David Seastone, Ph.D., D.O.

Biochemistry
 The work horse of the cell. It's
the proteins that makes a
Blue print of life hepatocyte different form a
neuron.

While translation occurs in all phases of

cell cycle, except M phase, replication only
occurs in S phase.
Cell cycle

Example neuron, which are just

hanging out, and doing their
thing. Some cells seldom inter this
phase, e.g. GI cells.

E.g. Insulin-like growth factor,

epidermal growth factor, platelet
derived growth factor, ... etc.
M phase
Blocking thymidylate synthetase,
dUMP to dTMP.
The entire human genome is about
3,000,000,000 divided by 23 homologous
chromosome =~ 100,000,000.
Remember: purines only base-pair with pyrimidines : This deamination doesn't occur
DNA : C-G, A-T normally in the cell. And if
RNA : C-G, A-U occurred, it should be corrected,
because no uracil is found in the
Purines: bigger structure but shorter name! DNA.

CUT

Uracil : RNA

This methylation step is catalyzed

Adenine has amine group
by thymidylate synthetase, the
enzyme that is blocked by 5-FU.
This deamination step is catalyzed by
adenosine deaminase, which is deficient
in the autosomal recessive from of severe
combined immune deficiency syndrome.
Note: the name of the nucleotide is the
same name of the nucleoside plus the
number of phosphate group. E.g. ATP is
adenosine ( the nucleoside )
triphosphate.
When the 2' carbon doesn't has
OH, then it's deoxy.
Nucleoside nomenclature:
Purines : " osine "
Pyrimidines : " idine "
 G-C has the bigger number of hydrogen bonds. G for
grand. This needs higher energy ( melting temperature )
Phosphate group usually to break. The more the DNA molecule contains G-C bonds,
attaches to the 5' carbon of the the higher the energy it requires to break.
sugar These Ps represent phosphate
Phosphodiester bond groups that join these
nucleosides

The 5' end of one of the DNA

At the 3' carbon, OH is attached. So strands, will base pair with the 3'
DNA has polarity that goes from 5' end of the complementary strand.
phosphate to 3' OH.
N.B. we as human, read the DNA/RNA from 5' to 3' ( English language), but
DNA/ RNA polymerases read it from 3' to 5'.
 Chargaff's Rules

Erwin Chargaff (Czernowitz, August 11, 1905 –

New York City, USA, June 20, 2002)

This occurs, e.g. in viruses.

 The form of DNA that is present in
our body is the B form.

More bases per turn, shorter the DNA.

Definitions:

DNA : Two chains of nucleotide ploymer.

Chromatin : DNA plus structural proteins. This chromatin occurs in two form according to the phase
of cell cycle.

Interphase : not well organized structure, some of which is loose and accessible to cell replication/
transcription machinery ( euchromatin ), and some is very tight and dense, and contains no
active genes.
M phase : well organized, known as chromosomes. It composed of two identical ( except if a
mutation have occurred ) DNA strands, one of mam and the other from dad.

Diagram of a duplicated and condensed metaphase eukaryotic chromosome.

(1) Chromatid – one of the two parts of the chromosome after duplication.
(2) Centromere – the point where the two chromatids touch.
(3) Short arm. (4) Long arm.
Sister chromatids Vs homologous chromosome :
Sister chromatids are two identical copies of a chromatid connected by a centromere.
Compare sister chromatids to homologous chromosomes, which are the two different copies
of the same chromosome that diploid organisms (like humans) inherit, one from each
parent. In other words, sister chromatids contain the same genes and same alleles, and
homologous chromosomes contain the same genes but two copies of alleles, each of which
might or might not be the same as each other. A full set of sister chromatids is created
during the S subphase of interphase, when all the DNA in a cell is replicated. Identical
chromatid pairs are separated into two different cells during mitosis, or cellular division.

Genome:
genome is the entirety of an organism's hereditary information. It is encoded either in DNA or,
for many types of virus, in RNA. The genome includes both the genes and the non-coding
sequences of the DNA/RNA.
 Organization of DNA
Chromatin exist in 30nm particle when H1
is present. It's more tight than 10 nm.

It's the general, when present, the

There are 2 copies of each of the H3, H2A, H2B, H4, troops are all aligned in attention!
making this compound an octamer ( oct=8). H1 is present
when the chromatin is arregend in 30 nm particles. These
histones are positively charged so that they could form
ionic bond with the negatively charged phosphate groups,
that lie at the exterior of the DNA.
Note: the cause of histones positivity is the presence of the
2 of the 3 basic, positively charged amino acids; arginine
and lysine. Histidine ( the 3rd) is not present in histones.
So, no actual cutoff point that separate eu from
heterochromatin
Methylation add more positive charges to histones, makes it
more attracted to DNA, thus, the chromatin become more
dense. In contrast, acetylation and phosphorylation add more
negative charges to histone, thus, they rebel the DNA and the
DNA become more loose.
DNA Replication and Repair
 Replication bubbles.

The DNA sequence at the end of the chromosomes are known as telomeres. They
acts as buffers, as the cell ages, the length of these telomeres decrease, as such,
they act as time keepers that tell us how old the cell is. We telomeres reach
certain length, the cell undergo aptosis. The don't encode for any protein.
Telomerase is an ezyme that makes the telomeres ( not breaking it). These are
two types of cells that have telomerase activity: germ cells and tumor cells.
p: short ( petite ) arm, q : long arm, just happen to be the next letter in
the alphabet.
 DNA/RNA synthesis is always complementary and antiparallel.
Note: as G should always pair with C, this is a misspair. This error would be corrected,
because DNA polymerase has proofreading activity.
Replication Transcription

dNTP: deoxynucleotide triphosphate.

