract .............................................................................................................................. iii

Acknowledgements ..............................................................................................................v
Table of contents .............................................................................................................. viii
List of
figures……………………………………………………………………………………..x
Chapter 1 Introduction and Literature Review ..............................................................1

Introduction ......................................................................................................................1
Literature review ..............................................................................................................4
Chapter 2 Androgen receptor and C/EBPα interaction in folate receptor α gene
activation in human trophoblasts and cancer cells……………………………….......37
Abstract ..........................................................................................................................37
Introduction ....................................................................................................................38
Results ............................................................................................................................46
Discussion ......................................................................................................................56
Materials and Methods ...................................................................................................59
References ......................................................................................................................66
Figure Legends ...............................................................................................................74
Figures ............................................................................................................................79
Chapter 3 Elk-1 directs a critical component of growth signaling by the androgen
receptor in prostate cancer cells……………………….………………………………84
Abstract ..........................................................................................................................84
Introduction ....................................................................................................................85
viii
Results ............................................................................................................................87
Discussion ....................................................................................................................102
Materials and Methods .................................................................................................109
References ....................................................................................................................121
Figure Legends .............................................................................................................130
Figures ..........................................................................................................................138
Chapter 4 Summary and
Conclusions…………………………………………………………………………….151
References ....................................................................................................................154
A:Supplement 1 ............................................................................................................195
B:Supplement 2 ............................................................................................................208
C:Supplement 3 ............................................................................................................212
List of Figures
Chapter 1
Figure 1-1………………...………………………………………………………………25
Figure1-2………………………………………………………………..............................
Chapter 2
Figure 2-1…………………………………………………………………………...........38
Figure 2-2………………………………………………………………………………...39
Figure 2-3………………………………………………………………………………...40
Figure 2-4………………………………………………………………………………...41
Figure 2-5………………………………………………………………………………...42
x
List of Abbreviations
AR – Androgen Receptor
FRα – Folate receptor α
C/EBPα – CAAT enhancer binding protein α
CBP- CREB binding protein
CREB – cAMP response element binding
TIF2 – Transcriptional intermediary factor 2
SRF – Serum response factor
TCF – Ternary complex factor
PADI4 – Peptidyl arginine deiminase 4
JNK – c-Jun N-terminal kinase
HDAC – Histone deacetylase
HAT – Histone acetyltransferase
CYP17A1 – Cytochrome P450 17 A1
AKR1C3 – Aldo-keto reductase family 1, member C3
PSA – Prostate specific antigen
AR - Androgen receptor
ARE - Androgen response elements
xi
List of my contributions
Chapter 2
Figure 1A – Others
Figure 1B – All parts of mRNA expression determination
Figure 1C - Others
Figure 2A, B and C - Others
Figure 4A - Others
Figure 4B – Co-immunoprecipitation completely including optimization for ACH-3P
cells
Figure 4C – Chromatin immunoprecipitation completely including optimization for
ACH-3P cells
Figure 4D - Others
Figure 5A and B - Others
xii
Chapter 3
Figure 1A – Cloned (Elk12-TATA-Luc. Have contributed indirectly by doing couple of
preliminary experiments in different HeLa cell line.
Figure 1B, C, D – Others
Figure 1E – Cloned ISRE-TATA-Luc and contributed indirectly during screening of
transcription factors
Figure 2A – Have performed all steps in the luciferase assay
Figure 2B – Have performed all steps towards this figure
Figure 2C – performed all the steps including luciferase assay and optimization for
nucleofection in C4-2 cells, cloning of (Elk1)2-TATA-Luc
Figure 2D – Have performed all steps of mRNA expression determination
Figure 3A- Have performed all parts of co-immunoprecipitation including optimization
for C4-2 cells and on other prostate cancer cell line.
Figure 3B- Provided the basic outline of the figure
Figure 3C – Identified that Gal4 expression vector (empty) we used initially were wrong
with guidance of Dr. Ratnam. Prepared large scale preparation of Gal4 expression vector
from the original company stock and verified the sequence. Transfection of the plasmids
until the analysis of the results done
Figure 3D- From transfection until the analysis done. Had tested different concentrations
of vectors (results not shown in this manuscript). Western blot done – performed from
cell culture until the film development
xiii
Figure 6A, B - Others
Figure 9A, B, C - Others
Figure 9D – Optimization of Western blot for determination of phosphor-Elk-1. This
includes utilization of the different antibodies, two different cell lines and method of
blocking and reagents used for antibody incubation. All steps performed by me
Figure 9E – All steps performed by me
Figure 10C- Contributed by designing the probes and primers
Figure 11A – All steps done by me
Figure 11 B and C- All steps done by me
Figure 11D and E – All steps done by me including identification of the optimum probe
and primers to determine Elk1 and Elk3 mRNA expression
Western blots – Contributed by identifying the correct Elk-1 band and identified that Elk-
1 antibody loses its activity very rapidly. Had done Western blot for Elk-1 and androgen
receptor during initial stages of the project. Have helped in identifying the correct
androgen receptor bands.
xiv
Chapter 1
Introduction and Literature Review
Introduction
Androgen receptor plays a very important role in the male reproductive system
and its role in female reproductive system has been identified in recent years. In women,
androgen receptor expression is increased during the first trimester of pregnancy and in
placental trophoblast cells (Horie et al., 1992). This implies an important role in
pregnancy. During pregnancy, folic acid is essential for the normal growth of the fetus.
The folate receptor α mediates transplacental folate transport and facilitates folic acid
availability to the growing fetus (Kelley et al., 2003; Shatnawi et al., 2007). Female
hormones estrogen and progesterone play significant roles in the maintenance of
pregnancy. Our earlier studies identified the role of the estrogen and progesterone
receptors in folate receptor α regulation. The increased expression of androgen receptor
during the first trimester implies that it has a role in normal fetal development and that it
may be involved in folate receptor α gene regulation. Folate receptor α expression is also
increased in non-mucinous cancer. The modes of folate receptor α regulation will aid in
understanding folic acid related pregnancy complications and in designing folate receptor
α dependent drug targets in cancer. In the first chapter, we demonstrate that androgen
receptor activates folate receptor α gene expression. We utilized folate receptor α
promoter deletions and mutations to identify the binding site of androgen receptor and
1
CAAT enhancer binding protein α. We extended our findings to human placental
trophoblast cells and showed that androgen receptor associates with CAAT enhancer
binding protein α (C/EBPα) and androgen receptor is recruited to folate receptor α gene
promoter.
In men, androgen receptor mediates the effect of androgens on male reproductive
organs. The classical mechanism of action of androgen receptor is through binding to its
canonical or non-canonical androgen response elements. Androgen receptors are in
cytosol associated with heat shock proteins. Dihydrotestosterone binding to androgen
receptor leads to dissociation of heat shock proteins from the receptor, androgen receptor
dimerization and phosphorylation. The phosphorylated androgen receptor enters the
nucleus, binds to its response elements and activates target genes. Androgens essential for
normal prostate growth, development and maintenance are also required for prostate
cancer growth. Therefore, androgen ablation therapy is the standard treatment strategy in
prostate cancer. The therapy is effective for 18-24 months after which the cancer recurs
as androgen-independent prostate cancer. At this stage, androgen receptor undergoes
modifications and is the critical molecule for supporting cancer growth. The adaptations
include androgen-independent androgen receptor activation due to receptor modifications
or activation of alternate signaling or biochemical pathways (Bennett et al., 2010).
Transcription factors tether androgen receptor to their gene promoters to exert their
transcriptional effects. For example, homeobox B13 (HoxB13) tethers androgen receptor
at its target gene promoter during prostate development (Norris et al., 2009). Our lab
showed that androgen receptor associates with transcription factors. The second chapter
describes the identification of Elk-1 transcription factor that required androgen receptor
2
to activate genes. We show that Elk-1 and the androgen receptor N-terminal domain
interact to regulate genes involved in cell cycle, growth and DNA repair. The Elk-1-
androgen receptor association supports prostate cancer growth without effects on
apoptosis. We show that Elk-1 tethered androgen receptor to Elk-1 binding sites at
specific chromosomal regions.
3
Literature Review
Folates are essential water soluble vitamins necessary for normal growth and
functioning of the body systems. Their absorption and transport involves reduced folate
carrier and folate receptor α. Folate receptor α plays an important role in transplacental
folate transport and is over expressed in cancer cells.
Folate receptor α transcript and promoter structure
The folate receptor α gene is located on chromosome 11q13 in proximity to the
folate receptor β gene. It consists of seven exons and six introns and spans 7.7 kb. Its
transcription is regulated by P1 and P4 promoters (Saikawa et al., 1995). The P4
promoter lacks TATA or CAAT elements but contains GC rich regions that form three
Sp1-binding sites and an initiator region (Page et al., 1993; Saikawa et al., 1995). P1 is
the distal promoter while the P4 promoter is the proximal promoter. P1 derived
transcripts have multiple transcription start sites and are predominantly expressed in
normal kidney and cerebellum (Elwood et al., 1997). P4 derived transcripts arise from a
single transcription start site and are expressed in several normal and cancerous human
tissues. The P1 and P4 promoter driven transcripts differ only in the length and
heterogeneity of 5’ untranslated regions (Elwood et al., 1997).
Folate receptor α regulation
Folate receptor α is regulated by plasma folate concentrations. Folate deficiency
upregulates folate receptor α transcription initiation rate and prolongs mRNA half-life
(Kane et al., 1988; Sadasivan et al., 2002). Steroid hormones also regulate folate receptor
α gene. Estrogens through the estrogen receptor repress folate receptor α gene by
recruiting co-repressors including nuclear corepressor (NCoR) and silencing mediator of
4
retinoic acid and thyroid hormone receptor (SMRT) while progesterone receptor activates
the gene through Sp1 and Sp4 binding (Hao et al., 2007; Shatnawi et al., 2007).
Tissue distribution and expression
Folate receptor α is expressed in choroid plexus, ovary, lungs, renal proximal
tubules, fallopian tube, endometrium and placenta. (Weitman et al., 1992b). In
developing mouse embryo, folate receptor α is expressed in yolk sac, neural crest, heart,
neural fold and neural tube indicating its importance in embryo development (Saitsu et
al., 2003). Folate receptor α expression is upregulated in non-mucinous ovarian
carcinoma, renal, lung and endometrial cancer (Weitman et al., 1992a). Folate receptor β
is present in the placenta, but its role in folate transport from mother to fetus may be
insignificant since folate receptor β null mice is not embryonic lethal, fertile and
physically normal, while the folate receptor α knockout is embryonic lethal (Piedrahita et
al., 1999).
Folate receptor structure
Folate receptors are glycosylphosphatidyl inositol anchored membrane proteins
except for folate receptor γ that is secreted in hematopoietic tissues (Antony, 1996; Lacey
et al., 1989; Luhrs, 1991; Luhrs and Slomiany, 1989). The number of N-linked
glycosylation motifs N-X-S/T varies between the folate receptor types. At least one or
two glycosylated residues are required for the receptor folding, stability and cell surface
expression. The glycosylation at Ser203 is essential for the receptor affinity to folate
(Roberts et al., 1998). Folate receptor α is a single-chained 42kDa glycoprotein
containing 12% carbohydrate. It binds folate with 1:1 molar stoichiometry (Antony et al.,
1981). It has affinity for folates in the following order: folic acid > 5-
5
methyltetrahydrofolate>> 5-formyltetrahydrofolate (Westerhof et al., 1991). Placental
folate receptor α has intramolecular disulfide bonds and two potential N-linked
glycosylation sites at Asn-99 and Asn-179 (Ratnam et al., 1989).
Folate and folate Receptor α in Pregnancy
The role of folates in DNA, RNA and protein synthesis makes it indispensable
during pregnancy when there is rapid cell growth and proliferation. The one carbon
metabolism in which folate is an important methyl donor is necessary for regulation of
proper epigenetic activity and chromosome structure maintenance.
Effects of folate deficiency: Folate deficiency increases the rate of deoxyuridylate
monophosphate (dUMP) misincorporation into DNA due to deficient deoxythymidylate
monophosphate (dTMP) synthesis. Inadequate thymidylate and purine synthesis due to
folate deficiency inhibits DNA repair reactions, slows replication and thus reduces the
proliferative capacity of the cells (Blount et al., 1997). It also leads to increased apoptosis
and cell necrosis. Decreased availability of S-adenosyl methionine causes defective DNA
and histone methylation (Blount et al., 1997). Folate deficiency leads to homocysteine
accumulation as the pathway that prevents its accumulation is inhibited under folate
deficient conditions. Hyperhomocysteinemia induces trophoblast apoptosis (Di Simone et
al., 2003; Nelen et al., 2000). Animal studies demonstrate that maternal folate deficiency
affects folliculogenesis, pregnancy rates and fertility (Mohanty and Das, 1982; Mooij et
al., 1992; Xiao et al., 2005) and studies on pregnant women indicate that the deficiency
causes reduced fetal weight, neural tube defects in new born (Czeizel and Dudas, 1992),
intrauterine growth retardation and pre-term birth (Lindblad et al., 2005).
6
Folate deficiency occurs due to poor dietary intake or malabsorption. Folate
deficiency can arise due to defects in folate-metabolizing genes or due to deficiency of
other vitamins and micronutrients essential for folate metabolism such as zinc, iron,
vitamins B6 and B12 (McNulty et al., 2006).
Folate receptor α knock-out mice show retarded embryonic growth and
development and neural tube defects. The heterozygous folate receptor α deficient mice
had reduced plasma folic acid (Piedrahita et al., 1999). Folate receptor α knock-out
mouse is embryonically lethal indicating its significance in normal embryo development.
Folic acid supplementation rescues neural tube defects even in the absence of functional
folate receptor α (Rosenquist and Finnell, 2001). Hyperhomocysteinemia caused neural
tube defects independent of folate concentration by acting as NMDA receptor antagonist.
Folate is involved in methionine metabolism cycle and thus reduces accumulation of
homocysteine. Folate prevents neural tube defects by decreasing homocysteine
concentration. Folate receptor α nullizygous mice exhibited apoptosis and reduced cell
proliferation. Apoptosis genes Bax and activated caspase-3 were evenly distributed
across the apico-basal axis of the lateral neural plate (Tang et al., 2005). Plasma and
tissue folate levels were decreased (plasma levels decreased to one-third) with folate
receptor knock-out mice (Ma et al., 2005).
Steroid hormones during pregnancy
Female sex hormones during pregnancy: Progesterone and estrogen through their
respective receptors play important roles in pregnancy. Estrogens exert proliferative
effects on the endometrium while progesterones cause endometrial differentiation which
is essential for implantation (Tan et al., 1999; Tibbetts et al., 1999). The significance of
7
progesterone receptor in pregnancy is evident from infertility in progesterone receptor
knock-out mice. These mice showed defects in embryo implantation and decidualization
(Lydon et al., 1995). Administration of progesterone antagonists causes abortion in wild-
type mice (Loutradis et al., 1991).
Role of androgens during pregnancy: Androgens dehydroepiandrosterone sulphate,
dehydroepiandrosterone, androstenedione, testosterone and dihydrotestosterone are
secreted in decreasing order of serum concentration in females. In females, androgens are
synthesized by adrenal glands and ovaries. Skin, adipose tissue and liver are involved in
androgen synthesis by converting dehydroepiandrosterone to androstenedione by 3β-
hydroxysteroid dehydrogenase and androstenedione converted to testosterone by 17β-
hydroxysteroid dehydrogenase (Burger, 2002). Testosterone levels reach a peak during
the luteal phase of the menstrual cycle (Abraham, 1974; Burger, 2002). Testosterone
secretion also increases during the first trimester and androgen receptor regulates genes
associated with cytoskeletal organization (Cloke et al., 2008; Milne et al., 2005).
Androgen receptor is localized to the nuclei of endometrial stromal cells and in first
trimester decidual cells. (Critchley and Saunders, 2009).
Human placental trophoblast cells
Implantation and placentation are two important events during the initial stages of
pregnancy. Implantation is a highly coordinated process in which the trophoectoderm and
the trophoblasts of the embryo establish contact with the uterus (Carson et al., 2000). The
coordination of this event needs the growth factors, cytokines and hormones from both
the embryonic and uterine tissues. Fertilization occurs in the fallopian tubes within 24-48
hours after ovulation. The fertilized ovum is a one-cell zygote that undergoes several cell
8
divisions to a mass of 12 to 16 cells called morula as it passes through the fallopian tube.
This development of morula occurs in an encased non-adherent protective coating called
zona pellucida (Norwitz et al., 2001). The morula enters the uterine cavity two to three
days after implantation. The morula develops into a blastocyst with the formation of a
fluid filled inner cavity within the mass of cells. This stage is marked by cellular
differentiation: the surface cells become trophoblasts which give rise to placenta and
extraembryonic tissues, the inner cell mass forms the embryo. The embryo is released
from the zona and exposes the trophoblasts to the uterine cavity within 72 hours after
reaching the cavity. At this stage, implantation occurs with the adhesion of blastocyst to
uterine wall and cytotrophoblasts from the trophoblast layer invade the endometrium, the
myometrium and the uterine vasculature. Thus, the invasion establishes the uteroplacental
circulation (Norwitz et al., 2001).
Human placenta is the organ that connects mother to the fetus. The main cellular
component of the placenta is syncytial trophoblast (Carr, 1967). Trophoblasts line the
chorionic villi which is the interface between maternal blood and umbilical vessels. The
outer layer of trophoblast is in direct contact with maternal blood. They have transport
and endocrine functions (Strauss et al., 1996).
Folic acid
Folates are essential water-soluble B9 vitamins. They are important biomolecules
in trans-methylation and trans-sulfuration reactions and thus are essential in epigenetic
processes (Bailey and Gregory, 1999). Structurally, folic acid consists of a pteridine ring,
p-aminobenzoic acid, and one to nine glutamic acid residues (figure A). The normal
serum folate concentration ranges between 5 and 40 nM and is maintained by liver that
9
stores folate and the kidney that reabsorbs it (Lucock, 2000). After glomerular filtration,
the luminal folate binds folate receptor (FR) in the brush bordered membranes of the
proximal renal tubular cells and is internalized by endocytosis. With low pH of the
endocytic vesicles, folate dissociates from folate receptor which is then transported back
to proximal cells. Folate enters blood circulation by transport across basolateral
membranes.(Antony, 1996)
Naturally occurring folate derivatives are polyunsaturated and are reduced to
dihydrofolate or tetrahydrofolate (Laanpere et al., 2010). They are required for de novo
synthesis of purine and thymidine and for metabolism of amino acids serine, glycine,
cysteine, homocysteine and methionine (For reactions, refer to figure 2-1, 2-2, 2-3, 2-4
and 2-5 in introduction, page number 38-42) (Laanpere et al., 2010). Folate deficiency
affects DNA synthesis, amino acid metabolism and methylation of genes, proteins and
lipids. Folates are not naturally synthesized in humans and are obtained from the diet.
Dietary sources of folates include dark green leafy vegetables, milk, whole grains and
citrus fruits (Laanpere et al., 2010).
Folate Transport and Absorption
Dietary folates exist as 5-methyl tetrahydrofolate and 10-formyl tetrahydrofolate
in polyglutamate forms that cannot cross the cell membrane and are enzymatically
hydrolyzed by folylpolyglutamate conjugase to monoglutamate forms to be absorbed in
the intestine (Fowler, 2001). Synthetic folic acid is oxidized, more stable and is mono-
glutamate. Natural folates containing polyglutamates are hydrolyzed to monoglutamates
by glutamate carboxypeptidase II in the gut lumen (Laanpere et al., 2010). Natural and
synthetic folates are converted to 5-methyltetrahydrofolate by folylpolyglutamate
10
conjugase during their transit through the intestinal mucosa (Fowler, 2001). Peripheral
uptake of circulating 5-methyltetrahydrofolate is mediated by reduced folate carrier and
folate receptors. Folates are transported by reduced folate carrier, proton-coupled folate
transporter and by folate receptor-mediated endocytosis (Laanpere et al., 2010). Folate
transport involves translocation of folate from extracellular compartment into the cell and
also translocation across intracellular compartments.
Folate transport systems: Reduced folate carrier, a low-affinity high-capacity carrier
mediates the uptake of reduced folate into cancer cells at pharmacologic micromolar
extracellular folate concentrations. Folate receptor, a 38- to 44-KDa membrane associated
folate binding protein, binds physiologic folates with high affinity (nanomolar
concentration) (Antony, 1996). Reduced folate carrier is involved in folate transport in
both directions while folate receptor α facilitates endocytosis-mediated unidirectional
folate transport (Chancy et al., 2000; Sabharanjak and Mayor, 2004).
Plasma membrane bound folate receptor α binds folic acid and transfers it to an
acidic compartment at the rate of 0.9- 1.0 pmol/million cells per hour. The cytoplasmic
folic acid is glutamylated at the rate of 0.6 -0.7 pmol/million cells per hour. Cytoplasmic
folic acid accumulation continues until it reaches 5-7 pmol/million cells. At this level, the
accumulation is inhibited while the folate receptor α remains functional (Kamen et al.,
1989)
Transplacental folate transport: Folate receptor α-mediated transplacental transport is a
two-step process- Maternal 5-methyl tetrahydrofolate is bound by placental folate
receptors on the maternally-facing chorionic surface (Yasuda et al., 2008). The bound 5-
methyl tetrahydrofolate is released to intervillous circulation and replaced by folate from
11
maternal circulation. This ensures higher intervillous blood levels of 5-methyl
tetrahydrofolate than in the maternal blood. The intervillous 5-methyl tetrahydrofolate is
passively transported to the fetal circulation. This allows the fetus to utilize maternal
folate continuously and avoid the effects of folate deficiency during critical stages of
development (Henderson et al., 1995).
Androgen Receptors and Prostate Cancer
The observation that hormones bind specifically to components in cellular extract
led to the purification and cloning of nuclear receptors including androgen receptor.
Androgen receptor cloning and purification helped elucidate its genomic organization,
domain structure, and function (Brinkmann et al., 1989; Jenster et al., 1991; Lubahn et
al., 1988; Tilley et al., 1989; Trapman et al., 1988).
Prostate Gland
The prostate gland is a walnut-sized organ surrounding the urethra at the base of
the bladder. The human prostate is divided into central, periurethral, transition, and
peripheral zones with an anterior fibromuscular stroma. The peripheral zone is the site of
prostate carcinomas and occupies the major volume of the gland (Timms, 2008).
Histologically, the prostate is comprised of luminal, basal and neuroendocrine cells. The
luminal columnar epithelial cells express high levels of androgen receptor. Basal cells
express low or undetectable levels of androgen receptor. Less abundant neuroendocrine
cells do not express androgen receptor (Shen and Abate-Shen, 2010). Androgens are
required for prostate development, growth, differentiation, maintenance of morphology,
and function. They exert these effects by binding to the androgen receptor.
12
Androgens
Androgens, testosterone and dihydrotestosterone exert transcriptional effects by
binding to the androgen receptor. Androgen synthesis and release are under the controlled
regulation of hypothalamus-pituitary-gonadal axis. Leuteinizing hormone releasing
hormone secreted by hypothalamus causes the anterior pituitary to release leuteinizing
hormone which in turn acts on testicular Leydig cells to induce testosterone synthesis
and release (Yadav and Heemers, 2012). Testosterone secreted by the Leydig cells enters
the prostate epithelial cells; is irreversibly converted to dihydrotestosterone by 5α-
reductase type 2 (Miyamoto et al., 2004; Penning et al., 2008). Dihydrotestosterone has
ten times greater affinity than testosterone for the androgen receptor. (Miyamoto et al.,
2004). Adrenal androgens dehydroepiandrosterone, ∆4-androstenedione and ∆5-
androstenediol also weakly activate androgen receptor by binding directly or by being
converted to testosterone or dihydrotestosterone. (Miyamoto et al., 2004)
Androgen Receptor
Androgen receptor belongs to type II nuclear hormone receptor family of
transcription factors that includes receptors for sex steroids, adrenal steroids, retinoids,
vitamin D, thyroid hormones and fatty acids (Chang et al., 1995; Miyamoto et al., 2004).
The human androgen receptor gene, spanning 186 kb of DNA on chromosome X at q11-
12 (Kuiper et al., 1989; Trapman et al., 1988), contains eight exons. The androgen
receptor promoter lacks TATA or CAAT sequences but contains GC-rich SP1 binding
sites (Tilley et al., 1990). The mRNA encodes a 919 amino acid residue (Tilley et al.,
1989). Differential splicing in the androgen receptor 3’untranslated region results in 8.5
kb and 11 kb mRNA that has 1.1 kb 5’ untranslated region and 2.7 kb open reading
13
frame. It exerts its transcriptional effects by binding to androgen response cis-elements
(ARE) in its target gene promoters. The androgen response element consists of two
palindromic hexanucleotide half sites separated by a three nucleotide spacer
(AGAACANNNTGTTCT) (Ham et al., 1988; Horie-Inoue et al., 2004; Tan et al., 1992).
In the absence of ligand, androgen receptor exists in the cytoplasm in association with
heat shock proteins that maintains the receptor in an inactive and ligand-friendly
conformation (Beato et al., 1995). Disruption of Hsp90 impairs hormone induction
(Beato et al., 1995).
Structural Domains
Androgen receptor has three domains: an N-terminal ligand-independent
transactivation domain, (Guo et al., 2009) a DNA binding domain, a hinge region and a
C-terminal ligand binding domain. The N-terminal domain has a ligand-independent
transcriptional activation function, activation function-1 (AF-1) (Jenster et al., 1995) and
FQNLF motif important for the intramolecular N/C interaction with the ligand-binding
domain and for interaction with coactivators. Androgen receptor differs from other
members of the nuclear receptors; its N-terminal/C-terminal interaction is necessary for
androgen receptor to exert transcriptional activity. Deletion of the C-terminal ligand
binding domain results in constitutive androgen receptor activation (Dehm et al., 2008;
Guo et al., 2009; Sun et al., 2010). The DNA binding domain encoded by exons 2 and 3
contains two zinc finger motifs that facilitate the binding of the androgen response
elements (Clinckemalie et al., 2012; Umesono and Evans, 1989). The DNA binding
domain binds the DNA as a homodimer to direct or inverted hexameric repeats. The
hinge region which facilitates the N-terminal/C-terminal interaction is important for
14
androgen receptor nuclear translocation, DNA binding, and posttranslational modification
(Schoenmakers et al., 1999; Wong et al., 2004; Zhou et al., 1994). The ligand binding
domain binds with testosterone and dihydrotestosterone; dissociation constant of
testosterone is 1 x 10-9 M and dihydrotestosterone is 10-11M. The ligand binding domain
of androgen receptor contains a nuclear export sequence (between amino acids 742-817)
that facilitates its nuclear export in a CRM-independent manner. The nuclear export
sequence overrides the nuclear localization signal of androgen receptor (Saporita et al.,
2003).
Classical mechanism of androgen receptor action: Binding of testosterone or
dihydrotestosterone causes conformational changes in the ligand binding domain leading
to a more compact structure.
Figure 1-1 Classical mechanism of androgen receptor

(Adapted from Feldman BJ & Feldman D Nature Reviews Cancer 2001; 1:34-45)
The conformational change causes dissociation of heat shock proteins and nuclear
translocation of the receptor. Androgen bound androgen receptor mediates transcriptional
15
effects by recruiting co-activators. Coactivators of SRC (steroid receptor coactivator)
family bind the activation function-2 (AF-2) region of the ligand binding domain while
CREB-binding protein (CREB- cAMP response element binding) bind near the DNA
binding domain (Aarnisalo et al., 1998)
Functions
Androgen receptor maintains the balance between cell proliferation and cell
apoptosis in normal prostate (Stanbrough et al., 2001). Androgen receptor exerts
cytoprotective effects by activation of p38, AKT and NFкB (Coffey et al., 2002; Rokhlin
et al., 2005). In androgen independent prostate cancer, androgen receptor directly
activates the M-phase related gene UBE2C and other cell cycle related genes such as
CDC20, CDK1, and ANAPC10 and supports prostate cancer growth by blocking S and
G2/M phases (Wang et al., 2009). Androgens induce p21Cip1 mRNA expression that
mediates the formation of active cyclin D1/CDK4 complex (Lu et al., 1999) and (Xu et
al., 2006). Androgen receptor also activates cyclin E/cdk2 activity through post-
translational mechanisms. Activated androgen receptor degrades p27Kip1, an inhibitor of
CDK2 (Lu et al., 2002). CyclinE/CDK2 and cyclin D1/CDK4 mediated retinoblastoma
phosphorylation causes retinoblastoma inactivation which releases inhibition of E2F by
retinoblastoma and facilitates cell cycle entry (Knudsen and Knudsen, 2006). Thus,
androgens stimulate prostate cancer cell proliferation through mammalian target of
rapamycin (mTOR) activation and post-transcriptional and post-translational increase in
cyclin D proteins. The androgen mediated mTOR activation was not by PI3K/Akt
activation which is constitutively active in LNCaP prostate cancer cells (Xu et al., 2006).
16
The androgen stimulated cell proliferation is biphasic with dihydrotestosterone at higher
doses (>1-10 nM) suppressing prostate cancer cell growth (Xu et al., 2006).
Non-genomic actions of androgen receptor: Androgens exert non-transcriptional effects
through androgen receptor. In the presence of androgens, androgen receptors interact
with the Src homology 3 domain of c-Src and stimulate its kinase activity very rapidly. c-
Src activation causes MAPK activation leading to direct phosphorylation of androgen
receptor and its co-activators such as SRC-1, SRC-3 and transcription intermediary
factor-2. Androgens can also activate extracellular signal-regulated kinase very rapidly.
Androgens increase intracellular calcium in different cell lines though it is not certain if
these are purely androgen specific effects (Bennett et al., 2010).
Androgen receptor post-translational modifications
Androgen receptor is regulated at the post-translational level by phosphorylation,
acetylation and ubiquitylation. The binding of ligand results in its phosphorylation and
subsequent nuclear localization (Brinkmann et al., 1999; Goueli et al., 1984; Kuiper and
Brinkmann, 1995). Androgen receptor is phosphorylated at serine, threonine and tyrosine
residues, largely within the N-terminal domain. Androgen receptor is phosphorylated by
androgen or by growth factor signaling pathways. Akt regulates androgen receptor Ser
213 and Ser 791 phosphorylation (Lin et al., 2001; Wen et al., 2000), and epidermal
growth factor and protein kinase C phosphorylate androgen receptor Ser 525 and 578
residues (Ponguta et al., 2008). Mitogen activated protein kinases p38 and c-Jun N-
terminal kinase phosphorylate androgen receptor Ser 650 residue which is required for
androgen receptor nuclear export. In the presence of Src, epidermal growth factor
17
phosphorylates androgen receptor Tyr 534 (Guo et al., 2006). Protein phosphatases 1 and
2 cause androgen receptor dephosphorylation.
Androgen receptor undergoes acetylation in the hinge region at the acetylation
consensus site KLLKK. Histone acetyltransferases p/CAF, p300 and Tip60 acetylate
androgen receptor at Lys 630, 632 and 633 (Fu et al., 2004) while histone deacetylases
HDAC1 and SIRT1 deacetylate androgen receptor to down regulate its transcriptional
activity (Gaughan et al., 2002).
SUMO1 sumoylates androgen receptor at Lys 386 and Lys 520 while SUMO
proteases SENP1 and 2 desumoylate and down regulate androgen receptor transcriptional
activity (Kaikkonen et al., 2009; Poukka et al., 2000). Protein ubiquitination leads to its
degradation; three ubiquitin E3 ligases MDM2, CHIP and RNF6 ubiquitinylates
androgen receptor. MDM2 and CHIP mediated ubiquitination cause androgen receptor
degradation while RNF6 enhances androgen receptor transcriptional activity by recruiting
androgen receptor co-activator ARA54. In LNCaP prostate cancer cells, RNF6 knock-
down reduced androgen receptor recruitment to androgen response elements in prostate
specific antigen and its transcriptional activity (Xu et al., 2009). Androgen receptor
ubiquitination is reversed by deubiquitinating enzymes Usp26 and Usp10.
Androgen Receptor Co-regulators
Androgen receptor co-activators: Co-activators that enhance androgen receptor
transcriptional activity include the members of the steroid receptor coactivator family,
and protein inhibitor of activated signal transducer and activator of transcription family.
Co-activators like Hsp90 chaperone complex and ARA70 mediate androgen receptor
stability and facilitate ligand binding respectively (Heinlein and Chang, 2002). ARA267
18
cooperates with coactivators ARA24 and p300/CBP associated factor (P/CAF) to
enhance androgen receptor transactivation function (Wang et al., 2001). The steroid
receptor coactivator (SRC) family members SRC-1, glucocorticoid receptor interacting
protein 1 (GRIP1) and transcription intermediary factor 2 (TIF2) recruit additional co-
activators such as cAMP response element binding protein-binding protein (CBP/p300)
(Berrevoets et al., 1998; Bevan et al., 1999). CBP/p300 facilitates chromatin remodeling
by its histone acetyltransferase activity (Fronsdal et al., 1998). Retinoblastoma and
Smad3 are identified as androgen receptor co-activators in prostate cancer cells (Kang et
al., 2001; Yeh et al., 1998).
Androgen receptor co-repressors: Androgen receptor co-repressors include: corepressors
that inhibit DNA binding and nuclear translocation of androgen receptor, corepressors
that recruit histone deacetylases, corepressors that disrupt the interaction between
androgen receptor and co-activators and those that disrupt the N/C terminal androgen
receptor interaction (Wang et al., 2005).
Corepressors that inhibit DNA binding and nuclear translocation include the
calcium binding protein calreticulin, orphan receptor dosage-sensitive sex reversal
hypoplasia congenita critical region on the X chromosome gene 1 (DAX-1) and p21-
activated kinase 6. Calreticulin binds the receptor DNA binding domain and DAX-1 to
the ligand binding domain (Dedhar et al., 1994; Holter et al., 2002).
The corepressors that recruit histone deacetylases include 5’TG3’ interacting
factor (TGIF), androgen receptor corepressor, 19kDa (ARR19) and the silencing
mediator for retinoid and thyroid hormone receptors/nuclear receptor corepressors
(SMRT/NCoR). 5’TG3’ interacting factor recruits histone deacetylase Sin3A (Sharma
19
and Sun, 2001) while androgen receptor corepressor, 19kDa recruits histone deacetylase
4 to repress androgen receptor transcriptional effects (Jeong et al., 2004). The silencing
mediator for retinoid and thyroid hormone receptors/nuclear receptor corepressors
(SMRT/NCoR) interacts directly and suppresses androgen receptor transcriptional effects
(Cheng et al., 2002; Liao et al., 2003).
Corepressors that disrupt interaction of androgen receptor with coactivators
include short heterodimer partner (SHP) and cyclin D1. Short heterodimer partner
competes with androgen receptor coactivators and binds to amino and carboxyl terminus
of androgen receptor (Gobinet et al., 2001). Cyclin D1 binds the hinge region of
androgen receptor and competes for p300/CBP associated factors (Reutens et al., 2001).
Filamin A is a corepressor that disrupts the androgen receptor amino-carboxy terminal
interaction. It interacts with androgen receptor hinge region and disrupts interaction
between the receptor and transcription intermediary factor 2 (Loy et al., 2003).
Tethering Mechanism
Nuclear hormone receptors including androgen receptor can transactivate target
genes by a tethering mechanism. In the presence of androgens, serum response factor
tethers androgen receptor to serum response elements in the α-actin promoter
(Vlahopoulos et al., 2005). Progesterone receptor regulates gene promoters that lack
canonical progesterone response elements by tethering Sp1, Stat5 and AP1 (Faivre et al.,
2008; Owen et al., 1998; Stoecklin et al., 1999). Our lab studies showed that at gene
promoters that lacked androgen response elements, CAAT enhancer binding protein α
tethered androgen receptor. homeobox B13 (HoxB13) tethered androgen receptor at
HoxB13 binding sites (Zhang et al., 2010)
20
Prostate cancer
Prostate cancer progresses in stages. Prostate cancer in its initial stage is localized
and requires androgens for its growth. Androgen ablation therapy is the standard
treatment option and is an effective therapy for one to two years. In majority of prostate
cancer patients, cancer recurs and at this stage no longer depends on androgen for growth.
This stage is called as androgen-independent or hormone-refractory or castration-resistant
prostate cancer. In androgen-independent prostate cancer, androgen receptor undergoes
modifications that include androgen receptor mutations, over expression, and gene
amplification. Due to these modifications, androgen receptor is activated by low
androgen levels, by non-androgenic steroids, by antiandrogens and by growth factors
independent of androgens. Androgen receptor splice variants that are constitutively active
play significant roles in prostate cancer growth and progression (Attar et al., 2009;
Knudsen and Penning, 2010). These modifications and their roles in prostate cancer are
described in detail below.
Androgen receptor amplification: One of the mechanisms by which androgen receptor
supports castration resistant prostate cancer is by androgen receptor gene amplification
(Visakorpi et al., 1995) and consequent protein over expression. Genome wide screening
for genetic aberrations using comparative genomic hybridization showed increased
androgen receptor gene (Xq11-q13) copy number in hormone-refractory prostate cancer
but not in primary tumors obtained from the same patients (Visakorpi et al., 1995). This
indicates that the role of androgen receptor gene amplification is in cancer progression
and not initiation. Lack of gene amplification in untreated primary tumours also indicates
that the gene amplification occurred as a result of selection during androgen deprivation
21
therapy. These samples showed no androgen receptor gene mutation (Visakorpi et al.,
1995) and (Taylor et al., 2010).
Androgen receptor mutation: Androgen receptor missense and nonsense mutations are
identified in prostate cancer. Androgen receptor gene mutations are rare in early-stage
cancer but increase with the stage of the disease (Buchanan et al., 2001a). The majority of
missense mutations (85%) in prostate cancer is located in the ligand binding domain
leading to altered ligand binding specificity, cofactor responses and increased androgen
receptor transcriptional activity (Veldscholte et al., 1990). Mutations in other domains
include regions close to activation function-2 (AF-2) core sequence, between hinge and
ligand binding domain, DNA binding domain and N-terminal domain.
Mutations regions 874-911 residues proximal to activation function-2 (AF-2) core
sequence result in receptor activation by nonclassical ligands and antiandrogens. A well
known example is T877A mutation in androgen receptor in LNCaP prostate cancer cells
(Veldscholte et al., 1992). Mutations at the boundary between hinge region and ligand
binding domain are identified between amino acids 670 to 678 which is a coactivator
interaction site. This region in wild type androgen receptor weakens the receptor
interactions with p160 coactivators (Estebanez-Perpina et al., 2007). Mutation in this
region increases transcriptional activity of the receptor in response to
dihydrotestosterone, nonclassical ligands and antiandrogens due to increased p160 levels
during prostate cancer progression (Buchanan et al., 2001b).
Mutations in DNA binding domain were identified between amino acids 574-586
that lie at the carboxyl-terminal end of the first zinc finger motif. The T575A mutation
and T877A mutation causes nonspecific ligand binding of androgen receptor and
22
transactivation at non-canonical-binding sites (Aarnisalo et al., 1999; Marcelli et al.,
2000; Monge et al., 2006).
Mutations in N-terminal domain were identified in the conserved regions of 234
to 237 amino acids in clinical prostate cancer and transgenic adenocarcinoma of mouse
prostate tumors. In transgenic adenocarcinoma of mouse prostate tumors, E236G
mutations caused increased response to androgenic and nonandrogenic ligands and to
coactivators ARA70 and ARA160 (Han et al., 2001; Steinkamp et al., 2009).
Androgen receptor activation by signal transduction pathways: In androgen-independent
prostate cancer, androgen receptor is activated by growth factors such as insulin-like
growth factor-1, epidermal growth factor and keratinocyte growth factor (Culig et al.,
1994), interleukin -6 (Hobisch et al., 1998), Akt and mitogen activated protein kinase
pathway. Growth factor pathways cause androgen-independent activation of androgen
receptor and downstream activation of Akt and mitogen activated protein kinase
pathways. Akt over expression was identified in androgen-independent prostate cancer
cell lines derived from xenografts of LNCaP cell line (Graff et al., 2000). Her-2/neu over
expression is evident in androgen-independent prostate cancer cell lines derived from
androgen-dependent human prostate cancer xenografts (Craft et al., 1999) and in clinical
prostate cancer specimens (Osman et al., 2001). Overexpression of Her-2/neu resulted in
androgen-independence in prostate cancer and increased androgen receptor activity
(Mellinghoff et al., 2004). Inhibitors against growth factor receptor and Her2/neu were
developed but showed no promising results (Chen et al., 2008).
Androgen Receptor Splice Variants: In addition to activation of androgen receptor by its
gene mutation and amplification, recent studies have identified the contribution of
23
androgen receptor splice variants lacking ligand binding domain in hormone-refractory
prostate cancer. Androgen receptor splice variants containing the exons 1-3 and a cryptic
exon in intron 3 were identified in hormone refractory prostate cancer specimens and in
CWR22Rv1 and VCaP prostate cancer cells. This androgen receptor variant was
localized in the nucleus in the absence of androgen and was associated with worse
clinical outcome. It is constitutively active as evidenced by the increased expression of
androgen regulated genes like KLK3, TMPRSS2 and FKBP5 in the absence of androgens
(Hu et al., 2009).
Intratumoral androgen synthesis: Expression profiling studies comparing metastatic
castration resistant prostate cancer with primary tumors showed that enzymes that
synthesize cholesterol from acetyl-coenzyme A and testosterone and dihydrotestosterone
from cholesterol are upregulated in castration resistant prostate cancer (Holzbeierlein et
al., 2004; Stanbrough et al., 2006). Androgen receptor is re-activated by increased
cytochrome P450 17A1 (steroid 17α-monooxygenase or CYP17A1) and aldo-keto
reductase family 1, member C3 (AKR1C3)-dependent intratumoral de novo androgen
synthesis in VCaP prostate cancer cells derived from castration-resistant prostate cancer
patients with bone metastasis (Cai et al., 2011; Loberg et al., 2006). In C4-2 cells derived
from an LNCaP xenograft that relapsed after castration , and LNCaP prostate cancer cells
derived from prostate cancer patients with lymph node metastases with androgen receptor
T877A mutation, androgen receptor is re-activated by cytochrome P450 11A1-dependent
intratumoral synthesis of progesterone (Cai et al., 2011). Castration-resistant VCaP
xenografts treated with abiraterone resulted in increased cytochrome P450 17A1
24
(CYP17A1) expression with tumor relapse indicating abiraterone caused selection of
relapsed tumors with increased cytochrome P450 17A1 expression.
Gene fusions: Chromosomal translocations which are common in hematologic
malignancies are detected in prostate cancer (Hermans et al., 2006; Iljin et al., 2006;
Lapointe et al., 2007; Mehra et al., 2007; Tomlins et al., 2007; Tomlins et al., 2006;
Tomlins et al., 2005). Translocations are of two kinds: those that result in fusion proteins
that have a novel effect on the cell and those in which the promoter region of one gene is
translocated into the coding region of an oncogene resulting in up regulation of the
oncogene expression (MacDonald and Ghosh, 2006). TMPRSS2 is the 5’fusion partner
for all ETS genes with known rearrangements (Soller et al., 2006; Wang et al., 2006;
Yoshimoto et al., 2006). TMPRSS2:ETV5 and SLC45A3:ETV5 gene fusions were one of
the rare fusions in prostate cancer. ETV5 over expression induced invasion in benign,
immortalized RWPE prostatic epithelial cells (Helgeson et al., 2008).
Present mode of therapies for Prostate Cancer:
Prostate cancer is the second leading cause of death among men; approximately
30,000 die annually according to 2012 estimates of American Cancer Society. The
standard treatment during its initial stages is surgical castration or administration of anti-
androgen bicalutamide or luteinizing hormone releasing hormone analogues. Prostate
cancer recurs and becomes androgen-independent. At this stage, the cancer cells depend
on androgen receptor. As discussed earlier, androgen receptor undergoes several
modifications or chooses pathways to support prostate cancer growth. These pathways
that lead to androgen independence are utilized in drug designing strategies to inhibit
prostate cancer growth.
25
Drugs targeting alternate androgen synthesis pathway: Prostate converts weak adrenal
androgens androstenedione, dehydroepiandrosterone and dehydroepiandrosterone sulfate
to high affinity testosterone and dihydrotestosterone (Penning et al., 2006). Finasteride, a
selective 5α-reductase type 2 inhibitor decreased prostate cancer incidence but led to
more aggressive form of cancer (Thompson et al., 2003). Finasteride did not completely
abolish the hormone levels indicating cancer cells adapt to other pathways.
Drug Name Type of Inhibitor

Finasteride 5α-reductase type 2 inhibitor
Dutasteride Inhibitor of 5α-reductase type 1 and 2
Abiraterone acetate Inhibitor of C17, 20-lyase
Ketoconazole
Indomethacin aldo-keto reductase family 1, member C3 inhibitor
MDV3100 Androgen receptor antagonist and prevents androgen receptor
nuclear accumulation
EPI-001 Androgen receptor N-terminal domain inhibitor
Abiraterone acetate: 5α-reductase type I synthesize dihydrotestosterone from adrenal
androgens. This led to new drug Dutasteride that inhibits both isoforms of 5α-reductase
(Wurzel et al., 2007). C17, 20-lyase is the enzyme that converts progesterone to Δ4-
androstenedione in the internal androgen synthesis pathway. Abiraterone acetate targets
this enzyme and inhibits the initial steps in the formation of dihydrotestosterone from
adrenal androgens. Abiraterone acetate that inhibits dihydrotestosterone synthesis results
in diverting pregnenolone into desoxycorticosterone that has glucocorticoid activity.
Therefore, abiraterone acetate is co-administered with dexamethasone to block
adrenocorticotrophic hormone (ACTH) formation. Abiraterone acetate is an FDA
approved drug for prostate cancer treatment (Attard et al., 2009).
26
Other inhibitors of adrenal androgen synthesis pathway: Ketoconazole is a less effective
lyase inhibitor than abiraterone acetate and is effective against prostate cancer
progression. Aldo-keto reductase family 1, member C3 (AKR1C3) is downstream of
C17-20 lyase and converts Δ4-androstenedione to testosterone. Increased expression of
aldo-keto reductase family 1, member C3 in prostate cancer led to use of aldo-keto
reductase family 1, member C3 inhibitor indomethacin in prostate cancer patients.
Figure 1-2 Alternate pathway for androgen synthesis
Cai C, Balk S P Endocr Relat Cancer 2011;18:R175-R182
Inhibitors of androgen receptor nuclear entry: MDV3100 is a new drug in the class of
androgen receptor antagonist. It reduces nuclear accumulation of androgen receptor and
inhibits the downstream transcriptional events. This drug is under review for FDA
approval. Another small molecule that binds and inhibits nuclear accumulation of
27
androgen receptor is a selective nuclear receptor exporter I inhibitor (Narayanan et al.,
2010). Androgen receptor N-terminal domain inhibitor: Recently, screening of a library
of marine sponge extracts led to the identification of inhibitor of androgen receptor N-
terminal domain, EPI-001 that structurally resembles Bisphenol A Diglycidic Ether
(Andersen et al., 2010). EPI-001 blocked androgen receptor N/C interaction, reduced the
interaction of CREB (cAMP response element binding) binding protein with androgen
receptor N-terminal domain and inhibited transactivation of full-length androgen receptor
or mutants lacking ligand binding domain. Further, it did not affect androgen receptor
protein level or its nuclear import or its post-translational modification. It reduced tumor
volume in LNCaP xenografts and LTL313 xenograft of patient-derived prostate tumor
obtained by needle biopsy with no apparent toxicity (Andersen et al., 2010).
Elk1
Elk1 is a member of the Ets (E twenty-six) oncogene family of transcription
factors and a nuclear phosphoprotein (Rao et al., 1989). It was identified initially as a
transcriptional activator of immediate early genes (Rao and Reddy, 1992a). Further
studies determined that the full length Elk-1 showed transcriptional repression (Yang et
al., 2002). It was identified due to its similarity in DNA binding sequence and ternary
complex factor formation to the c-fos regulatory factor p62 (Hipskind et al., 1991). The
ternary complex factor formation was first identified from the association of p62 with
serum response factor bound to serum response element at the c-fos promoter (Shaw et
al., 1989).
Ternary complex factors: Elk-1, Elk-3 (Sap2 or Net) and Elk-4 (Sap1) form the family of
ternary complex factors (Wasylyk et al., 1998). The ternary complex factors are 73%
28
identical in their DNA binding domain and have identical c-fos serum response element
binding affinities (Pingoud et al., 1994; Price et al., 1995). Their activation domains are
highly conserved but less than their DNA binding domain (Balamotis et al., 2009). They
share clusters of sequence identity that include the serine residues whose phosphorylation
results in activation. In the absence of serum response factor, Elk-1 binds to ETS-binding
sites (Yamauchi et al., 1999). Genomic footprinting studies show that the ternary
complex is present at the serum response element even in unstimulated cells (Herrera et
al., 1989; Konig et al., 1989). Though Elk-1 binding is sub-optimal in the presence of
serum response factor binding, the formation of this ternary complex factor is very
essential for c-fos promoter activation. This is evident from c-fos promoter mutants that
can bind serum response factor but cannot form the ternary complex did not respond to
12-O-tetradecanoylphorbol-13-acetate or v-raf (Graham and Gilman, 1991; Hill et al.,
1994; Konig et al., 1989; Kortenjann et al., 1994).
Elk-1 Transcript
Elk-1 gene has seven exons and six introns with the coding region encompassing
exons III to VII and is located on chromosome Xp11 (Araud et al., 2007; Rao et al.,
1989). Elk-1 is expressed in brain, thymus and testis and in HeLa cells (Hollenhorst et al.,
2007; Rao et al., 1989). Elk-1 encodes a 428 amino acid polypeptide with an estimated
relative molecular weight of 45 KD. Its initiation codon at nucleotide 316 is preceded by
another initiation codon upstream. But since there is a stop codon between the 2 initiation
codons, the initiation codon downstream of stop codon is taken as the start site. Elk-1
differs from other Ets proteins in having its Ets DNA-binding domain located at the
amino terminus of the protein (Hipskind et al., 1991; Reddy and Rao, 1990). Elk-1 is rich
29
in proline, serine, leucine, glycine and alanine (Rao et al., 1989) and is hydrophilic except
the amino and carboxy terminal portion of Elk-1.
Elk-1 Domains
The ternary complex factors contain four closely related domains – N-terminus
Ets-DNA binding domain, serum response factor interaction domain, transactivation
domain and R domain. The Ets-DNA binding domain or A box linked by a glycine-
proline-rich linker to B box, spans from 1-85 amino acids (Rao and Reddy, 1992b). The
linker is essential for ternary complex formation (Shore and Sharrocks, 1994).
Structurally, the three α-helices of Elk-1 ETS domain are packed against four antiparallel
β-strands to form a ‘winged helix-turn-helix structure (Mo et al., 2000). Nuclear
localization signal and nuclear export sequences are present in the A domain and in the
region between 137-157 amino acids (Janknecht et al., 1994). The DNA-binding
properties of ETS proteins share an invariant GGA core and the DNA specificity could be
due to the variable nucleotides surrounding the GGA core (Hollenhorst et al., 2007).
The serum response factor interaction domain or B box is a short region of 20
amino acids (Rao and Reddy, 1992b; Shore and Sharrocks, 1994). The serum response
factor (SRF) need not bind to serum response elements but needs to be dimeric for its
interaction with Elk-1. The presence of A-box and an extended B-box is sufficient to
form ternary complex (Janknecht and Nordheim, 1992).
Elk-1 has a carboxyl-terminal phosphorylation-activated 49 amino acid long
transcriptional activation C domain (Marais et al., 1993) and a mitogen activated protein
kinase-docking site in the D domain. (Buchwalter et al., 2004; Ducret et al., 2000;
Hassler and Richmond, 2001; Janknecht et al., 1993; Janknecht et al., 1994; Shore and
30
Sharrocks, 1994; Yang et al., 1999; Yang et al., 1998a; Yang et al., 1998b). The
transcriptional activation C domain has multiple serine and threonine residues that are
phosphorylation targets of mitogen activated protein kinases.
Elk-1 phosphorylation: The phosphorylation of Elk-1 also increases its capacity to form
ternary complex (Gille et al., 1992). Elk-1 has nine consensus sites for extracellular
signal-regulated kinases, most of which are phosphorylated in vivo by mitogens (Gille et
al., 1995; Marais et al., 1993). The phospho-acceptor sites on Elk-1 include Ser 383,
Ser389, Ser324, Ser422 and Thr336 that are phosphorylated by signal-regulated kinases.
Mitogen activated protein kinase mediated phosphorylation of Ser383 and Ser389 is
necessary for ternary complex formation and c-fos promoter activation (Gille et al.,
1995). Mitogen activated protein kinase plays an important role in Elk-1 regulation
(Janknecht et al., 1993; Kortenjann et al., 1994).
Elk-1 repression: Elk-1 mediated transient and rapid activation of immediate early genes
c-fos and egr-1 for example, in response to mitogenic and stress signals needs a
controlled regulation of activation and repression events. This is facilitated by a
repression domain called R domain that forms the negative feedback loop (Yang et al.,
2002). R domain spans from 230 to 260 amino acids and the residues 244 to 260 is
critical for the repressive function. The two amino acid residues important for the
repressive activity are lysine at 249 and glutamic acid at 251. A repressive motif is also
present in the ETS DNA binding domain as evident from the promoter repression. Both
the ETS DNA binding region and the R domain mediate basal transcription repression by
sumoylation (Shaw and Saxton, 2003) and recruitment of histone deacetylase complex.
The repressive regions exert their effects at gene promoters that contain direct Elk-1
31
binding regions or regions containing Elk-1 and serum response factor co-occupancy
(Yang et al., 2002). In particular, Elk-1 ETS domain represses transcription by
recruitment of the mSin3A-HDAC complex (Yang et al., 2001). In contrast to the highly
conserved A, B and C domain amongst the ternary complex factors; the R domain is not
conserved. Thus, the R motif may contribute to the Elk-1 specificity of the target gene
activation. The Elk-1 R motif is conserved similar to the R motif in the p300 repression
domain (Yang et al., 2002).
Elk-1 and its protein-protein interactions
Elk-1 binds to the ETS binding motif on the DNA, dependent or independent of
its direct association with serum response factor dimer (Herrera et al., 1989). Elk-1 binds
to DNA as a monomer but exists in the cytosol as a dimer (Evans et al., 2011)
independent of its phosphorylation status (Drewett et al., 2000). Ekl-1 binds to sub-
optimal binding site and binds DNA less stringently when it associates with serum
response factor dimer (Treisman et al., 1992). The full-length Elk-1 cannot bind to its
sub-optimal Elk-1 binding site in the absence of serum response factor. This is attributed
to conformational constraint on the full-length Elk-1 protein to bind to low-affinity DNA
sequences. The interaction of serum response factor with Elk-1 causes a conformational
change in Elk-1 that allows it to bind to the DNA. Elk-1 does not interact with serum
response factor in solution and requires both Elk-1 and serum response factor binding
sites to interact. The amino acids 1-14 of Elk-1 are not essential for DNA binding but
play a role in ternary complex formation through the serum response factor interaction
domain that lies between 89-205 amino acids (Rao and Reddy, 1992b). The Elk-1-serum
response factor ternary complex regulates transcription of the immediate early genes c-
32
fos, egr-1 (Herrera et al., 1989). Elk-1 and serum response factor co-localize at the
promoter regions with 500bp of each other (Boros et al., 2009a).
Elk-1 and its ETS binding site: Elk-1 binds to an optimal high affinity binding site 5’-
ACCGGAAGT-3’ in the absence of its interaction with serum response factor (SRF) (Mo
et al., 2000) and regulates basal transcriptional factors, ribosomes and the spliceosomal
pathway (Boros et al., 2009a; Boros et al., 2009b). Chromatin immunoprecipitation-
microarray chip (ChIP-chip) performed in serum-starved HeLa cells showed a large
number of Elk-binding promoter regions without a serum response element. It also
showed that 31% of Elk-1 binding regions contained the high affinity binding sequence
(Boros et al., 2009a). On the other hand, in association with serum response factor (SRF),
Elk-1 selects for GGAT and GGAA in the central motif (Treisman et al., 1992). The
ChIP-chip study on serum-starved HeLa cells showed that 71% of Elk-1 binding regions
were centered within 1Kb of the transcription start site and contained multiple Elk-1
binding motifs (Boros et al., 2009a).
Elk-1 promoter redundancy: Elk-1 shows promoter redundancy with GA binding protein
alpha chain (GABPA) and Elk-4. In the absence of Elk-1 association with serum response
factor, a significant portion of the promoter region bound by Elk-1 is co-occupied by GA
binding protein alpha chain (GABPA) (Boros et al., 2009a). Co-occupancy of Elk-1 and
serum response factor, and promoter redundancy of Elk-1 with GA binding protein alpha
chain or Elk-4 are mutually exclusive events (Boros et al., 2009a). In addition to serum
response factor, Elk-1 associates with basal transcription factors involved in initial
promoter recognition such as TBP and a subset of TBP associated factors (Boros et al.,
2009a; Zhong et al., 2007). Elk-1 also shows redundancy in promoter occupancy with
33
FLI-1 in differentiated and undifferentiated monocytic-like U937 cells (Boros et al.,
2009b). Elk-1 was the major binding protein on the FOS and MCL1 promoters in U937
cells. This could be because at these gene promoters, serum response factor promotes
selectivity in ETS-domain protein binding (Boros et al., 2009b).
Elk-1 and its tethering protein: Peptidyl arginine deiminase 4 (PADI4) is an enzyme that
catalyzes the conversion of histone arginine residue to citrulline. Elk-1 recruits peptidyl
arginine deiminase 4 to c-fos promoter region and PADI4 increased extracellular signal-
regulated kinase-mediated Elk-1 phosphorylation via Elk-1 citrullination (Zhang et al.,
2011).
Mechanism of Elk-1 activation
Elk-1 is the final effector of activation of mitogen activated protein kinase, c-Jun
N-terminal kinase or p38 pathway. The three mitogen activated protein kinases are
activated by different stimuli. The extracellular signal-regulated kinase is activated by
mitogens while the Jun N-terminal kinase and p38 pathways are activated by stress
(Balamotis, et al., 2009). ETS family of transcription factors are the terminal effectors of
mitogen activated protein kinases (Robinson and Cobb, 1997; White and Sharrocks,
2010). Growth factors, stress or hormones activate Ras. The active GTP-bound Ras
recruits Raf to the plasma membrane. Raf phosphorylation and its interaction with
phospholipids and 14-3-3 protein cause its activation. Activated Raf phosphorylates Mek
which phosphorylates and activates the mitogen activated protein kinase (MAPK) and
extracellular signal-regulated kinase regulated kinase 1/2. The activated extracellular
signal-regulated kinase dimerizes, translocates to the nucleus and activates Elk-1
(Figueroa and Vojtek, 2003; Pearson et al., 2001). The type of pathway involved in Elk-1
34
phosphorylation varies with cell type and the type of stimulus. For example, extracellular
signal-regulated kinase regulated kinase 1 and 2 activate Elk-1 in BAC-1 macrophages
while c-Jun N-terminal kinase and p38 activate ELK-1 in NIH 3T3 cells and c-Jun N-
terminal kinase alone stimulates Elk-1 in CHO cells. Thus, the cell type specific
differences lead to differential effects of extracellular signal on Elk-1 activation
(Wasylyk et al., 1998).
Elk-1 Functions
Elk-1 knock-out in mice is not lethal and does not show strong phenotypical
abnormalities (Cesari et al., 2004b). The immediate early genes c-fos and Egr-1 are
regulated by both megakaryoblastic leukemia1/2 (MKL1/2) and Elk-1 under serum
induction. Megakaryoblastic leukemia1/2 activates serum response factor and vinculin
gene while megakaryoblastic leukemia1/2 and Elk-1 together activates c-fos and Egr-1
gene expression. Elk-1 exerted both activation and repressive functions independent of
megakaryoblastic leukemia1 on immediate early genes, c-fos and Egr-1 and, serum
response factor depending on the presence or absence of serum (Lee et al., 2010).
Elk-1 Co-Activators and Co-repressors
Elk-1 is activated by phosphorylation of Ser 383, Ser 363 or Ser 324 by p38, c-
Jun N-terminal kinase or extracellular signal-regulated kinase regulated kinase
(Janknecht et al., 1993). Phosphorylated Elk-1 undergoes conformational changes (Yang
et al., 1999) and activates transcription by recruiting co-activators p300/CBP and MED23
(Janknecht and Nordheim, 1996; Li et al., 2003; Stevens et al., 2002). Elk-1 forms a pre-
assembled Elk-1-CREB (cAMP response element binding) binding protein co-activator
complex at target enhancer elements (Janknecht and Nordheim, 1996; Nissen et al.,
35
2001). Elk-1 phosphorylation enhances Elk-1 DNA binding activity and also the affinity
of the Elk-1 C-terminus for p300 co-activator. Phosphorylation of Elk1 fragment
containing D-domain enhanced its interaction with bromo domain of p300 and the
domain with histone acetyltransferase activity. Elk-1 phosphorylation enhances p300
histone acetyltransferase activity (Li et al., 2003). PIASx, member of protein inhibitor of
activated STAT family functions as co-activator to remove SUMO and HDAC-2 from
Elk-1 and supports Elk-1 mediated transcriptional activation (Yang and Sharrocks, 2005;
Yang and Sharrocks, 2006).
Elk1 Target Genes
The well established Elk-1 target genes are the immediate early growth response
genes Egr-1 and c-fos. These growth response genes are activated through a ternary
complex that includes serum response factor (SRF) and the ternary complex factor Elk-1.
Elk-1 interacts with serum response factor that binds to its response elements called
serum response element (SRE). The interaction of Elk-1 with serum response factor
requires a CAGGA tract immediately upstream of the serum response factor. Mitogen
activated protein kinase signaling regulates transcription factor binding protein (TBP)
that is essential for general and gene specific transcription. Epidermal growth factor
stimulates transcription factor binding protein synthesis that is regulated by Elk1. Elk1,
FOS and JUN bind to and cause incremental activation of transcription factor binding
protein promoter (White and Sharrocks, 2010). Elk1 directly targets TAFIIA and B, and
genes encoding the core spliceosome subunits (White and Sharrocks, 2010).
36
Chapter 2
Androgen receptor and C/EBPα interaction in folate receptor α gene activation in
human trophoblasts and cancer cells
Suneethi Sivakumaran*, Juan Zhang*, Karen M. M. Kelley*, Mesfin Gonit, Hong
Hao, Robert Trumbly, Manohar Ratnam
Abstract
Folate receptor α is a major folate transporter in several tissues and in placenta.
Embryogenesis involves the interplay between the hormones, growth factors and
cytokines. The hormone secretions vary between the trimesters; progesterone receptor
and androgen receptor levels increase while estrogen receptor levels decrease during the
first trimester. While the estrogen and progesterone effects on folate receptor α gene has
been studied, the effect of androgens on folate receptor α gene has not been examined.
We show that androgen activated androgen receptor binds to response elements in the
folate receptor α gene promoter and causes gene activation. CAAT enhancer binding
protein α (C/EBPα) binds to its binding sites in the folate receptor α gene promoter and
interacts with androgen receptor. We mapped the androgen receptor and CAAT enhancer
binding protein α binding sites to between 1565 to 1535 nucleotides upstream of
transcription start site. This region lies between the distal P1 and
37
proximal P4 promoters. Androgen receptor mediated folate receptor α gene activation
required androgen receptor co-activators. These findings suggest an alternate mechanism
for folate receptor α gene regulation. The results underscore the importance of androgen
receptor in pregnancy and in folate receptor α positive cancer.
Introduction
1.1 Folates in development
Embryogenesis is a rapid and dynamic process of growth and differentiation with
elevated rates of synthesis of nucleic acids and proteins. The biosynthesis reflects the
increased cell number in a short period of time. It is dynamic because the zygote
undergoes several changes in cell division and differentiation leading to the formation
and organization of functional organelles and organ systems. Folic acid as a methyl donor
is essential for nucleic acid and protein biosynthesis and DNA methylation during
embryogenesis and for cancer cells (Blount et al., 1997).
Folic acid was identified by Lucy Wills in 1931 as a yeast extract constituent
effective against macrocytic anaemia in pregnant women. The structure of folic acid is
illustrated in figure 3-1. Humans cannot synthesize folates and require them in the diet:
sources include green leafy vegetables, citrus fruits and liver, to name a few (reviewed by
Lucock 2000). Dietary forms of folate are 5-methyltetrahydrofolate, and
formyltetrahydrofolate. Dietary folates are transported across the enterocyte brush border
by an anion exchange mechanism driven by a transmembrane pH gradient (Bailey and
Gregory, 1999). After absorption, the 5-methyltetrahydrofolate is released into the portal
circulation. The reabsorption of folates by proximal kidney tubules prevents loss in urine
38
and thus helps circulating levels of 5-methyltetrahydrofolate. 30-40% of endogenous
plasma folates are bound with low-affinity to albumin, α2-macroglobulin and
transferring.
Pteridine ring p-amino benzoyl glutamic acid
Pteroic acid Glutamic acid
Tetrahydrofolate orFigure 2-1

tetrahydropteroylmonoglutamate
Figure 2-1 Structure of Folic Acid

Adapted from Lucock et al., (2000) 71 (1-2):121-138
Folates are also bound by high-affinity membrane folate receptors (Kd ~1nM).
The folate receptors become abundant during folate deficiency and pregnancy, and are
present at high levels in serum of umbilical cord blood. Cellular folate receptors are
bound to the plasma membrane on the apical surface through a C-terminal
phosphatidylinositol anchor. Folate receptors mediate four important enzymatic reactions
within a cell. These include

39
1. Methylation of homocysteine to form methionine
Methionine synthase
Homocysteine 5-methyl tetrahydrofolate
Methionine
Tetrahydrofolate
Figure 2-2 Conversion of homocysteine to methionine
Methionine synthesized is utilized in the presence of ATP to form S-
adenoyslmethionine catalyzed by the enzyme methionine adenosyltransferase. S-
adenosylmethionine is used to methylate biomolecules like phosphatidylcholine and
epinephrine.
40
2. Methylation of deoxyuridylate monophosphate to deoxythymidylate
monophosphate
Thymidylate
synthase
5, 10-methylene
tetrahydrofolate
Deoxy uridylate
monophosphate
Deoxy thymidylate
monophosphate
Dihydrofolate
Figure 2-3 Synthesis of deoxythymidylate monophosphate
Deoxy uridylate monophosphate utilizes one carbon unit from 5, 10-methylene
tetrahydrofolate to form pyrimidine, deoxy thymidylate monophosphate catalyzed by
Thymidylate synthase. Deoxy thymidylate monophosphate is incorporated in DNA
synthesis.
41
3) Methylation of ribonucleotides to form purine
N10-formyl tetrahydrofolate Tetrahydrofolate
Aminocarbaxamide ribotide
transformylase
5-formamidoimidazole-4-
Aminoimidazole-4- carboxamide ribotide
carbaxamide ribonucleotide
(AICAR)
Inosine monophosphate H2O
cyclohydrolase
Inosine monophosphate
Figure 2-4 Synthesis of inosine monophosphate
Inosine monophosphate is converted to xanothosine monophosphate by inosine
monophosphate dehydrogenase. Xanthosine monophosphate is intermediate in purine
42
synthesis and is converted to guanosine monophosphate by guanosine
monophosphate synthase.
3. Conversion of serine to glycine by serine hydroxymethyltransferase.
Serine
Hydroxymethyl
Transferase
NAD+
NADH + H+
Serine
5, 10-methylene
tetrahydrofolate
H2O
Glycine
Tetrahydrofolate
Figure 2-5 Synthesis of glycine
Serine is reversibly converted to glycine by utilizing one carbon unit from 5, 10-
methylene tetrahydrofolate. Serine hydroxymethyl transferase catalyzes this reaction and
requires vitamin B6 as cofactor.
Dietary folic acid is transported from the maternal circulation to the fetus through
placenta (Henderson et al., 1995). Reduced folate carrier and folate receptors facilitate
the transport of folic acid from the circulation into the cells (Antony, 1996). Placental
folate receptor α binds folates with higher affinity than folate receptor β (Weitman et al.,
1992a). Folate receptors are glycoproteins anchored to the luminal surface of the cell
membrane through their glycosylphosphatidylinositol anchor. The number of N-linked
glycosylation motifs N-X-S/T varies between the folate receptor types. At least one or
43
two glycosylated residues are required for the receptor stability and cell surface
expression (Roberts et al., 1998). There are three folate receptors – folate receptor α, β
and γ. Folate receptor α which has broader tissue distribution than β and γ (Henderson,
1990), is expressed in epithelial cells of the placenta, ovary, choroid plexus, salivary
glands, proximal kidney tubules, breast, lung, fallopian tubes, uterus and endocervix
(Weitman et al., 1992b). Folate receptor β expressed in placenta, binds the unphysiologic
(6R)-diastereoisomers of 5-methyltetrahydrofolate and 5-formyltetradhydrofolate (Wang
et al., 1992).
Folate receptor α is essential for the normal fetal growth (Blount et al., 1997).
Folate receptor α nullizygous embryo has retarded growth and development, neural tube
defects and is lethal in mice. The heterozygous folate receptor α deficient dams had
reduced plasma folic acid compared to wild type dams. This result demonstrates the
significance of folate receptor α in maternal-fetal folate transport in embryonic viability
(Piedrahita et al., 1999).
Role of steroid hormones in folate receptor α gene regulation
The sex hormones and their receptors facilitate the complex well-coordinated
regulation of embryogenesis (Horie et al., 1992). Progesterone secretion increases during
the post-ovulatory phase to support differentiation and inhibits estrogen effects on cell
proliferation. These hormones also regulate the Folate receptor α gene (Hao et al., 2007;
Kelley et al., 2003; Shatnawi et al., 2007). Progesterone receptor mediated activation and
estrogen receptor mediated repression of the folate receptor α gene coincides with the
progesterone surge and estrogen decline soon after implantation (Tan et al., 1999).
Androgens and androgen receptor which have major effects on male reproductive system
44
have physiological effects in female reproductive systems also. Their role in female
reproductive system is evident from studies on androgen receptor functions in
endometrial cells and ovaries (Hillier, 1987; Neulen et al., 1987). Immunohistochemical
study showed androgen receptor nuclear staining in trophoblastic cells from pregnant
women. The androgen levels remain high during the secretory or luteal phase of the
menstrual cycle and androgen receptor expression is evident in the deciduas during the
first-trimester of pregnancy (Cloke and Christian, 2011). Androgen receptor activity
during fetal growth is due to direct effects of androgens and indirect effects of estrogen
formed by aromatization of androgens (Horie et al., 1992; Mooradian et al., 1987).
Androgen receptor also regulates genes associated with cytoskeletal organization and
motility of decidualizing cells (Cloke et al., 2008). Though androgen receptor is
expressed in placenta, its role in folate receptor α regulation remains to be elucidated. In
this study, we show that the folate receptor α promoter has androgen receptor and CAAT
enhancer binding protein α binding sites. The androgen receptor and CAAT enhancer
binding protein α bound at the folate receptor promoter activates the gene by recruiting
androgen receptor co-activators.
45
Results
Androgen receptor activates folate receptor α expression in human trophoblast cells
and cancer cells
Steroid receptors like estrogen receptor and progesterone receptor regulate folate
receptor α regulation (Kelley et al., 2003; Shatnawi et al., 2007). The androgen receptor
expression exerts its effects during placentation; and its role in folate receptor α gene
regulation has not been characterized. We examined androgen receptor mediated
regulation of folate receptor α gene by employing HeLa cells that express folate receptor
α but not the androgen receptor, and T47D cells expressing androgen receptor and folate
receptor α. Endogenous folate receptor α-bound folate in HeLa cells is removed by
washing and cells incubated with fluorescein-conjugated folic acid. The cells were
transfected with androgen receptor and treated with 10 nM testosterone to facilitate the
entry of androgen receptor into the nucleus (Zhang et al., 2010). The functional folate
receptor α expression is measured by FACS analysis. Figure 1A shows that testosterone
activated androgen receptor increased folate receptor α cell surface expression. In the
absence of testosterone or androgen receptor, there is no effect on folate receptor α cell
surface expression. We asked if androgens affect folate receptor α mRNA and protein
expression in cells expressing androgen receptor. To determine this, we measured folate
receptor α mRNA and protein expression in T47D cells expressing endogenous androgen
receptor. Androgen treatment increased the folate receptor α mRNA and protein
expression in T47D cells (figure 1B). The greater increase in folate receptor α protein
expression over that of its mRNA expression may reflect increased mRNA turnover,
46
increased translation efficiency or increased stability of folate receptor α protein.
Androgen receptor mediated increase in folate receptor α expression could be specific to
cancer cells. We tested the effect of androgen receptor on folate receptor α expression in
ACH-3P immortalized human placental trophoblast cells. As shown in Figure 1B,
androgen treatment increased the folate receptor α mRNA and protein expression. These
results show that androgen receptor causes increased folate receptor α expression in
normal and malignant cells.
Folate receptor α mRNA and protein expression may result from activation of the
transcription of its gene. To test this idea, we determined the effect of androgen and
androgen receptor on folate receptor α promoter activity. We used HeLa cells for the ease
of transfection and transfected the cells with folate receptor α promoter reporter plasmid
with P1 and P4 promoter or empty vector PGL3 basic reporter plasmid and androgen
receptor expression plasmid. The cells were treated with vehicle or 10 nM testosterone to
promote entry of androgen receptor into the nucleus (Zhang et al., 2010). Androgen
receptor in the presence of testosterone caused the activation of the folate receptor α
promoter (Figure 1C). We used PGL3 basic empty vector as a negative control and SV40
promoter reporter vector to show that androgen receptor effects are specific to folate
receptor α promoter.
Androgen receptor activation of folate receptor α promoter mimics that of prostate
specific antigen promoter and identification of androgen response elements
A classical target gene of androgen/androgen receptor is prostate specific antigen
(Lemaitre et al.); its expression increases with increase in testosterone dose with optimum
expression at 10 nM. Our results showed that testosterone and androgen receptor
47
activated folate receptor α promoter activity (Figure 1C). We compared androgen
receptor mediated prostate specific antigen promoter activation with folate receptor α
promoter activation. We transfected HeLa cells with an androgen receptor expression
plasmid and the folate receptor α promoter reporter or prostate specific antigen promoter
reporter and treated with different doses of testosterone. Figure 2A showed that
increasing dose of testosterone increased the activation of folate receptor α promoter
reporter in a similar pattern as prostate specific antigen promoter reporter. Folate receptor
α promoter reporter activation increased with a time course similar to that of the prostate
specific antigen promoter reporter (figure 2B).
The effects on folate receptor α expression could be due to androgen receptor
mediated activation of the synthesis of proteins of other signaling pathways or the
synthesis of proteins that act on the folate receptor α gene. We tested this possibility by
transfecting HeLa cells with a folate receptor α promoter reporter plasmid, an androgen
receptor expression plasmid and treating the transfected cells with vehicle or
cycloheximide or 10 nM testosterone and cycloheximide. After the indicated periods of
treatment (figure 2 legend and figure 2C), cells were harvested for total RNA preparation
and for measurement of luciferase activity. Cells treated with testosterone showed a
seven fold increase in luciferase mRNA expression by qRT-PCR and five fold increase in
luciferase activity. Luciferase mRNA expression and luciferase activity diminished with
cycloheximide treatment. Cells treated with cycloheximide and testosterone showed no
luciferase activity but showed an eleven fold increase in luciferase mRNA expression.
These results suggest that the effects of testosterone and androgen receptor on folate
receptor α mRNA accumulation do not require protein synthesis. This result excludes
48
explanations that involve synthesis of proteins that act directly or indirectly to increase
the level of folate receptor α mRNA expression.
Androgen receptor activates folate receptor α gene expression by binding to
androgen response elements at the folate receptor α promoter
Folate receptor α gene consists of two TATA-less promoters, the proximal P4
promoter and the distal P1 promoter. The testosterone dose-dependent increase in folate
receptor α mRNA suggests the presence of androgen response elements in the folate
receptor α P1 or P4 promoters. We examined promoter deletions and mutations to
identify the region in the promoters that mediate the androgen receptor effects. HeLa
cells were co-transfected with androgen receptor and the folate receptor α promoter
constructs and treated with testosterone as shown in figure 3A. Deletion of the P1
promoter (ΔP1) had little effect on the folate receptor α reporter activation while the P4
promoter deletion (ΔP4) significantly reduced the reporter activity. The P4 promoter
construct lacking the P1 promoter and the upstream elements exhibited diminished
activity similar to deletion of the P4 promoter. The P4 promoter alone lacks the elements
required to elicit the effects of testosterone. Therefore, we tested the effects of androgen
receptor on P4 promoter and portion of the regions 5’ to the P4 promoter. The regions are
numbered with the transcription start site designated as +1. The region spanning -1565 to
+33 nucleotides showed increased promoter reporter activity in the presence of androgen
receptor and testosterone (Figure 3A). When 10 nucleotides were deleted 3’ to -1565nt;
the region between -1555 to +33 nucleotides resulted in diminished reporter activity
indicating that the androgen receptor responsive region lies between -1555 to -1565
nucleotides. To identify the 5’ boundary of the androgen response elements, mutations
49
were introduced as shown in Figure 3A. The mutations at -1533 to -1530nt did not
diminish the reporter activity while the mutations in the region between -1534 to -1549nt
showed reduced reporter activity. These results show that the region between -1534 to -
1565nt responsible for androgen-mediated effects. We corroborated this result by
performing reporter assays using portions of the identified region and comparing the
reporter activity with the reporter vector containing androgen response elements. HeLa
cells were co-transfected with the reporter vectors as shown in Figure 3B, androgen
receptor expression plasmid and treated with 10 nM testosterone. Gal4-TATA-luc, a
commercially available reporter vector containing the luciferase reporter and Gal4
binding sites is a negative control. ARE-TATA-luc is the luciferase reporter vector with a
androgen responsive promoter with androgen response elements. Testosterone treatment
caused no activation of Gal4-TATA-Luc reporter vector, more than 6 fold induction of
androgen responsive promoter (ARE-TATA-Luc) and a 10 fold activation of reporter
vector containing the elements of the folate receptor α promoter spanning -1565 to -1536
nucleotides (genomic coordinates being 71,901,608 – 71,901,637 hg19 on chromosome
11). Testosterone caused eight fold increase in activation of reporter vector containing
elements of the folate receptor α promoter spanning -1565 to -1533 nucleotides (figure
3B). Testosterone caused a two fold induction of reporter vector containing folate
receptor α promoter spanning -1549 to -1536 nucleotides and -1565 to -1548 nucleotides.
These results indicate that the folate receptor α promoter region between -1565 to -1536
nucleotides is androgen and androgen receptor responsive region.
The promoter sequences could have overlapping transcription factor binding sites.
We examines the sequences for transcription factor binding sites using the MATCH
50
program (Kel et al., 2003) and the Transfac database (Matys et al., 2006). The
transcription factors with potential binding sites in folate receptor α promoter regions are
listed in figure 3C. Mutations were introduced in transcription factor cis-elements by
changing A-T pairs to G-C pairs and vice versa to identify the cis-elements that cause
folate receptor α promoter activation. We utilized a minimal promoter reporter vector
containing the mutated transcription factor cis-elements to test for the promoter activation
by androgen/androgen receptor. Mutations in the androgen response element half-site and
CAAT enhancer binding protein α site abrogated the promoter activation by
androgen/androgen receptor (figure 3C). demonstrating that androgen receptor and
CAAT enhancer binding protein α activate the folate receptor α gene. The reporter assays
show that androgen/androgen receptor increase folate receptor α mRNA and protein
expression by binding of androgen receptor and CAAT enhancer binding protein α to
their response elements at the folate receptor α promoter.
Androgen receptor and C/EBPα associate with each other at the folate receptor α
promoter
Androgen receptor and CAAT enhancer binding protein α (C/EBPα) activated
folate receptor α promoter. To test if androgen receptor and CAAT enhancer binding
protein α physically bind the folate receptor α promoter, we performed biotinylated target
DNA precipitation assays. We transfected HeLa cells with an androgen receptor
expression plasmid and treated with testosterone. Whole cell extracts were incubated with
biotinylated probe spanning the regions responsive to androgen receptor (-1570 to -
1533nt) for the assay. The biotinylated probes with the bound proteins were adsorbed to
streptavidin beads. The biotinylated adsorption experiment shows that androgen receptor
51
and CAAT enhancer binding protein α binding was most efficient with extracts from
testosterone treated cells (figure 4A). We used the following DNA probes as competitors
to determine the specificity of androgen receptor and CAAT enhancer binding protein α
interaction at the folate receptor α promoter: folate receptor α promoter region (-1570nt
to -1533nt) containing the ½ androgen response element and CAAT enhancer binding
protein α binding site, folate receptor α promoter region (-1570nt to -1533nt) with the
androgen response element half-site mutated (mA) and folate receptor α promoter region
(-1570nt to -1533nt) with both androgen response element and CAAT enhancer binding
protein α site mutated (dM). In the presence of wild type unlabelled probe, binding of
androgen receptor and CAAT enhancer binding protein α to the biotinylated probe
diminished. In the presence of excess (two hundred times) mutant probe as competitor,
Western blots showed the interaction between androgen receptor and CAAT enhancer
binding protein α though the band intensities were weaker. The decreased intensity in the
presence of mutant probe competitors may reflect non-specific binding of androgen
receptor and CAAT enhancer binding protein α to the mutant probe. Input for androgen
receptor and CAAT enhancer binding protein α showed their protein expression in the
transfected HeLa cell lysates. The biotinylated pull down using CAAT enhancer binding
protein α (three tandem repeats of C/EBPα utilized here) probe showed androgen
receptor and CAAT enhancer binding protein α interacted with each other. To extend
these findings to normal human placental trophoblasts, we performed co-
immunoprecipitation in ACH-3P trophoblast cells to demonstrate the interaction between
androgen receptor and CAAT enhancer binding protein α (Figure 4B). Whole cell lysates
of human trophoblast ACH-3P cells were immunoprecipitated with anti-androgen
52
receptor antibody and Western blot performed for androgen receptor and CAAT enhancer
binding protein α using anti-androgen receptor and anti-C/EBPα antibody respectively.
Immunoprecipitation of the lysates with normal IgG served as control. We used 0.3X
input for androgen receptor and CAAT enhancer binding protein α (C/EBPα) protein
expression. Immunoprecipitation showed that androgen receptor associates with CAAT
enhancer binding protein α.
These results indicate that androgen receptor and CAAT enhancer binding protein
α interact with each other on the folate receptor α promoter. The transcription factor
occupancy at a gene promoter in vivo is complex and determined by several factors. The
association and the activation effects seen in vitro may not mimic that of a cell’s nuclear
interior. We performed chromatin immunoprecipitation to determine if androgen receptor
was recruited at the endogenous folate receptor α gene promoter in HeLa cells and
human trophoblast cells ACH-3P. HeLa cells were transfected with His-tag androgen
receptor and treated with vehicle or 10 nM testosterone. The DNA bound proteins were
cross-linked with formaldehyde. After shearing the DNA, the androgen receptor bound
DNA fragments were immunoprecipitated using anti-His tag antibody. DNA fragments
bound by androgen receptor were quantitated using primers and probes that correspond to
the folate receptor α promoter region (-1565 to -1535nt identified as androgen
responsive). Immunoprecipitation with a non-immune IgG antibody in the presence or
absence of testosterone did not show androgen receptor association at the folate receptor
α promoter indicating lack of non-specific interaction (figure 4C). Testosterone caused
three fold increases in androgen receptor recruitment to the folate receptor α promoter
region over the vehicle-treated control. Chromatin immunoprecipitation was performed in
53
human trophoblast ACH-3P cells treated with vehicle or R1881 with non-immune IgG
antibody serving as a control. The control target in the figure is the promoter region that
is a non-specific target of androgen receptor (figure 4D). R1881 treatment resulted in
significant enrichment of androgen receptor at the folate receptor α promoter compared
to vehicle treatment and the non-target control promoter region. These results showed
that androgen receptor associates with the endogenous folate receptor α promoter in
HeLa cells and normal placental trophoblast cells.
Our previous studies (Zhang et al., 2010) showed CAAT enhancer binding protein
α tethered androgen receptor to a promoter lacking androgen response elements. This
tethering mechanism did not require testosterone. Testosterone was required to promote
androgen receptor entry into the nucleus. Folate receptor α promoter contains a half
androgen response element site and the androgen receptor tethering by CAAT enhancer
binding protein α could be androgen dependent (refer Figure 3C). To test this, we utilized
reporter assay and determined if androgen receptor and CAAT enhancer binding protein
α activate folate receptor α promoter in the presence or absence of androgen. We
transfected HeLa cells with folate receptor α promoter reporter (P4 promoter region -
1565 to -1535nt) construct or prostate specific antigen promoter reporter construct which
is a positive control, androgen receptor expression plasmid of different concentrations
and treated with vehicle or 10 nM testosterone. Folate receptor α promoter and prostate
specific antigen promoter activation increased with increased concentration of androgen
receptor expression plasmid in the presence of testosterone. Folate receptor α promoter
activation increased to three fold even in the absence of androgen treatment with 200ng
of androgen receptor expression plasmid (compare 200ng to 50ng of plasmid) and
54
androgens increased promoter activation by eight fold (figure 6A). Prostate specific
antigen promoter was activated in the presence of testosterone and not by vehicle
treatment. These results showed that the androgen receptor mediated folate receptor α
promoter activation is partially androgen-dependent. Taken together, these results
showed that CAAT enhancer binding protein α recruited androgen receptor at its cis-
elements on the folate receptor α promoter and is partially androgen dependent in
cervical cancer HeLa cells and human trophoblast ACH-3P cells.
Recruitment of androgen receptor co-activators is responsible for the androgen
receptor-mediated activation of folate receptor α gene
Androgen receptor exerts transcriptional activation by recruiting co-activators.
Our previous study (Zhang et al., 2010) showed that CAAT enhancer binding protein α
tethered androgen receptor to CAAT enhancer binding protein α binding sites at genes
lacking androgen response elements. This study also showed that CAAT enhancer
binding protein α mediated tethering of androgen receptor involved recruitment of
androgen receptor co-activators. We asked if a similar mechanism existed at the folate
receptor α promoter. We transfected HeLa cells with the folate receptor α promoter
reporter construct with the P4 promoter region (-1565 to -1535nt), and CREB (cAMP
response element binding) binding protein and Transcriptional intermediary factor 2
expression plasmid. Prostate specific antigen promoter reporter construct was used as
positive control. The cells were treated with 10 nM testosterone and luciferase assays
were performed at 48 hours. The co-activators CREB (cAMP response element binding)
binding protein and Transcriptional intermediary factor 2 induced folate receptor α
promoter and prostate specific antigen promoter to approximately three-fold. These
55
results show that androgen receptor co-activators CREB (cAMP response element
binding) binding protein and Transcriptional intermediary factor 2 are required for
androgen receptor effects on folate receptor α promoter.
Discussion
Our study identified the role of androgens in folate receptor α gene regulation in
placental trophoblast cells. Our results show that androgen receptor and CAAT enhancer
binding protein α bound to their response elements at the folate receptor α gene promoter.
Androgen/androgen receptor required androgen receptor co-activators to activate folate
receptor α promoter and this activation was not completely androgen-independent.
Androgen receptor physically associated with CAAT enhancer binding protein α in
placental trophoblasts.
Folate receptor α is necessary for folic acid transplacental transport and its
expression is upregulated during pregnancy. Its expression is also upregulated in non-
mucinous ovarian carcinoma, renal cell, lung and endometrial cancer (Parker et al.,
2005). Sex hormones guide embryogenesis that also needs folate receptor α. These
observations indicate that folate receptor α may be under the steroid hormone regulation.
Folate receptor α is regulated transcriptionally by the female sex hormones. Estrogen
receptor represses while progesterone receptor activates folate receptor α gene (Hao et
al., 2007; Kelley et al., 2003; Shatnawi et al., 2007). The androgen secretion peaks during
the first trimester and androgen receptor regulates genes associated with cytoskeletal
organization. Binding studies using fluorescein conjugated folic acid showed that
androgen receptor increases folate receptor α cell surface expression. The activated
androgen receptor also increased folate receptor α mRNA and protein expression in
56
trophoblast cells. Progesterone/progesterone receptor mediated folate receptor α gene
activation through Sp1 and Sp4 transcription factors unlike androgen receptor that bound
to its response elements at the folate receptor α promoter. The Sp1 and Sp4 binding
elements resided within the proximal P4 promoter (Shatnawi et al., 2007) while androgen
receptor binding sites lie in the region between P1 and P4 promoter. The effect of
androgen receptor on folate receptor α promoter activation does not require new protein
synthesis. In addition, we may overlook the effect of other transcription factors or co-
activators in utilizing an isolated folate receptor α promoter in these studies. A major
concern in our study is that normal placental cells may contain different complement of
transcription factors and transcriptional regulation that are not accurately mimicked in
HeLa cells. Accordingly, while the simplicity of the HeLa cell system is useful in
identifying the androgen responsive elements, it likely does not mimic more complex
regulation that occurs in normal trophoblasts.
The CCAAT-enhancer binding protein family of transcription factors is expressed
in trophoblast cells until the third trimester of pregnancy. The human CAAT enhancer
binding protein α is expressed at the highest level in the placenta (Antonson and
Xanthopoulos, 1995). Our co-immunoprecipitation results show that CAAT enhancer
binding protein α and androgen receptor interact in trophoblast cells and they associate on
the folate receptor α promoter. CAAT enhancer binding protein α is expressed until the
third trimester (Antonson and Xanthopoulos, 1995) while androgen receptor expression
increases during the first trimester suggesting that CAAT enhancer binding protein α may
exert effects independent of androgen receptor. Our promoter analysis suggests that
57
CAAT enhancer binding protein α and androgen receptor association may be important in
regulation of folate receptor α gene.
Our earlier results (Zhang et al., 2010) show that CAAT enhancer binding protein
α mediated recruitment of androgen receptor to CAAT enhancer binding protein α
binding sites requires androgen receptor co-activators and we obtained similar results in
this study. These results suggest that CAAT enhancer binding protein α may tether
androgen receptor to androgen receptor binding sites at the folate receptor α promoter.
Binding of CAAT enhancer binding protein α and androgen receptor at the folate receptor
α promoter could lead to synergistic effects on folate receptor α activation. Our study
shows androgen/androgen receptor mediated folate receptor α regulation and this may
involve CAAT enhancer binding protein α dependent tethering of androgen receptor. The
study gives significant insights into different modes of folate receptor α gene regulation
that could be utilized in understanding the complications of pregnancy and in folate
receptor α effects in cancer. It will also aid in designing better folate receptor α drug
targets in ovarian, lung, renal and endometrial cancer.
58
Materials and Methods
Chemicals and reagents
Dulbecco’s minimum essential medium (DMEM) and penicillin/streptomycin/L-
glutamine stock mix were purchased from Life Technologies, Inc. (Carlsbad, CA);
HAM’s F-12 medium from Lonza (Walkersville, MD) Fetal bovine serum (FBS) and
charcoal stripped FBS (CS-FBS) were from Invitrogen (Carlsbad, CA). FUGENE 6 was
from Roche Diagnostics (Indianapolis, IN). Luciferase assay reagents were from
Promega (Madison, WI). Affinity purified rabbit anti-human androgen receptor (sc-816),
rabbit anti-human C/EBP(sc-61), His-probe(sc-803), mouse anti-GAPDH (sc-47724),
and normal rabbit IgG control (sc-2027) were from Santa Cruz Biotechnologies (Santa
Cruz, CA). Vent DNA polymerase was from New England Biolabs (Beverly, MA).
Custom oligonucleotide primers and biotinylated oligonucleotide probes were from
Integrated DNA Technologies (Coralville, IA). Protein A-sepharose beads and
streptavidin sepharose beads were from Amersham (Uppsala, Sweden). The reagents for
RT-PCR and real-time PCR were purchased from Applied Biosystems (Branchburg, NJ).
R1881 was a gift from Dr. Lirim Shemshedini at the University of Toledo, Toledo, Ohio.
Cycloheximide was from Sigma-Aldrich.
DNA constructs and expression plasmids
Construct design used either existing restriction sites or restriction sites created by
PCR using Vent DNA polymerase (New England Biolabs) and synthetic
oligonucleotides. PCR products were digested with the appropriate restriction enzymes
and cloned into the pGL3-basic plasmid (Promega). The 5’ deletion constructs of the FR-
 promoter, i.e., FR- (-3394nt to +33nt), FR- P1 (-3113nt to +33nt), FR- P4 (-
59
3394nt to +33nt with the deletion from -146 nt to -34nt), FR- P4 (-176nt to +33 nt), -
1565nt to +33nt, and -1555nt to +33nt and the 3’ mutation constructs, i.e., mut(-1549nt to
-1546nt), mut (-1545nt to -1542nt), mut (-1541nt to -1538nt), mut (-1537nt to – 1534nt),
mut (-1533nt to -1530nt) were constructed by PCR using the appropriate primers and
subcloned at MluI (upstream) and XhoI (downstream) sites in the pGL3 basic plasmid.
For mutation constructs, the sequential 4-base mutations were obtained by changing A-T
pairs to G-C pairs and vice versa. GAL4-TATA-Luc plasmid (pG5luc) was purchased
from Promega. ARE-TATA-Luc (ARE- androgen response elements), FR- (-1565nt to -
1536nt), (-1565nt to -1533nt), (-1549nt to -1536nt), or (-1565nt to -1548nt)-TATA-Luc,
(C/EBP)3-TATA-luc, (C/EBP)3-ARE-TATA-luc were made by cloning appropriate
annealed oligos with the addition of KpnI(5’) and NheI(3’) terminal restriction sites into
the large segment of GAL4-TATA-Luc digested by KpnI and NheI. To generate ARE-
TATA-luc, a high affinity androgen response elements (ARE), AGTACGTGATGTTCT,
(Schoenmakers et al., 2000) was inserted upstream of the TATA box. The Renilla
luciferase transfection control was the pRL-null plasmid from Promega (Madison, WI).
The recombinant plasmids were amplified in E. coli strain XL1 Blue and purified using
the Qiagen plasmid kit (Qiagen, Chatsworth, CA). The cloned DNA sequence in each
construct was verified by automated DNA sequence analysis performed by Plant microbe
genomics facility at Ohio State University. The co-regulator expression plasmids were
provided by Dr. Brian Rowan at Tulane University. The full length PSG5-androgen
receptor expression plasmid and prostate specific antigen-luciferase reporter plasmid
were provided by Dr. Lirim Shemshedini.
60
Cell culture and transfection
HeLa (American Type Culture Collection) cells were cultured in Dulbecco’s
minimum essential medium (DMEM) supplemented with FBS (10%), penicillin (100
units/ml), streptomycin (100 µg/ml), and L-glutamine (2 mM). ACH-3P immortalized
human placental trophoblast cells (Hiden et al., 2007) (kindly provided by Dr. Ursula
Hiden at Medical University Graz, Austria) were cultured in HAM’s F-12 medium
supplemented with FBS (10%), penicillin (100 units/ml), streptomycin (100 µg/ml), and
L-glutamine (2 mM). T47D cells (American Type Culture Collection) were cultured in
RPMI-1640 medium supplemented with FBS (10%), penicillin (100 units/ml),
streptomycin (100 µg/ml), and L-glutamine (2 mM), 10mM HEPES, 1mM sodium
pyruvate and 0.2units/ml of bovine serum. To obtain hormone depletion, HeLa cells were
grown in phenol red-free media supplemented with charcoal-stripped FBS (5% v/v), L-
glutamine (2 mM), insulin (2 µg/ml), and transferrin (40 µg/ml) for 72h. Hormone
depletion in ACH-3P cells was achieved by growing them in HAM’s F-12 medium
supplemented with charcoal stripped FBS (10%). HeLa cells were transfected with DNA
constructs in 6-well plates (Corning, New York, NY) using FuGENE 6 (Roche
Diagnostics), according to manufacturer’s protocol. Reporter (500 ng) and expression
plasmid (25-100 ng) were used at the indicated amounts unless indicated otherwise.
Transfection efficiency and promoter specificity were controlled using the pRL-null
plasmid expressing Renilla luciferase and measurement of Renilla luciferase activity in
the cell lysates.
61
Assay of cell surface FRα
In the fluorimetric assay, cells were washed with cold acid buffer (10mM sodium
acetate, pH 3.5, 150 mM NaCl) to remove FR-bound endogenous folate. The cells were
washed with 4°C PBS [10mM sodium phosphate (pH 7.5), 150 mM NaCl] and incubated
with 5 nM fluorescein-conjugated folate (McAlinden et al., 1991) at 4°C for 30 min. The
cells were washed twice with PBS and the bound folate was measured by flow cytometry
as described (McAlinden et al., 1991). Non-specific background fluorescence was
measured by blocking with a 100-fold excess of unlabeled folic acid and these values
were subtracted. In the radiolabeling assay, cells were incubated with 27nM of [3H] folic
acid in serum free FFRPMI for 1h at 37°C. Cells were washed with ice cold PBS to
remove unbound radioactivity. Cells were washed with 1ml of 10 mM sodium acetate,
pH 3.5/150 mM NaCl for 1 min on ice. The acid wash eluate was counted by liquid
scintillation and represents the amount of [3H] folic acid bound. The cells were also
incubated with a 20-fold excess of unlabeled folic acid, relative to the amount of [3H]
folic acid added, to ensure the specificity of binding via FR. Assays were performed in
triplicate.
Luciferase assay
After incubation as indicated, transfected cells were washed with PBS and
harvested in 500 µl of renilla luciferase assay lysis buffer provided with the renilla
luciferase assay system (Promega).The culture plates were placed on an orbital shaker
with gentle shaking at room temperature for 15 min. The cell lysates were centrifuged for
30 seconds in a refrigerated microcentrifuge and the supernatant was used for
measurements of firefly or renilla luciferase activity using the appropriate luciferase
62
substrates from Promega in a luminometer (Lumat LB 9501; Berthold; Wildbad,
Germany). Luciferase assays were performed at least in triplicate.
Biotin-DNA pull-down assay
HeLa cells were transfected with androgen receptor expression plasmid or empty
vector. 48 hours after transfection, cells were treated with vehicle or testosterone (10 nM)
for 60 min, washed twice with PBS. Cell pellets were suspended in lysis buffer (400 mM
NaCl; 10 mM Tris, pH 8.0; 1 mM EDTA; 1 mM EGTA; 0.1% Triton X-100; 1 mM
PMSF; and 5 g/mL each of aprotinin, leupeptin, and pepstatin A) supplemented with
vehicle or testosterone (10 nM). The lysates were centrifuged at 16,000g for 10 min and
the supernatants were diluted 1:4 with dilution buffer (10 mM Tris-HCl, pH 8.0; 1 mM
EDTA; 0.5 mM EGTA; 10% glycerol; 0.25% Nonidet P-40) in the presence of ligand as
indicated. Cell lysates (300 µg) were incubated with 1 µg of the folate receptor α or
CAAT enhancer binding protein α (C/EBPα) biotinylated DNA probe, 10 g poly (dI-
dC) and with or without 200 g of appropriate unlabelled probe at 4oC on a rotary shaker
for 1 hour. The cell lysate mixture is incubated with 30 µl of 50% streptavidin-Sepharose
A beads overnight. The samples were centrifuged at 600g for 5 minutes, and the pellets
were washed four times with washing buffer (10 mM Tris-HCl, pH 8.0; 1 mM EDTA;
0.5 mM EGTA; 100 mM NaCl; 10% glycerol; 0.25% Nonidet P-40) in the presence of
ligand for 5 minutes with rotation. The proteins were released by boiling in 100 l SDS
gel loading buffer (62.5 mM Tris-HCl, pH 6.8; 10% glycerol; 2% SDS; 5% 2-
mercaptoethanol; and 0.05% bromophenol blue) and analyzed by Western blots to probe
for androgen receptor (AR) and CAAT enhancer binding protein α (C/EBP). The 5’
biotin-labeled probes were:

63
FR- (5’-biotin-AGGGTTTGTTCCCGCAGGAACTGAACCCAAAGGA TCAC);
(C/EBP)3 5’-biotin-(TGCAGATTGCGCCAATCTGCA)3. The unlabelled probes were:
wt (wild type cold probe for FR-; the sequence was the same as the biotin labeled FR-
probe), mA (FR- element with mutated androgen response element (ARE),
AGGGTTTTCTCGCGCAGGAACTG AACCCAAAGGATCAC), dm (FR- element
with double mutations in both androgen response element and CCAAT element,
AGGGTTTTCTCGCGCAGGAACGTCTCTTCGAGGATCAC).
RNA isolation, RT-PCR and real-time PCR
Total RNA from HeLa, T47D or ACH-3P cells was prepared using RNeasy Mini
kit (Qiagen). Reverse transcription PCR (RT-PCR) followed by real-time PCR was used
to measure mRNAs for luciferase as well as glyceraldehyde-3-phosphate dehydrogenase
(GAPDH). For the reverse transcription, 200 ng of total RNA was reverse transcribed
using random primers employing the High-Capacity cDNA Archive kit (Applied
Biosystems, Foster City, CA) The resulting cDNA was measured by quantitative real-
time PCR using the Real-time PCR master mix (Applied Biosystems) in the 7500
StepOne Plus Real Time PCR System (Applied Biosystems, Foster). The primers and
TaqMan probe for Luciferase, folate receptor α and GAPDH were obtained from
Integrated DNA Technologies, Inc. (Coralville, IA). Samples were assayed in triplicate
and normalized to GAPDH values in the same samples. Folate receptor α probe and
primers sequences are as follows:
Probe: 5’ 6-FAM-TCG GGA CAG GTT GAA CGG GAA CC 3’ 6-TAM
Sense primer: 5’ CCC CAA GGC CAA GGA GAA 3’
Antisense primer: 5’ CGG GAA CAA ACC CTA ACT GTT T 3’

64
Chromatin immunoprecipitation assay
HeLa cells were transfected with His- tagged androgen receptor expression
plasmid or vector. 48h after transfection, cells were treated with vehicle or testosterone
(10 nM) for 1h, washed with cold PBS and subjected to ChIP analysis using anti-His
antibody (sc-803) or normal IgG (sc-2027) following the procedure described previously
(Hao et al., 2007). The recruitment of His-androgen receptor to the FR- gene was
measured by real time PCR. Real-Time PCR analysis of chromatin-immunoprecipitated
products was performed using the following FR-α promoter primers and TaqMan probe:
FR-α promoter probe (-1913nt to -1935nt), 5'-6 FAM-
TCGGGACAGGTTGAACGGGAACC-3'; sense primer (-1876nt to – 1893nt), 5'-
CCCCAAGGCCAAGGAGAA-3'; and antisense primer (-1966nt to -1945nt), 5'-
CGGGAACAAACCCTAACTGTTT -3'. Samples were assayed in triplicate. Chromatin
immunoprecipitation in ACH-3P cells was performed by treating the cells with vehicle or
R1881. After 48 hours, chromatin immunoprecipitation was performed using rabbit anti-
androgen receptor antibody or normal rabbit IgG antibody. The recruitment of androgen
receptor to folate receptor α was performed as described for HeLa cells.
Co-immunoprecipitation assay
ACH-3P cells were hormone-stripped for 48 hours and treated with vehicle or
R1881. After 48 hours cells were lysed using RIPA buffer as described in
(Chattopadhyay et al., 2006). Cell extracts (150µg of protein) were used for
immunoprecipitation employing anti-androgen receptor antibody or normal IgG antibody;
Western blots were performed using anti-androgen receptor antibody or anti- CAAT
enhancer binding protein α.
65
Statistical analyses
All experimental values are presented as the mean ± SE. The statistical
significance of differences (P value) between values being compared was determined
using ANOVA.
References
1. Abraham, G. E. (1974). "Ovarian and adrenal contribution to ion." Oncogene

29(5): 723-738.
2. Antonson, P. and K. G. Xanthopoulos (1995). "Molecular cloning, sequence, and

expression patterns of the human gene encoding CCAAT/enhancer binding
protein alpha (C/EBP alpha)." Biochem Biophys Res Commun 215(1): 106-113.
3. Antony, A. C. (1996). "Folate receptors." Annu Rev Nutr 16: 501-521.
4. Antony, A. C., C. Utley, et al. (1981). "Isolation and characterization of a folate

receptor from human placenta." J Biol Chem 256(18): 9684-9692.
5. Bailey, L. B. and J. F. Gregory, 3rd (1999). "Folate metabolism and

requirements." J Nutr 129(4): 779-782.
6. Blount, B. C., M. M. Mack, et al. (1997). "Folate deficiency causes uracil

misincorporation into human DNA and chromosome breakage: implications for
cancer and neuronal damage." Proc Natl Acad Sci U S A 94(7): 3290-3295.
7. Burger, H. G. (2002). "Androgen production in women." Fertil Steril 77 Suppl 4:

S3-5.
8. Carr, M. C. (1967). "Biology of human trophoblast." Calif Med 107(4): 338-343.
9. Carson, D. D., I. Bagchi, et al. (2000). "Embryo implantation." Dev Biol 223(2):
217-237.
66
10. Chancy, C. D., R. Kekuda, et al. (2000). "Expression and differential polarization
of the reduced-folate transporter-1 and the folate receptor alpha in mammalian
retinal pigment epithelium." J Biol Chem 275(27): 20676-20684.
11. Chattopadhyay, S., E. Y. Gong, et al. (2006). "The CCAAT enhancer-binding

protein-alpha negatively regulates the transactivation of androgen receptor in
prostate cancer cells." Mol Endocrinol 20(5): 984-995.
12. Cloke, B. and M. Christian (2011). "The role of androgens and the androgen
receptor in cycling endometrium." Mol Cell Endocrinol.
13. Cloke, B., K. Huhtinen, et al. (2008). "The androgen and progesterone receptors
regulate distinct gene networks and cellular functions in decidualizing
endometrium." Endocrinology 149(9): 4462-4474.
14. Critchley, H. O. and P. T. Saunders (2009). "Hormone receptor dynamics in a

receptive human endometrium." Reprod Sci 16(2): 191-199.
15. Czeizel, A. E. and I. Dudas (1992). "Prevention of the first occurrence of neural-
tube defects by periconceptional vitamin supplementation." N Engl J Med
327(26): 1832-1835.
16. Di Simone, N., N. Maggiano, et al. (2003). "Homocysteine induces trophoblast

cell death with apoptotic features." Biol Reprod 69(4): 1129-1134.
17. Elwood, P. C., K. Nachmanoff, et al. (1997). "The divergent 5' termini of the
alpha human folate receptor (hFR) mRNAs originate from two tissue-specific
promoters and alternative splicing: characterization of the alpha hFR gene
structure." Biochemistry 36(6): 1467-1478.
18. Fowler, B. (2001). "The folate cycle and disease in humans." Kidney Int Suppl
78: S221-229.
19. Hao, H., M. d'Alincourt-Salazar, et al. (2007). "Estrogen-induced and TAFII30-

mediated gene repression by direct recruitment of the estrogen receptor and co-
67
repressors to the core promoter and its reversal by tamoxifen." Oncogene 26(57):
7872-7884.
20. Henderson, G. B. (1990). "Folate-binding proteins." Annu Rev Nutr 10: 319-335.
21. Henderson, G. I., T. Perez, et al. (1995). "Maternal-to-fetal transfer of 5-

methyltetrahydrofolate by the perfused human placental cotyledon: evidence for a
concentrative role by placental folate receptors in fetal folate delivery." J Lab Clin
Med 126(2): 184-203.
22. Hiden, U., C. Wadsack, et al. (2007). "The first trimester human trophoblast cell
line ACH-3P: a novel tool to study autocrine/paracrine regulatory loops of human
trophoblast subpopulations--TNF-alpha stimulates MMP15 expression." BMC
Dev Biol 7: 137.
23. Hillier, S. G. (1987). "Intrafollicular paracrine function of ovarian androgen." J

Steroid Biochem 27(1-3): 351-357.
24. Horie, K., K. Takakura, et al. (1992). "Immunohistochemical localization of

androgen receptor in the human endometrium, decidua, placenta and pathological
conditions of the endometrium." Hum Reprod 7(10): 1461-1466.
25. Kamen, B. A., C. A. Johnson, et al. (1989). "Regulation of the cytoplasmic

accumulation of 5-methyltetrahydrofolate in MA104 cells is independent of folate
receptor regulation." J Clin Invest 84(5): 1379-1386.
26. Kane, M. A., P. C. Elwood, et al. (1988). "Influence on immunoreactive folate-

binding proteins of extracellular folate concentration in cultured human cells." J
Clin Invest 81(5): 1398-1406.
27. Kel, A. E., E. Gossling, et al. (2003). "MATCH: A tool for searching transcription
factor binding sites in DNA sequences." Nucleic Acids Res 31(13): 3576-3579.
28. Kelley, K. M., B. G. Rowan, et al. (2003). "Modulation of the folate receptor
alpha gene by the estrogen receptor: mechanism and implications in tumor
targeting." Cancer Res 63(11): 2820-2828.
68
29. Laanpere, M., S. Altmae, et al. (2010). "Folate-mediated one-carbon metabolism
and its effect on female fertility and pregnancy viability." Nutr Rev 68(2): 99-113.
30. Lacey, S. W., J. M. Sanders, et al. (1989). "Complementary DNA for the folate
binding protein correctly predicts anchoring to the membrane by glycosyl-
phosphatidylinositol." J Clin Invest 84(2): 715-720.
31. Lemaitre, R. N., T. Tanaka, et al. (2011). "Genetic loci associated with plasma
phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies
from the CHARGE Consortium." PLoS Genet 7(7): e1002193.
32. Lindblad, B., S. Zaman, et al. (2005). "Folate, vitamin B12, and homocysteine
levels in South Asian women with growth-retarded fetuses." Acta Obstet Gynecol
Scand 84(11): 1055-1061.
33. Lucock, M. (2000). "Folic acid: nutritional biochemistry, molecular biology, and
role in disease processes." Mol Genet Metab 71(1-2): 121-138.
34. Luhrs, C. A. (1991). "The role of glycosylation in the biosynthesis and acquisition
of ligand-binding activity of the folate-binding protein in cultured KB cells."
Blood 77(6): 1171-1180.
35. Luhrs, C. A. and B. L. Slomiany (1989). "A human membrane-associated folate

binding protein is anchored by a glycosyl-phosphatidylinositol tail." J Biol Chem
264(36): 21446-21449.
36. Lydon, J. P., F. J. DeMayo, et al. (1995). "Mice lacking progesterone receptor
exhibit pleiotropic reproductive abnormalities." Genes Dev 9(18): 2266-2278.
37. Ma, D. W., R. H. Finnell, et al. (2005). "Folate transport gene inactivation in mice
increases sensitivity to colon carcinogenesis." Cancer Res 65(3): 887-897.
38. Matys, V., O. V. Kel-Margoulis, et al. (2006). "TRANSFAC and its module
TRANSCompel: transcriptional gene regulation in eukaryotes." Nucleic Acids
Res 34(Database issue): D108-110.
69
39. McAlinden, T. P., J. B. Hynes, et al. (1991). "Synthesis and biological evaluation
of a fluorescent analogue of folic acid." Biochemistry 30(23): 5674-5681.
40. McNulty, H., R. C. Dowey le, et al. (2006). "Riboflavin lowers homocysteine in
individuals homozygous for the MTHFR 677C->T polymorphism." Circulation
113(1): 74-80.
41. Milne, S. A., T. A. Henderson, et al. (2005). "Leukocyte populations and steroid
receptor expression in human first-trimester decidua; regulation by antiprogestin
and prostaglandin E analog." J Clin Endocrinol Metab 90(7): 4315-4321.
42. Mohanty, D. and K. C. Das (1982). "Effect of folate deficiency on the

reproductive organs of female rhesus monkeys: a cytomorphological and
cytokinetic study." J Nutr 112(8): 1565-1576.
43. Mooij, P. N., M. G. Wouters, et al. (1992). "Disturbed reproductive performance

in extreme folic acid deficient golden hamsters." Eur J Obstet Gynecol Reprod
Biol 43(1): 71-75.
44. Mooradian, A. D., J. E. Morley, et al. (1987). "Biological actions of androgens."

Endocr Rev 8(1): 1-28.
45. Nelen, W. L., J. Bulten, et al. (2000). "Maternal homocysteine and chorionic
vascularization in recurrent early pregnancy loss." Hum Reprod 15(4): 954-960.
46. Neulen, J., B. Wagner, et al. (1987). "Effect of progestins, androgens, estrogens
and antiestrogens on 3H-thymidine uptake by human endometrial and
endosalpinx cells in vitro." Arch Gynecol 240(4): 225-232.
47. Norwitz, E. R., D. J. Schust, et al. (2001). "Implantation and the survival of early
pregnancy." N Engl J Med 345(19): 1400-1408.
48. Page, S. T., W. C. Owen, et al. (1993). "Expression of the human placental folate
receptor transcript is regulated in human tissues. Organization and full nucleotide
sequence of the gene." J Mol Biol 229(4): 1175-1183.
70
49. Parker, N., M. J. Turk, et al. (2005). "Folate receptor expression in carcinomas
and normal tissues determined by a quantitative radioligand binding assay." Anal
Biochem 338(2): 284-293.
50. Piedrahita, J. A., B. Oetama, et al. (1999). "Mice lacking the folic acid-binding
protein Folbp1 are defective in early embryonic development." Nat Genet 23(2):
228-232.
51. Ratnam, M., H. Marquardt, et al. (1989). "Homologous membrane folate binding
proteins in human placenta: cloning and sequence of a cDNA." Biochemistry
28(20): 8249-8254.
52. Roberts, S. J., M. Petropavlovskaja, et al. (1998). "Role of individual N-linked

glycosylation sites in the function and intracellular transport of the human alpha
folate receptor." Arch Biochem Biophys 351(2): 227-235.
53. Rosenquist, T. H. and R. H. Finnell (2001). "Genes, folate and homocysteine in

embryonic development." Proc Nutr Soc 60(1): 53-61.
54. Sabharanjak, S. and S. Mayor (2004). "Folate receptor endocytosis and

trafficking." Adv Drug Deliv Rev 56(8): 1099-1109.
55. Sadasivan, E., A. Regec, et al. (2002). "The half-life of the transcript encoding the
folate receptor alpha in KB cells is reduced by cytosolic proteins expressed in
folate-replete and not in folate-depleted cells." Gene 291(1-2): 149-158.
56. Saikawa, Y., K. Price, et al. (1995). "Structural and functional analysis of the
human KB cell folate receptor gene P4 promoter: cooperation of three clustered
Sp1-binding sites with initiator region for basal promoter activity." Biochemistry
34(31): 9951-9961.
57. Saitsu, H., M. Ishibashi, et al. (2003). "Spatial and temporal expression of folate-
binding protein 1 (Fbp1) is closely associated with anterior neural tube closure in
mice." Dev Dyn 226(1): 112-117.
58. Schoenmakers, E., G. Verrijdt, et al. (2000). "Differences in DNA binding

characteristics of the androgen and glucocorticoid receptors can determine
hormone-specific responses." J Biol Chem 275(16): 12290-12297.
71
59. Shatnawi, A., T. Tran, et al. (2007). "R5020 and RU486 act as progesterone
receptor agonists to enhance Sp1/Sp4-dependent gene transcription by an indirect
mechanism." Mol Endocrinol 21(3): 635-650.
60. Strauss, J. F., 3rd, F. Martinez, et al. (1996). "Placental steroid hormone synthesis:
unique features and unanswered questions." Biol Reprod 54(2): 303-311.
61. Tan, J., B. C. Paria, et al. (1999). "Differential uterine expression of estrogen and
progesterone receptors correlates with uterine preparation for implantation and
decidualization in the mouse." Endocrinology 140(11): 5310-5321.
62. Tang, L. S., D. R. Santillano, et al. (2005). "Role of Folbp1 in the regional
regulation of apoptosis and cell proliferation in the developing neural tube and
craniofacies." Am J Med Genet C Semin Med Genet 135C(1): 48-58.
63. Tibbetts, T. A., O. M. Conneely, et al. (1999). "Progesterone via its receptor
antagonizes the pro-inflammatory activity of estrogen in the mouse uterus." Biol
Reprod 60(5): 1158-1165.
64. Wang, X., F. Shen, et al. (1992). "Differential stereospecificities and affinities of
folate receptor isoforms for folate compounds and antifolates." Biochem
Pharmacol 44(9): 1898-1901.
65. Weitman, S. D., R. H. Lark, et al. (1992). "Distribution of the folate receptor
GP38 in normal and malignant cell lines and tissues." Cancer Res 52(12): 3396-
3401.
66. Weitman, S. D., A. G. Weinberg, et al. (1992). "Cellular localization of the folate
receptor: potential role in drug toxicity and folate homeostasis." Cancer Res
52(23): 6708-6711.
67. Westerhof, G. R., G. Jansen, et al. (1991). "Membrane transport of natural folates
and antifolate compounds in murine L1210 leukemia cells: role of carrier- and
receptor-mediated transport systems." Cancer Res 51(20): 5507-5513.
72
68. Xiao, S., D. K. Hansen, et al. (2005). "Maternal folate deficiency results in
selective upregulation of folate receptors and heterogeneous nuclear
ribonucleoprotein-E1 associated with multiple subtle aberrations in fetal tissues."
Birth Defects Res A Clin Mol Teratol 73(1): 6-28.
69. Yasuda, S., S. Hasui, et al. (2008). "Placental folate transport during pregnancy."
Biosci Biotechnol Biochem 72(9): 2277-2284.
70. Zhang, J., M. Gonit, et al. (2010). "C/EBPalpha redirects androgen receptor
signaling through a unique bimodal interaction." Oncogene 29(5): 723-38.
73
Figure Legends
Figure 1 Effect of androgen receptor on folate receptor α expression in normal and
malignant cells
A) HeLa cells were transfected with control vector plasmid or androgen receptor
expression plasmid and treated with vehicle or 10 nM testosterone. After 72 hours of
transfection, the cells were harvested and the folate receptor α cell surface expression
determined by fluorimetric assay (P value < 0.005). B) T47D cells or ACH-3P cells were
treated with vehicle or 10 nM R1881 for 72 hours. The cells were harvested for total
RNA or protein. The mRNA expression was determined by quantitative real time PCR
and the folate receptor α protein expression determined by radiolabeling assay (P value <
0.05). C) HeLa cells were co-transfected with PGL3 basic empty vector control plasmid
reporter vector or SV40 promoter reporter vector or folate receptor α promoter (proximal
and distal) reporter vector and androgen receptor expression plasmid. The cells were
treated with vehicle or 10 nM testosterone. The cells were harvested after 48 hours of
transfection and luciferase assay performed. The luciferase values were normalized
against renilla luciferase activity (P value < 0.003).
Figure 2 Dose- and time-dependent response of folate receptor α promoter to
testosterone
A) HeLa cells were co-transfected with folate receptor α promoter reporter or prostate
specific antigen promoter reporter and androgen receptor expression plasmid. The cells
were treated with different concentrations of testosterone as shown. After 48 hours of
transfection and treatment, the cells were harvested for luciferase assay. B) HeLa cells
were co-transfected with folate receptor α promoter reporter or prostate specific antigen
74
promoter reporter and androgen receptor expression plasmid. The cells were treated with
10 nM testosterone for different time period as shown. After the respective periods of
treatment, the cells were harvested for luciferase assay. C) HeLa cells were transfected
with folate receptor α promoter reporter vector and treated with vehicle or testosterone or
cycloheximide for the indicated time period. The cells were harvested for total RNA and
luciferase mRNA expression quantified by quantitative real-time PCR. The cells were
also harvested for luciferase activity for luciferase protein expression (P value < 0.005).
Figure 3 Identification of androgen receptor responsive region on the folate receptor α
promoter
A) HeLa cells were transfected with the following reporter vectors: folate receptor α
promoter containing both the proximal (P4) and distal promoter (P1), folate receptor α
promoter with the P1 promoter deleted (ΔP1), folate receptor α promoter with the P4
promoter deleted (ΔP4), folate receptor α P4 promoter (P4), folate receptor α promoter
containing -1565 to +33nt (-1535 to +33), folate receptor α promoter containing -1555 to
+33nt (-1535 to +33), folate receptor α promoter containing -1565 to +33 nt and with
sequential 4 base pair mutations at the indicated nucleotides (Mut (-1549 to -1546), Mut(-
1545 to -1542), Mut(-1541 to -1538), Mut(-1537 to -1534), Mut(-1533 to -1530)). Note
the nucleotides are numbered with +1nt representing the transcription start site. P1
promoter spans from -3394 to -2468nt and P4 promoter spans from -271 to +33nt. The
cells were also co-transfected with androgen receptor expression plasmid and treated with
vehicle or 10 nM testosterone. After 48 hours of transfection and treatment, the cells were
harvested for luciferase activity. B) HeLa cells were co-transfected with a Gal4 cis-
element containing minimal promoter reporter vector, androgen response element
75
containing minimal promoter reporter vector, folate receptor α promoter spanning from -
1565 to -1536nt ((-1565 to -1536)-TATA), folate receptor α promoter spanning from -
1565 to -1533nt ((-1565 to -1533)-TATA), folate receptor α promoter spanning from -
1549 to -1536nt ((-1549 to -1536)-TATA) or folate receptor α promoter spanning from -
1565 to -1548nt ((-1565 to -1548)-TATA) and androgen receptor expression plasmid.
The cells were treated with vehicle or 10 nM testosterone. After 48 hours of transfection
and treatment, the cells were harvested for luciferase activity. C) The table shows the
results of the MATCH program that was used to identify the transcription factor cis-
elements in the folate receptor α (-1565 to -1535nt) promoter. The sequence represents
the sequence of the folate receptor α (-1565 to -1535nt) promoter. The underlined
sequence represents the sequence that is mutated. The last column in the table shows the
results of the reporter activity determined in HeLa cells. HeLa cells were co-transfected
with each of the mutated folate receptor α (-1565 to -1535nt) promoter and androgen
receptor. The cells were treated with 10 nM testosterone and luciferase activity
determined after 48 hours of transfection. The loss of activation is represented by (-) and
the increase in activation is represented by (+).
Figure 4 Androgen receptor and CAAT enhancer binding protein α are associated at the
folate receptor α gene promoter
A) Biotinylated DNA pull-down assay were performed in HeLa cells using biotinylated
folate receptor α promoter (-1570 to -1533nt) or three tandem repeat elements of CAAT
enhancer binding protein α. HeLa cells were transfected with androgen receptor
expression plasmid for 48 hours and treated with vehicle or 10 nM testosterone for 1 hour
before harvesting the cell lysates. The lysates were incubated with each of the
76
biotinylated probe in the presence of vehicle or testosterone. The control for the assay
was performed with 200-fold excess of the competitors. The competitors included the
wild type folate receptor α promoter (-1570 to -1533nt) probe or the wild type folate
receptor α promoter (-1570 to -1533nt) probe in which the androgen response element
half-site was mutated (mA) or wild type folate receptor α promoter (-1570 to -1533nt)
probe in which the androgen response element half-site and CAAT enhancer binding
protein α elements were mutated (dM). The biotinylated probes and the bound proteins
were precipitated using streptavidin beads. The bound proteins were eluted and Western
blot performed using the androgen receptor or CAAT enhancer binding protein α
antibody. The input represents the androgen receptor expression and CAAT enhancer
binding protein α protein expression in the cell lysates. B) Human ACH-3P trophoblast
cells were grown in serum stripped medium for 24 hours and treated with vehicle or 10
nM R1881 for 48 hours. The cells were harvested for co-immunoprecipitation. The
proteins were immunoprecipitated using androgen receptor antibody or normal IgG
antibody and Western blot performed using androgen receptor or CAAT enhancer
binding protein α antibody. The input represents the androgen receptor and CAAT
enhancer binding protein α protein expression in the cell lysates. 0.3X of the total
proteins used for immunoprecipitation were used as input. C) HeLa cells were grown in
serum stripped medium and transfected with His-tag androgen receptor expression
plasmid. After 48 hours of transfection, the cells were treated with vehicle of 10 nM
testosterone for 1 hour and ChIP assay performed. The immunoprecipitation was
performed using His-tag antibody or normal IgG antibody. The primers corresponding to
the folate receptor α promoter (-1565 to -1535 nt) region were used to quantitate the
77
immunoprecipitated fragments by quantitative real time PCR (P value < 0.001). D)
Human trophoblast ACH-3P cells were grown in serum-stripped media for 48 hours and
treated with vehicle or 10 nM R1881 for 2 hours. After the treatment, the cells were
harvested for chromatin immunoprecipitation assay. Immunoprecipitation was performed
using normal IgG antibody or androgen receptor antibody. The immunoprecipitated
fragments were quantitated using quantitative real time PCR. the control target represents
the non-target control primers used to quantitate the immunoprecipitated fragments (P
value < 0.001).
Figure 5
A) HeLa cells were co-transfected with folate receptor α promoter reporter vector or
prostate specific antigen promoter reporter vector and androgen receptor expression
plasmid of varying concentrations. Androgen receptor plasmid of 50 ng and 200ng were
transfected per 3 x 105 cells. The cells were treated with vehicle or 10 nM testosterone.
After 48 hours of transfection and treatment, the cells were harvested for luciferase
activity. B) HeLa cells were co-transfected with folate α promoter reporter vector or
prostate specific antigen promoter reporter vector, androgen receptor expression plasmid
and plasmids expressing CREB (cAMP response element binding) binding protein or
Transcriptional intermediary factor 2. The cells were treated with 10 nM testosterone for
the period of transfection of 48 hours. After 48 hours the cells were harvested for
luciferase activity.
78
Figure 1
A B
5 Protein
8
FR Expression
* mRNA
(Fold Increase)
* 4
(Fold Increase)
FR Expression
6
3 * Series1
4 *
Series2
2
2 1
0 0
AR - - + + 1 2 3 4
Veh Androgen Veh Androgen
Test - + - +
T47D cells ACH-3P
cells
7.5
Untreated + AR
Promoter Activity (RLU)
+ Testosterone + Testosterone + AR
6
*
4.5
(x 106)
1.5
0
PGL3 Basic SV40 Promoter FRα Promoter
79
Figure 2
A FRα Promoter-Luc + AR
6 PSA Promoter-Luc + AR
Promoter Activity
(RLU) (X105)
0
0 0.1 1.0 10.0 100.0
-9
Testosterone (X10 M)
B 4
-Luc + AR
PSA Promoter-Luc + AR
in Promoter Activity
3
Fold Increase
0
1 2 3 4 6 8 10
Testosterone Treatment (hours)
C
12 Luciferase mRNA *
Fold Change
Luciferase activity
10
8
6
4
2
0
0-2 h: Veh Veh CHX CHX
3-14 h: Veh Test CHX CHX+Test
80
Figure 3
A
Fold Induction by Testosterone

B
Gal4-TATA
ARE-TATA
(-1565 to -1536)-TATA
(-1565 to -1533)-TATA
(-1549 to -1536)-TATA
(-1565 to -1548)-TATA
00 22 44 66 88 10 10 12
12
Fold Induction by Test
C
Putative Sequence Test/AR
elements response
of mutant
1/2 ARE TTGTTCCCGCAGGAACTGAACCCAAAGGAT -
RFX1 TTGTTCCCGCAGGAACTGAACCCAAAGGAT +
AP-2 TTGTTCCCGCAGGAACTGAACCCAAAGGAT +
Ik-2 TTGTTCCCGCAGGAACTGAACCCAAAGGAT +
Pax (4,2) TTGTTCCCGCAGGAACTGAACCCAAAGGAT +
Elk-1 TTGTTCCCGCAGGAACTGAACCCAAAGGAT +
c-Ets-1(p54) TTGTTCCCGCAGGAACTGAACCCAAAGGAT +
USF TTGTTCCCGCAGGAACTGAACCCAAAGGAT +
CdxA TTGTTCCCGCAGGAACTGAACCCAAAGGAT +
Msx-1 TTGTTCCCGCAGGAACTGAACCCAAAGGAT +
Myb (c, v) TTGTTCCCGCAGGAACTGAACCCAAAGGAT +
cap TTGTTCCCGCAGGAACTGAACCCAAAGGAT +
C/EBP (,) TTGTTCCCGCAGGAACTGAACCCAAAGGAT -
Oct-1 TTGTTCCCGCAGGAACTGAACCCAAAGGAT +
Lyf-1 TTGTTCCCGCAGGAACTGAACCCAAAGGAT +
SRY TTGTTCCCGCAGGAACTGAACCCAAAGGAT +
HOXA3 TTGTTCCCGCAGGAACTGAACCCAAAGGAT +
81
Figure 4
A 1 2 3 4 5 6 7 8 9 10 11 12
AR - + + + + + - + + - + +
AR - - + + + + - - + - - +
Test
C/EBP
Competitor - - - wt mA dM - - -
(200)
Biotin-probe FR- (C/EBP)3 Input
B C
*
B
82
Figure 5
12
FRα Promoter-Luc
9
Fold increase in Promoter Activity
Vehicle
6 Testosterone
18 PSA Promoter-Luc
12 Vehicle
Testosterone
0
0 50 200
AR expression plasmid (ng)
4
PSA Promoter Luc
FRα Promoter Luc
Fold Induction by
3
Co-activator
0
Vector CBP TIF2
83
Chapter 3
Elk-1 directs a critical component of growth signaling by the androgen receptor in
prostate cancer cells
Suneethi Sivakumaran*, Mesfin A Gonit*, Mugdha R Patki*, Venkatesh V Chari, Robert
J Trumbly and Manohar Ratnam
Abstract
Androgen receptor is critical for prostate cancer growth and proliferation. Prostate
cancer in the initial stage requires androgen for growth and therefore, androgen ablation
therapy is the standard treatment. The cancer regresses but recurs within one to two years
as androgen-independent prostate cancer. Anti-androgens that inhibit androgen receptor
are effective only for a short period and cause undesirable side-effects. Androgen
receptor causes transactivation by binding to androgen response elements and by protein-
protein interactions. Disruption of the protein-protein interaction is a promising strategy
and could be used as an adjuvant therapy. We identified a ubiquitous transcription factor
Elk-1 that associated with androgen receptor to support expression of genes associated
with cell cycle and growth. Interestingly, Elk-1 knock-down inhibited prostate cancer
growth and tumorigenicity in androgen-sensitive and androgen-independent prostate
cancer cells. Elk-1 recruited androgen receptor to promoter regions of genes containing
Elk-1 binding sites. Androgens did not affect Elk-1 phosphorylation.