Note that, although the required
substance for Nucleic acid synthesis are
dNTP, however, the polymerase would
add only dNMP. The other 2 phosphates
get lost as
This is a misspair, because G should
base-pair with C. This error would not
be corrected, as the enyme RNA
polymeraes has no no proofreading
activity. However, this is not a problem,
because RNA has reletivly short t half.
i.e Read

In fact, RNA polymerase has no " build in

" proofreading, but it is assisted by other
proteins to do this proofreading.
DNA Replication

Moving bidirectionally.
RNA primer
As the replication fork advances, there is tension that is being
build up at the ends of the chromosome, creating supercoils. This
tension has to relived or, otherwise, the DNA either snap back
closing, or breaks. Topoisomerase is an enzymes that releases
this tension by breaking some bond and, after replication, reform
these bonds.
As helicase enzyme separate the two strands from each other, they tend
to recombine. SSB proteins then come to play, they have two functions:
1. Stabilize the DNA in the single strand conformation.
2. Protect it from degradation.
 Etoposite, the anticancer, blocks the human
Topoisomerase 2.
In some autoimmune diseases, there antibodies
made against this enzyme, scleroderma for e.g.
Because DNA is circular.
 DNA Repair

This repair mechanism miss

1 in million error.

Lynch syndrome

Deaminated cytosine = uracil, which

should not be in the DNA, it's an RNA
base.
HNPCC

These are genes the protein product of which

slow down the cell cycle, allowing enough time
for repair. When these are defected, cell
accumulate tumors. Note, if the repair
mechanism failed, P53 has the ability to induce
apoptosis.
Some viruses interfere with P53 and Rb function,
such as hepatitis B and human papilloma virus.
 This means that the number of these microsatellite
is different from cell to cell within the individual.
Normally, they should be the same in every cell.

Microsatellites, also known as Simple Sequence Repeats (SSRs) or short tandem

repeats (STRs), are repeating sequences of 2-6 base pairs of DNA.

Trinucleotide repeat expansions are different from microsatellite expansions.

let me give you an example of mistmatch repair and trinucleotide repeat
expansions. Note the "triplet repeat" differs considerably from the single base
repetitive seqences given here.
trinucleotide repeat expansion
ATTCT(CAGCAGCAGCAGCAG)GGTA ---------->
ATTCT(CAGCAGCAGCAGCAGCAGCAGCAG)GGTA
microsatellite instability in a GC rich region of DNA
GCTGCCTAGCC(GGGGGG)CACGGC ------->
GCTGCCTAGCC(GGGGGGGGGGGGGGG)CACGGC
 Transcription

Only 3-4% of the 3 billion base pair

actually transcribed.

TATA and other boxes are found in the

coding not template strand.
 The most abandand

Small nuclear RNA.

Initial transcript is called heterogeneous nuclear RNA (hnRNA) destined for translation is
called pre-mRNA.

Tetramer

Laboratory, experimentery type of drugs.

Prophylaxis

alpha-Amanitin or α-amanitin is a
cyclic peptide of eight amino acids.
It is possibly the most deadly of all
the amatoxins, toxins found in
several species of the Amanita
genus of mushrooms, one being the
death cap (Amanita phalloides) as
well as the destroying angel, a
complex of similar species,
principally A. virosa and A.
bisporigera. It is also found in the
mushrooms Galerina marginata
and Conocybe filaris. The oral LD50
Any thing that is toward the 5' of the coding
strand.
This is called coding strand because it looks like codons,
except Ts are being replaced by Us.
 Always assume that 5' in the left hand
and 3' in the right hand, unless otherwise
indicated.

Note, although D looks like a correct answer,

however, it should be read from 3' to 5' to be
correct, which is not the right way to read a DNA
sequence by human. We read it from 5' to 3' in
contrast to DNA/ RNA polymerase.
 This stem-loop structure is responsible
for transcription termination

This is sequence of bases where rRNA would bind and

initiate proteins synthesis.

Note: ribosome read the mRNA from 5' to

3', just like human. It synthesizes protein in
the same direction.

More than one gene encoded by one mRNA. The word cistrone is an
old word for gene.
Tc= transcription, Tl = translation. Both occur in the
cytoplasmm because there is no nucleus.
 In contact to prokaryotics

These boxes are part of promoter site ( promoter

elements). They are on the coding ( top ) strand.
Still contains introns

1
3
2

Occur in the nucleus

Occur in the cytoplasm

 RNA maturation
It's the same pre RNA.

Steps of maturation:
1. Removal of introns
2. Caping of the 5' end
3. Addition of polyA tail to 3'
 = during transcription

There are some debate weather splicing occur co- or post-

transcriptionally.

7 methylguanosine cap is unique

because it's connected to the 5'
end of the mRNA by triphosphate.
This cap has to functions:
1.Protects the mRNA ( like football
head hamlet ).
2. Identification of mRNA species.
While the poly A tail has the following
functions:
1. Protection
2. It helps the mRNA to get out of the
nucleus.
Small nuclear RNA plus small nuclear ribonuclear proteins ( snRNPs) from
spliceosome to do the splicing within the nucleus.
Capped-Spliced-Tailed
 In contract to Constitutive splicing

This allows the cell to produce two or mor different

proteins from one single mRNA by putting different
exons together each time.