84
Elk-1 was more highly expressed in prostate cancer cells than in normal prostate
epithelial cells. These results demonstrate an alternative mechanism of androgen receptor
action on prostate cancer growth and provide an alternative direction in drug design
strategies.
Introduction
The male sex hormones, testosterone and dihydrotestosterone are essential for the
growth, function and maintenance of the prostate gland and for prostate cancer growth.
Androgen ablation therapy, the standard mode of treatment, is effective only for a period
of 18-24 months after which cancer recurs (Ramsay and Leung, 2009). When prostate
cancer recurs, the cancer growth depends on androgen receptor and does not require
androgens. This androgen-independent function of androgen receptor is attributed to its
modifications. Androgen receptor is mutated in 10-20% of cancer patients (Marcelli et
al., 2000; Taplin et al., 2003). Androgen receptor mutations result in its activation by
non-androgenic steroids like estrogen and by anti-androgens like flutamide. In some
cases, androgen receptor undergoes gene amplification or is over expressed (Chen et al.,
2004) leading to androgen receptor activation by low or castrate levels of androgen.
Another mechanism of androgen receptor modification is growth factor dependent
signaling pathway activation of androgen receptor in a ligand independent manner.
Imbalances between co-activator and co-repressor lead to increased androgen receptor
transcriptional effects (Attar et al., 2009). Available treatment options in androgen-
independent cancers include adrenal androgen synthesis inhibitors, the
immunotherapeutic drug Sipeulcel T and drugs that target the androgen receptor N-
terminal transactivation domain (Andersen et al., 2010), SRC inhibitor and other
85
improved anti-androgens (Liu et al., 2010; Tran et al., 2009). Prostate cancer cells evade
these drugs by adapting new mechanisms. For instance, the recently identified ETS
transcription factor gene fusions under the control of androgen response promoter
(Carver et al., 2009; Helgeson et al., 2008; Tomlins et al., 2005) and androgen receptor
splice variants that are constitutively active (Guo et al., 2009; Hu et al., 2009; Sun et al.,
2010).
Elk-1 is a proto-oncogene belonging to ETS family of transcription factors (Rao
et al., 1989). It is the final effector of the MAPK signaling pathways. Mitogen and stress
activated signaling pathways, extracellular signal-regulated kinase, c-Jun N-terminal
kinase and p38, phosphorylate Elk-1 to mediate their growth effects. After activation,
Elk-1 binds to its binding site either autonomously or by interacting with serum response
factor dimer through its B-box and activates the immediate early genes c-fos, egr1, egr2,
pip92, nur77 (Latinkic et al., 1996). Elk-1 belongs to the ternary complex factor family
that comprises of Elk-3 and Elk-4. The ternary complex factors have similar ETS DNA
binding domain, serum response factor interaction domain and transactivation C domain,
and exhibit redundancy in their functions and promoter occupancy (Dalton and Treisman,
1992; Giovane et al., 1995). Elk-1 rapidly and transiently activates immediate early
genes, inhibits apoptosis and regulates cell growth and proliferation (Vickers et al.,
2004). In breast cancer, Elk-1 associates with peptidylarginine deiminase 4 and activates
c-fos expression. (Zhang et al., 2011). In addition to immediate early genes, Elk-1
activates anti-apoptotic gene Mcl-1. In breast cancer cells, epidermal growth factor
pathway deregulation leads to Elk-1 mediated activation of Mcl-1 leading to survival of
cancer cells (Booy et al., 2011). Recent studies have identified the role of ETS family
86
members and androgen receptor in supporting prostate cancer growth. For example, write
TMPRSS2-ERG fusions are prevalent in prostate cancer patients. In the presence of
androgens, androgen receptor also activates MAPK pathway and phosphorylate Elk-1
(Peterziel et al., 1999). A recent study utilizing the transcription factor cis-elements array
showed that Elk-1 interacts with androgen receptor in LNCaP prostate cancer cells
(Mukhopadhyay et al., 2006). The role of Elk-1 and its ubiquitous nature implies its
significant role in cancer.
In our study, we showed Elk-1 depends on androgen receptor to activate target
gene expression. Elk-1 interacts with the androgen receptor N-terminal transactivation
domain and regulates genes involved in cell growth, mitosis and DNA repair. The anti-
androgen bicalutamide did not inhibit the expression of these genes. Elk-1 and androgen
receptor supported growth and tumorigenicity but did not affect apoptosis of prostate
cancer cells. The androgen receptor recruitment to Elk-1 binding sites indicated androgen
receptor is tethered by Elk-1. These results provide a significant direction towards
alternative treatment strategies for prostate cancer.
Results:
Elk-1 transcriptional activity is androgen receptor dependent
Androgen receptor utilizes new pathways and mechanisms after androgen
ablation therapy to support prostate cancer growth (Best et al., 2005). One of these
mechanisms is interaction of androgen receptor with other transcription factors without
binding to its response elements. Our ChIP-chip results from a hormone-independent
LNCaP prostate cancer cell variant (Gonit et al., 2011) showed that androgen receptor
exhibited an alternative mechanism of action by associating with transcription factors
87
rather than binding to its respective response elements. In addition, the analysis of the
androgen receptor interactome from LNCaP prostate cancer cells (Mukhopadhyay et al.,
2006) identified the transcription factors that associate with androgen receptor. We
screened the transcription factors, identified from our ChIP-chip analysis and the
interactome study, for their dependence on androgen receptor for transcriptional activity.
The transcription factor binding sites or cis-elements were cloned upstream of a
minimal TATA-box containing adenovirus major late promoter reporter construct. The
transcription factors were analyzed for their increased ability to promote transactivation
in the presence of androgen receptor when transfected into HeLa cells. We also examined
decreased transactivation with androgen receptor knock-down in prostate cancer cells.
HeLa cells that are androgen receptor negative were transfected with androgen receptor
expression plasmids and androgen receptor was knocked-down in C4-2 prostate cancer
cells. The screening identified Elk-1 as a transcription factor that requires androgen
receptor for its capacity to cause transactivation.
Figure 1A shows the effect of androgen receptor expression on Elk-1 mediated
reporter activity. HeLa cells that express Elk-1 were transfected with androgen receptor
expression plasmid or empty vector and reporter plasmid containing two tandem repeats
of Elk-1 binding sites cloned upstream of the major late adenovirus promoter ((Elk-1)2-
TATA-Luc). The cells were treated with testosterone to facilitate the entry of androgen
receptor into the nucleus. After 48 hours of transfection and treatments, the cells were
harvested for luciferase assay. In the absence of testosterone, androgen receptor did not
increase Elk-1 reporter activity above the basal level. In the presence of testosterone,
88
androgen receptor caused more than three fold increase in Elk-1 reporter activity (Figure
1A).
We determined if Elk-1 over expression further increased its reporter activity. We
transfected HeLa cells with empty vector or Elk-1 expression plasmid, reporter vector
containing Elk-1 binding sites and androgen receptor expression plasmid. The cells were
treated with vehicle or testosterone. In cells expressing endogenous Elk-1, androgen
receptor and testosterone caused four fold increase in reporter activity (Figure 1C).
Overexpression of Elk-1 in the presence of androgen receptor further increased reporter
activity in the presence of testosterone but showed no effect in the absence of testosterone
(Figure 1C). Figure 1B shows the mRNA expression level in HeLa cells transfected with
Elk-1 expression plasmid. We questioned if the Elk-1 mediated reporter activation in the
presence of androgen receptor and testosterone treatment affects androgen receptor
responsive promoter that harbors androgen response elements. We transfected HeLa cells
with androgen response element containing promoter reporter construct, empty vector or
Elk-1 expression plasmid and androgen receptor expression plasmid. The cells were
treated with vehicle or testosterone. Testosterone treatment caused significant promoter
activation in the presence of androgen receptor, but Elk-1 over expression did not have
further effect (Figure 1C). We utilized a reporter vector containing Interferon Stimulated
Response Element (ISRE) binding site as a negative control. Our results showed
androgen receptor and Elk-1 did not cause significant effects on ISRE reporter activity
(Figure 1D). Figure 1E shows the increase in Elk-1 mRNA expression with Elk-1 over
expression. Elk-1 over expression caused a two fold increase in Elk-1 mRNA expression.
89
We determined the effect of Elk-1 knock-down on its reporter activity. We
transfected HeLa cells with reporter vector containing Elk-1 binding sites, androgen
receptor expression plasmid and Elk-1 shRNA. Elk-1 knock-down caused reduced Elk-1
reporter activity by half (Figure 2A) and mRNA expression by half (Figure 2B). These
results show that androgen receptor is required for Elk-1 mediated reporter activation in
HeLa cells.
We determined Elk-1 dependence on androgen receptor for Elk-1 reporter
activation in prostate cancer cells. Prostate cancer cells express Elk-1 and androgen
receptor, so we utilized shRNA to knock-down Elk-1 and androgen receptor. We
nucleofected C4-2 prostate cancer cells with reporter plasmid containing two tandem
repeats of Elk-1 binding sites cloned upstream of the adenovirus major late promoter
((Elk-1)2-TATA-Luc) and shRNA for Elk-1, androgen receptor or both. Androgen
receptor knock-down reduced the Elk-1 reporter activity by 50% (Figure 2C). Elk-1
knock-down restored the basal reporter activity, and androgen receptor and Elk-1 knock-
down did not affect the basal reporter activity (Figure 2C). Elk-1 reporter activity
restoration with Elk-1 knock-down could be due to repressive functions of Elk-1 (See
details in discussion). Figure 2D shows the effect of androgen receptor or Elk-1 knock-
down on Elk-1 and androgen receptor mRNA expression in C4-2 prostate cancer cells.
Androgen receptor knock-down reduced androgen receptor mRNA expression to half but
did not affect Elk-1 mRNA expression. Similarly, Elk-1 knock-down did not affect
androgen receptor mRNA expression. These results showed that Elk-1 required androgen
receptor for its reporter activity.
90
Elk-1 and androgen receptor interact with each other
A potential explanation for the effect of androgen receptor on Elk-1 reporter
activity is they associate with each other. To address this possibility, we performed co-
immunoprecipitation in C4-2 prostate cancer cells. We immunoprecipitated Elk-1 and
performed Western blot analysis to detect androgen receptor. Conversely, we
immunoprecipitated androgen receptor and performed Western blot analysis to detect
Elk-1 (figure 3A). Immunoprecipitation using normal IgG served as the negative control.
Input samples shows androgen receptor and Elk-1 expression in C4-2 prostate cancer
cells. Co-immunoprecipitation showed that androgen receptor and Elk-1 interact with
each other (figure 3 A). To identify the domains involved in this association, we
performed a mammalian two-hybrid assay. The transactivation domain of VP16 was
fused to androgen receptor domains and Gal4 DNA-binding domain was fused to Elk-1
domains. The domain structures of Elk-1 and androgen receptor are shown in Figure 3B.
We transfected HeLa cells with luciferase reporter vector containing Gal4 binding sites,
Gal4 or Gal4-Elk-1 fusion proteins and VP16 or VP16-androgen receptor fusion proteins.
The Gal4-Elk-1 (307-428) is fusion protein of Gal4 and Elk-1 transactivation domain,
and Gal4-Elk-1 (87-428) is fusion protein of Gal4 and full-length Elk-1 lacking the DNA
binding domain. Androgen receptor-VP16 fusion proteins include the different domains
of androgen receptor fused to VP16. For instance, VP16-AB is VP16 fused to androgen
receptor N-terminal domain, VP16-CD is VP16 fused to DNA binding domain and hinge
region of androgen receptor and VP16-CDE is VP16 fused to full length androgen
receptor lacking the N-terminal domain. The domain names are indicated in figure 3B.
Our results showed that Gal4-Elk-1 fusion protein encoding full length Elk-1 without the
91
DNA binding domain and the VP16-androgen receptor A/B domain caused 200 fold
increase in reporter activation while Elk-1 transactivation domain alone caused reporter
activation to a negligible level (figure 3C). The other domains of androgen receptor
caused less than 50 fold increase in reporter activation with either fusion protein of Gal4
and full length Elk-1 lacking the DNA binding domain or fusion protein of Gal4 and Elk-
1 transactivation domain.
In order to confirm that androgen receptor A/B domain is sufficient to interact
with Elk-1, we compared the effect of the androgen receptor A/B domain with full-length
androgen receptor on Elk-1 reporter activation. HeLa cells were co-transfected with
reporter vector containing the Elk-1 binding site ((Elk1)2-TATA-Luc), empty vector,
androgen receptor or androgen receptor A/B domain fused to nuclear localization signal
and treated with vehicle or 10 nM testosterone. Figure 3D shows that full-length
androgen receptor increased the promoter activation in the presence of Elk-1 and after
testosterone treatment. Androgen receptor A/B domain fused with NLS increased the
reporter activity to a similar extent as the full length androgen receptor in the presence
and absence of testosterone. The inset shows the Western blot showing the protein
expression levels of full length androgen receptor expression plasmid and androgen
receptor A/B domain expression plasmid. These results showed that the androgen
receptor N-terminal domain is sufficient for the interaction with full-length Elk-1 lacking
the DNA binding domain.
92
Androgen receptor-dependent Elk-1 transactivation regulates genes associated with
cell cycle and mitosis
Androgen receptor regulates genes involved in growth and apoptosis while Elk-1
regulates immediate early growth response genes. The well-established target genes of
androgen receptor include prostate specific antigen, TMPRSS2, UBE2C to name a few
and the Elk-1 target genes include c-fos, Egr-1, Nur77. The gene signature due to Elk-1
and androgen receptor interaction could be different from those regulated by Elk-1 and
androgen receptor alone. In order to determine this, we performed microarray gene
expression profiling in androgen-sensitive LNCaP prostate cancer cells. LNCaP prostate
cancer cells were infected with control or Elk-1 shRNA and treated with vehicle or
synthetic androgen R1881. The isolated total RNA is reverse transcribed and cDNA
hybridized to U133 affymetrix whole genome array. Figure 4A provides the quantitative
description of probe ids upregulated by Elk-1 in androgen receptor dependent manner.
We identified the genes upregulated by greater than 1.5 fold by Elk-1 in androgen
(R1881)/androgen receptor dependent manner (supplement 1 in appendix A). Amongst
the 1033 genes upregulated by androgen receptor, 466 of the genes (45%) were
upregulated by Elk-1 association with androgen receptor. Among the 466 genes, Elk-1
repressed or activated these genes alone (supplement 2 and 3) or in association with
androgen receptor. 21% of these genes are repressed by Elk-1 alone. 75% of Elk-1
repressed genes showed overlap with those regulated by Elk-1 in androgen/androgen
receptor dependent manner. Less than 1% of the genes activated by Elk-1 overlap with
those activated by Elk-1 and androgen/androgen receptor.
93
Analysis of the data from microarray experiments identified 1499 genes whose
mRNA expression increased by at least 1.5 fold. The results of this analysis are shown in
figure 4A. Ontology of the genes activated by Elk-1 and androgen receptor showed the
genes associated with cell cycle/mitosis. The venn diagram of the gene expression profile
showed that Elk-1 could activate or repress genes (figure 4B). Activation or repression
could depend on additional factors like the DNA sequences proximal to the Elk-1 binding
site on the Elk-1/androgen receptor target gene. The candidate genes identified in the
microarray analysis were examined by qRT-PCR. Among the 466 candidate genes, 28
were validated by more rigorous qRT-PCR and were subjected to more detailed study.
We validated the gene expression in hormone-sensitive LNCaP and hormone-
independent C4-2 prostate cancer cells and found similar pattern of repression or
activation by Elk-1 (Figure 5A and 5B). Figure 5A shows the results of the gene
validation by qRT-PCR in hormone-sensitive LNCaP prostate cancer cells. We infected
the cells with either control shRNA or Elk-1 shRNA and treated with vehicle or synthetic
androgen R1881. The first eight genes on the left hand side of the plot are the genes
activated by Elk-1 in androgen receptor dependent manner. The remaining genes on the
right hand side (starting from DTL) are repressed by Elk-1 in androgen receptor
dependent manner. Amongst these, some of the genes like CDC6, RAD54B and FEN1
that are de-repressed with Elk-1 knock-down are further activated by synthetic androgen
R1881. Irrespective of the activation or repressive effects of Elk-1, as will be shown later,
the ultimate consequence of the androgen receptor dependent Elk-1 regulation of genes is
increased cell growth. This result is also supported from our growth assays (discussed
later).
94
We performed gene validation in hormone-refractory C4-2 prostate cancer cells
(Figure 5B). The cells were infected with control shRNA or Elk-1 shRNA. C4-2 cells are
hormone-independent and did not require androgen treatment. In C4-2 cells, androgen
receptor, in the absence of androgen, is localized in the nucleus (Thalmann et al., 1994).
In C4-2 cells, Elk-1 either activated or repressed expression of the genes in androgen
receptor dependent manner. Thus, gene expression profile in C4-2 cells was similar as in
LNCaP cells. An example that shows similar pattern of gene expression in LNCaP cells
and C4-2 cells is the expression of CDC6. Its expression is activated by Elk-1-androgen
receptor association (figure 4B). Its expression is down regulated in the presence of Elk-1
and de-repressed in the absence of Elk-1. The expression of androgen receptor target
genes MYC and CDC5L are not affected by Elk-1 knock-down but are down regulated
by androgen receptor knock-down. These results showed that the genes activated by Elk-
1 in association with androgen receptor were unique.
Elk-1 promotes prostate cancer cell growth in androgen receptor dependent manner
Elk-1 or androgen receptor alone supports cell growth (Chen et al., 2004; Vickers
et al., 2004). Ontology of genes identified from microarray analyses showed that Elk-1
and androgen receptor interact to regulate genes supporting cell cycle and mitosis. To
determine if androgen receptor dependent Elk-1 effects influence cell growth, we
performed MTT growth assay in different prostate cancer cell lines. Androgen dependent
LNCaP cells were treated with vehicle or R1881 with normal levels of Elk-1 or with Elk-
1 knock-down and MTT assay performed at different time period. These cells require
androgen for their growth which is evident from decreased growth in the absence of
androgen and increased growth in the presence of synthetic androgen R1881. Elk-1
95
knock-down decreased growth of these cells even in the presence of androgen R1881,
indicating the essential role of Elk-1 and androgen receptor in supporting cell growth
(figure 6A). The marginal increase in growth with Elk-1 knock-down in the presence of
R1881 may reflect the activation of growth genes by androgen as observed in gene
expression analysis or due to de-repression of growth genes with Elk-1 knock-down. The
inset shows a Western blot of Elk-1 knock-down and androgen receptor expression; Elk-1
knock-down has a marginal effect on androgen receptor protein expression. Androgen
receptor transcriptional activity is not affected as observed from the effect of Elk-1 knock
down in the presence of R1881 on androgen receptor target genes RHOU, IGF1R,
PMEPA1, TMPRSS2 and PSA (figure 6B).
To determine if these effects of Elk-1 on growth are restricted to LNCaP prostate
cancer cells, we examined Elk-1 effects on the growth of hormone-independent C4-2
cells and androgen receptor-negative DU145 and PC3 cells. We examined C4-2 cells as a
model for hormone-refractory prostate cancers. We infected C4-2 prostate cancer cells
with control shRNA or androgen receptor shRNA and MTT assay performed at different
time period. Androgen receptor knock-down inhibited C4-2 prostate cancer cell growth
(figure 7A). The inset shows Western blot of androgen receptor before and after androgen
receptor knock-down. C4-2 cells were infected with control shRNA or Elk-1 shRNA
(Elk1 shRNA#1 and #2 represents shRNA with different target site specificity) and MTT
assay performed at different time period. Elk-1 knock-down in C4-2 cells inhibited
growth in the presence of androgen receptor (Figure 7B). The inset shows Western blot
for Elk-1 before and after Elk-1 knock-down in C4-2 cells. We determined the effect of
Elk-1 knock-down on androgen receptor negative prostate cancer cells DU145 and PC3.
96
DU145 and PC3 cells were infected with control shRNA or Elk-1 shRNA and MTT assay
performed at different days as shown in Figure 8A. Elk-1 knock-down had no effect on
androgen receptor negative prostate cancer cells indicating the growth supporting actions
of Elk-1 is androgen receptor dependent and vice versa (Figure 8A). The inset shows
Western blot for Elk-1 before and after Elk-1 knock-down in DU145 and PC3 cells. The
significance of Elk-1-androgen receptor association is further strengthened by our growth
assays in androgen receptor-negative DU145 and PC3 cells (Figure 8A). These results
show that Elk-1 and androgen receptor interaction supports prostate cancer cell growth.
Elk-1 is an oncogene and our results showed that Elk-1 and androgen receptor
interactions are required for prostate cancer cell growth. We asked if these interactions
also support tumorigenicity of the cancer cells. Anchorage-dependent and anchorage-
independent colony forming assays (figure 8B and C) were performed after infection of
C4-2 cells with control shRNA or Elk-1 shRNA and treated with synthetic androgen
R1881. Figure 8B shows the effect of R1881 treatment and Elk-1 knock-down on
tumorigenic capacity of cells of different density. In the presence of R1881 and Elk-1,
C4-2 cells formed colonies but Elk-1 knock-down decreased the ability of cells to form
colonies irrespective of cell density. Figure 8C shows that Elk-1 in the presence of R1881
formed colonies but Elk-1 knock-down abolished the colony forming ability of cells in
the presence of R1881. The Western blot inset shows the extent of Elk-1 knock-down and
androgen receptor protein expression in the presence and absence of Elk-1 knock-down
and in the presence or absence of synthetic androgen R1881 (figure 8C inset). These
results show that Elk-1 and androgen receptor are required for the tumorigenicity of C4-2
cells.
97
Androgen receptor dependent Elk-1 effects do not result in apoptosis of hormone-
sensitive or hormone-refractory prostate cancer cells
The decreased cell growth and survival observed with Elk-1 knock-down may
reflect its role in apoptosis (Mamali et al., 2008). To determine this, we infected
hormone-sensitive C4-2 and hormone-refractory LNCaP cells with control shRNA or
Elk-1 shRNA and treated with or without synthetic androgen R1881. As a positive
control for apoptosis, the cells were treated with 100µM cisplatin for 24 hours and 48
hours. Cells were harvested after 24hours and 48 hours of treatment (figure 9A and figure
9B). In hormone-sensitive LNCaP (Figure 8A) and hormone-refractory C4-2 cells
(Figure 8B), Elk-1 knock-down did not affect apoptosis; figure 9C shows that the
synthetic androgen R1881 did not affect Elk-1 mRNA expression. Western blot showed
no change in Elk-1 protein expression after treatment with vehicle or R1881.
Androgen receptor dependent Elk-1 effects are not caused due to change in Elk-1
phosphorylation
Elk-1 is regulated post-translationally by phosphorylation by mitogen activated
protein kinase, p38 or c-Jun N-terminal kinase pathway (Robinson and Cobb, 1997;
White and Sharrocks, 2010). Dihydrotestosterone activated androgen receptor activates
Elk-1 through extracellular signal-regulated kinase-1 and -2 activation in genital skin
fibroblasts and prostate stromal cells (Peterziel et al., 1999). To test if androgen receptor
dependent Elk-1 mediated effects may be due to increased R1881-mediated Elk-1
phosphorylation, we treated hormone-refractory C4-2 cells with R1881 for different time
period as shown in Figure 9D. As a positive control of Elk-1 phosphorylation mediated
98
by MAPKs, cells were serum starved and treated with phorbol 12-myristate 13-acetate
(PMA) (figure 9D). As a negative control, the cells were serum starved without PMA
treatment. The phospho-Elk-1 expression was significantly increased by phorbol 12-
myristate 13-acetate treatment while androgen treatment did not affect the phosphor-Elk-
1 expression. Elk-1 expression was unaffected by any of the treatment conditions (figure
9D). GAPDH served as the loading control.
The immediate early growth genes c-Fos and Egr-1 are targets of Elk-1 (Latinkic
et al., 1996). The basal phospho-Elk-1 level observed with androgen treatment (Figure
9E) may transactivate c-Fos and Egr-1 in addition to the cell cycle genes upregulated by
Elk-1-androgen receptor as suggested by our microarray analysis. Hormone-sensitive
LNCaP cells were serum starved for 24 hours and stimulated with serum for different
time period. Cells were hormone stripped before treating with vehicle or R1881 for
different time period as shown in figure 8E. Serum stimulation caused activation of c-Fos
and Egr-1 within half an hour and peaked at 1 hour after serum stimulation but prostate
specific antigen remained unaffected (figure 9E). Androgen treatment did not activate c-
Fos and Egr-1 but steadily activated the androgen target gene prostate specific antigen
(figure 9E). These results indicate that androgen did not increase Elk-1 phosphorylation
and are consistent with microarray results showing that androgen receptor mediated Elk-1
regulated genes are unique.
Casodex does not inhibit the androgen receptor dependent Elk-1 regulated genes
Casodex or bicalutamide is an androgen receptor antagonist and used as an anti-
androgen in prostate cancer patients (Fradet, 2004). Our microarray results and the gene
expression validation results showed that the genes regulated by Elk-1 in association with
99
androgen receptor are different from those regulated by androgen/androgen receptor or
Elk-1 alone. We determined if androgen receptor dependent Elk-1 mediated
transcriptional activity is inhibited by bicalutamide in hormone-sensitive LNCaP and
hormone-independent C4-2 prostate cancer cells. We treated hormone-stripped LNCaP
(figure 10A) or C4-2 cells (figure 10B) with vehicle, R1881 or R1881 and bicalutamide.
Synthetic androgen R1881 increased expression of the Elk-1 and androgen receptor
regulated genes in LNCaP and C4-2 cells. In C4-2 cells, R1881 treatment did not increase
expression of the genes as high as observed in LNCaP cells. This may be because C4-2
cells are androgen-independent and androgen treatment did not have further activation
effect. Bicalutamide or Casodex did not inhibit expression of majority of the genes in
LNCaP and C4-2 cells (figure 10A and B). As a positive control, we determined the
effect of vehicle, R1881 or R1881 and Casodex on androgen receptor target gene PSA in
LNCaP and C4-2 prostate cancer cells. In both cell lines, R1881 increased and Casodex
decreased prostate specific antigen mRNA expression. These results showed that
Casodex or bicalutamide did not inhibit the androgen receptor dependent Elk-1 regulated
genes and indicated that these genes are unique.
Androgen receptor associates with Elk-1 at chromatin sites of Elk-1 binding in
Our results showed that Elk-1 and androgen receptor interact to target unique
genes. To determine if Elk-1 tethers androgen receptor or Elk-1 and androgen receptor
co-occupy at the promoter of target genes, we performed chromatin immunoprecipitation
in LNCaP prostate cancer cells. There is no existing ChIP-chip study for Elk-1 in prostate
cancer cells. So we utilized the ChIP-chip study done in HeLa cells (Boros et al., 2009b)
100
to identify the regions containing Elk-1 binding sites. We identified seven target
chromosomal sites with Elk-1 binding sites. These target sites contained Elk-1 binding
sites but did not contain androgen response elements and serum response elements. We
performed chromatin immunoprecipitation in LNCaP cells infected with Elk-1 shRNA.
We used anti-androgen receptor antibody to immunoprecipitate and the respective
primer-probe sets to quantitate the effect of Elk-1 knock-down on androgen receptor
enrichment at Elk-1 binding sites at the target gene promoter. Elk-1 knock-down reduced
androgen receptor enrichment at three sites amongst the seven sites tested. These three
sites are proximal to the transcription start site of genes LOC38928 (chromosome 5),
MAP3K7 (chromosome 6) and RBM8A (chromosome 1) (figure 10C). prostate specific
antigen is used as positive control. Elk-1 knock-down did not affect the recruitment of
androgen receptor to androgen response elements at prostate specific antigen enhancer
region. These results showed that Elk-1 tethered androgen receptor to its binding sites at
gene promoter. Further studies are required to confirm tethering of androgen receptor at
promoters of genes regulated by Elk-1 and androgen receptor association as identified
from microarray analysis.
The highly conserved ternary complex factor Elk-3 does not tether androgen
receptor to mediate Elk-1 transactivation function
The ternary complex factors Elk-1, Elk-3 and Elk-4 have highly conserved DNA-
binding domain (Giovane et al., 1994). We questioned if Elk-3 could transactivate
reporter activity in the presence of androgen receptor. HeLa cells were transfected with
Elk-1 or Elk-3 expression plasmid in the presence of androgen receptor. The cells were
treated with vehicle or testosterone. Figure 11A shows that in the presence of androgen
101
receptor, Elk-1 expression increased the reporter activity while Elk-3 did not. This shows
that Elk-1 but not Elk-3 tethers androgen receptor. Figure 10B shows the Elk-1 and Elk-3
gene expression levels (figure 11B and C).
Dysregulated expression is a common event in any cancer. We asked if Elk-1
expression is altered in prostate cancer cells. To test this, we compared the mRNA
expression of Elk-1 and Elk-3 between normal prostate epithelial cells derived from men
aged 17 and 29 years and hormone-sensitive and hormone-refractory prostate cancer
cells. Elk-1 mRNA expression is increased in hormone-sensitive LNCaP and VCaP
prostate cancer cells and in hormone-refractory C4-2 prostate cancer cells compared to
normal prostate epithelial cells (figure 11D). On the other hand, Elk-3 mRNA expression
is increased in normal prostate epithelial cells than in prostate cancer cells (figure 11E).
Discussion:
The present study shows that Elk-1 interacts with androgen receptor N-terminal
domain. Elk-1 and androgen receptor are required for regulation of cell cycle and cell
growth related genes and supports prostate cancer cell growth and tumorigenicity. Elk-1
is upregulated in hormone dependent prostate cancer cells, LNCaP and VCaP and in
hormone-independent C4-2 prostate cancer cells compared to normal prostate epithelial
cells.
Our luciferase reporter assays in HeLa and C4-2 cells showed Elk-1 depends on
androgen receptor for its transcriptional activity. Elk-1 exerts basal transcriptional
repression through R domain and ETS DNA-binding domain (Yang et al., 2002).
Deletion of the ETS DNA-binding domain of Elk-1 alleviated this repressive activity thus
102
indicating Elk-1 ETS domain itself acts as a repressive motif (Yang et al., 2002; Yang et
al., 2001). A repressive motif in the ETS domain and the R motif present between 230
and 260 amino acids act synergistically to repress Elk-1 activity in a reporter assay (Yang
et al., 2001). In our study, endogenous Elk-1 in HeLa cells did not show this repressive
effect in the presence of androgen receptor. This shows that androgen receptor supports
transcriptional activation that overrides the Elk-1 repressive effect in HeLa cells. We
observed a similar effect in C4-2 prostate cancer cells: Androgen receptor knock-down
decreased the Elk-1 reporter activation. Elk-1 reporter activity with Elk-1 knock-down
was same as the reporter activity in the presence of Elk-1 and androgen receptor
indicating a repressive role of Elk-1. Androgen receptor and Elk-1 knock-down did not
decrease the basal reporter activity further. This may be due to low efficiency of
androgen receptor knock-down. An alternatively spliced isoform called s-Elk-1 that lacks
the first 54 amino acids at the N-terminal and does not exert repressive effects is
expressed in neuronal cells (Rahim et al., 2012; Vanhoutte et al., 2001). The expression
of this isoform in prostate cancer cells may be ruled out due to its neuronal specific
expression but needs to be confirmed. In HeLa cells, Elk-1 knock-down reduced Elk-1
reporter activity only marginally. This is attributed to low efficiency of Elk-1 knock-
down. A similar study showed that two siRNA were required to obtain 90% Elk-1 knock-
down in HeLa cells (Zhang et al., 2008).
Co-immunoprecipitation and mammalian two-hybrid assays showed that Elk-1
interacts with androgen receptor N-terminal domain. Elk-1 knock-down resulted in
decreased cell growth in only androgen receptor positive prostate cancer cells
strengthening the significance of the interaction. Serum response factor was initially
103
identified as protein interaction partner of Elk-1. Elk-1 interacts with serum response
factor dimer at the serum response element to form ternary complex factor and activate
immediate early growth genes. The ternary complex factor formation involves
recruitment of extracellular signal-regulated kinase regulated kinase and mitogen and
stress-activated kinase (MSK) at these gene promoters. The recruitment of extracellular
signal-regulated kinase regulated kinase involves its interaction with Elk-1 D box. The
active extracellular signal-regulated kinase regulated kinase and the phospho-Elk-1
interact with active RNA polymerase II to activate the early growth response genes
(Zhang et al., 2008).
Our chromatin immunoprecipitation results showed that Elk-1 may bind
autonomously to its binding site without interacting with serum response factor and tether
androgen receptor. Serum response factor showed androgen dependence in activating
genes involved in cell cycle, cell development, assembly and organization, cell division,
lipid synthesis and immediate early response (Heemers et al., 2011). The effect of serum
response factor knock-down on the expression of genes regulated by Elk-1 and androgen
receptor is unknown at present. Though we utilized regions that contained only Elk-1
binding sites for chromatin immunoprecipitation, serum response factor and Elk-1 could
interact from greater distances. Chromatin immunoprecipitation identified androgen
receptor recruitment by Elk-1 to Elk-1 binding sites proximal to the transcription start site
of gene promoters that lacked serum response elements. Though the recruitment was
proximal to the transcription start site of genes shown in fig 10B, the genes identity needs
to be determined. The peaks of Elk-1 binding regions in serum-starved HeLa cells were
within 1kb of the transcription start site. Elk-1 also showed promoter binding redundancy
104
with Elk-4, GA binding protein alpha chain (GABPA) and co-occupies with serum
response factor at target genes with sub-optimal Elk-1 binding sites (Boros et al., 2009a).
Elk-1 and serum response factor co-localize within 500bp of each other. Elk-1 regulates
genes independent of extracellular signal-regulated kinase regulated kinase signaling.
Only 10% of the genes sensitive to Elk-1 knock down are regulated by Elk-1 in the
presence of extracellular signal-regulated kinase regulated kinase indicating Elk-1
regulates genes independent of extracellular signal-regulated kinase regulated kinase
signaling. The Elk-1 binding regions identified by ChIP-seq in MCF10A cells showed a
33% overlap with those identified by ChIP-chip and ChIP-seq in HeLa cells. About 93%
of the redundant regions bound by Elk-1 and other transcription factors are largely tightly
centered on the transcription start site while only 26% of Elk-1 binding regions that do
not exhibit any redundancy are located within 2kb of TSS. This study also showed that
the binding specificity of Elk-1 is more divergent from the core consensus when Elk-1
binds to non-redundant DNA sequences. The regions with weak Elk-1 binding sites are
uniquely bound by Elk-1. The expression of genes with unique Elk-1 binding sites are
down regulated with Elk-1 depletion and those with redundant Elk-1 binding sites are
upregulated with Elk-1 loss (Odrowaz and Sharrocks, 2012). We observed a similar
pattern in our gene expression profile in LNCaP and C4-2 prostate cancer cells. The
genes that contain redundant Elk-1 binding motifs are normally repressed by Elk1 and
upon depletion of Elk-1, it is replaced by other transcription factors like GABPA which
can provide stronger gene activation. The uniquely bound Elk-1 genes included those
encoding nuclear hormone receptors like peroxisome proliferator-activated receptor
gamma, retinoid acid receptor beta. This study showed that RBM8A was regulated by
105
Elk-1 by binding to motifs that are redundantly regulated by ETS family of transcription
factors (Odrowaz and Sharrocks, 2012). Further investigations will be required to
determine if transcription factors tether androgen receptor and exert synergistic effects on
gene expression. Since our microarray results shows genes that upregulate and down
regulate with Elk-1 depletion, Elk-1 may regulate distinct cellular processes and leads to
distinct functional outcomes.
Our mammalian two-hybrid assay showed that Elk-1 transactivation domain is not
sufficient to interact with androgen receptor. It is surprising that transactivation domain
did not increase luciferase reporter activity significantly. One possibility is that MAPK
docking site is essential for Elk-1 phosphorylation and its transactivation capacity. Elk-1
interacts with Gal4 binding site in an serum response factor- and phosphorylation-
dependent manner (Gille et al., 1995) but our studies showed that Gal4-Elk1 and VP16-
androgen receptor fusion significantly produced greater luciferase activity Gal4 and
VP16-androgen receptor proteins.
Sumoylated Elk-1 induced p21 without affecting p53 levels and arrested cell
growth (Vickers et al., 2004). Our study showed Elk-1 knock-down decreased cell
growth without affecting apoptosis and cell cycle (data not shown) in prostate cancer
cells. In prostate cancer cells, p53 is mutated in majority of prostate cancer patients
suggesting p53 mutation may play additional roles in Elk-1 mediated prostate cancer cell
growth. Elk-1 activates anti-apoptotic protein Mcl-1 and protects kidney epithelial cells
against apoptosis (Vickers et al., 2004). Anti-apoptotic role of Elk-1 required the
formation of ternary complex. On the contrary, our study showed that Elk-1 knock down
did not change basal apoptotic rate of prostate cancer cells. The contradictory results may
106
be attributed to cell dependent effects. The role of redundant ETS transcription factors
Elk-3 and Elk-4 in controlling apoptosis in prostate cancer cells is unknown. The effect
of combined knock-down of all the three ternary complex factors on apoptosis needs
further investigation.
Our microarray validation results showed Elk-1 in association with androgen
receptor activated as well as repressed genes in prostate cancer cells. Ternary complex
factor exhibit redundancy in their promoter specificity and function as suggested from the
phenotypes observed with knock-down of Elk-1, Elk-3 or Elk-4 (Ayadi et al., 2001;
Cesari et al., 2004a; Costello et al., 2004). We utilized lentiviral knock-down of Elk-1.
Elk-1 knock-down may result in gene expression effects due to redundant promoter
occupancy by Elk-3 or Elk-4. Elk-1 fused to repression domain Elk-En that represses all
the ternary complex factors and their downstream processes as shown in (Vickers et al.,
2004) may rule out the possible role of Elk-3 or Elk-4. Elk-1 dependent gene activation
could be serum response factor dependent or serum response factor-independent and
megakaryoblastic leukemia-1 (MKL-1) dependent or serum response factor and
megakaryoblastic leukemia-1 (MKL-1) independent. The effect of serum response factor
knock-down or Elk-1 B-box mutation that inhibits Elk-1 interaction with serum response
factor (Vickers et al., 2004) will be an interesting area of investigation.
Elk-3 contains three conserved regions shared by Elk-1 and Elk-4 (Dalton and
Treisman, 1992). Our study showed that over expression of Elk-3 did not replace Elk-1 in
tethering androgen receptor. Surprisingly, in our study Elk-3 over expression decreased
Elk-1 reporter activity in spite of the conserved DNA binding regions. This may be
107
because intact full length Elk-3 caused less efficient transcriptional activation in the
absence of extracellular signal-regulated kinase (Price et al., 1995).
Mitogen-mediated protein kinase pathways phosphorylate and activate Elk-1 that
regulates growth associated genes. Elk-1 is regulated at both transcriptional and post-
transcriptional level. Akt targets the first 279 nt of Elk-1 that includes the N-terminal Ets
domain and the B box (SRF interaction domain) to negatively regulate its translation
without affecting the Elk-1 mRNA or protein stability (Figueroa and Vojtek, 2003). In
prostate cancer, androgen receptor has been shown to be activated in ligand-independent
manner by activation of Akt pathway. It is possible Akt pathway also plays a role in
reducing Elk-1 protein expression in prostate cancer cells and requires further
investigation.
Androgen receptor consists of a modular structure like other nuclear receptors. It
consists of N-terminal ligand-independent transactivation domain, hinge region, DNA-
binding domain and C-terminal ligand-dependent transactivation domain. However, it
differs from other nuclear receptors- the transactivation function activation function-2
(AF-2) in ligand binding domain binds to FXXLF motif unlike other nuclear receptors
activation function-2 that binds to LXXLL-motif found in coactivators (Chang and
McDonnell, 2002; He et al., 2000). As a consequence, androgen receptor exhibits N
terminal-C terminal interaction and androgen receptor coregulators interacts by binding
to N-terminal and DNA binding domain of androgen receptor. Our study shows that Elk-
1 interacts with the N-terminal domain of androgen receptor. Future studies will require
the identification of the co-regulators that facilitate Elk-1 and androgen receptor mediated
regulation of genes involved in cell growth.
108
Our study showed a significant role of Elk-1 and androgen receptor in prostate
cancer cells. This study provides another approach towards drug designing for prostate
cancer.
.Materials and methods
Cell culture and reagents
Normal primary prostate epithelial cells from two donors aged 17 years and 29
years were purchased from Lifeline Cell Technology (Oceanside, CA). LNCaP, VCaP,
DU145, PC-3 and HeLa cell lines were from the American Type Culture Collection
(Rockville, MD). C4-2 cells were kindly provided by Dr Edwin Sanchez (University of
Toledo). 293FT cells were from Invitrogen (Life Technologies Corp, Carlsbad, CA). The
normal primary prostate epithelial cells were grown in proprietary media (catalog # LM-
0017) supplemented with ProstaLife LifeFactors (LS-1072) in the absence of antibiotics.
LNCaP and C4-2 cells were routinely grown at 37°C in 5% CO2 in RPMI-1640
supplemented with 10% FBS (Invitrogen, Life Technologies Corp, Carlsbad, CA),
penicillin (100 unit/ml)/streptomycin (100 µg/ml)/L-glutamine (2mM) mix (Invitrogen,
Life Technologies Corp, Carlsbad, CA) and sodium pyruvate (1mM) (Invitrogen, Life
Technologies Corp, Carlsbad, CA). VCaP, HeLa and DU145 cells were grown in DMEM
supplemented with 10% FBS, penicillin (100 units/ml)/streptomycin (100 µg/ml)/L-
glutamine (2mM) mix. PC-3 cells were grown in RPMI-1640 supplemented with 10%
FBS, penicillin (100 unit/ml)/streptomycin (100 µg/ml)/L-glutamine (2mM) mix. 293FT
cells were grown in DMEM supplemented with 10% FBS, non-essential amino acid
(Invitrogen, Life Technologies Carlsbad, CA), 500 µg/ml geneticin (Invitrogen, Life
Technologies Carlsbad, CA) and penicillin (100 unit/ml)/streptomycin (100 µg/ml)/L-
109
glutamine (2mM) mix. Custom made oligonucleotides were from Integrated DNA
Technologies (Coralville, IA). Affinity-purified rabbit anti-human antibodies to androgen
receptor (AR-N20), Elk-1 (I-20, sc-355) and mouse anti-human antibody to GAPDH (sc-
47724) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Phospho-Elk1
(Ser383) antibody (catalog #9181) was purchased from Cell Signaling Technology
(Danvers, MA). R1881 and Casodex were kindly provided by Dr Lirim Shemshedini
(University of Toledo). Cisplatin used for the Annexin V assay was a gift from Dr. Steve
Patrick (University of Toledo). Lipofectamine 2000TM was purchased from Invitrogen
(Life Technologies Corp, Carlsbad, CA). Protease inhibitor cocktail was purchased from
Thermo Scientific (product # 78410). Phosphatase inhibitor cocktail (Catalog # P-5726)
and PMA (Phorbol 12-myristate 13-acetate) were purchased from Sigma-Aldrich (St.
Louis, MO). For hormone depletion, cells were grown in either phenol-red free RPMI-
1640 or phenol-red free DMEM supplemented with 10% charcoal stripped FBS
(Invitrogen, Life Technologies Corp, Carlsbad, CA), penicillin (100
unit/ml)/streptomycin (100 µg/ml)/L-glutamine (2mM) mix for 48 h before the
experiments.
Plasmids
GAL4-TATA-Luc plasmid (pG5luc) and expression plasmid for VP16 and Gal4
were purchased from Promega (CheckMate Mammalian Two hybrid System). The
(Elk1)2-TATA-Luc plasmid was constructed using an EMSA validated oligonucleotide
sequence representing a tandem repeat of the optimal binding site for Elk-1 (5’-
GAGCCGGAAGATCGGAGCCGGAAG-3’) that was custom synthesized. The
complementary oligonucleotides were annealed to obtain double stranded DNA. The
110
synthetic DNA was designed with the addition of 5ʹ KpnI and 3ʹ NheI sites and
substituted for the Gal4 element in the pG5luc vector (Promega Madison, WI) upstream
of the TATA box. The (ISRE)-TATA-Luc and (ARE)-TATA-Luc plasmids were
similarly constructed but with the insertion of the ISRE element (5’-
GATCGGGAAAGGGAAACCGAAACTGAAGCC-3’) or a consensus ARE (5’-
AGTACGTGATGTTCT-3’) respectively, instead of the Elk1 element. The pRL plasmid
encoding Renilla luciferase was purchased from Promega (Madison, WI). The prostate
specific antigen-Luc plasmid containing 6.1kb DNA fragment encompassing the
promoter and distal enhancer regions of the prostate specific antigen gene was a kind gift
from Dr Lirim Shemshedini. The androgen receptor expression plasmid (pSG5 vector)
was a kind gift from Dr. Lirim Shemshedini. The expression plasmids for human full
length Elk1, Elk3 and Elk4 in the pCMV plasmid were purchased from OriGene
(Rockville, MD). Gal4-Elk1 fusion plasmid containing Elk1 activation domain (amino
acids 307-428) was a kind gift from Dr. Kam Yeung (University of Toledo). Gal4 fusion
of Elk1 in which the DNA binding domain of Elk1 (amino acids 1-86) was deleted was
constructed by PCR using the Elk1 expression plasmid as the template and the
appropriate primers and subcloned at BamHI (upstream) and NotI (downstream) sites in a
vector expressing Gal4 fusions (pBind). VP16 fusion constructs for the various domains
of androgen receptor were constructed using the VP16 expression plasmid from Promega.
The androgen receptor(A/B)-NLS construct was generated by PCR amplification of the
A/B domain (residues 1-555) from the full length androgen receptor plasmid and cloning
into the pCDH vector with an in-frame insertion of tandem repeats of a nuclear
localization sequence (NLS) at its carboxyl terminus. shRNAs targeting androgen
111
receptor and ELK1 and non-targeted control shRNA in the lentiviral expression vector,
pLKO.1 puro, were purchased from Sigma-Aldrich (St. Louis, MO). The shRNA
sequences are as follows:
Androgen receptor shRNA: (TRCN0000003718, MISSIONTMTRC shRNA Target Set,
Sigma)
CCGGCACCAATGTCAACTCCAGGATCTCGAGCTCCTGGAGTTGACATTGGTGT
TTTT
ELK1 (shRNA #1): (TRCN0000007450, MISSIONTMTRC shRNA Target Set, Sigma)
CCGGCCCAAGAGTAACTCTCATTATCTCGAGATAATGAGAGTTACTCTTGGGT
TTTT
ELK1 (shRNA #2): (TRCN0000007453, MISSIONTMTRC shRNA Target Set, Sigma).
CCGGCCTGCTTCCTACGCATACATTCTCGAGAATGTATGCGTAGGAAGCAGG
TTTTT
non-target control shRNA: (MISSIONTM Non-Target shRNA Control Vector, Sigma)
CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCA
TCTTGTTGTTTTT. GAL4-TATA-Luc plasmid (pG5luc) and expression plasmids for
VP16 and Gal4 were purchased from Promega (CheckMateTM Mammalian Two-hybrid
System).
Transfection and reporter Luciferase assays
Transient transfections of C4-2 cells were performed using Cell Line
Nucleofector Kits (R) from Amaxa Biosystems (Germany) following the manufacturer-
optimized protocol for LNCaP cells. 2 x 106 cells were used for each nucleofection. After
nucleofection with appropriate plasmids and shRNA, the cells were plated in 12-well
112
poly-D-Lysine coated plates from Becton Dickinson Labware (Bedford, MA). In all
cases, the appropriate empty vector plasmids were used to equalize total DNA for
transfection. For promoter analysis 2μg of each promoter-luciferase reporter construct
was transfected. In the androgen receptor or Elk1 knockdown experiments 1.5 μg of each
shRNA or non-targeting control shRNA plasmid was transfected. HeLa cells were
transfected using LipofectamineTM 2000 transfection reagent. The cells were lysed with
Passive Lysis Buffer (Promega Madison, WI) and the luciferase activities were measured
using substrates for either Firefly luciferase or Renilla luciferase provided in the
Luciferase Assay System (Promega Madison, WI) in a luminometer (Lumat LB9501;
Berthold; Wildbad, Germany). In all cases, uniformity of transfection was confirmed
using the pRL-null plasmid expressing Renilla luciferase.
Lentivirus-mediated transduction
For lentivirus-mediated gene knockdown, shRNAs for androgen receptor, ELK1
and non-target control were packaged in 293FT cells using lentiviral packaging plasmids
as previously described (Gonit et al., 2011). The virus containing supernatant was
harvested 48 h and 72 h after transfection, filtered and stored at -80°C until the time of
infection. 24 h before infection, 5 x 105- 6 x 105 cells were plated in poly-D-lysine coated
6-well plates (for LNCaP or C4-2 cells) in phenol red free medium supplemented with
10% heat inactivated charcoal-stripped FBS and L-glutamine (2mM). The next day cells
were infected with either non-target control shRNA lentivirus or androgen receptor
shRNA lentivirus or Elk1 shRNA lentivirus or a combination of androgen receptor
shRNA and Elk1 shRNA lentiviruses with polybrene (8μg/ml) for duration of 5 h
followed by a similar second lentiviral infection for an additional 5 h. 10 h after the
113
infection, the virus was replaced with fresh phenol red free medium containing 10%
charcoal stripped FBS. For the androgen receptor-negative cell lines DU145 and PC-3,
after the lentiviral infection, the virus was replaced with fresh phenol red free medium
containing 10% FBS. VCaP cells are sensitive to polybrene. Therefore, to increase the
lentiviral transduction efficiency in the absence of polybrene, the MISSIONTM
ExpressMag Super Magnetic Kit from Sigma-Aldrich (St. Louis, MO) was used. Briefly,
24 h before infection, 5 x 105- 6 x 105 cells were plated in poly-D-lysine coated 6-well
plates in phenol red free DMEM supplemented with 10% heat inactivated charcoal-
stripped FBS and L-glutamine (2mM). The next day cells were infected with either non-
target control shRNA or Elk1 shRNA lentivirus using MISSIONTM ExpressMag Beads
per the manufacturer’s protocol. 18-20 h after the infection, the virus was replaced with
fresh phenol red free DMEM containing 10% FBS.
Cell proliferation assay
Cells were trypsinized and 4000-6000 cells per well were seeded in 96-well plates
in phenol red free medium supplemented with 10% charcoal-stripped FBS and grown at
37°C and in 5% CO2 for different time periods. For LNCaP, VCaP and C4-2 cells it was
necessary to use plates coated with poly-D-lysine. For LNCaP and VCaP cells, 24 h after
seeding in 96-well plates, the cells were treated with vehicle (ethanol) or R1881 (1nM).
The culture media was not changed during the entire time course. At the end of each time
point cell viability was determined using the MTT assay. Briefly, 10μl of MTT (5mg/ml)
was added to each well and incubated for 2 h at 37°C. The formazan crystal sediments
were dissolved in 100μl of DMSO and the absorbance at 570nm was measured using the
114
SpectraMax Plus spectrophotometer (Molecular Devices Corp, Sunnyvale, CA). The
assay was conducted in six wells and all values were normalized to day 0.
Two- and three-dimensional colony formation assays
For the 2-dimensional colony formation assay, cells were trypsinized and 500
cells per well were seeded in poly-D-lysine coated 6-well plates in phenol red free
medium supplemented with 10% charcoal-stripped FBS. 24 h later the cells were treated
with vehicle or R1881 (1nM) and grown at 37°C in 5% CO2 for 2 weeks till colonies had
formed. The treatments were replenished every 96 h. Colonies were fixed with methanol
and stained with crystal violet. Each treatment was conducted in triplicate and pictures of
individual wells were taken. For the 3-dimensional colony formation assay, 24-well
plates were coated with a bottom layer of 0.8% SeaPrep ultra low-gelling temperature
agarose (BioWhittaker Molecular Applications, Rockland, ME) in phenol red free
medium supplemented with 10% charcoal-stripped FBS. Cells were trypsinized, serially
diluted in the same media and applied as the top agarose layer. The agarose gel bed was
overlayed with phenol red free medium supplemented with 10% charcoal-stripped FBS
containing R1881 (1nM). The plates were incubated at 37°C in 5% CO2 for 2 weeks until
colonies formed. R1881 was replenished every 96 h. The colonies were stained with
MTT by applying 500μl of MTT (5mg/ml) to each well and incubated for 30 min at
37°C.
Apoptosis assay
Cells were trypsinized and seeded in poly-D-lysine coated 6-well plates in phenol
red free medium supplemented with 10% charcoal-stripped FBS. Apoptosis was
115
measured by Guava Nexin Analysis using the Guava Nexin Reagent staining kit
according to the manufacturer’s instructions.
RNA isolation, reverse transcription and quantitative real time-PCR
Total RNA from cells was isolated using the RNeasy mini kit (Qiagen,
Georgetown, MD) per the manufacturer’s protocol. Reverse transcription was performed
using 500ng of total RNA and the High-Capacity cDNA Archive kit (Applied
Biosystems, Life Technologies Corp, Carlsbad, CA) according to the vendor’s protocol.
cDNA was measured by quantitative real time PCR using the StepOnePlus Real-Time
PCR System (Applied Biosystems, Life Technologies Corp, Carlsbad, CA) and TaqMan
Fast Universal PCR Master Mix (Applied Biosystems, Life Technologies Corp, Carlsbad,
CA). Primers and TaqMan probes for androgen receptor, ELK1(Assay Id#
Hs00901847_m1), ELK3 (Assay Id# Hs00987814_m1), C-FOS, EGR1, KLK3
(Lemaitre et al.), RHOU, IGF1R, TMPRSS2, PMEPA1, PRKCA, BMPR2, THBS1,
TPD52L1, NUPR1, SLC7A11, MAP2, MTHFD2, DTL, CDC6, RAD54B, EME1, FEN1,
CDCA3, CCNB2, UBE2C, CDCA5, MLF1IP, UCK2, MYC, CDC5L and GAPDH were
purchased from the Applied Biosystems inventory (Life Technologies Corp, Carlsbad,
CA). All samples were measured in triplicate and normalized to the values for GAPDH.
Western blot analysis
Cells were lysed with RIPA buffer (150mM NaCl, 1% NP-40, 0.5% sodium
deoxycholate, 0.1% SDS, 50mM Tris of pH 8.0) containing protease inhibitor cocktail
(Pierce Biotechnology, Thermo Fisher Scientific, Rockford, IL ) and incubated on ice for
30 minutes. Cell lysates were heated at 95°C for 5 minutes. Total protein concentration
was determined by Bradford assay (Bio-Rad Laboratories, Hercules, CA). Protein
116
samples (25-50µg) were resolved by electrophoresis on 8% SDS-Polyacrylamide gels
and electrophoretically transferred to PVDF membranes (Millipore Corporation,
Billerica, MA). The blots were probed with appropriate primary antibody and the
appropriate horse-radish peroxidase conjugated secondary antibody. The protein bands
were visualized using the HyGlo Chemiluminescent HRP Antibody Detection Reagent
(Denville scientific, Metuchen, NJ).
Detection of phospho-Elk1
LNCaP cells were grown in RPMI-1640 supplemented with 10% FBS,
penicillin/streptomycin /L-glutamine mix and sodium pyruvate (1mM) as described
before. The cells were washed twice with PBS and incubated for a further 24 hours in
serum-free media. The cells were then treated with vehicle, PMA (10µM) or R1881
(1nM) for various durations. After the treatment, the cells were harvested and lysed in
RIPA buffer containing 1X protease inhibitor cocktail and 1X phosphatase inhibitor
cocktail. Total protein was estimated by Bradford assay. 60µg of total protein was heated
at 95°C for 5 min in SDS sample loading buffer and analyzed by Western blot. Phospho-
Elk1 was detected using anti-phospho Elk1 (Ser383) antibody.
Chromatin Immunoprecipitation
Cells were treated with either vehicle or R1881 (1nM) for 2 h and then subjected
to chromatin immunoprecipitation using anti-androgen receptor antibody. The ChIP assay
was performed using the EZ ChIP chromatin immunoprecipitation kit (# 17-371)
according to the vendor’s protocol (Millipore, Temecula, CA) and ChIP signals were
measured by quantitative Real-Time PCR analysis of chromatin-immunoprecipitated
117
products. Each sample was tested in triplicate. The optimal target sequences chosen to
amplify the genomic sequences were as follows:
Major androgen response element enhancer region of the prostate specific antigen
promoter (-4366 to -3874 nt):
Forward primer: 5’ GCCTGGATCTGAGAGAGATATCATC 3’
Reverse primer: 5’ ACACCTTTTTTTTTCTGGATTGTTG 3’
Probe: 5’-/56-FAM/TGCAAGGATGCCTGCTTTACAAAC/36-TAMSp/-3’
Chromosome 5 (43075562-8194):
Forward primer: 5’ GAAACTGGCGCGTTGAACTTAGCA 3’
Reverse primer: 5’ TTAGGTGTGGAAGCACCGCTCTTA 3’
Probe: 5’-/56-FAM/TAGCGGATAGCGCTGGTATTGCCAAA/36-TAMSp/-3’
Chromosome 6 (91353148-5086):
Forward primer: 5’ATTAAAGTGCGCGAACGGAAGTGG 3’
Reverse primer: 5’ GGCCAAGACATATTTCACGCAGCA 3’
Probe: 5’-/56-FAM/TCCCTTAAGGACCAGCGGGAAAGATA/36-TAMSp/-3’
Chromosome 1 (144218176-9723):
Forward primer: 5’ ACACTTCCGGTATCTTTCCGCACT 3’
Reverse primer: 5’ CGCCAGTCAAGCTGACCAATCAAA 3’
Probe: 5’-/56-FAM/TTACCGTGCAGAGGGAGGGATTTAGA/36-TAMSp/-3’
mRNA expression profiling and gene ontology analysis
The Affymetrix DNA microarray analysis was performed as a full service global
gene expression study at the transcriptional profiling core facility of The Cancer Institute
of New Jersey (New Brunswick, NJ). Total RNA samples were used to generate labeled
118
cRNA, which were hybridized to human U133 Plus 2.0 Affymetrix microarrays. Scanned
image files were analyzed using the Gene Chip Operating System version 1.4 software,
and standard threshold and filtering operations were used. The data were normalized
using housekeeping genes. Normalization assumes that for a subset of genes (i.e.
housekeeping genes), the ratio of measured expression averaged over the set should be
one. All data are Minimum Information About a Microarray Experiment (MIAME)
compliant, and the raw data have been deposited in a MIAME compliant database (Gene
Expression Omnibus), as detailed on the Microarray Gene Expression Data (MGED)
Society website available at http://www.mged.org/Workgroups/MIAME/miame.html.
Differentially expressed genes were identified by comparing R1881 treatment
with vehicle treatment (R1881-activated genes, 1.5-fold cutoff) in control shRNA vs.
Elk1 shRNA infected cells. In cells treated with vehicle, genes repressed or activated by
Elk1 alone were identified by comparing samples from cells infected with control shRNA
vs. Elk1 shRNA (0.5-fold cutoff for repression by Elk1, 2-fold cutoff for activation by
Elk1). Gene ontology analysis was performed using DAVID Bioinformatics Resources
6.7 (Huang da et al., 2009a; Huang da et al., 2009b)
Coimmunoprecipitation
In-vivo coimmunoprecipitation assays for endogenous proteins were performed
using C4-2 cells as described (Chattopadhyay et al., 2006). Briefly, cells grown to 75 %
confluence were harvested in RIPA lysis buffer (50 mM Tris-HCl at pH 7.5, 50 mM
NaCl, 2.5 mM EGTA, 1% Triton X-100, 50 mM NaF, 10 mM Na4P2O7, 10 mM
Na3VO4, 1x protease inhibitor cocktail). Total protein concentration was determined by
Bradford assay and 350 µg of whole cell lysate was precleared using protein A agarose
119
(Millipore, Temecula, CA). Immunoprecipitation was performed using anti-androgen
receptor (N-20), anti-Elk1 (I-20) followed by immunoblot with anti-androgen receptor
and anti-Elk1 antibody. The signal was detected using the HyGlo enhanced
chemiluminescence kit (Denville scientific, Metuchen, NJ).
Mammalian two-hybrid assay
The Checkmate Mammalian two–hybrid assay (Promega) system was used. HeLa
cells were plated in 24 well plates in hormone-free phenol red-free DMEM without
antibiotics. When the cells were about 90% confluent, they were co-transfected with
pG5Luc, pBind vector expressing Gal4 or Gal4-Elk1 fusion proteins and pACT vector
expressing VP16 or VP16 fusion proteins using LipofectamineTM 2000 transfection
reagent. After 48 hours of transfection, the cells were lysed with passive lysis buffer and
the luciferase activity was determined as described above.
Statistical analysis
All of the experiments were repeated at least 3 times. Statistical significance was
determined using one way ANOVA. The error bars represent standard deviation of the
mean. P values are indicated in the figure legends.
120
References
1. Andersen, R. J., Mawji, N. R., Wang, J., Wang, G., Haile, S., Myung, J. K., Watt,
K., Tam, T., Yang, Y. C., Banuelos, C. A., et al. (2010). Regression of castrate-
recurrent prostate cancer by a small-molecule inhibitor of the amino-terminus
domain of the androgen receptor. Cancer Cell 17, 535-546.
2. Attar, R. M., Takimoto, C. H., and Gottardis, M. M. (2009). Castration-resistant
prostate cancer: locking up the molecular escape routes. Clin Cancer Res 15,
3251-3255.
3. Ayadi, A., Zheng, H., Sobieszczuk, P., Buchwalter, G., Moerman, P., Alitalo, K.,
and Wasylyk, B. (2001). Net-targeted mutant mice develop a vascular phenotype
and up-regulate egr-1. EMBO J 20, 5139-5152
4. Best, C. J., Gillespie, J. W., Yi, Y., Chandramouli, G. V., Perlmutter, M. A.,
Gathright, Y., Erickson, H. S., Georgevich, L., Tangrea, M. A., Duray, P. H., et
al. (2005). Molecular alterations in primary prostate cancer after androgen
ablation therapy. Clin Cancer Res 11, 6823-6834.
5. Booy, E. P., Henson, E. S., and Gibson, S. B. (2011). Epidermal growth factor
regulates Mcl-1 expression through the MAPK-Elk-1 signalling pathway
contributing to cell survival in breast cancer. Oncogene 30, 2367-2378.
6. Boros, J., Donaldson, I. J., O'Donnell, A., Odrowaz, Z. A., Zeef, L., Lupien, M.,
Meyer, C. A., Liu, X. S., Brown, M., and Sharrocks, A. D. (2009a). Elucidation of
the ELK1 target gene network reveals a role in the coordinate regulation of core
components of the gene regulation machinery. Genome Res 19, 1963-1973.
121
7. Boros, J., O'Donnell, A., Donaldson, I. J., Kasza, A., Zeef, L., and Sharrocks, A.
D. (2009b). Overlapping promoter targeting by Elk-1 and other divergent ETS-
domain transcription factor family members. Nucleic Acids Res 37, 7368-7380.
8. Carver, B. S., Tran, J., Chen, Z., Carracedo-Perez, A., Alimonti, A., Nardella, C.,
Gopalan, A., Scardino, P. T., Cordon-Cardo, C., Gerald, W., and Pandolfi, P. P.
(2009). ETS rearrangements and prostate cancer initiation. Nature 457, E1;
discussion E2-3.
9. Cesari, F., Brecht, S., Vintersten, K., Vuong, L. G., Hofmann, M., Klingel, K.,
Schnorr, J. J., Arsenian, S., Schild, H., Herdegen, T., et al. (2004a). Mice
deficient for the ets transcription factor elk-1 show normal immune responses and
mildly impaired neuronal gene activation. Mol Cell Biol 24, 294-305.
10. Cesari, F., Rennekampff, V., Vintersten, K., Vuong, L. G., Seibler, J., Bode, J.,
Wiebel, F. F., and Nordheim, A. (2004b). Elk-1 knock-out mice engineered by
Flp recombinase-mediated cassette exchange. Genesis 38, 87-92.
11. Chang, C. Y., and McDonnell, D. P. (2002). Evaluation of ligand-dependent
changes in AR structure using peptide probes. Mol Endocrinol 16, 647-660.
12. Chattopadhyay, S., Gong, E. Y., Hwang, M., Park, E., Lee, H. J., Hong, C. Y.,
Choi, H. S., Cheong, J. H., Kwon, H. B., and Lee, K. (2006). The CCAAT
enhancer-binding protein-alpha negatively regulates the transactivation of
androgen receptor in prostate cancer cells. Mol Endocrinol 20, 984-995.
122
13. Chen, C. D., Welsbie, D. S., Tran, C., Baek, S. H., Chen, R., Vessella, R.,
Rosenfeld, M. G., and Sawyers, C. L. (2004). Molecular determinants of
resistance to antiandrogen therapy. Nat Med 10, 33-39.
14. Costello, P. S., Nicolas, R. H., Watanabe, Y., Rosewell, I., and Treisman, R.
(2004). Ternary complex factor SAP-1 is required for Erk-mediated thymocyte
positive selection. Nat Immunol 5, 289-298.
15. Dalton, S., and Treisman, R. (1992). Characterization of SAP-1, a protein
recruited by serum response factor to the c-fos serum response element. Cell 68,
597-612.
16. Figueroa, C., and Vojtek, A. B. (2003). Akt negatively regulates translation of the
ternary complex factor Elk-1. Oncogene 22, 5554-5561.
17. Fradet, Y. (2004). Bicalutamide (Casodex) in the treatment of prostate cancer.
Expert Rev Anticancer Ther 4, 37-48.
18. Gille, H., Kortenjann, M., Thomae, O., Moomaw, C., Slaughter, C., Cobb, M. H.,
and Shaw, P. E. (1995). ERK phosphorylation potentiates Elk-1-mediated ternary
complex formation and transactivation. EMBO J 14, 951-962.
19. Giovane, A., Pintzas, A., Maira, S. M., Sobieszczuk, P., and Wasylyk, B. (1994).
Net, a new ets transcription factor that is activated by Ras. Genes Dev 8, 1502-
1513.
20. Giovane, A., Sobieszczuk, P., Mignon, C., Mattei, M. G., and Wasylyk, B.
(1995). Locations of the ets subfamily members net, elk1, and sap1 (ELK3,
ELK1, and ELK4) on three homologous regions of the mouse and human
genomes. Genomics 29, 769-772.
123
21. Gonit, M., Zhang, J., Salazar, M., Cui, H., Shatnawi, A., Trumbly, R., and
Ratnam, M. (2011). Hormone depletion-insensitivity of prostate cancer cells is
supported by the AR without binding to classical response elements. Mol
Endocrinol 25, 621-634.
22. Guo, Z., Yang, X., Sun, F., Jiang, R., Linn, D. E., Chen, H., Kong, X., Melamed,
J., Tepper, C. G., Kung, H. J., et al. (2009). A novel androgen receptor splice
variant is up-regulated during prostate cancer progression and promotes androgen
depletion-resistant growth. Cancer Res 69, 2305-2313.
23. He, B., Kemppainen, J. A., and Wilson, E. M. (2000). FXXLF and WXXLF
sequences mediate the NH2-terminal interaction with the ligand binding domain
of the androgen receptor. J Biol Chem 275, 22986-22994.
24. Helgeson, B. E., Tomlins, S. A., Shah, N., Laxman, B., Cao, Q., Prensner, J. R.,
Cao, X., Singla, N., Montie, J. E., Varambally, S., et al. (2008). Characterization
of TMPRSS2:ETV5 and SLC45A3:ETV5 gene fusions in prostate cancer. Cancer
Res 68, 73-80.
25. Heemers, H. V., Schmidt, L. J., Sun, Z., Regan, K. M., Anderson, S. K., Duncan,
K., Wang, D., Liu, S., Ballman, K. V., and Tindall, D. J. (2011). Identification of
a clinically relevant androgen-dependent gene signature in prostate cancer. Cancer
Res 71, 1978-1988.
26. Hu, R., Dunn, T. A., Wei, S., Isharwal, S., Veltri, R. W., Humphreys, E., Han, M.,
Partin, A. W., Vessella, R. L., Isaacs, W. B., et al. (2009). Ligand-independent
androgen receptor variants derived from splicing of cryptic exons signify
hormone-refractory prostate cancer. Cancer Res 69, 16-22.
124
27. Latinkic, B. V., Zeremski, M., and Lau, L. F. (1996). Elk-1 can recruit SRF to
form a ternary complex upon the serum response element. Nucleic Acids Res 24,
1345-1351.
28. Liu, Y., Karaca, M., Zhang, Z., Gioeli, D., Earp, H. S., and Whang, Y. E. (2010).
Dasatinib inhibits site-specific tyrosine phosphorylation of androgen receptor by
Ack1 and Src kinases. Oncogene 29, 3208-3216.
29. Mamali, I., Kotsantis, P., Lampropoulou, M., and Marmaras, V. J. (2008). Elk-1
associates with FAK, regulates the expression of FAK and MAP kinases as well
as apoptosis in HK-2 cells. J Cell Physiol 216, 198-206.
30. Marcelli, M., Ittmann, M., Mariani, S., Sutherland, R., Nigam, R., Murthy, L.,
Zhao, Y., DiConcini, D., Puxeddu, E., Esen, A., et al. (2000). Androgen receptor
mutations in prostate cancer. Cancer Res 60, 944-949.
31. Mukhopadhyay, N. K., Ferdinand, A. S., Mukhopadhyay, L., Cinar, B.,
Lutchman, M., Richie, J. P., Freeman, M. R., and Liu, B. C. (2006). Unraveling
androgen receptor interactomes by an array-based method: discovery of proto-
oncoprotein c-Rel as a negative regulator of androgen receptor. Exp Cell Res 312,
3782-3795.
32. Norris, J. D., Chang, C. Y., Wittmann, B. M., Kunder, R. S., Cui, H., Fan, D.,
Joseph, J. D., and McDonnell, D. P. (2009). The homeodomain protein HOXB13
regulates the cellular response to androgens. Mol Cell 36, 405-416.
33. Odrowaz, Z., and Sharrocks, A. D. (2012). ELK1 Uses Different DNA Binding
Modes to Regulate Functionally Distinct Classes of Target Genes. PLoS Genet 8,
e1002694.
125
34. Peterziel, H., Mink, S., Schonert, A., Becker, M., Klocker, H., and Cato, A. C.
(1999). Rapid signalling by androgen receptor in prostate cancer cells. Oncogene
18, 6322-6329.
35. Price, M. A., Rogers, A. E., and Treisman, R. (1995). Comparative analysis of the
ternary complex factors Elk-1, SAP-1a and SAP-2 (ERP/NET). EMBO J 14,
2589-2601.
36. Rahim, G., Araud, T., Jaquier-Gubler, P., and Curran, J. (2012). Alternative
splicing within the elk-1 5' untranslated region serves to modulate initiation
events downstream of the highly conserved upstream open reading frame 2. Mol
Cell Biol 32, 1745-1756.
37. Ramsay, A. K., and Leung, H. Y. (2009). Signalling pathways in prostate
carcinogenesis: potentials for molecular-targeted therapy. Clin Sci (Lond) 117,
209-228.
38. Rao, V. N., Huebner, K., Isobe, M., ar-Rushdi, A., Croce, C. M., and Reddy, E. S.
(1989). elk, tissue-specific ets-related genes on chromosomes X and 14 near
translocation breakpoints. Science 244, 66-70.
39. Rao, V. N., and Reddy, E. S. (1992a). A divergent ets-related protein, elk-1,
recognizes similar c-ets-1 proto-oncogene target sequences and acts as a
transcriptional activator. Oncogene 7, 65-70.
40. Rao, V. N., and Reddy, E. S. (1992b). elk-1 domains responsible for autonomous
DNA binding, SRE:SRF interaction and negative regulation of DNA binding.
Oncogene 7, 2335-2340.
126
41. Robinson, M. J., and Cobb, M. H. (1997). Mitogen-activated protein kinase
pathways. Curr Opin Cell Biol 9, 180-186.
42. Saporita, A. J., Zhang, Q., Navai, N., Dincer, Z., Hahn, J., Cai, X., and Wang, Z.
(2003). Identification and characterization of a ligand-regulated nuclear export
signal in androgen receptor. J Biol Chem 278, 41998-42005.
43. Sun, S., Sprenger, C. C., Vessella, R. L., Haugk, K., Soriano, K., Mostaghel, E.
A., Page, S. T., Coleman, I. M., Nguyen, H. M., Sun, H., et al. (2010). Castration
resistance in human prostate cancer is conferred by a frequently occurring
androgen receptor splice variant. J Clin Invest 120, 2715-2730.
44. Taplin, M. E., Rajeshkumar, B., Halabi, S., Werner, C. P., Woda, B. A., Picus, J.,
Stadler, W., Hayes, D. F., Kantoff, P. W., Vogelzang, N. J., and Small, E. J.
(2003). Androgen receptor mutations in androgen-independent prostate cancer:
Cancer and Leukemia Group B Study 9663. J Clin Oncol 21, 2673-2678.
45. Tomlins, S. A., Laxman, B., Dhanasekaran, S. M., Helgeson, B. E., Cao, X.,
Morris, D. S., Menon, A., Jing, X., Cao, Q., Han, B., et al. (2007). Distinct classes
of chromosomal rearrangements create oncogenic ETS gene fusions in prostate
cancer. Nature 448, 595-599.
46. Tomlins, S. A., Mehra, R., Rhodes, D. R., Smith, L. R., Roulston, D., Helgeson,
B. E., Cao, X., Wei, J. T., Rubin, M. A., Shah, R. B., and Chinnaiyan, A. M.
(2006). TMPRSS2:ETV4 gene fusions define a third molecular subtype of
prostate cancer. Cancer Res 66, 3396-3400.
47. Tomlins, S. A., Rhodes, D. R., Perner, S., Dhanasekaran, S. M., Mehra, R., Sun,
X. W., Varambally, S., Cao, X., Tchinda, J., Kuefer, R., et al. (2005). Recurrent
127
fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer.
Science 310, 644-648.
48. Tran, C., Ouk, S., Clegg, N. J., Chen, Y., Watson, P. A., Arora, V., Wongvipat, J.,
Smith-Jones, P. M., Yoo, D., Kwon, A., et al. (2009). Development of a second-
generation antiandrogen for treatment of advanced prostate cancer. Science 324,
787-790.
49. Vanhoutte, P., Nissen, J. L., Brugg, B., Gaspera, B. D., Besson, M. J., Hipskind,
R. A., and Caboche, J. (2001). Opposing roles of Elk-1 and its brain-specific
isoform, short Elk-1, in nerve growth factor-induced PC12 differentiation. J Biol
Chem 276, 5189-5196.
50. Vickers, E. R., Kasza, A., Kurnaz, I. A., Seifert, A., Zeef, L. A., O'Donnell, A.,
Hayes, A., and Sharrocks, A. D. (2004). Ternary complex factor-serum response
factor complex-regulated gene activity is required for cellular proliferation and
inhibition of apoptotic cell death. Mol Cell Biol 24, 10340-10351.
51. White, R. J., and Sharrocks, A. D. (2010). Coordinated control of the gene
expression machinery. Trends Genet 26, 214-220.
52. Yang, S. H., Bumpass, D. C., Perkins, N. D., and Sharrocks, A. D. (2002). The
ETS domain transcription factor Elk-1 contains a novel class of repression
domain. Mol Cell Biol 22, 5036-5046.
53. Yang, S. H., and Sharrocks, A. D. (2005). PIASx acts as an Elk-1 coactivator by
facilitating derepression. EMBO J 24, 2161-2171.
128
54. Yang, S. H., and Sharrocks, A. D. (2006). PIASxalpha differentially regulates the
amplitudes of transcriptional responses following activation of the ERK and p38
MAPK pathways. Mol Cell 22, 477-487.
55. Yang, S. H., Vickers, E., Brehm, A., Kouzarides, T., and Sharrocks, A. D. (2001).
Temporal recruitment of the mSin3A-histone deacetylase corepressor complex to
the ETS domain transcription factor Elk-1. Mol Cell Biol 21, 2802-2814.
56. Zhang, H. M., Li, L., Papadopoulou, N., Hodgson, G., Evans, E., Galbraith, M.,
Dear, M., Vougier, S., Saxton, J., and Shaw, P. E. (2008). Mitogen-induced
recruitment of ERK and MSK to SRE promoter complexes by ternary complex
factor Elk-1. Nucleic Acids Res 36, 2594-2607.
57. Zhang, J., Gonit, M., Salazar, M. D., Shatnawi, A., Shemshedini, L., Trumbly, R.,
and Ratnam, M. (2010). C/EBPalpha redirects androgen receptor signaling
through a unique bimodal interaction. Oncogene 29, 723-738.
58. Zhang, X., Gamble, M. J., Stadler, S., Cherrington, B. D., Causey, C. P.,
Thompson, P. R., Roberson, M. S., Kraus, W. L., and Coonrod, S. A. (2011).
Genome-wide analysis reveals PADI4 cooperates with Elk-1 to activate c-Fos
expression in breast cancer cells. PLoS Genet 7, e1002112.
129
Figure Legends
Figure 1
Effect of androgen receptor on Elk-1 transcriptional activity
A) HeLa cells were co-transfected with reporter vector containing the Elk-1 cis element
((Elk1)2-TATA-Luc) or androgen receptor expression plasmid and treated with or
without 10 nM testosterone. After 48 hours of transfection, the cells were harvested and
luciferase activity measured (P value < 0.05). B and C) HeLa cells were co-transfected
with reporter vector containing the Elk-1 cis element ((Elk1)2-TATA-Luc), androgen
receptor expression plasmid or Elk-1 expression plasmid and treated with or without
testosterone. After 48 hours of transfection the cells were harvested for measuring mRNA
expression (B) and luciferase activity respectively (P value < 0.05). D) HeLa cells were
co-transfected with reporter vector containing the androgen response element (ARE-
TATA-Luc), androgen receptor expression plasmid or Elk-1 expression plasmid and
treated with or without testosterone. After 48 hours of transfection the cells were
harvested for measuring luciferase activity. E) HeLa cells were co-transfected with
reporter vector containing the interferon stimulated response element (ISRE-TATA-Luc),
androgen receptor expression plasmid or Elk-1 expression plasmid and treated with or
without testosterone. After 48 hours of transfection the cells were harvested for
measuring luciferase activity (P value < 0.05).
130
Figure 2
Effect of Elk-1 knock-down on Elk-1 transcriptional activity in the presence of
androgen receptor
A and B) HeLa cells were co-transfected with reporter vector containing the Elk-1 cis
element ((Elk1)2-TATA-Luc), androgen receptor expression plasmid or Elk-1 shRNA
and treated with or without testosterone. After 48 hours of transfection, the cells were
harvested for luciferase activity (A) or total mRNA for measurement of Elk-1 expression
by qRT-PCR (B) (P value < 0.05). C and D) C4-2 cells were nucleofected with the
reporter vector containing Elk-1 cis element, control shRNA, androgen receptor shRNA
or Elk-1 shRNA. After 48 hours of transfection, the cells were harvested for luciferase
activity (C) or for total RNA (D) for measuring Elk-1 and androgen receptor expression
by qRT-PCR (P value < 0.05).
Figure 3
Androgen receptor and Elk-1 interact with each other.
A) C4-2 cells were grown in serum stripped medium for 48 hours before harvesting for
total protein. Total protein was harvested, measured and immunoprecipitation performed
as described in materials and methods section. After immunoprecipitation, Western blot
was performed using the appropriate antibody. B and C) HeLa cells were co-transfected
with Gal4-TATA-luc reporter vector, expression plasmid Gal4 protein or fusion protein
of Gal4-Elk1 with Elk-1 activation domain (Gal4-Elk1 (307-428 amino acids) or fusion
protein of Gal4-Elk-1 with full length Elk-1 lacking the DNA binding domain (Gal4-Elk-
1 (87-428 amino acids) and expression plasmid for VP16 activation domain or fusion
proteins of VP16 with different domains of androgen receptor as shown in panel B (P
131
value < 0.001). B) The domains of Elk-1 and androgen receptor are depicted (not to
scale). D) HeLa cells were co-transfected with ((Elk1)2-TATA-Luc), full length androgen
receptor or androgen receptor A/B domain fused with nuclear localization signal (AR
A/B-NLS) and treated with or without testosterone. After 48 hours of transfection, the
cells are lysed to measure luciferase activity (P value < 0.001).
Figure 4
Microarray analysis of LNCaP cells with endogenous Elk1 and with Elk-1 knock
down.
A) LNCaP cells were infected with control sh RNA or Elk-1 shRNA for 72 hours in
hormone-stripped media and treated with or without synthetic androgen R1881 for 48
hours and harvested for total RNA. These samples were subjected to microarray. The
probe ids that showed up regulation by Elk-1 in association with androgen receptor are
shown. B) Venn diagram of the gene expression profile obtained from samples above
after microarray.
Figure 5
Validation of genes identified by microarray in LNCaP and C4-2 cells
A) Hormone-stripped LNCaP cells were infected with control sh RNA or Elk-1 shRNA
for 72 hours and treated with or without synthetic androgen R1881 for 48 hours and
harvested for total RNA. The total RNA was reverse transcribed and utilized for
validation of expression of genes obtained from microarray analysis by qRT-PCR. B)
Hormone-stripped C4-2 cells were infected with control sh RNA or androgen receptor
shRNA or Elk-1 shRNA for 72 hours and harvested for total RNA. The total RNA was
132
reverse transcribed and utilized for validation of expression of genes obtained from
microarray analysis by qRT-PCR.
Figure 6
Effect of Elk1 knock down on growth of LNCaP cells
(Elk-1 shRNA-1) for 72 hours and treated with or without synthetic androgen R1881 for
48 hours. The cell growth was determined by MTT assay at different time points (P value
< 0.05). The inset shows the expression of Elk-1 and androgen receptor before and after
knock-down and before and after R1881 treatment B) Hormone-stripped LNCaP cells
were infected with control sh RNA or Elk-1 shRNA (Elk-1 shRNA-1) for 72 hours and
treated with or without synthetic androgen R1881 for 48 hours. The cells were harvested
for mRNA to determine the expression of androgen receptor target genes by qRT-PCR.
Figure 7
Effect of Elk-1 knock-down on hormone-sensitive and hormone-independent
A) Hormone-stripped C4-2 cells were infected with control sh RNA or androgen receptor
shRNA for 72 hours. The cell growth was determined by MTT assay at different time
points. The inset shows the Western blot for androgen receptor with GAPDH as the
loading control. B) Hormone-stripped C4-2 cells were infected with control sh RNA or
Elk-1 shRNA-1 or Elk-1 shRNA-2 for 72 hours. The cell growth was determined by
MTT assay at different time points. The inset shows the Western blot for Elk-1 with
GAPDH as the loading control.
133
Figure 8
Effect of Elk-1 knock down on androgen receptor negative prostate cancer cells and
on clonogenicity of C4-2 prostate cancer cells
A) Hormone-stripped DU145 and PC3 cells were infected with Elk-1 shRNA for 72
hours and MTT assay performed at different time points. The inset shows the Western
blot for Elk-1 with GAPDH as the loading control (P value < 0.05). B) Hormone-
stripped C4-2 cells were infected with control shRNA or Elk-1 shRNA and anchorage-
independent colony formation was measured in 0.8% soft agar containing a serial dilution
of cells after treatment with 1nM R1881. After 2 weeks, colonies were stained with MTT.
C) Hormone-stripped C4-2 cells were infected with control shRNA or Elk-1 shRNA.
Anchorage-dependent colony formation was measured after treatment with vehicle or
1nM R1881. After 2 weeks, colonies were stained with crystal violet. The inset shows the
Western blot for androgen receptor and Elk-1 with or without knock-down and with or
without treatment with R1881. GAPDH is the loading control.
Figure 9
Effect of Elk-1 knock-down on apoptosis and effect of androgen on Elk-1
phosphorylation and Elk-1 target genes
(Elk-1 shRNA-1 or Elk-1 shRNA-2) and after 96 hours, treated with or without synthetic
androgen R1881 for 48 hours. The cells were harvested at the end of treatment and
annexin V staining performed to measure apoptosis. As a positive control for apoptosis,
hormone-stripped LNCaP cells were treated with 100µM cisplatin for 24 and 48 hours.
B) Hormone-stripped C4-2 cells were infected with control sh RNA or Elk-1 shRNA
134
(Elk-1 shRNA-1 or Elk-1 shRNA-2). After 72 hours of infection, the cells were harvested
and annexin V assay performed to measure apoptosis. As a positive control for apoptosis,
hormone-stripped LNCaP cells were treated with 100µM cisplatin for 24 and 48 hours C)
Hormone-stripped LNCaP cells were treated with Vehicle or R1881 and Elk-1 expression
measured by qRT-PCR. The inset shows the Western blot of Elk-1 before or after R1881
treatment. D) C4-2 cells were serum starved for 24 hours and treated with phorbol 12-
myristate 13-acetate for 1 hour. C4-2 cells were serum stripped for 48 hours and treated
with vehicle or R1881 for different time. The cells were harvested at appropriate time
points for total protein and Western blot performed with Ser383 phospho-Elk-1 antibody
or Elk-1 antibody. GAPDH is the loading control. E) LNCaP cells were serum starved for
24 hours. The serum starved cells were stimulated with serum for different time. The
cells were also serum stripped for 48 hours. The serum stripped cells were treated with
vehicle or 1nM R1881. After the appropriate treatment, the cells were harvested for total
mRNA and quantitative real-time PCR performed for quantitation of expression of
prostate specific antigen, c-Fos and Egr-1 expression (P value for A and B < 0.05 and P
value for E <0.005).
Figure 10
Effect of Casodex on gene expression in prostate cancer cells and effect of androgen
receptor on Elk-1 mediated recruitment of androgen receptor
A) Hormone-stripped LNCaP cells were treated with vehicle or 1nM R1881 or 1nM
R1881 and 10µM Casodex. After 48 hours of treatment, the cells were harvested for total
RNA and qRT-PCR performed for quantitative measurement of gene expression. The
inset shows the Western blot of androgen receptor under different treatment conditions.
135
As a positive control, the gene expression of prostate specific antigen was performed
under different treatment conditions. B) Hormone-stripped C4-2 cells were treated with
vehicle or 1nM R1881 or 1nM R1881 and 10µM Casodex. After 48 hours of treatment,
the cells were harvested for total RNA and qRT-PCR performed for quantitative
measurement of gene expression. The inset shows the Western blot of androgen receptor
under different treatment conditions. As a positive control, the gene expression of
prostate specific antigen was performed under different treatment conditions. C)
Hormone-stripped LNCaP cells were infected with control shRNA or Elk-1 shRNA.
After 72 hours of infection, the cells were treated with vehicle or R1881 for 48 hours.
After treatment, chromatin-immunoprecipitation was performed using anti-androgen
receptor antibody followed by quantification of the immunoprecipitated chromatin
regions using primers for target sequences that were within the 250bp from the Elk-1
binding sites of the genes. Prostate specific antigen is used as a positive control and
GAPDH as non-target control (P value < 0.05).
Figure 11
Role of Elk-3 over expression on Elk-1 transcriptional activity and expression levels
of Elk-1 and Elk-3 in normal prostate epithelial cells, and prostate cancer cells
A) HeLa cells were co-transfected with reporter vector containing the Elk-1 cis element
((Elk1)2-TATA-Luc) or androgen receptor expression plasmid and treated with or
without 10 nM testosterone. After 48 hours of transfection, the cells were harvested and
luciferase activity measured (P value < 0.005). B) HeLa cells were co-transfected with
reporter vector containing the Elk-1 cis element ((Elk1)2-TATA-Luc) or androgen
receptor expression plasmid and treated with or without 10 nM testosterone. After 48
136
hours of transfection, the cells were harvested total RNA and gene expression of Elk-1
and Elk-3 quantified by qRT-PCR. C) LNCaP, VCaP, C4-2 prostate cancer cells or
normal prostate epithelial cells from men aged 17 years and 29 years were harvested for
total RNA and gene expression of Elk-1 and Elk-3 quantified by qRT-PCR (P value <
0.05).
137
Figure 1
A B
C D
138
Figure 2
A B
C D
139
Figure 3
140
D
141
Figure 4
142
Figure 5
143
Figure 6
A
144
Figure 7
A
145
Figure 8
Cells seeded 1000 500 250