If one of Ig has a hydrophobic amino acid

in its Fc portion, it would be membrane-
bound. And if it has a hydrophilic one, it
would be secretory.
 Ribosomes All these RNAs are made RNA
polymerase type 1 except this;
Sedimentation Coefficient made by type 3
 tRNA

CCA residue
Clover leaf

Sometimes in tRNA, Ts might be seen.

These enzymes attaches amino group,

via ethyl linkage, to the tRNA.
Also known as Elgato box.
 The Genetic Code
The third base provide much less specificity for coding the amino acid, e.g. look
at leu and Arg, no matter the 3rd base is, the first 2 are enough. This is known
as Wobble hypothesis, and the 3rd position is Wobble position. So, mutation
occured in the 3rd base is less likely to cause deterimental effects.

Gln: glutamine

This CAG sequence is expanded and

repeated in huntington disease.
The genetic code is going to apply to all cell types; eukaryotic,
bacteria, fungi, viruses, etc. except for mitochondria

Complementary and antiparallel

One amino acid could be encoded for by
more than one codon.

The same triplet always specify the same amino acid.

 Mutations

TTG also encodes for Leu, just like TTA, as

In human, the first triplet in the DNA and
such, no change in the protein despite the
corresponding RNA always encodes for
mutation, so, it correctly named silent
methionine.

TCA encodes for Ser, which in not Leu. Furthermore, while

Leu is hydrophilic, Ser is hydrophobic, leading to production
of a protein that has different physical and chemical
properties. Note however, not all missense mutation lead to
production of different protein, because the misplaced
amino acid might have the same properity of the original.
 In frame shift, wrong amino acids would been
UGA is the stop codone " You Go
but, and commonly rRNA would hit a stop
Away". The produced protein is
codon ( here is UGA) with early truncation of
most likely nonfunctional.
the protein.

Note: any multiple of 3, if added or deleted, its not a

frame shift mutation. For example, if 3 bases where
omitted, this would omit only one amino acid, and
down the stream, all other amino acids would be the
same. This is known as an inframe.
 Shshshsh! Don't tell any body, no
change would occur, it's silent.

It might also be an increase of function.

This how evolution have occurred.
Beta thalassemia, Tay sacks, etc.

e.g Alfa thalassemia

CAG:

And unstable and get degraded.

With generations, the disease gets more

severe and occurs at earlier ages.
 Protein Synthesis

There are several of this enzyme (20),

each specified for certain amino acid,
according to the anticodon, the 2nd
This symbol means: the tRNA, which has the anticodon that encodes
of isoleucine, would be carrying the amino acid isoleucine. If there is
a wrong amino acid attached to known anticodon, then there should
be a problem with enzyme aminoacyl tRNA synthetase.
So, it's a dehydration reaction.
Lionel P. Raymon
 Amino Acids ( AA)

Tends to be free in Hydrophobic tends to be in membranes:

aqueous environment, cell membrane, ER, mitochondria, etc.
plasma for example.
 There would be H and C in
With such small side chain, it allows collagen, in the side chain.
which glycine is abundant ( 1/3 of AA), to form
a very tight Alfa helix , allowing very strong
tensile force.
Gly is also an inhibitory neurotransmitter, it's Strictly ketogenic, i.e. in metabolism, the only
release is inhibited by tetanispasmin. thing that could be done by Leu is ketone
It also involved in heme synthesis. bodies.
Val, Leu and Ile have branched chain.
Maple syrup disease is associate with Disrupt alpha helixes.
build up of branched chain AA.

"Pro GAV PIL."

Proline, Glycine, Alanine, Valine, Phenylalanine, Isoleucine, Leucine.
Ring side chain = aromatic
Tyr is a precursor of melanin ( so Tyr causes pigmentation) , DA, NE,
EPI. Since Tyr is a precursor of melanin, tissues the secrete substance
that made of Tyr tend to be colored:
Substantia nigra produces DA from Tyr is a black area.
The locus coeruleus is the principal site for brain synthesis of
norepinephrine (noradrenaline). The locus coeruleus and the areas of
the body affected by the norepinephrine it produces are described
collectively as the locus coeruleus-noradrenergic system or LC-NA
system.[3] Norepinephrine may also be released directly into the
blood from the adrenal medulla.

Tyrosinase is a copper-containing enzyme present in plant

and animal tissues that catalyzes the production of
melanin and other pigments from tyrosine by oxidation, as
in the blackening of a peeled or sliced potato exposed to air.
It is found inside melanosomes. In humans, the tyrosinase
enzyme is encoded by the TYR gene.
A mutation in the tyrosinase gene resulting in impaired
tyrosinase production leads to type I oculocutaneous
albinism, a hereditary disorder that affects one in every
Depigmented substantia nigra, Parkison's
Depigmented
Normal
Iodination of two adjacent Tyr residues in
thyroglobulin would yield, down the road
thyroid hormones.
Trp is :
Precursor of serotonin and
Small source of niacin, and Trp deficiency precipitate niacin
deficiency, as occurs in Hartnup disease.
Precursor of melatonin, which is responsible for circadian
rhythm.
Hartnup disease (also known as "Pellagra-
like dermatosis," and "Hartnup disorder" is
an autosomal recessive metabolic disorder
affecting the absorption of nonpolar
amino acids (particularly tryptophan that
can be, in turn, converted into Serotonin,
Melatonin and Niacin). Niacin is a
precursor to nicotinamide, a necessary
component of NAD+.
Note about hydrophobic AA:
The primary signal to push a protein outside the cytoplasm, so
that it would be placed in membranes, enters the
endoplasmic reticulum to be transported ( targeted ), or
lysosomes, is the N-terminal hydrophobic signal sequance. This
is synthesized when the first few codon of the exon encodes
hydrophobic AAs.
 Hydrophilic AA

Precursor of
histamine

Came from an extra amino group in the side chain

Histones are rich in these AA, giving them positive

charge, allowing them to interact with negatively
charged DNA.
Arg is a precursor of NO, involved in smooth
muscle relaxation.
This negative charge is because of extra carboxyl group
in the side chain.

Asp, Glu are exititory AAs, and serve as

neurotransmitters. Filbamate and ketamine
block Glu receptors.
Each has OH group in the side chain.
These are sites for O-glycosylation,
which is a posttranslational
modification in Goli, that confer more
water solubility and some
immunogenicity for the protein
( putting a sugar in a molecules is going
to identify it as self or nonself ).
And also site for O-phosphorylation,
that is mediated by various kinases
that phosphorylate protein activating
N-acetyl cys
Cys and met have sulfur in the side chain.
Cys has SH group which is important in
making disulfide bonds, that changes the
shape of proteins putting them in the a
propitiate shape for function, e.g. the
disulfide bond of insulin. Disulfide bond,
S-S, always require t wo Cys.
Cys is used as part of glutathione, GSH,
which is used to detoxify free radicals.
When there is a degenerative disorders
associated with free radicles, we use N-
acetyl cysteine, an analogue of Cys.
N-acetyl Cys is also used in cystic fibrosis
to facilitate expectoration and to treat
hemorrhagic cystitis ( Mesna is used to
prevent ).

Met contains methyl group,
thus, met is used as methyl
donor. S-adenosyl methionine
(ademetionine, SAM, SAMe,
SAM-e) is a common
cosubstrate involved in methyl
group transfers. It contains
Met. This Met is used to
methylate very important
things, e.g. methyl guanine cap
of mRNAs at the 5' end. Other
example is when epinephrine is
made out of norepinephrine.
Asn & Gln contains amine group at
their side chain ( but unlike Lys
and Arg, they do not have any
charges). Asn & Gln are spots for
N-glycosylation, a
posttranslational modification,
that tends to occur in ER, and it
requires dolico phosphate, which is
an intermediate of chloesterol.
So, in proteins, sugar could be put on
oxygen of Ser or Thr, or, nitrogens of Asn
or Gln.
 Glu (-) Val ( no charge )

HbS contains less Glu, which is a

negatively charged AA. Thus, it
tends to migrate more toward the
negative charge, more HbA.

HbC In HbC, Glu (-) at 6 got replaced lys ( + ).

 Proteins Turn Over

E.g. In cystic fibrosis, the chloride channels are misfolded

( become abnormal ), thus, it's ubiquiated and destroyed
leading to appearance of symptoms of cystic fibrosis.
 Period of growth, when we make
protein more than we brake them. As
nitrogen is needed for amino group
of amino acid, nitrogen balance is
used to speak about protein balance.
Mnemonic for essential amino acids:
"These Ten Valuable Amino Acids Have Long Preser ved Life In Man."
These ....... Tryptophan
Ten ......... Threonine
Valuable .... Valine
Amino Acids . Arginine
Have ........ Histidine
Long ........ Lysine
Preser ved ... Phenylalanine
Life ........ Leucine
In .......... Isoleucine
Man ......... Methionine
 Insulin is a major anabolic hormone

Proteins are broken to give energy to immune cells

that are fighting infection. Also, infection causes tissue
damage, and tissue repair utilizes nitrogen.
 Biochemical Reactions

This tells us whether the reaction is going to

happen or not.
Delta G is explained graphically in the next
page

Speed of the reaction

Delta G = delta P - delta S, this will give us a negative value. As this reaction is going
down the hell, this tells us that thus reaction will happen spontaneously, but this
would not tell us how fast it would happen.
Note: time is needed because first we need to but some more energy ( delta G plus
plus )before the reaction occur. Enzymes decrease the amount of this energy.

Energy for
Gs: energy activation
of the
substrate

Gp: energy
of the
product
 Michaelis-Menten Plot
Km tells us about the affinity bet ween the enzyme and the substrate, if the
Km is large, that means we need a lot of S to get the enzyme to work ( low
affinity ), and vice versa. Since affinity depends on the binding of the enzyme
to substrate, and the binding depends on the shape of the enzyme, any change
in shape will change the Km.
So, while Vmax depends on the # of the enzymes, Km depends on the shape of
these enzymes,

Depends on the # of enzymes

Km is the substrate
concentration that gives
half of the Vmax

As this graph depicts, the more substance you put in the system, the more
products you will make. But there are physiological limits, enzymes
number for example. This limits ( when enzymes are saturated ) is called
Vmax.
Lineweaver-Burk Plot
 E.g ACEi, COXi, HbA which
is having less affinity to
O2, and shift the curve to
the right

With competitive inhibition, the amount of the S

that is needed to reach Km has to be increased.
This does not affect Vmax ( enzyme's #).
 Competitive inhibitor will increase the Km
form -1/Km to -0.5/Km. It shifts the curve to
the right but crosses the Y axis at the same
spot ( no change in Vmax).