(0.25 ml gel)
Cells seeded 1000 500 250

(0.25 ml gel)
146
Figure 8
147
Figure 9
A B
C
148
Figure 10
A
* *
149
Figure 11
A B C
E
D
150
Chapter 4
Summary and Conclusions
The research studies showed that androgen receptor exert significant
transcriptional effects. Folates are essential for normal body functions and during
embryogenesis (Laanpere et al., 2010). Folic acid deficiency results in spina bifida and
neural tube defects in the new born. During pregnancy, the folic acid demand increases
due to rapid cell growth in the fetus. Folate receptor α facilitates the transport of folic
acid from maternal circulation to the fetus. Pregnancy is a complicated process that has to
be tightly regulated. Estrogen and progesterone receptor regulates folate receptor α
transcriptionally (Kelley et al., 2003; Shatnawi et al., 2007). Progesterone secretion
increases after ovulation and remains high during the first trimester of pregnancy.
Testosterone secretion peaks during the luteal phase and during the first trimester of
pregnancy (Abraham, 1974; Burger, 2002). Progesterone activates folate receptor α gene.
In the first part of the study, we determined the role of testosterone secretion on folate
receptor α gene. We identified that androgen receptor increased folate receptor α mRNA
and protein expression. Androgen receptor and CAAT enhancer binding protein α
activated folate receptor α gene by binding to their recognition sites at the promoter.
Androgen receptor and CAAT enhancer binding protein α interacted suggesting that
folate receptor α gene activation is a synergistic effect. The results show an additional
mechanism of folate receptor α gene regulation. Folate receptor α expressed in non-
151
mucinous cancer cells is an important cancer drug target and utilized for targeted drug
delivery to folate receptor positive cancer cells (Zhao et al., 2008).
In the second part of the study, we identified an alternative role of Elk-1 and
androgen receptor in prostate cancer cells. In normal prostate and prostate cancer,
androgen activated androgen receptor binds to its recognition sites and activates
transcription of genes required for growth and survival. This is classical mechanism of
androgen receptor (Agoulnik and Weigel, 2006). In addition to the classical mechanism,
androgen receptor exerts its effects through other transcription factors (Vlahopoulos et
al., 2005). We identified Elk-1 transcription factor that required androgen receptor for
Elk-1 mediated transcriptional effects. We showed that Elk-1 and androgen receptor
interact and suggested the interaction is necessary for supporting genes involved in cell
growth. Elk-1 and androgen receptor is necessary to support prostate cancer growth and
tumorigenicity. The ternary complex factor members Elk-3 did not tether androgen
receptor suggesting Elk-1 has a specific role in supporting prostate cancer growth.
Prostate cancer affects approximately 30,000 men in United States of America annually
according to American Cancer Society 2011 surveillance research. The existing drugs
targeting androgen receptor or its axis and immunotherapy extends the survival time to
three to six months. Prostate cancer cells adapt and outsmart these drugs. Our study
showed Elk-1 and androgen receptor support androgen-dependent prostate cancer growth
providing a new strategy for drug designing. Drugs targeting Elk-1 may be successful as
Elk-1 exhibits redundancy with Elk-4 and GA binding protein alpha chain (GABPA).
This study provides a foundation for a deeper understanding of the mechanism of Elk-1
152
in prostate cancer. An in-depth knowledge of the mechanism of action of Elk-1 and
androgen receptor will help in designing smarter drugs.
153
References
1. Aarnisalo, P., Palvimo, J. J., and Janne, O. A. (1998). CREB-binding protein in
androgen receptor-mediated signaling. Proc Natl Acad Sci U S A 95, 2122-2127.
2. Aarnisalo, P., Santti, H., Poukka, H., Palvimo, J. J., and Janne, O. A. (1999).
Transcription activating and repressing functions of the androgen receptor are
differentially influenced by mutations in the deoxyribonucleic acid-binding
domain. Endocrinology 140, 3097-3105.
3. Abraham, G. E. (1974). Ovarian and adrenal contribution to peripheral androgens
during the menstrual cycle. J Clin Endocrinol Metab 39, 340-346.
4. Agoulnik, I. U., and Weigel, N. L. (2006). Androgen receptor action in hormone-
dependent and recurrent prostate cancer. J Cell Biochem 99, 362-372.
5. Andersen, R. J., Mawji, N. R., Wang, J., Wang, G., Haile, S., Myung, J. K., Watt,
K., Tam, T., Yang, Y. C., Banuelos, C. A., et al. (2010). Regression of castrate-
recurrent prostate cancer by a small-molecule inhibitor of the amino-terminus
domain of the androgen receptor. Cancer Cell 17, 535-546.
6. Antonson, P., and Xanthopoulos, K. G. (1995). Molecular cloning, sequence, and
expression patterns of the human gene encoding CCAAT/enhancer binding
protein alpha (C/EBP alpha). Biochem Biophys Res Commun 215, 106-113.
7. Antony, A. C. (1996). Folate receptors. Annu Rev Nutr 16, 501-521.
154
8. Antony, A. C., Utley, C., Van Horne, K. C., and Kolhouse, J. F. (1981). Isolation
and characterization of a folate receptor from human placenta. J Biol Chem 256,
9684-9692.
9. Araud, T., Genolet, R., Jaquier-Gubler, P., and Curran, J. (2007). Alternatively
spliced isoforms of the human elk-1 mRNA within the 5' UTR: implications for
ELK-1 expression. Nucleic Acids Res 35, 4649-4663.
10. Attar, R. M., Takimoto, C. H., and Gottardis, M. M. (2009). Castration-resistant
prostate cancer: locking up the molecular escape routes. Clin Cancer Res 15,
3251-3255.
11. Attard, G., Reid, A. H., A'Hern, R., Parker, C., Oommen, N. B., Folkerd, E.,
Messiou, C., Molife, L. R., Maier, G., Thompson, E., et al. (2009). Selective
inhibition of CYP17 with abiraterone acetate is highly active in the treatment of
castration-resistant prostate cancer. J Clin Oncol 27, 3742-3748.
12. Ayadi, A., Zheng, H., Sobieszczuk, P., Buchwalter, G., Moerman, P., Alitalo, K.,
and Wasylyk, B. (2001). Net-targeted mutant mice develop a vascular phenotype
and up-regulate egr-1. EMBO J 20, 5139-5152.
13. Bailey, L. B., and Gregory, J. F., 3rd (1999). Folate metabolism and requirements.
J Nutr 129, 779-782.
14. Balamotis, M. A., Pennella, M. A., Stevens, J. L., Wasylyk, B., Belmont, A. S.,
and Berk, A. J. (2009). Complexity in transcription control at the activation
domain-mediator interface. Sci Signal 2, ra20.
15. Beato, M., Herrlich, P., and Schutz, G. (1995). Steroid hormone receptors: many
actors in search of a plot. Cell 83, 851-857.
155
16. Bennett, N. C., Gardiner, R. A., Hooper, J. D., Johnson, D. W., and Gobe, G. C.
(2010). Molecular cell biology of androgen receptor signalling. Int J Biochem
Cell Biol 42, 813-827.
17. Berrevoets, C. A., Doesburg, P., Steketee, K., Trapman, J., and Brinkmann, A. O.
(1998). Functional interactions of the AF-2 activation domain core region of the
human androgen receptor with the amino-terminal domain and with the
transcriptional coactivator TIF2 (transcriptional intermediary factor2). Mol
18. Best, C. J., Gillespie, J. W., Yi, Y., Chandramouli, G. V., Perlmutter, M. A.,
Gathright, Y., Erickson, H. S., Georgevich, L., Tangrea, M. A., Duray, P. H., et
al. (2005). Molecular alterations in primary prostate cancer after androgen
ablation therapy. Clin Cancer Res 11, 6823-6834.
19. Bevan, C. L., Hoare, S., Claessens, F., Heery, D. M., and Parker, M. G. (1999).
The AF1 and AF2 domains of the androgen receptor interact with distinct regions
of SRC1. Mol Cell Biol 19, 8383-8392.
20. Blount, B. C., Mack, M. M., Wehr, C. M., MacGregor, J. T., Hiatt, R. A., Wang,
G., Wickramasinghe, S. N., Everson, R. B., and Ames, B. N. (1997). Folate
deficiency causes uracil misincorporation into human DNA and chromosome
breakage: implications for cancer and neuronal damage. Proc Natl Acad Sci U S
A 94, 3290-3295.
21. Booy, E. P., Henson, E. S., and Gibson, S. B. (2011). Epidermal growth factor
regulates Mcl-1 expression through the MAPK-Elk-1 signalling pathway
contributing to cell survival in breast cancer. Oncogene 30, 2367-2378.
156
22. Boros, J., Donaldson, I. J., O'Donnell, A., Odrowaz, Z. A., Zeef, L., Lupien, M.,
Meyer, C. A., Liu, X. S., Brown, M., and Sharrocks, A. D. (2009a). Elucidation of
the ELK1 target gene network reveals a role in the coordinate regulation of core
components of the gene regulation machinery. Genome Res 19, 1963-1973.
23. Boros, J., O'Donnell, A., Donaldson, I. J., Kasza, A., Zeef, L., and Sharrocks, A.
D. (2009b). Overlapping promoter targeting by Elk-1 and other divergent ETS-
domain transcription factor family members. Nucleic Acids Res 37, 7368-7380.
24. Brinkmann, A. O., Blok, L. J., de Ruiter, P. E., Doesburg, P., Steketee, K.,
Berrevoets, C. A., and Trapman, J. (1999). Mechanisms of androgen receptor
activation and function. J Steroid Biochem Mol Biol 69, 307-313.
25. Brinkmann, A. O., Faber, P. W., van Rooij, H. C., Kuiper, G. G., Ris, C.,
Klaassen, P., van der Korput, J. A., Voorhorst, M. M., van Laar, J. H., Mulder, E.,
and et al. (1989). The human androgen receptor: domain structure, genomic
organization and regulation of expression. J Steroid Biochem 34, 307-310.
26. Buchanan, G., Greenberg, N. M., Scher, H. I., Harris, J. M., Marshall, V. R., and
Tilley, W. D. (2001a). Collocation of androgen receptor gene mutations in
prostate cancer. Clin Cancer Res 7, 1273-1281.
27. Buchanan, G., Yang, M., Harris, J. M., Nahm, H. S., Han, G., Moore, N., Bentel,
J. M., Matusik, R. J., Horsfall, D. J., Marshall, V. R., et al. (2001b). Mutations at
the boundary of the hinge and ligand binding domain of the androgen receptor
confer increased transactivation function. Mol Endocrinol 15, 46-56.
28. Buchwalter, G., Gross, C., and Wasylyk, B. (2004). Ets ternary complex
transcription factors. Gene 324, 1-14.
157
29. Burger, H. G. (2002). Androgen production in women. Fertil Steril 77 Suppl 4,
S3-5.
30. Cai, C., Chen, S., Ng, P., Bubley, G. J., Nelson, P. S., Mostaghel, E. A., Marck,
B., Matsumoto, A. M., Simon, N. I., Wang, H., and Balk, S. P. (2011).
Intratumoral de novo steroid synthesis activates androgen receptor in castration-
resistant prostate cancer and is upregulated by treatment with CYP17A1
inhibitors. Cancer Res 71, 6503-6513.
31. Carr, M. C. (1967). Biology of human trophoblast. Calif Med 107, 338-343.
32. Carson, D. D., Bagchi, I., Dey, S. K., Enders, A. C., Fazleabas, A. T., Lessey, B.
A., and Yoshinaga, K. (2000). Embryo implantation. Dev Biol 223, 217-237.
33. Carver, B. S., Tran, J., Chen, Z., Carracedo-Perez, A., Alimonti, A., Nardella, C.,
Gopalan, A., Scardino, P. T., Cordon-Cardo, C., Gerald, W., and Pandolfi, P. P.
(2009). ETS rearrangements and prostate cancer initiation. Nature 457, E1;
discussion E2-3.
34. Cesari, F., Brecht, S., Vintersten, K., Vuong, L. G., Hofmann, M., Klingel, K.,
Schnorr, J. J., Arsenian, S., Schild, H., Herdegen, T., et al. (2004a). Mice
deficient for the ets transcription factor elk-1 show normal immune responses and
mildly impaired neuronal gene activation. Mol Cell Biol 24, 294-305.
35. Cesari, F., Rennekampff, V., Vintersten, K., Vuong, L. G., Seibler, J., Bode, J.,
Wiebel, F. F., and Nordheim, A. (2004b). Elk-1 knock-out mice engineered by
Flp recombinase-mediated cassette exchange. Genesis 38, 87-92.
158
36. Chancy, C. D., Kekuda, R., Huang, W., Prasad, P. D., Kuhnel, J. M., Sirotnak, F.
M., Roon, P., Ganapathy, V., and Smith, S. B. (2000). Expression and differential
polarization of the reduced-folate transporter-1 and the folate receptor alpha in
mammalian retinal pigment epithelium. J Biol Chem 275, 20676-20684.
37. Chang, C., Saltzman, A., Yeh, S., Young, W., Keller, E., Lee, H. J., Wang, C.,
and Mizokami, A. (1995). Androgen receptor: an overview. Crit Rev Eukaryot
Gene Expr 5, 97-125.
38. Chang, C. Y., and McDonnell, D. P. (2002). Evaluation of ligand-dependent
changes in AR structure using peptide probes. Mol Endocrinol 16, 647-660.
39. Chattopadhyay, S., Gong, E. Y., Hwang, M., Park, E., Lee, H. J., Hong, C. Y.,
Choi, H. S., Cheong, J. H., Kwon, H. B., and Lee, K. (2006). The CCAAT
enhancer-binding protein-alpha negatively regulates the transactivation of
androgen receptor in prostate cancer cells. Mol Endocrinol 20, 984-995.
40. Chen, C. D., Welsbie, D. S., Tran, C., Baek, S. H., Chen, R., Vessella, R.,
Rosenfeld, M. G., and Sawyers, C. L. (2004). Molecular determinants of
resistance to antiandrogen therapy. Nat Med 10, 33-39.
41. Chen, Y., Sawyers, C. L., and Scher, H. I. (2008). Targeting the androgen
receptor pathway in prostate cancer. Curr Opin Pharmacol 8, 440-448.
42. Cheng, S., Brzostek, S., Lee, S. R., Hollenberg, A. N., and Balk, S. P. (2002).
Inhibition of the dihydrotestosterone-activated androgen receptor by nuclear
receptor corepressor. Mol Endocrinol 16, 1492-1501.
43. Clinckemalie, L., Vanderschueren, D., Boonen, S., and Claessens, F. (2012). The
hinge region in androgen receptor control. Mol Cell Endocrinol 358, 1-8.
159
44. Cloke, B., and Christian, M. (2011). The role of androgens and the androgen
receptor in cycling endometrium. Mol Cell Endocrinol.
45. Cloke, B., Huhtinen, K., Fusi, L., Kajihara, T., Yliheikkila, M., Ho, K. K.,
Teklenburg, G., Lavery, S., Jones, M. C., Trew, G., et al. (2008). The androgen
and progesterone receptors regulate distinct gene networks and cellular functions
in decidualizing endometrium. Endocrinology 149, 4462-4474.
46. Coffey, R. N., Watson, R. W., O'Neill, A. J., Mc Eleny, K., and Fitzpatrick, J. M.
(2002). Androgen-mediated resistance to apoptosis. Prostate 53, 300-309.
47. Costello, P. S., Nicolas, R. H., Watanabe, Y., Rosewell, I., and Treisman, R.
(2004). Ternary complex factor SAP-1 is required for Erk-mediated thymocyte
positive selection. Nat Immunol 5, 289-298.
48. Craft, N., Shostak, Y., Carey, M., and Sawyers, C. L. (1999). A mechanism for
hormone-independent prostate cancer through modulation of androgen receptor
signaling by the HER-2/neu tyrosine kinase. Nat Med 5, 280-285.
49. Critchley, H. O., and Saunders, P. T. (2009). Hormone receptor dynamics in a
receptive human endometrium. Reprod Sci 16, 191-199.
50. Culig, Z., Hobisch, A., Cronauer, M. V., Radmayr, C., Trapman, J., Hittmair, A.,
Bartsch, G., and Klocker, H. (1994). Androgen receptor activation in prostatic
tumor cell lines by insulin-like growth factor-I, keratinocyte growth factor, and
epidermal growth factor. Cancer Res 54, 5474-5478.
51. Czeizel, A. E., and Dudas, I. (1992). Prevention of the first occurrence of neural-
tube defects by periconceptional vitamin supplementation. N Engl J Med 327,
1832-1835.
160
52. Dalton, S., and Treisman, R. (1992). Characterization of SAP-1, a protein
recruited by serum response factor to the c-fos serum response element. Cell 68,
597-612.
53. Dedhar, S., Rennie, P. S., Shago, M., Hagesteijn, C. Y., Yang, H., Filmus, J.,
Hawley, R. G., Bruchovsky, N., Cheng, H., Matusik, R. J., and et al. (1994).
Inhibition of nuclear hormone receptor activity by calreticulin. Nature 367, 480-
483.
54. Dehm, S. M., Schmidt, L. J., Heemers, H. V., Vessella, R. L., and Tindall, D. J.
(2008). Splicing of a novel androgen receptor exon generates a constitutively
active androgen receptor that mediates prostate cancer therapy resistance. Cancer
Res 68, 5469-5477.
55. Di Simone, N., Maggiano, N., Caliandro, D., Riccardi, P., Evangelista, A.,
Carducci, B., and Caruso, A. (2003). Homocysteine induces trophoblast cell death
with apoptotic features. Biol Reprod 69, 1129-1134.
56. Drewett, V., Muller, S., Goodall, J., and Shaw, P. E. (2000). Dimer formation by
ternary complex factor ELK-1. J Biol Chem 275, 1757-1762.
57. Ducret, C., Maira, S. M., Lutz, Y., and Wasylyk, B. (2000). The ternary complex
factor Net contains two distinct elements that mediate different responses to MAP
kinase signalling cascades. Oncogene 19, 5063-5072.
161
58. Elwood, P. C., Nachmanoff, K., Saikawa, Y., Page, S. T., Pacheco, P., Roberts,
S., and Chung, K. N. (1997). The divergent 5' termini of the alpha human folate
receptor (hFR) mRNAs originate from two tissue-specific promoters and
alternative splicing: characterization of the alpha hFR gene structure.
Biochemistry 36, 1467-1478.
59. Estebanez-Perpina, E., Arnold, L. A., Nguyen, P., Rodrigues, E. D., Mar, E.,
Bateman, R., Pallai, P., Shokat, K. M., Baxter, J. D., Guy, R. K., et al. (2007). A
surface on the androgen receptor that allosterically regulates coactivator binding.
Proc Natl Acad Sci U S A 104, 16074-16079.
60. Evans, E. L., Saxton, J., Shelton, S. J., Begitt, A., Holliday, N. D., Hipskind, R.
A., and Shaw, P. E. (2011). Dimer formation and conformational flexibility
ensure cytoplasmic stability and nuclear accumulation of Elk-1. Nucleic Acids
Res 39, 6390-6402.
61. Faivre, E. J., Daniel, A. R., Hillard, C. J., and Lange, C. A. (2008). Progesterone
receptor rapid signaling mediates serine 345 phosphorylation and tethering to
specificity protein 1 transcription factors. Mol Endocrinol 22, 823-837.
62. Figueroa, C., and Vojtek, A. B. (2003). Akt negatively regulates translation of the
ternary complex factor Elk-1. Oncogene 22, 5554-5561.
63. Fowler, B. (2001). The folate cycle and disease in humans. Kidney Int Suppl 78,
S221-229.
64. Fradet, Y. (2004). Bicalutamide (Casodex) in the treatment of prostate cancer.
Expert Rev Anticancer Ther 4, 37-48.
162
65. Fronsdal, K., Engedal, N., Slagsvold, T., and Saatcioglu, F. (1998). CREB
binding protein is a coactivator for the androgen receptor and mediates cross-talk
with AP-1. J Biol Chem 273, 31853-31859.
66. Fu, M., Wang, C., Zhang, X., and Pestell, R. G. (2004). Acetylation of nuclear
receptors in cellular growth and apoptosis. Biochem Pharmacol 68, 1199-1208.
67. Gaughan, L., Logan, I. R., Cook, S., Neal, D. E., and Robson, C. N. (2002). Tip60
and histone deacetylase 1 regulate androgen receptor activity through changes to
the acetylation status of the receptor. J Biol Chem 277, 25904-25913.
68. Gille, H., Kortenjann, M., Thomae, O., Moomaw, C., Slaughter, C., Cobb, M. H.,
and Shaw, P. E. (1995). ERK phosphorylation potentiates Elk-1-mediated ternary
complex formation and transactivation. EMBO J 14, 951-962.
69. Gille, H., Sharrocks, A. D., and Shaw, P. E. (1992). Phosphorylation of
transcription factor p62TCF by MAP kinase stimulates ternary complex formation
at c-fos promoter. Nature 358, 414-417.
70. Giovane, A., Pintzas, A., Maira, S. M., Sobieszczuk, P., and Wasylyk, B. (1994).
Net, a new ets transcription factor that is activated by Ras. Genes Dev 8, 1502-
1513.
71. Giovane, A., Sobieszczuk, P., Mignon, C., Mattei, M. G., and Wasylyk, B.
(1995). Locations of the ets subfamily members net, elk1, and sap1 (ELK3,
ELK1, and ELK4) on three homologous regions of the mouse and human
genomes. Genomics 29, 769-772.
163
72. Gobinet, J., Auzou, G., Nicolas, J. C., Sultan, C., and Jalaguier, S. (2001).
Characterization of the interaction between androgen receptor and a new
transcriptional inhibitor, SHP. Biochemistry 40, 15369-15377.
73. Gonit, M., Zhang, J., Salazar, M., Cui, H., Shatnawi, A., Trumbly, R., and
Ratnam, M. (2011). Hormone depletion-insensitivity of prostate cancer cells is
supported by the AR without binding to classical response elements. Mol
74. Goueli, S. A., Holtzman, J. L., and Ahmed, K. (1984). Phosphorylation of the
androgen receptor by a nuclear cAMP-independent protein kinase. Biochem
Biophys Res Commun 123, 778-784.
75. Graff, J. R., Konicek, B. W., McNulty, A. M., Wang, Z., Houck, K., Allen, S.,
Paul, J. D., Hbaiu, A., Goode, R. G., Sandusky, G. E., et al. (2000). Increased
AKT activity contributes to prostate cancer progression by dramatically
accelerating prostate tumor growth and diminishing p27Kip1 expression. J Biol
Chem 275, 24500-24505.
76. Graham, R., and Gilman, M. (1991). Distinct protein targets for signals acting at
the c-fos serum response element. Science 251, 189-192.
77. Guo, Z., Dai, B., Jiang, T., Xu, K., Xie, Y., Kim, O., Nesheiwat, I., Kong, X.,
Melamed, J., Handratta, V. D., et al. (2006). Regulation of androgen receptor
activity by tyrosine phosphorylation. Cancer Cell 10, 309-319.
164
78. Guo, Z., Yang, X., Sun, F., Jiang, R., Linn, D. E., Chen, H., Kong, X., Melamed,
J., Tepper, C. G., Kung, H. J., et al. (2009). A novel androgen receptor splice
variant is up-regulated during prostate cancer progression and promotes androgen
depletion-resistant growth. Cancer Res 69, 2305-2313.
79. Ham, J., Thomson, A., Needham, M., Webb, P., and Parker, M. (1988).
Characterization of response elements for androgens, glucocorticoids and
progestins in mouse mammary tumour virus. Nucleic Acids Res 16, 5263-5276.
80. Han, G., Foster, B. A., Mistry, S., Buchanan, G., Harris, J. M., Tilley, W. D., and
Greenberg, N. M. (2001). Hormone status selects for spontaneous somatic
androgen receptor variants that demonstrate specific ligand and cofactor
dependent activities in autochthonous prostate cancer. J Biol Chem 276, 11204-
11213.
81. Hao, H., d'Alincourt-Salazar, M., Kelley, K. M., Shatnawi, A., Mukherjee, S.,
Shah, Y. M., and Ratnam, M. (2007). Estrogen-induced and TAFII30-mediated
gene repression by direct recruitment of the estrogen receptor and co-repressors to
the core promoter and its reversal by tamoxifen. Oncogene 26, 7872-7884.
82. Hassler, M., and Richmond, T. J. (2001). The B-box dominates SAP-1-SRF
interactions in the structure of the ternary complex. EMBO J 20, 3018-3028.
83. He, B., Kemppainen, J. A., and Wilson, E. M. (2000). FXXLF and WXXLF
sequences mediate the NH2-terminal interaction with the ligand binding domain
of the androgen receptor. J Biol Chem 275, 22986-22994.
165
84. Heemers, H. V., Schmidt, L. J., Sun, Z., Regan, K. M., Anderson, S. K., Duncan,
K., Wang, D., Liu, S., Ballman, K. V., and Tindall, D. J. (2011). Identification of
a clinically relevant androgen-dependent gene signature in prostate cancer. Cancer
Res 71, 1978-1988.
85. Heinlein, C. A., and Chang, C. (2002). Androgen receptor (AR) coregulators: an
overview. Endocr Rev 23, 175-200.
86. Helgeson, B. E., Tomlins, S. A., Shah, N., Laxman, B., Cao, Q., Prensner, J. R.,
Cao, X., Singla, N., Montie, J. E., Varambally, S., et al. (2008). Characterization
of TMPRSS2:ETV5 and SLC45A3:ETV5 gene fusions in prostate cancer. Cancer
Res 68, 73-80.
87. Henderson, G. B. (1990). Folate-binding proteins. Annu Rev Nutr 10, 319-335.
88. Henderson, G. I., Perez, T., Schenker, S., Mackins, J., and Antony, A. C. (1995).
Maternal-to-fetal transfer of 5-methyltetrahydrofolate by the perfused human
placental cotyledon: evidence for a concentrative role by placental folate receptors
in fetal folate delivery. J Lab Clin Med 126, 184-203.
89. Hermans, K. G., van Marion, R., van Dekken, H., Jenster, G., van Weerden, W.
M., and Trapman, J. (2006). TMPRSS2:ERG fusion by translocation or interstitial
deletion is highly relevant in androgen-dependent prostate cancer, but is bypassed
in late-stage androgen receptor-negative prostate cancer. Cancer Res 66, 10658-
10663.
90. Herrera, R. E., Shaw, P. E., and Nordheim, A. (1989). Occupation of the c-fos
serum response element in vivo by a multi-protein complex is unaltered by
growth factor induction. Nature 340, 68-70.
166
91. Hiden, U., Wadsack, C., Prutsch, N., Gauster, M., Weiss, U., Frank, H. G.,
Schmitz, U., Fast-Hirsch, C., Hengstschlager, M., Potgens, A., et al. (2007). The
first trimester human trophoblast cell line ACH-3P: a novel tool to study
autocrine/paracrine regulatory loops of human trophoblast subpopulations--TNF-
alpha stimulates MMP15 expression. BMC Dev Biol 7, 137.
92. Hill, C. S., Wynne, J., and Treisman, R. (1994). Serum-regulated transcription by
serum response factor (SRF): a novel role for the DNA binding domain. EMBO J
13, 5421-5432.
93. Hillier, S. G. (1987). Intrafollicular paracrine function of ovarian androgen. J
Steroid Biochem 27, 351-357.
94. Hipskind, R. A., Rao, V. N., Mueller, C. G., Reddy, E. S., and Nordheim, A.
(1991). Ets-related protein Elk-1 is homologous to the c-fos regulatory factor
p62TCF. Nature 354, 531-534.
95. Hobisch, A., Eder, I. E., Putz, T., Horninger, W., Bartsch, G., Klocker, H., and
Culig, Z. (1998). Interleukin-6 regulates prostate-specific protein expression in
prostate carcinoma cells by activation of the androgen receptor. Cancer Res 58,
4640-4645.
96. Hollenhorst, P. C., Shah, A. A., Hopkins, C., and Graves, B. J. (2007). Genome-
wide analyses reveal properties of redundant and specific promoter occupancy
within the ETS gene family. Genes Dev 21, 1882-1894.
167
97. Holter, E., Kotaja, N., Makela, S., Strauss, L., Kietz, S., Janne, O. A., Gustafsson,
J. A., Palvimo, J. J., and Treuter, E. (2002). Inhibition of androgen receptor (AR)
function by the reproductive orphan nuclear receptor DAX-1. Mol Endocrinol 16,
515-528.
98. Holzbeierlein, J., Lal, P., LaTulippe, E., Smith, A., Satagopan, J., Zhang, L.,
Ryan, C., Smith, S., Scher, H., Scardino, P., et al. (2004). Gene expression
analysis of human prostate carcinoma during hormonal therapy identifies
androgen-responsive genes and mechanisms of therapy resistance. Am J Pathol
164, 217-227.
99. Horie-Inoue, K., Bono, H., Okazaki, Y., and Inoue, S. (2004). Identification and
functional analysis of consensus androgen response elements in human prostate
cancer cells. Biochem Biophys Res Commun 325, 1312-1317.
100.Horie, K., Takakura, K., Imai, K., Liao, S., and Mori, T. (1992).
Immunohistochemical localization of androgen receptor in the human
endometrium, decidua, placenta and pathological conditions of the endometrium.
Hum Reprod 7, 1461-1466.
101.Hu, R., Dunn, T. A., Wei, S., Isharwal, S., Veltri, R. W., Humphreys, E., Han,
M., Partin, A. W., Vessella, R. L., Isaacs, W. B., et al. (2009). Ligand-
independent androgen receptor variants derived from splicing of cryptic exons
signify hormone-refractory prostate cancer. Cancer Res 69, 16-22.
102.Huang da, W., Sherman, B. T., and Lempicki, R. A. (2009a). Bioinformatics
enrichment tools: paths toward the comprehensive functional analysis of large
gene lists. Nucleic Acids Res 37, 1-13.
168
103.Huang da, W., Sherman, B. T., and Lempicki, R. A. (2009b). Systematic and
integrative analysis of large gene lists using DAVID bioinformatics resources.
Nat Protoc 4, 44-57.
104.Iljin, K., Wolf, M., Edgren, H., Gupta, S., Kilpinen, S., Skotheim, R. I., Peltola,
M., Smit, F., Verhaegh, G., Schalken, J., et al. (2006). TMPRSS2 fusions with
oncogenic ETS factors in prostate cancer involve unbalanced genomic
rearrangements and are associated with HDAC1 and epigenetic reprogramming.
Cancer Res 66, 10242-10246.
105.Janknecht, R., Ernst, W. H., Pingoud, V., and Nordheim, A. (1993). Activation of
ternary complex factor Elk-1 by MAP kinases. EMBO J 12, 5097-5104.
106.Janknecht, R., and Nordheim, A. (1992). Elk-1 protein domains required for
direct and SRF-assisted DNA-binding. Nucleic Acids Res 20, 3317-3324.
107.Janknecht, R., and Nordheim, A. (1996). MAP kinase-dependent transcriptional
coactivation by Elk-1 and its cofactor CBP. Biochem Biophys Res Commun 228,
831-837.
108.Janknecht, R., Zinck, R., Ernst, W. H., and Nordheim, A. (1994). Functional
dissection of the transcription factor Elk-1. Oncogene 9, 1273-1278.
109.Jenster, G., van der Korput, H. A., Trapman, J., and Brinkmann, A. O. (1995).
Identification of two transcription activation units in the N-terminal domain of the
human androgen receptor. J Biol Chem 270, 7341-7346.
169
110.Jenster, G., van der Korput, H. A., van Vroonhoven, C., van der Kwast, T. H.,
Trapman, J., and Brinkmann, A. O. (1991). Domains of the human androgen
receptor involved in steroid binding, transcriptional activation, and subcellular
localization. Mol Endocrinol 5, 1396-1404.
111.Jeong, B. C., Hong, C. Y., Chattopadhyay, S., Park, J. H., Gong, E. Y., Kim, H.
J., Chun, S. Y., and Lee, K. (2004). Androgen receptor corepressor-19 kDa
(ARR19), a leucine-rich protein that represses the transcriptional activity of
androgen receptor through recruitment of histone deacetylase. Mol Endocrinol 18,
13-25.
112.Kaikkonen, S., Jaaskelainen, T., Karvonen, U., Rytinki, M. M., Makkonen, H.,
Gioeli, D., Paschal, B. M., and Palvimo, J. J. (2009). SUMO-specific protease 1
(SENP1) reverses the hormone-augmented SUMOylation of androgen receptor
and modulates gene responses in prostate cancer cells. Mol Endocrinol 23, 292-
307.
113.Kamen, B. A., Johnson, C. A., Wang, M. T., and Anderson, R. G. (1989).
Regulation of the cytoplasmic accumulation of 5-methyltetrahydrofolate in
MA104 cells is independent of folate receptor regulation. J Clin Invest 84, 1379-
1386.
114.Kane, M. A., Elwood, P. C., Portillo, R. M., Antony, A. C., Najfeld, V., Finley,
A., Waxman, S., and Kolhouse, J. F. (1988). Influence on immunoreactive folate-
binding proteins of extracellular folate concentration in cultured human cells. J
Clin Invest 81, 1398-1406.
170
115.Kang, H. Y., Lin, H. K., Hu, Y. C., Yeh, S., Huang, K. E., and Chang, C. (2001).
From transforming growth factor-beta signaling to androgen action: identification
of Smad3 as an androgen receptor coregulator in prostate cancer cells. Proc Natl
Acad Sci U S A 98, 3018-3023.
116.Kel, A. E., Gossling, E., Reuter, I., Cheremushkin, E., Kel-Margoulis, O. V., and
Wingender, E. (2003). MATCH: A tool for searching transcription factor binding
sites in DNA sequences. Nucleic Acids Res 31, 3576-3579.
117.Kelley, K. M., Rowan, B. G., and Ratnam, M. (2003). Modulation of the folate
receptor alpha gene by the estrogen receptor: mechanism and implications in
tumor targeting. Cancer Res 63, 2820-2828.
118.Knudsen, E. S., and Knudsen, K. E. (2006). Retinoblastoma tumor suppressor:
where cancer meets the cell cycle. Exp Biol Med (Maywood) 231, 1271-1281.
119.Knudsen, K. E., and Penning, T. M. (2010). Partners in crime: deregulation of
AR activity and androgen synthesis in prostate cancer. Trends Endocrinol Metab
21, 315-324.
120.Konig, H., Ponta, H., Rahmsdorf, U., Buscher, M., Schonthal, A., Rahmsdorf, H.
J., and Herrlich, P. (1989). Autoregulation of fos: the dyad symmetry element as
the major target of repression. EMBO J 8, 2559-2566.
121.Kortenjann, M., Thomae, O., and Shaw, P. E. (1994). Inhibition of v-raf-
dependent c-fos expression and transformation by a kinase-defective mutant of
the mitogen-activated protein kinase Erk2. Mol Cell Biol 14, 4815-4824.
171
122.Kuiper, G. G., and Brinkmann, A. O. (1995). Phosphotryptic peptide analysis of
the human androgen receptor: detection of a hormone-induced phosphopeptide.
Biochemistry 34, 1851-1857.
123.Kuiper, G. G., Faber, P. W., van Rooij, H. C., van der Korput, J. A., Ris-Stalpers,
C., Klaassen, P., Trapman, J., and Brinkmann, A. O. (1989). Structural
organization of the human androgen receptor gene. J Mol Endocrinol 2, R1-4.
124.Laanpere, M., Altmae, S., Stavreus-Evers, A., Nilsson, T. K., Yngve, A., and
Salumets, A. (2010). Folate-mediated one-carbon metabolism and its effect on
female fertility and pregnancy viability. Nutr Rev 68, 99-113.
125.Lacey, S. W., Sanders, J. M., Rothberg, K. G., Anderson, R. G., and Kamen, B.
A. (1989). Complementary DNA for the folate binding protein correctly predicts
anchoring to the membrane by glycosyl-phosphatidylinositol. J Clin Invest 84,
715-720.
126.Lapointe, J., Kim, Y. H., Miller, M. A., Li, C., Kaygusuz, G., van de Rijn, M.,
Huntsman, D. G., Brooks, J. D., and Pollack, J. R. (2007). A variant TMPRSS2
isoform and ERG fusion product in prostate cancer with implications for
molecular diagnosis. Mod Pathol 20, 467-473.
127.Latinkic, B. V., Zeremski, M., and Lau, L. F. (1996). Elk-1 can recruit SRF to
form a ternary complex upon the serum response element. Nucleic Acids Res 24,
1345-1351.
128.Lee, S. M., Vasishtha, M., and Prywes, R. (2010). Activation and repression of
cellular immediate early genes by serum response factor cofactors. J Biol Chem
285, 22036-22049.
172
129.Lemaitre, R. N., Tanaka, T., Tang, W., Manichaikul, A., Foy, M., Kabagambe, E.
K., Nettleton, J. A., King, I. B., Weng, L. C., Bhattacharya, S., et al. (2011).
Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis
of genome-wide association studies from the CHARGE Consortium. PLoS Genet
7, e1002193.
130.Li, Q. J., Yang, S. H., Maeda, Y., Sladek, F. M., Sharrocks, A. D., and Martins-
Green, M. (2003). MAP kinase phosphorylation-dependent activation of Elk-1
leads to activation of the co-activator p300. EMBO J 22, 281-291.
131.Liao, G., Chen, L. Y., Zhang, A., Godavarthy, A., Xia, F., Ghosh, J. C., Li, H.,
and Chen, J. D. (2003). Regulation of androgen receptor activity by the nuclear
receptor corepressor SMRT. J Biol Chem 278, 5052-5061.
132.Lin, H. K., Yeh, S., Kang, H. Y., and Chang, C. (2001). Akt suppresses
androgen-induced apoptosis by phosphorylating and inhibiting androgen receptor.
Proc Natl Acad Sci U S A 98, 7200-7205.
133.Lindblad, B., Zaman, S., Malik, A., Martin, H., Ekstrom, A. M., Amu, S.,
Holmgren, A., and Norman, M. (2005). Folate, vitamin B12, and homocysteine
levels in South Asian women with growth-retarded fetuses. Acta Obstet Gynecol
Scand 84, 1055-1061.
134.Liu, Y., Karaca, M., Zhang, Z., Gioeli, D., Earp, H. S., and Whang, Y. E. (2010).
Dasatinib inhibits site-specific tyrosine phosphorylation of androgen receptor by
Ack1 and Src kinases. Oncogene 29, 3208-3216.
173
135.Loberg, R. D., St John, L. N., Day, L. L., Neeley, C. K., and Pienta, K. J. (2006).
Development of the VCaP androgen-independent model of prostate cancer. Urol
Oncol 24, 161-168.
136.Loutradis, D., Bletsa, R., Aravantinos, L., Kallianidis, K., Michalas, S., and
Psychoyos, A. (1991). Preovulatory effects of the progesterone antagonist
mifepristone (RU486) in mice. Hum Reprod 6, 1238-1240.
137.Loy, C. J., Sim, K. S., and Yong, E. L. (2003). Filamin-A fragment localizes to
the nucleus to regulate androgen receptor and coactivator functions. Proc Natl
Acad Sci U S A 100, 4562-4567.
138.Lu, L., Schulz, H., and Wolf, D. A. (2002). The F-box protein SKP2 mediates
androgen control of p27 stability in LNCaP human prostate cancer cells. BMC
Cell Biol 3, 22.
139.Lu, S., Liu, M., Epner, D. E., Tsai, S. Y., and Tsai, M. J. (1999). Androgen
regulation of the cyclin-dependent kinase inhibitor p21 gene through an androgen
response element in the proximal promoter. Mol Endocrinol 13, 376-384.
140.Lubahn, D. B., Joseph, D. R., Sullivan, P. M., Willard, H. F., French, F. S., and
Wilson, E. M. (1988). Cloning of human androgen receptor complementary DNA
and localization to the X chromosome. Science 240, 327-330.
141.Lucock, M. (2000). Folic acid: nutritional biochemistry, molecular biology, and
role in disease processes. Mol Genet Metab 71, 121-138.
142.Luhrs, C. A. (1991). The role of glycosylation in the biosynthesis and acquisition
of ligand-binding activity of the folate-binding protein in cultured KB cells. Blood
77, 1171-1180.
174
143.Luhrs, C. A., and Slomiany, B. L. (1989). A human membrane-associated folate
binding protein is anchored by a glycosyl-phosphatidylinositol tail. J Biol Chem
264, 21446-21449.
144.Lydon, J. P., DeMayo, F. J., Funk, C. R., Mani, S. K., Hughes, A. R.,
Montgomery, C. A., Jr., Shyamala, G., Conneely, O. M., and O'Malley, B. W.
(1995). Mice lacking progesterone receptor exhibit pleiotropic reproductive
abnormalities. Genes Dev 9, 2266-2278.
145.Ma, D. W., Finnell, R. H., Davidson, L. A., Callaway, E. S., Spiegelstein, O.,
Piedrahita, J. A., Salbaum, J. M., Kappen, C., Weeks, B. R., James, J., et al.
(2005). Folate transport gene inactivation in mice increases sensitivity to colon
carcinogenesis. Cancer Res 65, 887-897.
146.MacDonald, J. W., and Ghosh, D. (2006). COPA--cancer outlier profile analysis.
Bioinformatics 22, 2950-2951.
147.Mamali, I., Kotsantis, P., Lampropoulou, M., and Marmaras, V. J. (2008). Elk-1
associates with FAK, regulates the expression of FAK and MAP kinases as well
as apoptosis in HK-2 cells. J Cell Physiol 216, 198-206.
148.Marais, R., Wynne, J., and Treisman, R. (1993). The SRF accessory protein Elk-
1 contains a growth factor-regulated transcriptional activation domain. Cell 73,
381-393.
149.Marcelli, M., Ittmann, M., Mariani, S., Sutherland, R., Nigam, R., Murthy, L.,
Zhao, Y., DiConcini, D., Puxeddu, E., Esen, A., et al. (2000). Androgen receptor
mutations in prostate cancer. Cancer Res 60, 944-949.
175
150.Matys, V., Kel-Margoulis, O. V., Fricke, E., Liebich, I., Land, S., Barre-Dirrie,
A., Reuter, I., Chekmenev, D., Krull, M., Hornischer, K., et al. (2006).
TRANSFAC and its module TRANSCompel: transcriptional gene regulation in
eukaryotes. Nucleic Acids Res 34, D108-110.
151.McAlinden, T. P., Hynes, J. B., Patil, S. A., Westerhof, G. R., Jansen, G.,
Schornagel, J. H., Kerwar, S. S., and Freisheim, J. H. (1991). Synthesis and
biological evaluation of a fluorescent analogue of folic acid. Biochemistry 30,
5674-5681.
152.McNulty, H., Dowey le, R. C., Strain, J. J., Dunne, A., Ward, M., Molloy, A. M.,
McAnena, L. B., Hughes, J. P., Hannon-Fletcher, M., and Scott, J. M. (2006).
Riboflavin lowers homocysteine in individuals homozygous for the MTHFR
677C->T polymorphism. Circulation 113, 74-80.
153.Mehra, R., Tomlins, S. A., Shen, R., Nadeem, O., Wang, L., Wei, J. T., Pienta, K.
J., Ghosh, D., Rubin, M. A., Chinnaiyan, A. M., and Shah, R. B. (2007).
Comprehensive assessment of TMPRSS2 and ETS family gene aberrations in
clinically localized prostate cancer. Mod Pathol 20, 538-544.
154.Mellinghoff, I. K., Vivanco, I., Kwon, A., Tran, C., Wongvipat, J., and Sawyers,
C. L. (2004). HER2/neu kinase-dependent modulation of androgen receptor
function through effects on DNA binding and stability. Cancer Cell 6, 517-527.
155.Milne, S. A., Henderson, T. A., Kelly, R. W., Saunders, P. T., Baird, D. T., and
Critchley, H. O. (2005). Leukocyte populations and steroid receptor expression in
human first-trimester decidua; regulation by antiprogestin and prostaglandin E
analog. J Clin Endocrinol Metab 90, 4315-4321.
176
156.Miyamoto, H., Messing, E. M., and Chang, C. (2004). Androgen deprivation
therapy for prostate cancer: current status and future prospects. Prostate 61, 332-
353.
157.Mo, Y., Vaessen, B., Johnston, K., and Marmorstein, R. (2000). Structure of the
elk-1-DNA complex reveals how DNA-distal residues affect ETS domain
recognition of DNA. Nat Struct Biol 7, 292-297.
158.Mohanty, D., and Das, K. C. (1982). Effect of folate deficiency on the
reproductive organs of female rhesus monkeys: a cytomorphological and
cytokinetic study. J Nutr 112, 1565-1576.
159.Monge, A., Jagla, M., Lapouge, G., Sasorith, S., Cruchant, M., Wurtz, J. M.,
Jacqmin, D., Bergerat, J. P., and Ceraline, J. (2006). Unfaithfulness and
promiscuity of a mutant androgen receptor in a hormone-refractory prostate
cancer. Cell Mol Life Sci 63, 487-497.
160.Mooij, P. N., Wouters, M. G., Thomas, C. M., Doesburg, W. H., and Eskes, T. K.
(1992). Disturbed reproductive performance in extreme folic acid deficient golden
hamsters. Eur J Obstet Gynecol Reprod Biol 43, 71-75.
161.Mooradian, A. D., Morley, J. E., and Korenman, S. G. (1987). Biological actions
of androgens. Endocr Rev 8, 1-28.
162.Mukhopadhyay, N. K., Ferdinand, A. S., Mukhopadhyay, L., Cinar, B.,
Lutchman, M., Richie, J. P., Freeman, M. R., and Liu, B. C. (2006). Unraveling
androgen receptor interactomes by an array-based method: discovery of proto-
oncoprotein c-Rel as a negative regulator of androgen receptor. Exp Cell Res 312,
3782-3795.
177
163.Narayanan, R., Yepuru, M., Szafran, A. T., Szwarc, M., Bohl, C. E., Young, N.
L., Miller, D. D., Mancini, M. A., and Dalton, J. T. (2010). Discovery and
mechanistic characterization of a novel selective nuclear androgen receptor
exporter for the treatment of prostate cancer. Cancer Res 70, 842-851.
164.Nelen, W. L., Bulten, J., Steegers, E. A., Blom, H. J., Hanselaar, A. G., and
Eskes, T. K. (2000). Maternal homocysteine and chorionic vascularization in
recurrent early pregnancy loss. Hum Reprod 15, 954-960.
165.Neulen, J., Wagner, B., Runge, M., and Breckwoldt, M. (1987). Effect of
progestins, androgens, estrogens and antiestrogens on 3H-thymidine uptake by
human endometrial and endosalpinx cells in vitro. Arch Gynecol 240, 225-232.
166.Nissen, L. J., Gelly, J. C., and Hipskind, R. A. (2001). Induction-independent
recruitment of CREB-binding protein to the c-fos serum response element through
interactions between the bromodomain and Elk-1. J Biol Chem 276, 5213-5221.
167.Norris, J. D., Chang, C. Y., Wittmann, B. M., Kunder, R. S., Cui, H., Fan, D.,
Joseph, J. D., and McDonnell, D. P. (2009). The homeodomain protein HOXB13
regulates the cellular response to androgens. Mol Cell 36, 405-416.
168.Norwitz, E. R., Schust, D. J., and Fisher, S. J. (2001). Implantation and the
survival of early pregnancy. N Engl J Med 345, 1400-1408.
169.Odrowaz, Z., and Sharrocks, A. D. (2012). ELK1 Uses Different DNA Binding
Modes to Regulate Functionally Distinct Classes of Target Genes. PLoS Genet 8,
e1002694.
178
170.Osman, I., Scher, H. I., Drobnjak, M., Verbel, D., Morris, M., Agus, D., Ross, J.
S., and Cordon-Cardo, C. (2001). HER-2/neu (p185neu) protein expression in the
natural or treated history of prostate cancer. Clin Cancer Res 7, 2643-2647.
171.Owen, G. I., Richer, J. K., Tung, L., Takimoto, G., and Horwitz, K. B. (1998).
Progesterone regulates transcription of the p21(WAF1) cyclin- dependent kinase
inhibitor gene through Sp1 and CBP/p300. J Biol Chem 273, 10696-10701.
172.Page, S. T., Owen, W. C., Price, K., and Elwood, P. C. (1993). Expression of the
human placental folate receptor transcript is regulated in human tissues.
Organization and full nucleotide sequence of the gene. J Mol Biol 229, 1175-
1183.
173.Parker, N., Turk, M. J., Westrick, E., Lewis, J. D., Low, P. S., and Leamon, C. P.
(2005). Folate receptor expression in carcinomas and normal tissues determined
by a quantitative radioligand binding assay. Anal Biochem 338, 284-293.
174.Pearson, G., Robinson, F., Beers Gibson, T., Xu, B. E., Karandikar, M., Berman,
K., and Cobb, M. H. (2001). Mitogen-activated protein (MAP) kinase pathways:
regulation and physiological functions. Endocr Rev 22, 153-183.
175.Penning, T. M., Jin, Y., Rizner, T. L., and Bauman, D. R. (2008). Pre-receptor
regulation of the androgen receptor. Mol Cell Endocrinol 281, 1-8.
176.Penning, T. M., Steckelbroeck, S., Bauman, D. R., Miller, M. W., Jin, Y., Peehl,
D. M., Fung, K. M., and Lin, H. K. (2006). Aldo-keto reductase (AKR) 1C3: role