Noncompetitive inhibition will decrease the Vmax

but will not affect Km. The shifts the curve to the
right but crosses the Y axis higher.
Note: in the Y axis, as we go up, the Vmax decreases ( because the line does not
represent Vmax, but rather, it represents 1/Vmax ( i.e. Vmax reciprocal ). And the X
represents the Km, which is increasing as we go toward zero ( represented on the
negative part of the X axis ).
In noncompetitive inhibition,
the drug ( the new substance )
made a covalent bond with the
enzymes, that is irreversible
bond, as such, that enzymes
will be taken out of the
equation. As such the total #
of enzyme decrease, affecting
Vmax, not Km.
In allosteric noncompetitive
inhibition, the inhibitor does
not bind at the same site in
the enzyme that the substrate
binds to, rather, it binds to
another site called allosteric
site.
Vmax depends on the
number of working
enzymes, Km depends
on the shape ( affinity )
of the working
enzymes.
 Induction

Vmax
Activation
Noncompetitive inhibition

1/2 Vmax
Inhibition shifts Michaelis-Menten Plot
down ( noncompetitive ) or to the right
Competitive
( competitive ).

Km
An increase in the # of enzymes, as in
induction of gene expression, will increase
the Vmax, increasing the hight of the
curve.
And if there is an increase in the affinity
of the enzymes ( activation ), this will
decrease the Km, shifting it to the left.
 Noncompetitive inhi.
Competitive inhi.

Off
Control
On

Activation

Induction

Noncompetitive inhibitor: decreases the Vmax but does not affect the Km.
Competitive inhibitor: increases the Km but does not affect the Vmax
Activation: increase the affinity ( i.e. decreases the Km ) but does not affect the Vmax.
Induction ( of the gene to produce more of the enzyme ): this will increase the Vmax ( the
rapidity in which the reaction is done ) but does not affect the affinity ( Km ).
 Cooperative Enzymes Kinetics
The rate-limiting Enzymes

This refers to the fact that, some enzymatic reactions start slowly and
hardly, but as the reaction goes on, it's steeper and steeper going easier
and easier.
Now, Fomepizole is the DOC. It's a dehydrogenase inhibitor
and does not have the toxicity of ethanol.
Signal Transduction
Endocrine hormone : the blood borne
 Could get into the cell

Could be floating in the plasma, but

could not get inside cells.

Part of spacer DNA.

Ion channels, transcription factors,

other receptors, ...etc.
Changes of phosphorylation, that
require minutes
 Water-Soluble Hormones

Tyrosine kinase is associated with growth. Example, in CML,

the translocation (q: 22) that leading a protein known as
bcr.abl which is a tyrosine kinase, mediating the abnormal
growth of these lymphocytes. Imatinib is anticancer used to
block this tyrosine kinase.
 Rate limiting

N.B. the phsophorylation occurs at Serine and Therionine residues.

 In step 1, a GDP is replaced by GTP, activating
that G protein. This process is mediated by the
hormone binding to the receptor.

They are 3: Alfa, beta, gamma. Called G proteins because of GTP

Binding

Binding of GTP will be the

signal that splits the G
proteins into Alfa GTP
complex and beta gamma
complex.

Alfa subunit has a GTPase activity,
that breaks GTP into GDP and energy,
the energy it to activate an enzyme.
Once GDP/Alfa complex bind to beta/gamma, they
are inactive and the cycle repeats itself.
Alfa/GTP complex binds to the target
enzyme, GTP is burned and the
enzyme is either activated or
inactivated depending on the type of
Gp, either Stimulatory or Inhibitory.
 Gproteins-Coupled Receptors
cAMP/PIP3 pathways
This is the 2nd massinger, the
first being the hormone.
7 transmembrane domains

Gs

( Thr, Ser )

Gq coupled receptors always increase

Ca, leading to smooth muscle
CRE: cAMP response element. contraction.
 cGMP mediated responses
The receptor itself has
guanylate Cyclase
Found in vascular endothelium. NO is a gas, and
activity.
gases are lipid-soluble, so it easily crosses to
interior of the cell.

Receptor but no G proteins No receptor, no G priteins

Smooth muscle

Heme-containing

Afferent arterioles of the kidney,

increasing RBF and GFR, leading Na and
water loss. As if it's an endogenous
diuretic.
 Insulin/Growth Factors Pathways
2 transmembrane domaines. What insulin does is bringing these t wo domains
together ( dimerization ), turning them ON (1). The receptor first
autophosohrylate itself (2)at Tyrosine residues ( not Thr or Ser ) via the enzyme
tyrosine kinase. Then, insulin receptor substrate ( IRS ) binds to the receptor and
get phosphorylated at the same amino acid ( Tyr) (3). Now, SH2 domain proteins
( and they are many ) dock into the receptor and get phosphorylated (4),
mediating insulin receptor, via activating protein phosphotases and genes.

ras is a G protein which is critical protein that

mediate growth. Point mutation involve the This is the way that insulin
gene responsible for this protein is associated drives glucose into these tissues.
with malignancy. Most human cancer are
associated with this.
 Pertussis toxin inhibits the inhibitory Gia, thus, activates G protein the
same way as cholera and E. coli. While activation of CFTR occurs in the
intestine in case of coli and cholera,putting out Cl, Na and water, in
case of pertussis, this occur in the lung.

# 1 in incidence and # 2 in killing

# 2 in incidence and # 1 in killing
When mutated, the ras protein is always
bound to GTP, i.e. always active, thus, # 3 in incidence and killing,
increasing proliferation of that tissue, i.e.
neoplasia.
Vitamins
 So, biotin deficiency would leads to
fasting hypoglycemia.