in prostate disease and the development of specific inhibitors. Mol Cell
179
177.Peterziel, H., Mink, S., Schonert, A., Becker, M., Klocker, H., and Cato, A. C.
(1999). Rapid signalling by androgen receptor in prostate cancer cells. Oncogene
18, 6322-6329.
178.Piedrahita, J. A., Oetama, B., Bennett, G. D., van Waes, J., Kamen, B. A.,
Richardson, J., Lacey, S. W., Anderson, R. G., and Finnell, R. H. (1999). Mice
lacking the folic acid-binding protein Folbp1 are defective in early embryonic
development. Nat Genet 23, 228-232.
179.Pingoud, V., Zinck, R., Hipskind, R. A., Janknecht, R., and Nordheim, A. (1994).
Heterogeneity of ternary complex factors in HeLa cell nuclear extracts. J Biol
Chem 269, 23310-23317.
180.Ponguta, L. A., Gregory, C. W., French, F. S., and Wilson, E. M. (2008). Site-
specific androgen receptor serine phosphorylation linked to epidermal growth
factor-dependent growth of castration-recurrent prostate cancer. J Biol Chem 283,
20989-21001.
181.Poukka, H., Karvonen, U., Janne, O. A., and Palvimo, J. J. (2000). Covalent
modification of the androgen receptor by small ubiquitin-like modifier 1 (SUMO-
1). Proc Natl Acad Sci U S A 97, 14145-14150.
182.Price, M. A., Rogers, A. E., and Treisman, R. (1995). Comparative analysis of
the ternary complex factors Elk-1, SAP-1a and SAP-2 (ERP/NET). EMBO J 14,
2589-2601.
180
183.Rahim, G., Araud, T., Jaquier-Gubler, P., and Curran, J. (2012). Alternative
splicing within the elk-1 5' untranslated region serves to modulate initiation
events downstream of the highly conserved upstream open reading frame 2. Mol
Cell Biol 32, 1745-1756.
184.Ramsay, A. K., and Leung, H. Y. (2009). Signalling pathways in prostate
carcinogenesis: potentials for molecular-targeted therapy. Clin Sci (Lond) 117,
209-228.
185.Rao, V. N., Huebner, K., Isobe, M., ar-Rushdi, A., Croce, C. M., and Reddy, E.
S. (1989). elk, tissue-specific ets-related genes on chromosomes X and 14 near
translocation breakpoints. Science 244, 66-70.
186.Rao, V. N., and Reddy, E. S. (1992a). A divergent ets-related protein, elk-1,
recognizes similar c-ets-1 proto-oncogene target sequences and acts as a
transcriptional activator. Oncogene 7, 65-70.
187.Rao, V. N., and Reddy, E. S. (1992b). elk-1 domains responsible for autonomous
DNA binding, SRE:SRF interaction and negative regulation of DNA binding.
Oncogene 7, 2335-2340.
188.Ratnam, M., Marquardt, H., Duhring, J. L., and Freisheim, J. H. (1989).
Homologous membrane folate binding proteins in human placenta: cloning and
sequence of a cDNA. Biochemistry 28, 8249-8254.
189.Reddy, E. S., and Rao, V. N. (1990). Localization and modulation of the DNA-
binding activity of the human c-ets-1 protooncogene. Cancer Res 50, 5013-5016.
181
190.Reutens, A. T., Fu, M., Wang, C., Albanese, C., McPhaul, M. J., Sun, Z., Balk, S.
P., Janne, O. A., Palvimo, J. J., and Pestell, R. G. (2001). Cyclin D1 binds the
androgen receptor and regulates hormone-dependent signaling in a p300/CBP-
associated factor (P/CAF)-dependent manner. Mol Endocrinol 15, 797-811.
191.Roberts, S. J., Petropavlovskaja, M., Chung, K. N., Knight, C. B., and Elwood, P.
C. (1998). Role of individual N-linked glycosylation sites in the function and
intracellular transport of the human alpha folate receptor. Arch Biochem Biophys
351, 227-235.
192.Robinson, M. J., and Cobb, M. H. (1997). Mitogen-activated protein kinase
pathways. Curr Opin Cell Biol 9, 180-186.
193.Rokhlin, O. W., Taghiyev, A. F., Guseva, N. V., Glover, R. A., Chumakov, P.
M., Kravchenko, J. E., and Cohen, M. B. (2005). Androgen regulates apoptosis
induced by TNFR family ligands via multiple signaling pathways in LNCaP.
Oncogene 24, 6773-6784.
194.Rosenquist, T. H., and Finnell, R. H. (2001). Genes, folate and homocysteine in
embryonic development. Proc Nutr Soc 60, 53-61.
195.Sabharanjak, S., and Mayor, S. (2004). Folate receptor endocytosis and
trafficking. Adv Drug Deliv Rev 56, 1099-1109.
196.Sadasivan, E., Regec, A., and Rothenberg, S. P. (2002). The half-life of the
transcript encoding the folate receptor alpha in KB cells is reduced by cytosolic
proteins expressed in folate-replete and not in folate-depleted cells. Gene 291,
149-158.
182
197.Saikawa, Y., Price, K., Hance, K. W., Chen, T. Y., and Elwood, P. C. (1995).
Structural and functional analysis of the human KB cell folate receptor gene P4
promoter: cooperation of three clustered Sp1-binding sites with initiator region for
basal promoter activity. Biochemistry 34, 9951-9961.
198.Saitsu, H., Ishibashi, M., Nakano, H., and Shiota, K. (2003). Spatial and temporal
expression of folate-binding protein 1 (Fbp1) is closely associated with anterior
neural tube closure in mice. Dev Dyn 226, 112-117.
199.Saporita, A. J., Zhang, Q., Navai, N., Dincer, Z., Hahn, J., Cai, X., and Wang, Z.
(2003). Identification and characterization of a ligand-regulated nuclear export
signal in androgen receptor. J Biol Chem 278, 41998-42005.
200.Schoenmakers, E., Alen, P., Verrijdt, G., Peeters, B., Verhoeven, G., Rombauts,
W., and Claessens, F. (1999). Differential DNA binding by the androgen and
glucocorticoid receptors involves the second Zn-finger and a C-terminal extension
of the DNA-binding domains. Biochem J 341 ( Pt 3), 515-521.
201.Schoenmakers, E., Verrijdt, G., Peeters, B., Verhoeven, G., Rombauts, W., and
Claessens, F. (2000). Differences in DNA binding characteristics of the androgen
and glucocorticoid receptors can determine hormone-specific responses. J Biol
Chem 275, 12290-12297.
202.Sharma, M., and Sun, Z. (2001). 5'TG3' interacting factor interacts with Sin3A
and represses AR-mediated transcription. Mol Endocrinol 15, 1918-1928.
203.Shatnawi, A., Tran, T., and Ratnam, M. (2007). R5020 and RU486 act as
progesterone receptor agonists to enhance Sp1/Sp4-dependent gene transcription
by an indirect mechanism. Mol Endocrinol 21, 635-650.
183
204.Shaw, P. E., and Saxton, J. (2003). Ternary complex factors: prime nuclear
targets for mitogen-activated protein kinases. Int J Biochem Cell Biol 35, 1210-
1226.
205.Shaw, P. E., Schroter, H., and Nordheim, A. (1989). The ability of a ternary
complex to form over the serum response element correlates with serum
inducibility of the human c-fos promoter. Cell 56, 563-572.
206.Shen, M. M., and Abate-Shen, C. (2010). Molecular genetics of prostate cancer:
new prospects for old challenges. Genes Dev 24, 1967-2000.
207.Shore, P., and Sharrocks, A. D. (1994). The transcription factors Elk-1 and serum
response factor interact by direct protein-protein contacts mediated by a short
region of Elk-1. Mol Cell Biol 14, 3283-3291.
208.Soller, M. J., Isaksson, M., Elfving, P., Soller, W., Lundgren, R., and
Panagopoulos, I. (2006). Confirmation of the high frequency of the
TMPRSS2/ERG fusion gene in prostate cancer. Genes Chromosomes Cancer 45,
717-719.
209.Stanbrough, M., Bubley, G. J., Ross, K., Golub, T. R., Rubin, M. A., Penning, T.
M., Febbo, P. G., and Balk, S. P. (2006). Increased expression of genes
converting adrenal androgens to testosterone in androgen-independent prostate
cancer. Cancer Res 66, 2815-2825.
210.Stanbrough, M., Leav, I., Kwan, P. W., Bubley, G. J., and Balk, S. P. (2001).
Prostatic intraepithelial neoplasia in mice expressing an androgen receptor
transgene in prostate epithelium. Proc Natl Acad Sci U S A 98, 10823-10828.
184
211.Steinkamp, M. P., O'Mahony, O. A., Brogley, M., Rehman, H., Lapensee, E. W.,
Dhanasekaran, S., Hofer, M. D., Kuefer, R., Chinnaiyan, A., Rubin, M. A., et al.
(2009). Treatment-dependent androgen receptor mutations in prostate cancer
exploit multiple mechanisms to evade therapy. Cancer Res 69, 4434-4442.
212.Stevens, J. L., Cantin, G. T., Wang, G., Shevchenko, A., and Berk, A. J. (2002).
Transcription control by E1A and MAP kinase pathway via Sur2 mediator
subunit. Science 296, 755-758.
213.Stoecklin, E., Wissler, M., Schaetzle, D., Pfitzner, E., and Groner, B. (1999).
Interactions in the transcriptional regulation exerted by Stat5 and by members of
the steroid hormone receptor family. J Steroid Biochem Mol Biol 69, 195-204.
214.Strauss, J. F., 3rd, Martinez, F., and Kiriakidou, M. (1996). Placental steroid
hormone synthesis: unique features and unanswered questions. Biol Reprod 54,
303-311.
215.Sun, S., Sprenger, C. C., Vessella, R. L., Haugk, K., Soriano, K., Mostaghel, E.
A., Page, S. T., Coleman, I. M., Nguyen, H. M., Sun, H., et al. (2010). Castration
resistance in human prostate cancer is conferred by a frequently occurring
androgen receptor splice variant. J Clin Invest 120, 2715-2730.
216.Tan, J., Paria, B. C., Dey, S. K., and Das, S. K. (1999). Differential uterine
expression of estrogen and progesterone receptors correlates with uterine
preparation for implantation and decidualization in the mouse. Endocrinology
140, 5310-5321.
185
217.Tan, J. A., Marschke, K. B., Ho, K. C., Perry, S. T., Wilson, E. M., and French,
F. S. (1992). Response elements of the androgen-regulated C3 gene. J Biol Chem
267, 4456-4466.
218.Tang, L. S., Santillano, D. R., Wlodarczyk, B. J., Miranda, R. C., and Finnell, R.
H. (2005). Role of Folbp1 in the regional regulation of apoptosis and cell
proliferation in the developing neural tube and craniofacies. Am J Med Genet C
Semin Med Genet 135C, 48-58.
219.Taplin, M. E., Rajeshkumar, B., Halabi, S., Werner, C. P., Woda, B. A., Picus, J.,
Stadler, W., Hayes, D. F., Kantoff, P. W., Vogelzang, N. J., and Small, E. J.
(2003). Androgen receptor mutations in androgen-independent prostate cancer:
Cancer and Leukemia Group B Study 9663. J Clin Oncol 21, 2673-2678.
220.Taylor, B. S., Schultz, N., Hieronymus, H., Gopalan, A., Xiao, Y., Carver, B. S.,
Arora, V. K., Kaushik, P., Cerami, E., Reva, B., et al. (2010). Integrative genomic
profiling of human prostate cancer. Cancer Cell 18, 11-22.
221.Thalmann, G. N., Anezinis, P. E., Chang, S. M., Zhau, H. E., Kim, E. E.,
Hopwood, V. L., Pathak, S., von Eschenbach, A. C., and Chung, L. W. (1994).
Androgen-independent cancer progression and bone metastasis in the LNCaP
model of human prostate cancer. Cancer Res 54, 2577-2581.
222.Thompson, I. M., Goodman, P. J., Tangen, C. M., Lucia, M. S., Miller, G. J.,
Ford, L. G., Lieber, M. M., Cespedes, R. D., Atkins, J. N., Lippman, S. M., et al.
(2003). The influence of finasteride on the development of prostate cancer. N
Engl J Med 349, 215-224.
186
223.Tibbetts, T. A., Conneely, O. M., and O'Malley, B. W. (1999). Progesterone via
its receptor antagonizes the pro-inflammatory activity of estrogen in the mouse
uterus. Biol Reprod 60, 1158-1165.
224.Tilley, W. D., Marcelli, M., and McPhaul, M. J. (1990). Expression of the human
androgen receptor gene utilizes a common promoter in diverse human tissues and
cell lines. J Biol Chem 265, 13776-13781.
225.Tilley, W. D., Marcelli, M., Wilson, J. D., and McPhaul, M. J. (1989).
Characterization and expression of a cDNA encoding the human androgen
receptor. Proc Natl Acad Sci U S A 86, 327-331.
226.Timms, B. G. (2008). Prostate development: a historical perspective.
Differentiation 76, 565-577.
227.Tomlins, S. A., Laxman, B., Dhanasekaran, S. M., Helgeson, B. E., Cao, X.,
Morris, D. S., Menon, A., Jing, X., Cao, Q., Han, B., et al. (2007). Distinct classes
of chromosomal rearrangements create oncogenic ETS gene fusions in prostate
cancer. Nature 448, 595-599.
228.Tomlins, S. A., Mehra, R., Rhodes, D. R., Smith, L. R., Roulston, D., Helgeson,
B. E., Cao, X., Wei, J. T., Rubin, M. A., Shah, R. B., and Chinnaiyan, A. M.
(2006). TMPRSS2:ETV4 gene fusions define a third molecular subtype of
prostate cancer. Cancer Res 66, 3396-3400.
229.Tomlins, S. A., Rhodes, D. R., Perner, S., Dhanasekaran, S. M., Mehra, R., Sun,
X. W., Varambally, S., Cao, X., Tchinda, J., Kuefer, R., et al. (2005). Recurrent
fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer.
Science 310, 644-648.
187
230.Tran, C., Ouk, S., Clegg, N. J., Chen, Y., Watson, P. A., Arora, V., Wongvipat,
J., Smith-Jones, P. M., Yoo, D., Kwon, A., et al. (2009). Development of a
second-generation antiandrogen for treatment of advanced prostate cancer.
Science 324, 787-790.
231.Trapman, J., Klaassen, P., Kuiper, G. G., van der Korput, J. A., Faber, P. W., van
Rooij, H. C., Geurts van Kessel, A., Voorhorst, M. M., Mulder, E., and
Brinkmann, A. O. (1988). Cloning, structure and expression of a cDNA encoding
the human androgen receptor. Biochem Biophys Res Commun 153, 241-248.
232.Treisman, R., Marais, R., and Wynne, J. (1992). Spatial flexibility in ternary
complexes between SRF and its accessory proteins. EMBO J 11, 4631-4640.
233.Umesono, K., and Evans, R. M. (1989). Determinants of target gene specificity
for steroid/thyroid hormone receptors. Cell 57, 1139-1146.
234.Vanhoutte, P., Nissen, J. L., Brugg, B., Gaspera, B. D., Besson, M. J., Hipskind,
R. A., and Caboche, J. (2001). Opposing roles of Elk-1 and its brain-specific
isoform, short Elk-1, in nerve growth factor-induced PC12 differentiation. J Biol
Chem 276, 5189-5196.
235.Veldscholte, J., Berrevoets, C. A., Brinkmann, A. O., Grootegoed, J. A., and
Mulder, E. (1992). Anti-androgens and the mutated androgen receptor of LNCaP
cells: differential effects on binding affinity, heat-shock protein interaction, and
transcription activation. Biochemistry 31, 2393-2399.
188
236.Veldscholte, J., Ris-Stalpers, C., Kuiper, G. G., Jenster, G., Berrevoets, C.,
Claassen, E., van Rooij, H. C., Trapman, J., Brinkmann, A. O., and Mulder, E.
(1990). A mutation in the ligand binding domain of the androgen receptor of
human LNCaP cells affects steroid binding characteristics and response to anti-
androgens. Biochem Biophys Res Commun 173, 534-540.
237.Vickers, E. R., Kasza, A., Kurnaz, I. A., Seifert, A., Zeef, L. A., O'Donnell, A.,
Hayes, A., and Sharrocks, A. D. (2004). Ternary complex factor-serum response
factor complex-regulated gene activity is required for cellular proliferation and
inhibition of apoptotic cell death. Mol Cell Biol 24, 10340-10351.
238.Visakorpi, T., Hyytinen, E., Koivisto, P., Tanner, M., Keinanen, R., Palmberg,
C., Palotie, A., Tammela, T., Isola, J., and Kallioniemi, O. P. (1995). In vivo
amplification of the androgen receptor gene and progression of human prostate
cancer. Nat Genet 9, 401-406.
239.Vlahopoulos, S., Zimmer, W. E., Jenster, G., Belaguli, N. S., Balk, S. P.,
Brinkmann, A. O., Lanz, R. B., Zoumpourlis, V. C., and Schwartz, R. J. (2005).
Recruitment of the androgen receptor via serum response factor facilitates
expression of a myogenic gene. J Biol Chem 280, 7786-7792.
240.Wang, J., Cai, Y., Ren, C., and Ittmann, M. (2006). Expression of variant
TMPRSS2/ERG fusion messenger RNAs is associated with aggressive prostate
cancer. Cancer Res 66, 8347-8351.
241.Wang, L., Hsu, C. L., and Chang, C. (2005). Androgen receptor corepressors: an
overview. Prostate 63, 117-130.
189
242.Wang, Q., Li, W., Zhang, Y., Yuan, X., Xu, K., Yu, J., Chen, Z., Beroukhim, R.,
Wang, H., Lupien, M., et al. (2009). Androgen receptor regulates a distinct
transcription program in androgen-independent prostate cancer. Cell 138, 245-
256.
243.Wang, X., Shen, F., Freisheim, J. H., Gentry, L. E., and Ratnam, M. (1992).
Differential stereospecificities and affinities of folate receptor isoforms for folate
compounds and antifolates. Biochem Pharmacol 44, 1898-1901.
244.Wang, X., Yeh, S., Wu, G., Hsu, C. L., Wang, L., Chiang, T., Yang, Y., Guo, Y.,
and Chang, C. (2001). Identification and characterization of a novel androgen
receptor coregulator ARA267-alpha in prostate cancer cells. J Biol Chem 276,
40417-40423.
245.Wasylyk, B., Hagman, J., and Gutierrez-Hartmann, A. (1998). Ets transcription
factors: nuclear effectors of the Ras-MAP-kinase signaling pathway. Trends
Biochem Sci 23, 213-216.
246.Weitman, S. D., Lark, R. H., Coney, L. R., Fort, D. W., Frasca, V., Zurawski, V.
R., Jr., and Kamen, B. A. (1992a). Distribution of the folate receptor GP38 in
normal and malignant cell lines and tissues. Cancer Res 52, 3396-3401.
247.Weitman, S. D., Weinberg, A. G., Coney, L. R., Zurawski, V. R., Jennings, D. S.,
and Kamen, B. A. (1992b). Cellular localization of the folate receptor: potential
role in drug toxicity and folate homeostasis. Cancer Res 52, 6708-6711.
190
248.Wen, Y., Hu, M. C., Makino, K., Spohn, B., Bartholomeusz, G., Yan, D. H., and
Hung, M. C. (2000). HER-2/neu promotes androgen-independent survival and
growth of prostate cancer cells through the Akt pathway. Cancer Res 60, 6841-
6845.
249.Westerhof, G. R., Jansen, G., van Emmerik, N., Kathmann, I., Rijksen, G.,
Jackman, A. L., and Schornagel, J. H. (1991). Membrane transport of natural
folates and antifolate compounds in murine L1210 leukemia cells: role of carrier-
and receptor-mediated transport systems. Cancer Res 51, 5507-5513.
250.White, R. J., and Sharrocks, A. D. (2010). Coordinated control of the gene
expression machinery. Trends Genet 26, 214-220.
251.Wong, H. Y., Burghoorn, J. A., Van Leeuwen, M., De Ruiter, P. E., Schippers,
E., Blok, L. J., Li, K. W., Dekker, H. L., De Jong, L., Trapman, J., et al. (2004).
Phosphorylation of androgen receptor isoforms. Biochem J 383, 267-276.
252.Wurzel, R., Ray, P., Major-Walker, K., Shannon, J., and Rittmaster, R. (2007).
The effect of dutasteride on intraprostatic dihydrotestosterone concentrations in
men with benign prostatic hyperplasia. Prostate Cancer Prostatic Dis 10, 149-154.
253.Xiao, S., Hansen, D. K., Horsley, E. T., Tang, Y. S., Khan, R. A., Stabler, S. P.,
Jayaram, H. N., and Antony, A. C. (2005). Maternal folate deficiency results in
selective upregulation of folate receptors and heterogeneous nuclear
ribonucleoprotein-E1 associated with multiple subtle aberrations in fetal tissues.
Birth Defects Res A Clin Mol Teratol 73, 6-28.
191
254.Xu, K., Shimelis, H., Linn, D. E., Jiang, R., Yang, X., Sun, F., Guo, Z., Chen, H.,
Li, W., Kong, X., et al. (2009). Regulation of androgen receptor transcriptional
activity and specificity by RNF6-induced ubiquitination. Cancer Cell 15, 270-282.
255.Xu, Y., Chen, S. Y., Ross, K. N., and Balk, S. P. (2006). Androgens induce
prostate cancer cell proliferation through mammalian target of rapamycin
activation and post-transcriptional increases in cyclin D proteins. Cancer Res 66,
7783-7792.
256.Yadav, N., and Heemers, H. V. (2012). Androgen action in the prostate gland.
Minerva Urol Nefrol 64, 35-49.
257.Yamauchi, T., Toko, M., Suga, M., Hatakeyama, T., and Isobe, M. (1999).
Structural organization of the human Elk1 gene and its processed pseudogene
Elk2. DNA Res 6, 21-27.
258.Yang, S. H., Bumpass, D. C., Perkins, N. D., and Sharrocks, A. D. (2002). The
ETS domain transcription factor Elk-1 contains a novel class of repression
domain. Mol Cell Biol 22, 5036-5046.
259.Yang, S. H., and Sharrocks, A. D. (2005). PIASx acts as an Elk-1 coactivator by
facilitating derepression. EMBO J 24, 2161-2171.
260.Yang, S. H., and Sharrocks, A. D. (2006). PIASxalpha differentially regulates the
amplitudes of transcriptional responses following activation of the ERK and p38
MAPK pathways. Mol Cell 22, 477-487.
261.Yang, S. H., Shore, P., Willingham, N., Lakey, J. H., and Sharrocks, A. D.
(1999). The mechanism of phosphorylation-inducible activation of the ETS-
domain transcription factor Elk-1. EMBO J 18, 5666-5674.
192
262.Yang, S. H., Vickers, E., Brehm, A., Kouzarides, T., and Sharrocks, A. D.
(2001). Temporal recruitment of the mSin3A-histone deacetylase corepressor
complex to the ETS domain transcription factor Elk-1. Mol Cell Biol 21, 2802-
2814.
263.Yang, S. H., Whitmarsh, A. J., Davis, R. J., and Sharrocks, A. D. (1998a).
Differential targeting of MAP kinases to the ETS-domain transcription factor Elk-
1. EMBO J 17, 1740-1749.
264.Yang, S. H., Yates, P. R., Whitmarsh, A. J., Davis, R. J., and Sharrocks, A. D.
(1998b). The Elk-1 ETS-domain transcription factor contains a mitogen-activated
protein kinase targeting motif. Mol Cell Biol 18, 710-720.
265.Yasuda, S., Hasui, S., Yamamoto, C., Yoshioka, C., Kobayashi, M., Itagaki, S.,
Hirano, T., and Iseki, K. (2008). Placental folate transport during pregnancy.
Biosci Biotechnol Biochem 72, 2277-2284.
266.Yeh, S., Miyamoto, H., Nishimura, K., Kang, H., Ludlow, J., Hsiao, P., Wang,
C., Su, C., and Chang, C. (1998). Retinoblastoma, a tumor suppressor, is a
coactivator for the androgen receptor in human prostate cancer DU145 cells.
Biochem Biophys Res Commun 248, 361-367.
267.Yoshimoto, M., Joshua, A. M., Chilton-Macneill, S., Bayani, J., Selvarajah, S.,
Evans, A. J., Zielenska, M., and Squire, J. A. (2006). Three-color FISH analysis
of TMPRSS2/ERG fusions in prostate cancer indicates that genomic
microdeletion of chromosome 21 is associated with rearrangement. Neoplasia 8,
465-469.
193
268.Zhang, H. M., Li, L., Papadopoulou, N., Hodgson, G., Evans, E., Galbraith, M.,
Dear, M., Vougier, S., Saxton, J., and Shaw, P. E. (2008). Mitogen-induced
recruitment of ERK and MSK to SRE promoter complexes by ternary complex
factor Elk-1. Nucleic Acids Res 36, 2594-2607.
269.Zhang, J., Gonit, M., Salazar, M. D., Shatnawi, A., Shemshedini, L., Trumbly,
R., and Ratnam, M. (2010). C/EBPalpha redirects androgen receptor signaling
through a unique bimodal interaction. Oncogene 29, 723-738.
270.Zhang, X., Gamble, M. J., Stadler, S., Cherrington, B. D., Causey, C. P.,
Thompson, P. R., Roberson, M. S., Kraus, W. L., and Coonrod, S. A. (2011).
Genome-wide analysis reveals PADI4 cooperates with Elk-1 to activate c-Fos
expression in breast cancer cells. PLoS Genet 7, e1002112.
271.Zhao, X., Li, H., and Lee, R. J. (2008). Targeted drug delivery via folate
receptors. Expert Opin Drug Deliv 5, 309-319.
272.Zhong, S., Fromm, J., and Johnson, D. L. (2007). TBP is differentially regulated
by c-Jun N-terminal kinase 1 (JNK1) and JNK2 through Elk-1, controlling c-Jun
expression and cell proliferation. Mol Cell Biol 27, 54-64.
273.Zhou, Z. X., Sar, M., Simental, J. A., Lane, M. V., and Wilson, E. M. (1994). A
ligand-dependent bipartite nuclear targeting signal in the human androgen
receptor. Requirement for the DNA-binding domain and modulation by NH2-
terminal and carboxyl-terminal sequences. J Biol Chem 269, 13115-13123.
194
Appendix A
Supplement 1
List of androgen dependent Elk-1 regulated genes in LNCaP cells
Elk1 dependent
Ctrl Elk1-kd
AFFY IDS Gene stimulation by
R1881/Veh R1881/veh
R1881 (Fold)
221436_s_at CDCA3 7.19 0.69 10.37
202870_s_at CDC20 5.59 0.66 8.47
218585_s_at DTL 9.45 1.25 7.58
1557128_at FAM111B 13.04 1.86 7.01
1563022_at CCDC160 8.34 1.29 6.44
201650_at KRT19 178.00 28.02 6.35
217678_at SLC7A11 3.81 0.61 6.27
228033_at E2F7 4.34 0.74 5.86
201890_at RRM2 6.16 1.07 5.77
223570_at MCM10 4.79 0.86 5.57
218662_s_at NCAPG 4.94 0.89 5.53
227609_at EPSTI1 5.93 1.10 5.41
1557129_a_at FAM111B 18.08 3.36 5.38
237939_at EPHA5 1.52 0.30 5.12
243938_x_at DNAH5 4.43 0.88 5.05
209921_at SLC7A11 3.08 0.61 5.05
218542_at CEP55 4.72 0.94 5.00
203764_at DLGAP5 3.47 0.74 4.66
230577_at LOC100507008 172.46 37.54 4.59
204822_at TTK 5.12 1.13 4.55
218663_at NCAPG 4.35 0.97 4.49
220786_s_at SLC38A4 39.63 8.90 4.46
201292_at TOP2A 3.36 0.76 4.43
202095_s_at BIRC5 4.14 0.94 4.38
222958_s_at DEPDC1 4.27 0.98 4.35
207165_at HMMR 4.77 1.11 4.31
195
220723_s_at CWH43 1.85 0.43 4.30
229551_x_at ZNF367 4.31 1.00 4.29
201291_s_at TOP2A 3.33 0.78 4.28
207828_s_at CENPF 3.01 0.71 4.25
204162_at NDC80 3.02 0.73 4.16
209610_s_at SLC1A4 2.47 0.60 4.15
204641_at NEK2 3.11 0.75 4.15
230631_s_at LOC100288432 21.56 5.23 4.12
207528_s_at SLC7A11 3.58 0.88 4.06
204298_s_at LOX 11.79 2.92 4.04
205047_s_at ASNS 1.83 0.46 3.98
228323_at CASC5 2.00 0.51 3.92
211126_s_at CSRP2 6.94 1.79 3.89
239578_at --- 4.01 1.04 3.87
209773_s_at RRM2 3.96 1.05 3.77
223700_at MND1 3.63 0.98 3.70
219990_at E2F8 2.97 0.82 3.63
218039_at NUSAP1 3.66 1.02 3.60
204351_at S100P 8.21 2.28 3.60
242398_x_at --- 3.23 0.90 3.60
214920_at THSD7A 11.29 3.15 3.59
222680_s_at DTL 3.33 0.95 3.49
1555390_at C14orf21 2.25 0.65 3.46
201294_s_at WSB1 2.24 0.65 3.43
204531_s_at BRCA1 2.32 0.68 3.41
205040_at ORM1 79.98 23.54 3.40
229097_at DIAPH3 2.39 0.72 3.33
216250_s_at LPXN 7.05 2.13 3.31
219148_at PBK 3.49 1.06 3.30
207030_s_at CSRP2 10.90 3.33 3.28
231094_s_at MTHFD1L 2.90 0.88 3.27
228281_at C11orf82 3.13 0.96 3.25
214437_s_at SHMT2 2.41 0.74 3.24
222039_at KIF18B 2.81 0.88 3.20
221489_s_at SPRY4 3.76 1.19 3.17
203967_at CDC6 3.66 1.17 3.13
212810_s_at SLC1A4 2.01 0.65 3.11
202503_s_at KIAA0101 2.92 0.94 3.09
202705_at CCNB2 2.60 0.84 3.09
201110_s_at THBS1 4.87 1.58 3.09
205421_at SLC22A3 2.16 0.70 3.08
226980_at DEPDC1B 3.81 1.25 3.06
203439_s_at STC2 1.51 0.49 3.05
202721_s_at GFPT1 2.89 0.95 3.05
215806_x_at TARP /// TRGC2 29.39 9.67 3.04
209891_at SPC25 3.69 1.22 3.03
231070_at IYD 2.10 0.69 3.03
205554_s_at DNASE1L3 2.14 0.71 3.03
218741_at CENPM 3.10 1.03 3.02
1568924_a_at IQUB 3.22 1.08 2.98
196
222608_s_at ANLN 3.13 1.06 2.96
227786_at MED30 1.95 0.66 2.94
223307_at CDCA3 2.60 0.89 2.93
235545_at DEPDC1 2.76 0.94 2.92
232639_at C3orf25 12.91 4.43 2.92
201006_at PRDX2 1.54 0.54 2.88
214095_at SHMT2 2.24 0.78 2.87
1554271_a_at CENPL 1.90 0.66 2.87
228966_at PANK2 1.92 0.67 2.87
211658_at PRDX2 2.30 0.80 2.86
208693_s_at GARS 1.92 0.67 2.85
219493_at SHCBP1 3.30 1.16 2.83
235676_at --- 3.67 1.30 2.82
228069_at FAM54A 2.19 0.78 2.80
225520_at MTHFD1L 2.02 0.73 2.78
208581_x_at MT1X 1.76 0.64 2.75
232413_at --- 1.66 0.60 2.75
217503_at STK17B 4.28 1.56 2.74
225540_at MAP2 2.20 0.80 2.74
219978_s_at NUSAP1 2.98 1.09 2.73
1553697_at C1orf96 2.78 1.02 2.73
244317_at KIAA1324L 1.95 0.72 2.73
221539_at EIF4EBP1 2.31 0.86 2.69
1553810_a_at KIAA1524 1.53 0.57 2.68
210559_s_at CDK1 2.33 0.87 2.67
219974_x_at ECHDC1 2.88 1.08 2.67
209855_s_at KLK2 163.87 61.47 2.67
230438_at TBX15 4.94 1.86 2.66
205475_at SCRG1 1.99 0.75 2.65
201599_at OAT 2.17 0.82 2.64
204887_s_at PLK4 1.83 0.70 2.63
208916_at SLC1A5 2.81 1.07 2.63
206731_at CNKSR2 3.12 1.19 2.63
201663_s_at SMC4 1.96 0.75 2.62
217967_s_at FAM129A 2.24 0.85 2.62
206461_x_at MT1H 1.81 0.69 2.62
219494_at RAD54B 3.52 1.36 2.59
241895_at LOC440905 2.73 1.05 2.59
207824_s_at MAZ 3.86 1.49 2.59
228273_at PRR11 2.79 1.08 2.58
242498_x_at --- 1.79 0.69 2.58
204326_x_at MT1X 1.77 0.69 2.56
203789_s_at SEMA3C 3.51 1.38 2.55
214804_at CENPI 2.95 1.16 2.54
202402_s_at CARS 1.67 0.66 2.54
1569108_a_at ZNF589 1.88 0.74 2.54
204825_at MELK 2.10 0.83 2.54
217165_x_at MT1F 2.19 0.87 2.52
209709_s_at HMMR 2.80 1.12 2.51
205393_s_at CHEK1 1.90 0.76 2.50
197
243001_at RBFA 2.44 0.98 2.49
204444_at KIF11 1.71 0.69 2.49
216126_at --- 1.77 0.72 2.47
242578_x_at SLC22A3 1.65 0.67 2.47
209387_s_at TM4SF1 8.36 3.41 2.45
207227_x_at RFPL2 5.32 2.17 2.45
218883_s_at MLF1IP 2.68 1.10 2.45
209172_s_at CENPF 2.59 1.06 2.45
223381_at NUF2 2.32 0.96 2.43
211456_x_at MT1P2 1.55 0.64 2.43
38241_at BTN3A3 1.90 0.79 2.42
210372_s_at TPD52L1 2.24 0.93 2.41
220738_s_at RPS6KA6 1.66 0.69 2.41
221782_at DNAJC10 3.75 1.56 2.40
203755_at BUB1B 1.52 0.63 2.40
230150_at BCAP29 2.13 0.89 2.40
202847_at PCK2 1.71 0.71 2.40
227192_at PRRT2 2.93 1.23 2.38
208549_x_at PTMA 2.08 0.88 2.37
215616_s_at KDM4B 2.23 0.94 2.37
202954_at UBE2C 2.49 1.06 2.35
237158_s_at MPHOSPH9 3.97 1.69 2.35
1560222_at --- 1.85 0.79 2.34
235572_at SPC24 1.82 0.78 2.34
243483_at TRPM8 126.48 54.11 2.34
201761_at MTHFD2 1.82 0.78 2.33
216307_at DGKB 2.65 1.14 2.33
1553220_at FAM117B 2.03 0.87 2.32
216336_x_at LOC100505584 /// MT1E 1.51 0.65 2.32
210951_x_at RAB27A 9.95 4.29 2.32
229305_at MLF1IP 2.72 1.17 2.32
217127_at CTH 2.51 1.08 2.32
1569283_at ZNF891 1.86 0.80 2.32
229588_at DNAJC10 2.43 1.05 2.31
204583_x_at KLK3 352.95 152.80 2.31
233197_at KLHL9 1.64 0.71 2.30
242427_at WAC 2.89 1.26 2.30
202183_s_at KIF22 7.18 3.13 2.29
229572_at ATP6V0A2 1.66 0.72 2.29
203072_at MYO1E 4.20 1.84 2.28
235247_at --- 3.79 1.66 2.28
235386_at --- 1.55 0.68 2.27
235445_at --- 59.69 26.35 2.27
210062_s_at ZNF589 2.11 0.93 2.26
204286_s_at PMAIP1 2.92 1.29 2.26
238513_at PRRG4 2.12 0.94 2.25
207038_at SLC16A6 6.27 2.79 2.25
200770_s_at LAMC1 5.23 2.33 2.24
209567_at RRS1 1.65 0.74 2.24
214096_s_at SHMT2 1.82 0.82 2.23
198
207226_at HIST1H2BN 2.25 1.01 2.23
235999_at --- 1.73 0.77 2.23
208353_x_at ANK1 3.38 1.52 2.23
234985_at LDLRAD3 2.33 1.05 2.23
225655_at UHRF1 2.30 1.03 2.22
1553494_at TDH 1.81 0.81 2.22
218736_s_at PALMD 4.66 2.10 2.22
228229_at ZNF526 1.72 0.78 2.22
212048_s_at YARS 1.75 0.79 2.21
213599_at OIP5 1.87 0.85 2.21
235062_at PIH1D2 1.53 0.69 2.21
1561817_at --- 7.53 3.41 2.21
216568_x_at --- 3.95 1.79 2.20
1555091_at PPM1F 3.09 1.41 2.19
209825_s_at UCK2 2.25 1.03 2.18
1556923_at --- 2.48 1.14 2.17
204745_x_at MT1G 1.63 0.75 2.17
220885_s_at CENPJ 2.28 1.06 2.16
218355_at KIF4A 2.98 1.38 2.16
209386_at TM4SF1 5.19 2.42 2.15
203372_s_at SOCS2 4.21 1.96 2.15
210527_x_at TUBA3C 4.62 2.15 2.14
1552540_s_at IQCD 1.94 0.90 2.14
1560827_at --- 1.54 0.72 2.13
212971_at CARS 1.52 0.71 2.13
206023_at NMU 1.54 0.72 2.13
242487_at CC2D1B 1.60 0.76 2.12
205622_at SMPD2 5.57 2.63 2.12
1553698_a_at C1orf96 2.33 1.10 2.12
237907_at --- 1.59 0.75 2.12
217989_at HSD17B11 3.89 1.84 2.12
217788_s_at GALNT2 1.64 0.78 2.11
222118_at CENPN 31.42 14.88 2.11
204285_s_at PMAIP1 2.38 1.13 2.10
213433_at ARL3 1.58 0.75 2.10
208352_x_at ANK1 4.15 1.98 2.10
209230_s_at NUPR1 1.55 0.74 2.09
201063_at RCN1 1.54 0.74 2.09
204962_s_at CENPA 1.82 0.87 2.08
222520_s_at IFT57 1.68 0.81 2.08
233110_s_at BCL2L12 1.84 0.89 2.08
229831_at CNTN3 2.17 1.05 2.07
1556265_at C20orf202 1.72 0.83 2.07
228531_at SAMD9 1.59 0.77 2.07
226875_at DOCK11 2.09 1.01 2.07
217966_s_at FAM129A 1.77 0.86 2.07
203373_at SOCS2 3.85 1.87 2.07
211689_s_at TMPRSS2 40.67 19.73 2.06
231629_x_at KLK3 6.28 3.05 2.06
219199_at AFF4 2.73 1.33 2.06
199
1554217_a_at CCDC132 1.51 0.73 2.06
203252_at CDK2AP2 2.18 1.07 2.05
213189_at MINA 1.61 0.79 2.04
203362_s_at MAD2L1 2.01 0.98 2.04
216450_x_at HSP90B1 1.98 0.97 2.04
209408_at KIF2C 1.66 0.81 2.04
203780_at MPZL2 1.61 0.79 2.04
205347_s_at TMSB15A 3.39 1.67 2.04
220774_at DYM 1.78 0.88 2.03
1559530_at --- 1.98 0.97 2.03
242370_at MTHFD2L 1.50 0.74 2.03
214308_s_at HGD 2.48 1.22 2.03
236069_at --- 1.90 0.94 2.03
243560_at --- 2.43 1.20 2.02
204027_s_at METTL1 1.52 0.75 2.02
C16orf52 ///
230721_at LOC100509359 1.67 0.83 2.02
224884_at AKAP13 1.55 0.77 2.02
1561418_at --- 1.82 0.90 2.02
203276_at LMNB1 1.53 0.76 2.01
210790_s_at SAR1A 2.54 1.27 2.01
204423_at MKLN1 2.03 1.01 2.01
204800_s_at DHRS12 1.98 0.99 2.01
208978_at CRIP2 2.97 1.48 2.00
233230_s_at SLAIN2 1.83 0.91 2.00
230748_at SLC16A6 5.81 2.91 1.99
203786_s_at TPD52L1 1.88 0.94 1.99
228308_at FKBP11 2.40 1.21 1.99
1565852_at --- 1.80 0.91 1.98
212973_at RPIA 1.75 0.88 1.98
203554_x_at PTTG1 2.25 1.13 1.98
211048_s_at PDIA4 2.01 1.02 1.98
242663_at LOC148189 2.21 1.12 1.98
217619_x_at --- 1.60 0.81 1.98
238717_at --- 1.94 0.98 1.97
242450_at RGMB 2.29 1.16 1.97
203214_x_at CDK1 1.55 0.79 1.97
220800_s_at TMOD3 1.74 0.88 1.97
213008_at FANCI 2.05 1.04 1.97
235457_at MAML2 3.90 1.98 1.97
204318_s_at GTSE1 1.73 0.88 1.97
216920_s_at TARP /// TRGC2 14.33 7.30 1.96
241827_at ZNF615 2.95 1.51 1.96
1560977_a_at BCL2L13 1.88 0.96 1.96
219105_x_at ORC6 2.37 1.21 1.95
219620_x_at C9orf167 1.55 0.79 1.95
209309_at AZGP1 28.15 14.42 1.95
210377_at ACSM3 3.02 1.55 1.95
222747_s_at SCML1 1.80 0.93 1.94
202375_at SEC24D 2.99 1.54 1.94
200
212543_at AIM1 4.80 2.48 1.94
229470_at --- 1.94 1.00 1.93
219694_at FAM105A 12.95 6.71 1.93
224428_s_at CDCA7 2.01 1.04 1.93
231772_x_at CENPH 1.98 1.03 1.92
213913_s_at TBC1D30 2.12 1.11 1.92
212558_at SPRY1 2.43 1.27 1.91
201625_s_at INSIG1 3.07 1.60 1.91
212290_at SLC7A1 1.67 0.87 1.91
220389_at CCDC81 4.03 2.11 1.91
229620_at --- 4.84 2.54 1.91
210792_x_at SIVA1 1.86 0.97 1.90
211150_s_at DLAT 1.74 0.91 1.90
212915_at PDZRN3 1.87 0.99 1.90
215195_at PRKCA 2.28 1.20 1.90
239580_at GUCY1A3 1.71 0.91 1.89
204244_s_at DBF4 2.45 1.30 1.89
211681_s_at PDLIM5 1.63 0.86 1.88
210339_s_at KLK2 69.52 36.99 1.88
221272_s_at C1orf21 4.74 2.53 1.87
214307_at HGD 2.75 1.47 1.87
239761_at GCNT1 2.74 1.46 1.87
222309_at LOC100506935 1.58 0.85 1.87
217053_x_at ETV1 2.19 1.18 1.86
225144_at BMPR2 2.26 1.21 1.86
204767_s_at FEN1 2.16 1.16 1.86
219374_s_at ALG9 /// FDXACB1 1.68 0.90 1.86
231011_at LARP1B 1.59 0.85 1.86
221779_at MICALL1 1.85 1.00 1.86
220295_x_at DEPDC1 2.80 1.50 1.86
222294_s_at RAB27A 6.40 3.44 1.86
1559315_s_at LOC144481 3.92 2.11 1.86
200670_at XBP1 1.58 0.85 1.85
210570_x_at MAPK9 1.51 0.81 1.85
209169_at GPM6B 1.68 0.91 1.85
227028_s_at DGCR2 1.56 0.84 1.85
219230_at TMEM100 7.71 4.17 1.85
205406_s_at SPA17 1.90 1.03 1.85
219555_s_at CENPN 13.19 7.14 1.85
225174_at DNAJC10 2.53 1.37 1.84
219211_at USP18 1.54 0.84 1.84
234529_at PCGEM1 2.41 1.31 1.83
219565_at CYP20A1 1.76 0.96 1.83
209514_s_at RAB27A 6.70 3.65 1.83
214482_at ZBTB25 1.73 0.94 1.83
231319_x_at KIF9 1.51 0.82 1.83
207936_x_at RFPL3 3.12 1.70 1.83
223707_at RPL27A 2.41 1.32 1.83
1570482_at --- 1.54 0.84 1.83
209534_x_at AKAP13 1.61 0.88 1.83
201
204026_s_at ZWINT 2.20 1.20 1.83
224753_at CDCA5 2.03 1.11 1.82
202655_at MANF 2.23 1.22 1.82
208937_s_at ID1 1.55 0.85 1.82
218100_s_at IFT57 1.98 1.09 1.81
235067_at MKLN1 1.59 0.88 1.81
1559003_a_at CCDC163P 1.89 1.05 1.81
211713_x_at KIAA0101 1.79 0.99 1.81
213618_at ARAP2 2.07 1.14 1.81
202935_s_at SOX9 1.51 0.84 1.81
200918_s_at SRPR 1.77 0.98 1.80
203712_at KIAA0020 2.17 1.20 1.80
203145_at SPAG5 1.60 0.89 1.80
221781_s_at DNAJC10 3.40 1.89 1.80
201790_s_at DHCR7 1.82 1.01 1.79
229998_x_at FAM176B 1.89 1.05 1.79
1552937_s_at ATRIP 1.55 0.87 1.79
215930_s_at CTAGE5 1.56 0.87 1.79
242069_at CBX5 2.32 1.30 1.78
211077_s_at TLK1 1.54 0.86 1.78
238448_at MRPL19 1.54 0.87 1.78
205282_at LRP8 2.15 1.21 1.78
221758_at ARMC6 1.66 0.93 1.78
217790_s_at SSR3 2.13 1.20 1.78
242775_at PTGR1 2.47 1.39 1.78
224615_x_at HM13 2.48 1.40 1.77
213912_at TBC1D30 2.15 1.21 1.77
213093_at PRKCA 2.40 1.35 1.77
242260_at MATR3 1.53 0.86 1.77
212295_s_at SLC7A1 1.55 0.88 1.77
235766_x_at RAB27A 5.65 3.21 1.76
238011_at --- 1.77 1.00 1.76
242592_at GPR137C 1.50 0.85 1.76
213951_s_at PSMC3IP 2.18 1.24 1.76
1565620_at AGAP4 1.94 1.10 1.76
218358_at CRELD2 1.69 0.96 1.76
1552572_a_at MIPOL1 2.37 1.35 1.75
205505_at GCNT1 2.54 1.45 1.75
222412_s_at SSR3 2.49 1.42 1.75
232311_at B2M 1.77 1.01 1.75
220018_at CBLL1 3.60 2.06 1.75
237311_at --- 4.11 2.34 1.75
232319_at --- 1.56 0.89 1.75
1554712_a_at GLYATL2 4.63 2.65 1.75
215892_at ZNF440 1.73 0.99 1.75
208433_s_at LRP8 1.77 1.01 1.75
1556321_a_at --- 2.26 1.29 1.75
200890_s_at SSR1 2.37 1.36 1.74
235949_at TTC26 1.58 0.91 1.74
218070_s_at GMPPA 2.10 1.20 1.74
202
216237_s_at MCM5 2.58 1.48 1.74
229669_at LOC100507263 1.62 0.93 1.74
206550_s_at NUP155 1.60 0.92 1.74
242258_at --- 2.02 1.16 1.74
201627_s_at INSIG1 3.37 1.94 1.74
200862_at DHCR24 5.01 2.88 1.74
235958_at PLA2G4F 1.64 0.95 1.74
201127_s_at ACLY 2.07 1.19 1.74
233511_at --- 1.54 0.89 1.74
222725_s_at PALMD 4.98 2.87 1.74
205316_at SLC15A2 16.06 9.26 1.73
205942_s_at ACSM3 3.41 1.97 1.73
224316_at --- 1.69 0.98 1.73
205510_s_at FLJ10038 2.14 1.24 1.73
204820_s_at BTN3A2 /// BTN3A3 1.58 0.91 1.72
232281_at LOC148189 2.03 1.18 1.72
216640_s_at PDIA6 1.86 1.08 1.72
209100_at IFRD2 1.70 0.99 1.72
228369_at CNPY3 1.55 0.90 1.72
1554116_s_at PARP11 1.73 1.01 1.72
201626_at INSIG1 2.53 1.47 1.72
238797_at TRIM11 1.82 1.06 1.71
1563075_s_at --- 2.48 1.45 1.71
237817_at --- 3.44 2.01 1.71
201247_at SREBF2 1.69 0.99 1.71
1555758_a_at CDKN3 1.99 1.16 1.71
222036_s_at MCM4 1.52 0.89 1.71
204017_at KDELR3 2.02 1.18 1.71
212811_x_at SLC1A4 1.73 1.02 1.70
209286_at CDC42EP3 2.50 1.47 1.70
219207_at EDC3 2.31 1.36 1.70
205896_at SLC22A4 3.00 1.77 1.70
209920_at BMPR2 1.95 1.15 1.70
244760_at HERC6 6.19 3.65 1.70
214240_at GAL 2.28 1.35 1.69
209291_at ID4 2.13 1.26 1.69
229975_at BMPR1B 3.01 1.78 1.69
201562_s_at SORD 7.18 4.25 1.69
218886_at PAK1IP1 5.86 3.47 1.69
242335_at SLC25A37 2.38 1.41 1.69
239282_at CCDC41 2.34 1.39 1.69
223164_at CCM2 1.53 0.91 1.69
209714_s_at CDKN3 1.71 1.01 1.69
234464_s_at EME1 2.12 1.26 1.69
1570339_x_at --- 1.67 0.99 1.68
218059_at ZNF706 2.38 1.42 1.68
200652_at SSR2 2.08 1.24 1.68
224484_s_at BRMS1L 2.17 1.30 1.67
212590_at RRAS2 1.59 0.95 1.67
231959_at LIN52 1.66 0.99 1.67
203
219388_at GRHL2 2.37 1.42 1.67
208658_at PDIA4 2.11 1.26 1.67
243188_at ZNF283 1.60 0.96 1.67
227340_s_at RGMB 1.81 1.09 1.67
222231_s_at LRRC59 2.31 1.38 1.67
217014_s_at AZGP1 15.25 9.14 1.67
222519_s_at IFT57 2.04 1.23 1.67
219306_at KIF15 1.68 1.01 1.67
202068_s_at LDLR 3.27 1.96 1.67
201798_s_at MYOF 1.61 0.97 1.66
222854_s_at GEMIN8 1.95 1.17 1.66
1554472_a_at PHF20L1 1.59 0.96 1.66
214106_s_at GMDS 1.71 1.03 1.66
226234_at GDF11 1.89 1.14 1.66
1560070_at --- 3.28 1.97 1.66
212527_at PPPDE2 1.72 1.04 1.66
231873_at BMPR2 2.15 1.30 1.66
203379_at RPS6KA1 1.54 0.93 1.66
213629_x_at MT1F 2.05 1.24 1.65
242827_x_at --- 3.85 2.33 1.65
202286_s_at TACSTD2 2.61 1.58 1.65
203269_at NSMAF 3.02 1.83 1.65
233065_at RNF207 1.71 1.04 1.65
204768_s_at FEN1 1.90 1.15 1.65
212665_at TIPARP 1.72 1.04 1.65
221541_at CRISPLD2 1.95 1.19 1.64
214255_at ATP10A 3.00 1.83 1.64
227235_at GUCY1A3 1.95 1.19 1.64
201727_s_at ELAVL1 1.71 1.04 1.64
1553645_at CCDC141 275.89 168.00 1.64
212712_at CAMSAP1 2.03 1.23 1.64
203385_at DGKA 1.75 1.07 1.64
230518_at MPZL2 1.52 0.93 1.64
214484_s_at SIGMAR1 1.92 1.17 1.64
1554486_a_at C6orf114 1.79 1.09 1.64
219118_at FKBP11 2.68 1.64 1.64
208962_s_at FADS1 1.97 1.21 1.64
201579_at FAT1 1.85 1.13 1.64
213577_at SQLE 2.20 1.35 1.64
210095_s_at IGFBP3 2.15 1.32 1.63
205909_at POLE2 2.81 1.72 1.63
201791_s_at DHCR7 1.94 1.19 1.63
228871_at ALG14 2.03 1.24 1.63
241721_at --- 1.93 1.18 1.63
204058_at ME1 1.65 1.01 1.63
1554691_a_at PACSIN2 1.62 1.00 1.63
200831_s_at SCD 2.15 1.32 1.62
242348_at FAM19A4 2.21 1.36 1.62
243031_at --- 1.62 1.00 1.62
35666_at SEMA3F 1.82 1.12 1.62
204
205833_s_at PART1 2.80 1.73 1.62
235707_at LOC221710 1.60 0.99 1.62
236836_at --- 1.70 1.05 1.62
237439_at USP43 1.96 1.21 1.62
229632_s_at INTS10 3.18 1.97 1.62
228736_at HELQ 1.58 0.98 1.62
36830_at MIPEP 1.58 0.98 1.62
201516_at SRM 2.03 1.26 1.62
226226_at TMEM45B 2.04 1.27 1.61
206364_at KIF14 2.23 1.38 1.61
222497_x_at NMD3 1.53 0.95 1.61
219551_at EAF2 19.19 11.92 1.61
226525_at STK17B 5.83 3.63 1.61
202207_at ARL4C 2.13 1.32 1.61
243309_at FLJ27352 1.85 1.15 1.60
222304_x_at OR7E47P 1.55 0.97 1.60
228818_at --- 4.01 2.50 1.60
1555878_at RPS24 1.70 1.06 1.60
210667_s_at C21orf33 1.81 1.13 1.60
228968_at ZNF449 1.53 0.95 1.60
243027_at IGSF5 3.11 1.95 1.60
202558_s_at HSPA13 1.93 1.21 1.60
208842_s_at GORASP2 1.53 0.96 1.60
232397_at LOC100507039 11.92 7.48 1.59
1558292_s_at PIGW 1.62 1.01 1.59
229530_at GUCY1A3 1.55 0.97 1.59
220187_at STEAP4 13.81 8.67 1.59
212839_s_at TROVE2 1.54 0.96 1.59
225687_at FAM83D 1.96 1.23 1.59
1554406_a_at CLEC7A 1.81 1.14 1.59
223108_s_at ZCCHC17 1.98 1.25 1.59
236915_at C4orf47 1.56 0.99 1.59
204059_s_at ME1 1.66 1.05 1.59
223544_at TMEM79 6.54 4.13 1.58
210534_s_at B9D1 1.55 0.98 1.58
227105_at CSPP1 1.56 0.99 1.58
217787_s_at GALNT2 1.60 1.01 1.58
218349_s_at ZWILCH 2.11 1.33 1.58
221942_s_at GUCY1A3 2.19 1.39 1.58
200889_s_at SSR1 2.99 1.90 1.58
223001_at OSTC 2.05 1.30 1.58
218708_at NXT1 1.63 1.04 1.57
212767_at MTG1 1.67 1.06 1.57
203267_s_at DRG2 1.75 1.11 1.57
221629_x_at C8orf30A 1.63 1.04 1.57
201894_s_at SSR1 2.00 1.28 1.57
1555543_a_at CLCC1 1.72 1.09 1.57
214021_x_at ITGB5 1.90 1.21 1.57
219736_at TRIM36 3.05 1.95 1.57
228050_at UTP15 1.90 1.22 1.57
205
209515_s_at RAB27A 5.81 3.71 1.57
205429_s_at MPP6 2.34 1.49 1.57
232149_s_at NSMAF 3.14 2.01 1.57
225094_at SETD8 2.20 1.40 1.56
235846_at --- 4.66 2.98 1.56
225367_at PGM2 2.08 1.33 1.56
1560446_at LOC100132815 2.04 1.31 1.56
200947_s_at GLUD1 2.78 1.78 1.56
200771_at LAMC1 4.39 2.81 1.56
235113_at PPIL5 1.63 1.05 1.56
220625_s_at ELF5 1.66 1.07 1.56
235543_at --- 1.53 0.98 1.56
242098_at KIAA1244 1.64 1.05 1.56
229443_at C6orf125 1.51 0.97 1.56
202557_at HSPA13 2.23 1.43 1.56
239106_at CA5BP 1.81 1.16 1.56
205221_at HGD 2.40 1.54 1.56
209759_s_at DCI 2.01 1.29 1.56
240016_at --- 1.75 1.13 1.55
202613_at CTPS 1.64 1.06 1.55
1563051_at OSBP 2.14 1.38 1.55
212064_x_at MAZ 2.84 1.83 1.55
1559654_s_at LOC100289508 1.81 1.17 1.55
215794_x_at GLUD2 2.84 1.84 1.55
200700_s_at KDELR2 2.56 1.66 1.54
207668_x_at PDIA6 1.64 1.06 1.54
203857_s_at PDIA5 4.95 3.21 1.54
242073_at --- 2.15 1.39 1.54
205319_at PSCA 2.75 1.79 1.54
242579_at BMPR1B 3.48 2.26 1.54
1555832_s_at KLF6 1.81 1.17 1.54
219252_s_at GEMIN8 1.77 1.15 1.54
232252_at DUSP27 4.92 3.20 1.54
235965_at --- 4.29 2.79 1.54
37005_at NBL1 8.87 5.78 1.54
201770_at SNRPA 1.54 1.00 1.54
217981_s_at FXC1 2.04 1.33 1.54
214947_at FAM105A 3.14 2.05 1.53
243762_at --- 11.66 7.61 1.53
1552314_a_at EYA3 3.10 2.03 1.53
228559_at CENPN 24.91 16.27 1.53
1560402_at GAS5 1.68 1.10 1.53
224465_s_at WIBG 2.44 1.60 1.53
203270_at DTYMK 1.68 1.10 1.53
220549_at RAD54B 4.27 2.80 1.53
220200_s_at SETD8 2.56 1.67 1.53
218826_at SLC35F2 4.92 3.22 1.53
236088_at NTNG1 1.54 1.01 1.53
219260_s_at C17orf81 1.76 1.15 1.53
218096_at AGPAT5 1.90 1.25 1.53
206
206363_at MAF 16.30 10.67 1.53
202276_at SHFM1 1.64 1.08 1.53
204010_s_at KRAS 1.70 1.11 1.53
201123_s_at EIF5A 1.61 1.06 1.53
203450_at CBY1 1.68 1.10 1.53
227787_s_at MED30 1.75 1.15 1.52
226486_at MTERFD2 2.04 1.34 1.52
219098_at MYBBP1A 1.54 1.01 1.52
219826_at ZNF419 1.65 1.08 1.52
205687_at UBFD1 1.74 1.14 1.52
223738_s_at PGM2 1.98 1.30 1.52
223852_s_at STK40 1.58 1.04 1.52
230492_s_at GPCPD1 1.75 1.15 1.52
227695_at GLYATL1 2.18 1.44 1.52
214649_s_at MTMR2 2.51 1.65 1.52
210811_s_at DDX49 1.57 1.04 1.52
203211_s_at MTMR2 2.17 1.43 1.52
1569253_at INTS4 1.62 1.07 1.52
203788_s_at SEMA3C 2.25 1.49 1.52
217200_x_at CYB561 1.77 1.17 1.52
201490_s_at PPIF 1.88 1.24 1.51
205324_s_at FTSJ1 1.58 1.05 1.51
227812_at TNFRSF19 1.62 1.07 1.51
208837_at TMED3 1.95 1.29 1.51
218193_s_at GOLT1B 2.43 1.61 1.51
210493_s_at MFAP3L 2.02 1.34 1.51
216962_at RPAIN 1.65 1.09 1.51
214153_at ELOVL5 2.20 1.46 1.51
1553575_at ND6 1.68 1.11 1.51
238121_at GK5 1.51 1.00 1.51
227794_at GLYATL1 3.26 2.17 1.51
224990_at C4orf34 1.81 1.20 1.51
243121_x_at --- 1.51 1.00 1.50
202669_s_at EFNB2 1.88 1.25 1.50
37384_at PPM1F 1.65 1.09 1.50
202418_at YIF1A 1.91 1.27 1.50
219968_at ZNF589 2.42 1.61 1.50
205835_s_at YTHDC2 1.90 1.26 1.50
215471_s_at MAP7 1.92 1.28 1.50
242731_x_at --- 2.00 1.33 1.50
203679_at TMED1 1.51 1.00 1.50
207
Appendix B
Supplement 2
List of Elk-1 repressed genes in LNCaP cells
AFFY IDS Gene Control shRNA / Elk1 shRNA