All carboxylases require A,B,C to do their jobs: A= ATP, B= biotin, C= CO2.

VOMIT pathway!

Consumption of raw egg is the most

common cause of biotin deficincy.
 Glucose
PDH
Pyruvate AcetylcoA TCA Energy
B1
So, thiamine is tightly associated
So, its the tissues that utilize glucose as exclusive source of with energy production.
energy, e.g. CNS, that suffer the most from B1 deficiency.

Invention of something to justify something else that the Also, alcohol dehydrogenate
patient believes its true although its not. Its a problem of consume B1.
memory due to the fact that B1 deficiency destroys the
mamillory bodies, which form a part of PAPEZ circuit that
links hypo campus to mam. Bodies to thalamus to Dilated cardiomyopathy.
cortical areas.
PAPEZ circuit
 Every single
dehydrogenase except that
would work with FAD.

Comes from diet. Deficiency might

occur in malnutrition, e.g. Tea and
toast diet.

In hartnup disease, there is a genetic defect results in inability of the kidney to

retain tryptophan. This results in mild form of pellagra.
 TS
U T DNA/RNA

Folic acid CH3

Three types of vitamins help

lower homocystine: B6, B12,
Folic acid.
 B12
( N5-methyl THF )
Storage folic acid Free ( active ) folic acid

Releases folic acid from its inactive storage form. As

such, deficiency of this enzyme leads to megaloplastic
anemia.

( N5-methyl THF )

Pancreatic proteases are

required to separate B12 from
is binding factor.

This enzymes is involved in the VOMIT pathway and its deficiency would lead to
accumulation of these amino acids. Also, methylmalonylCoA mutase is a source of
succinylCoA which is required for TCA. As such, vitamin B12 deficiency is associated
with ATP ( energy ) loss, leading to some of its clinical features ( e.g. peripheral
neuropathy, classical example is subacute combined degeneration of the cord. This
also occur in HIV and Friedreich's ataxia.
As pyridoxal phosphate, B6 is used by every single transaminases. These enzymes are
responsible for ammonia detoxification. Ammonia as a strong base can dissolve lipids of
membranes and causes terrible damage through through out the body. As such liver
damage is associated with big increase in ALT and AST in an attempt to detoxify
ammonia, consuming B6. So, everything that is associated with chronic elevation of AST
and ALT would results in B6 consumption and deficiency.

Alcohol

Due to hyperammonemia

With low heme, Hb would not be made ( small

RBCs) and iron would not be used ( siderplast ).
Deficiency is usually nutritional, e.g. parantral Nutrition.

Most
Succinate DH,
important
in TCA.
are 3

FattyacylCoA DH,
ATP in beta oxidation
production
Glycerol phosphate DH, used in several
pathways to bring the electron from the
cytoplasm to mitochondria.
 Hydroxylation of Pro and Lys amino acid in collagen to
allow them to cross react with each other, making
stable polymer of collagen.

DA NE

H+/vit C
Diet Fe3+. Fe2+ ( absorbable ) Heme containing proteins
Stomach

No antioxidant property or immunity role in fighting cold for Vit C!

Required to make
coenzyme A, a
prerequisite for
acetylCoA.
Ca and phosphate homostasist
 Ca PTH production

Kidney ( retaining Ca to Bone ( PTH receptors are on osteoblast not

expanse of phosphate ) clast!. Blast then tell clast to resorb bones )
Note: vit D acts on clasts and increase
bone resorption.

Gut ( increasing Ca
1 alpha hydroxylase reabsorption ), acting
of the kidney on steroid ( zinc type )
receptor.

Vit D 25-OH Vit D 1,25-OH

Kidney ( retaining Ca and phosphate )

So, the vitamin and the hormone work hand in hand in Ca, but
when it comes phosphate, the hormone lowers it ( p lower p )
and the vitamin rises it.
 Associated with growth

Vision

Vit A comes from diet, and is stored in the liver in stellate ( Ito ) cells.

These are the cells that behave as fibroblats,

lying down collagen and result in cirrhosis.
 Metaplasia, e.g. In the lung increasing
incidence if infections

Bitot spot

Vit A derivatives are used as drugs ( e.g. Isotretioin )to treat acne. Because they could
increase tissues growth and differentiation. As such, when taken in lipid soluble formulation,
the could cross placenta, and cause tremendous anomalies that involves craniofascial issues,
liver, bones.
In the translocation ( 15;17), which will translocates a vitamin A receptor in promyelocytes
that is associated AML M3 ( promyelocytic leukemia ). So, as vit A causes tissue growth and
differentiation, this leukemia is treated with high dose of vit A, which will help these
promyelocytes to maturate into myelocytes to metamyelocyte to band and finally to become
PMNs. The cells from metamyelocytes are incapable for division, as such, vit A takes these
malignant cells, push them to become end cells.
 Rhodopsin receptor, which senses light ( photons ). Like all receptors, when its excessively
stimulated ( e,g. at day time ), it becomes desensitized, so, this pathway is not required at day
time. Retinal is found in this receptor. Stimulation of this receptor will change the retinal from
trans form to cis form. This will activate a G protein known as Gt ( transducin ). This G protein
works on an enzyme known as cGMP phisphodiesterase, that inactivates cGMP to GMP. cGMP is
required to keep open Na channels, keeping the cell depolarized, and keeping on releasing
glutamate, decreasing vision.

Glutamate
Light hyperpolarizes rods.

Optic nerve
GABA

So, when rod cells are stimulated, they produce glutamate, which in turn,
stimulates the bipolar cells to produce GABA, which is inhibitory to optic
nerve, i.e. rods stimuated, I can't see. Vitamin A prevents glutamate release,
permitting vision especially at night.
 Retinol or retinoic acid can improve keritinization of tissues, hence, Vit A derivatives are
actually used to treat acne.
If these derivative can cause growth and differentiation, if taken systemically in pregnant
lady, they could cross the placenta causing nasty anomalies. As such, systemic vitA derivative
( e.g. Isotretinoin ) are contraindicated in pregnancy.

In AML M3, the translocation t(15:17) translocate vitA receptor on promyelocytes. As such,
high dose VitA in such a patient, will force the promyelocytes to mature ( from promyelocytes
to myelocyte, to metamyelocyte to band and then to PMN ).
The cells from metamyelocyte downward could not divide, as such, vit A decrease the tumor
cell mass.
This black dot here is glutamic acid, which already
contains carboxyl group ( coo-).
What vitK does is to put another carboxyl group on this
glutamic acid, making the protein ( e.g. Prothrombin )
with two carboxyl groups, i.e. two negative charges, to
which Ca would bind.
 Defective collagen, which will interfere
Drugs, such as cholestyramine with the platelet adhesion.
Pancreatic diseases, e.g cystic fibrosis
Dietary deficiency, e.g. No lipoprotein
made to aid for fat absorption such as B48.
 Linked to Selenium. Their absorption is at the same site

It also thought to prevent oxidation of

LDL, preventing them from releasing the
cholesterol content and fatty streak
formation. Weather or not vitE could help
people with atherosclerosis, the data
inconclusive.
ancanthosus = thorn.
Damages dorsal column, dorsal
root ganglia, and spinocerebellar
tract. As such, it presents with
ataxia and peripheral
neuropathy.
We need to answer these two questions:
1. Where does come from?, is it from burning CHO, lipids, proteins?
2. Once ATP is high, what do you do with than energy?
 In starvation

Glycolysis
Beta oxidation
PDH
ATP
Substrate-level phosphorylation
( without O2)

Dehydrogenases

CHO are considered the major

source of energy on postprandial This CO2 is directly
period. proportional to
Oxygen is the final electron acceptor. metabolic rate.
As such, it keeps electron flowing. O2
shortage ( ischemia ) is the most
common cause of cell energy.
In between meals. Require
presence of counter
CHO, proteins = 4 kcal regulatory response.
Fats = 9 kcal
Alcohol = 7 kcal ( only metabolized in the liver ).

So energy comes form :

Food. AcetylCoA. TCA. ATP
 Well-fed state
Insulin world of metabolism

LPL

RBCs don't use O2 to

When energy is already high in the tissues, glucose will be shunt to
produce energy, their role is
storage pathways ( glycogen synthesis ). While the liver store glycogen
to bring it to others tissues.
to give to other organs in between meals, muscle store it for its own use.
The excess of acetylCoA will be used to produce FAs. Unlike glycogen,
the liver is not going to store these FAs, otherwise, fatty liver would
result.

See, every tissue uses glucose to produce energy, except the heart, which, right after
embryonic period, shift to use fatty acids, even the well-fed state simply because glucose
does produce enough energy for the heart.
 Glut-4

Glucose is needed to store fats.

This transporter is insulin
dependent, as such, diabetics
tend to have high plasma
lipids.
 Glucagon world of metabolism

In between meals
The enzyme PDH is
irreversible, as such,
acetylcoA could not be
reverted to pyruvate.

HSL

Hormone sensitive lipase ( HSL ) senses the low level of
insulin ( not the high level of glucose ), and start to cleave
fats to FAs and glycerol. FAs will be carried by proteins to
tissues as a source of energy ( including adipose tissue
itself ), and the water-soluble glycerol will be recycled by
the liver.
Note: the glucose that is supplied to
tissues in between meals, comes from
glycogenolysis, and in fasting states
form gluconeogensis. The liver must be
in high energy state to run these two
processes ( from burning FAs ).

Muscle ( especially heart muscle ) and kidneys love to use ketones.

Hepatorenal syndrome occurs, in part, due to decreased ketones from
failing liver. Ketones are pathologic only when they are too much.

See, every tissue could use FAs to produce energy except RBCs and the
brain ( FAs could not cross the BBB because they are protein-bound ).
So, as an answer to the second question of what do I do with energy? We would say, this
depends on what are we in, is it insulin or glucagon world.
If we are in insulin world ( well-fed ), then I would make glycogen and fats ( the energy is
derived from glucose ).
In glucagon world, in which the energy is derived from burning fats, I will do three things :
Make ketones,
Gluconeogensis
Glycogenolysis
Sam Turco, Ph.D.
 The height of the peaks
depends on the amount of
CHO in the meal.

90 mg/dl

Irrespective to amount of CHO in

the meal, blood glucose should
come to normal after about 90
minutes. In diabetic patients, this
occur slower. So, insulin does not
affect the peak ( Y axis ), it
affects the duration ( X axis ).

One of SH2 proteins that are
phosphorylated by insulin. It opens the
vesicles that contain Glut4. As such,
insulin increase the number of glucose
transporters ( i.e. it increases Vmax ).
Glut-2
The gene responsible for LDL production
is induced by insulin. This is because,
when there is high glucose, the liver
produces high amounts of VLDL which
has to be shipped to the adipose tissue,
at which LPL should ready and waiting.
 Glu. conc.