207165_at HMMR 0.07
218663_at NCAPG 0.10
1554095_at RBM33 0.13
201890_at RRM2 0.13
218662_s_at NCAPG 0.15
209773_s_at RRM2 0.15
202503_s_at KIAA0101 0.15
228273_at PRR11 0.16
222608_s_at ANLN 0.17
219148_at PBK 0.18
219493_at SHCBP1 0.19
218039_at NUSAP1 0.20
210559_s_at CDK1 0.21
36830_at MIPEP 0.22
203554_x_at PTTG1 0.22
223381_at NUF2 0.23
204326_x_at MT1X 0.24
211456_x_at MT1P2 0.24
204607_at HMGCS2 0.24
219978_s_at NUSAP1 0.25
202705_at CCNB2 0.25
205376_at INPP4B 0.25
204286_s_at PMAIP1 0.25
208581_x_at MT1X 0.26
223700_at MND1 0.26
206461_x_at MT1H 0.26
208
204531_s_at BRCA1 0.27
229551_x_at ZNF367 0.27
228069_at FAM54A 0.28
204026_s_at ZWINT 0.28
204444_at KIF11 0.28
204423_at MKLN1 0.28
205421_at SLC22A3 0.28
203755_at BUB1B 0.28
222680_s_at DTL 0.28
225655_at UHRF1 0.29
202954_at UBE2C 0.29
223307_at CDCA3 0.29
217165_x_at MT1F 0.29
220738_s_at RPS6KA6 0.31
203214_x_at CDK1 0.31
242592_at GPR137C 0.32
244881_at LMLN 0.32
237939_at EPHA5 0.32
213599_at OIP5 0.33
243001_at RBFA 0.33
225687_at FAM83D 0.33
LOC100505584 ///
216336_x_at MT1E 0.33
204745_x_at MT1G 0.33
242578_x_at SLC22A3 0.34
205876_at LIFR 0.34
204241_at ACOX3 0.34
1570482_at --- 0.35
225520_at MTHFD1L 0.35
1555758_a_at CDKN3 0.35
218479_s_at XPO4 0.35
1557129_a_at FAM111B 0.35
204285_s_at PMAIP1 0.35
209714_s_at CDKN3 0.37
244760_at HERC6 0.38
218883_s_at MLF1IP 0.38
228050_at UTP15 0.39
217127_at CTH 0.39
230150_at BCAP29 0.40
214710_s_at CCNB1 0.40
228490_at ABHD2 0.40
203362_s_at MAD2L1 0.40
223772_s_at TMEM87A 0.41
213913_s_at TBC1D30 0.41
212712_at CAMSAP1 0.42
222309_at LOC100506935 0.42
218647_s_at YRDC 0.42
222077_s_at RACGAP1 0.42
1553697_at C1orf96 0.42
227771_at LIFR 0.42
209
205047_s_at ASNS 0.42
204244_s_at DBF4 0.42
214140_at SLC25A16 0.43
235386_at --- 0.43
211150_s_at DLAT 0.43
220295_x_at DEPDC1 0.43
208079_s_at AURKA 0.43
1558014_s_at FAR1 0.43
210793_s_at NUP98 0.43
201599_at OAT 0.43
214482_at ZBTB25 0.43
235062_at PIH1D2 0.44
204146_at RAD51AP1 0.44
212543_at AIM1 0.44
213912_at TBC1D30 0.44
228729_at CCNB1 0.44
219105_x_at ORC6 0.45
1555274_a_at EPT1 0.45
1554217_a_at CCDC132 0.45
226809_at LOC100216479 0.45
202288_at MTOR 0.45
219736_at TRIM36 0.46
216228_s_at WDHD1 0.46
233110_s_at BCL2L12 0.46
1553810_a_at KIAA1524 0.46
205505_at GCNT1 0.46
87100_at ABHD2 0.46
205566_at ABHD2 0.46
208964_s_at FADS1 0.47
224753_at CDCA5 0.47
1555250_a_at CPEB3 0.47
224484_s_at BRMS1L 0.48
226936_at CENPW 0.48
212973_at RPIA 0.48
239669_at --- 0.48
221963_x_at --- 0.48
201626_at INSIG1 0.48
219494_at RAD54B 0.48
202402_s_at CARS 0.48
201516_at SRM 0.49
209825_s_at UCK2 0.49
213836_s_at WIPI1 0.49
213433_at ARL3 0.49
239580_at GUCY1A3 0.49
208693_s_at GARS 0.49
227560_at SFXN2 0.49
227368_at --- 0.49
235550_at MAP9 0.49
203145_at SPAG5 0.49
213189_at MINA 0.49
210
202906_s_at NBN 0.49
203276_at LMNB1 0.50
235425_at SGOL2 0.50
238513_at PRRG4 0.50
205489_at CRYM 0.50
211
Appendix C
Supplement 3
List of Elk-1 activated genes in LNCaP prostate cancer cells
AFFY IDS Gene Control shRNA / Elk1 shRNA

210095_s_at IGFBP3 6.71
223092_at ANKH 6.27
203908_at SLC4A4 4.60
201739_at SGK1 4.04
223093_at ANKH 4.03
205925_s_at RAB3B 3.98
200920_s_at BTG1 3.90
209706_at NKX3-1 3.57
210510_s_at NRP1 3.36
229019_at ZNF385B 3.31
218137_s_at SMAP1 3.28
1569785_at --- 3.14
209185_s_at IRS2 3.12
203180_at ALDH1A3 3.03
200921_s_at BTG1 2.82
1555800_at ZNF385B 2.82
1567219_at --- 2.73
230659_at EDEM1 2.72
223201_s_at TMEM164 2.72
213675_at --- 2.69
236088_at NTNG1 2.66
242629_at RAB3B 2.61
235180_at STYX 2.60
244650_at FAM105A 2.55
229327_s_at --- 2.54
1563571_at LOC285463 2.51
219049_at CSGALNACT1 2.46
222455_s_at PARVA 2.46
217890_s_at PARVA 2.43
242752_at --- 2.42
209142_s_at UBE2G1 2.37
212
221865_at C9orf91 2.37
222121_at ARHGEF26 2.34
209130_at SNAP23 2.32
227198_at AFF3 2.30
222450_at PMEPA1 2.28
224661_at PIGY 2.25
227337_at ANKRD37 2.25
235749_at UGGT2 2.23
220302_at MAK 2.23
227787_s_at MED30 2.21
202948_at IL1R1 2.19
231262_at --- 2.18
224999_at EGFR 2.16
227123_at RAB3B 2.15
217014_s_at AZGP1 2.11
1558692_at C1orf85 2.09
1566079_at RPS16P5 2.07
217875_s_at PMEPA1 2.07
216860_s_at GDF11 2.04
225330_at IGF1R 2.04
219572_at CADPS2 2.04
218376_s_at MICAL1 2.02
244397_at --- 2.02
205883_at ZBTB16 2.01
213

Role of Androgen Receptor in Folate Receptor - Regulation and in

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Role of Androgen Receptor in Folate Receptor - Regulation and in

Uploaded by

Copyright:

Available Formats

The University of Toledo

The University of Toledo Digital Repository

Role of androgen receptor in folate receptor α

Follow this and additional works at: http://utdr.utoledo.edu/theses-dissertations

Role of Androgen Receptor in Folate Receptor α Regulation and in Prostate Cancer

Doctor of Philosophy Degree in Biomedical Sciences

The University of Toledo

Role of Androgen Receptor in Folate Receptor α Regulation and in Prostate Cancer

The University of Toledo

process of embryogenesis. Estrogen and progesterone through their receptors regulate

receptor α regulation is unknown.

We show that androgen/androgen receptor increases folate receptor α mRNA and

promoter activation. Co-immunoprecipitation studies show that androgen receptor and

In normal prostate, androgen-bound androgen receptor activates its target genes

by binding to cis androgen response elements. This is the classical mechanism of

promoting effects by tethering to other transcription factors. We identified Elk-1

prostate cancer growth. Chromatin immunoprecipitation studies identified chromosomal

receptor tethering supports prostate cancer growth.

me an opportunity to work in his laboratory and specifically for making decisions

research project. My committee members molded me scientifically and prepared me for

being helpful at times of need. I thank Dr. Shemshedini for agreeing to be on my

Dignam helped me in several ways professionally and encouraged me to shoot beyond

point of view. I thank my friends for their support and suggestions.

Abstract .............................................................................................................................. iii

Chapter 1 Introduction and Literature Review ..............................................................1

FRα – Folate receptor α

C/EBPα – CAAT enhancer binding protein α

CBP- CREB binding protein

CREB – cAMP response element binding

TIF2 – Transcriptional intermediary factor 2

SRF – Serum response factor

TCF – Ternary complex factor

PADI4 – Peptidyl arginine deiminase 4

JNK – c-Jun N-terminal kinase

HDAC – Histone deacetylase

HAT – Histone acetyltransferase

CYP17A1 – Cytochrome P450 17 A1

AKR1C3 – Aldo-keto reductase family 1, member C3

PSA – Prostate specific antigen

ARE - Androgen response elements

Figure 1B – All parts of mRNA expression determination

Figure 2A, B and C - Others

Figure 3A, B and C - Others

Figure 4B – Co-immunoprecipitation completely including optimization for ACH-3P

Figure 4C – Chromatin immunoprecipitation completely including optimization for

Figure 5A and B - Others

Figure 1A – Cloned (Elk12-TATA-Luc. Have contributed indirectly by doing couple of

preliminary experiments in different HeLa cell line.

Figure 1B, C, D – Others

Figure 1E – Cloned ISRE-TATA-Luc and contributed indirectly during screening of

Figure 2A – Have performed all steps in the luciferase assay

Figure 2B – Have performed all steps towards this figure

nucleofection in C4-2 cells, cloning of (Elk1)2-TATA-Luc

Figure 2D – Have performed all steps of mRNA expression determination

Figure 3A- Have performed all parts of co-immunoprecipitation including optimization

for C4-2 cells and on other prostate cancer cell line.

Figure 3B- Provided the basic outline of the figure

until the analysis of the results done

cell culture until the film development

Figure 4A and B - Others

Figure 5A and B - Others

Figure 7A and B - Others

Figure 8A, B and C - Others