Glut-2 entry
Note:
Only glut-4 is insulin-dependent, as such, only
adipose tissue and resting skeletal muscles are 15 mmol
insulin-dependent tissues.
5 mmol

Starting from plasma glucose that is

higher than the normal ( e.g. 15
mmol ), the entry of glucose to liver
and bata cells is proportional to
Plasma glucose.
 HbA1c : Peace of info, not related to this topic

This the aldehyde group of glucose.

The first carbon react nonenzymatically
with NH2 group of lysine in the periphery
Amino group of lysine in Hb. of Hb.
 Glycolysis
10 steps and enzymes, only 3 are important because these are regulatory points.

This is the most

important step in
glycolysis.

Isomerase

Hexokinase is present in every living cells. Glucokinase is only in the

liver and pancreas and it's hormonally regulated by insulin, which
turn the enzyme on at the genetic level ( in diabetics, glucose could
not be trapped in the liver, as such, it stays for prolonged periods in
the circulation ). There is no pathology or pharmacology points
associated with these enzymes, yet, this step is very important because
it's highly regulated.
Note:
Glucose is phosphorylated right when it enters
the cell to prevent it from exciting the cell ( i.e.
to trap it intracellularly ).
This is the only oxidation step in glycolysis.

Also, since alcoholics have higher conc. of NADH, this reaction will go in the reverse direction
producing more of glycerol-3-P that forms the backbone of TG predisposing these alcoholics to
fatty liver changes ( VLDL ).
Also note, since the TG backbone comes from glycolysis pathway, restriction of CHO in diet
will reduce TG in the body. Restriction of fat in the diet would not.
 Has twice the
energy of ATP.

( 2,3 BPG )
Occur in G6PD

Although this enzyme is regulated, but it's

PK deficiency = no enough ATP for the regulation is not important. The importance of
RBCs = pump failure = fluid rush = this enzyme lies in the fact that it's associated
swelling of the cell and rupture. with pathology ( the 2nd most common cause
of hemolytic anemia, # 1 G6PD ).

People with PK deficiency tend

to have met-hemoglobinemia.
Due to backup of substrate upstream
from the site of the deficiency,
glycolysis will be shunted toward BPG
formation.
This is same previous picture, with more talk about control this time ...

After meal, when the ATP is high in the

liver cell, the enzyme PFK-1 will inhibited.
At the same time, PFK-2 kicks in,
producing the molecule fructose2,6-P,
which will active PFK-1, overriding the
inhibition that is done by high ATP and
citrate, permitting glycolysis to continue to
make CHO into FAs.
 O2-Hb dissociation curve

In the lung, the high oxygen tension forces the

oxygen through the bilayer membrane of the RBCs. Once the fetal Hb grab on O2 in the
Within RBCs, the O2 binds to Hb. As the RBCs get placenta, and despite the placenta is
out of the lung to the tissues, where the O2 tension an area of low O2 tension, despite this,
is low, the RBCs should release their O2 to fetal Hb never loose it O2 because it
oxygenate the tissue. But, as shown by the top has no 2,3-BPG.
carve, this is done with difficulty without the
presence of 2,3-BPG. As such, 2,3-BPG facilitate the
dissociation between O2 and Hb, i.e. the decrease
the affinity if Hb to O2.
 Galactose

Lactose intolerance, # 1 genetic disorder of human kind.

Milk
Osmotic diarrhea
Bacteria ferment lactose

This is polyol, which is any sugar that contains OH

Due to deficiency in one of two
enzyme mentioned in the next page.
group at any Carbon. Galactitol could not exit the cell
and it's osmotically active molecule. In diabetic,
some the high glucose in the lens will be acted upon
by the same enzyme to produce sorbitol ( glucitol ),
which has the effects as galactitol. Normally this
produced to keep viscosity of the lens, but in
diabetics, it would be very high to an extend of
causing cataract. Sorbitol dehydrogenase converts
sorbitol to fructose. This enzyme is present in large
quantities in seminal fluid and small quantities in all
cells.
 Trapped in the cell

This acts as galactose donor to any thing that

UDP-Glc acts as glucose donor needs it, e.g. Galactose cerberoside,
to any thing that needs glucose, glycoproteins such as that in blood groups.
e.g. Glycogen, glucose
cerberoside.

Galactosemia results from either galactokinase or Gal 1-P uridyl transferase. The hallmark of
it is cataract. The latter enzyme deficiency is more severe, because the galactose-P is trapped
in the cell. But if galactokinase is deficient, galactose is free to exit the cell.
 More severe

Noticed months after birth

when solids are added to diet.

Aldolase A is a low yield

enzyme located in the
glycolysis pathway.
There are 3 important TLCFN-requiring enzyme .

Alcohol inhibits thiamine absorption. Also alcohol beverages contains

low level of alcohol. This way thiamine should be co-administered with
glucose in alcoholic. Otherwise, pyruvate build up in the mitochondria,
then it spells out to cytoplasm at which lactate dehydrogenase will
convert pyruvate into lactate, hence, lactic acidosis which is deadly. So,
glucose without thiamine in alcoholic is dangerous.
 Krebs cycle, the most important pathway for life!
Sir Hans Adolf Krebs
(25 August 1900 – The two highlighted enzymes are
22 November 1981). the most important for the board.

There are 3 enzymes that require TLCFN as

In addition to this, there are 3 substrate
level phosphorylation in our body. The
other two located in the glycolysis. These
are :
Phosphoglycerate kinase
Pyruvate kinase.
As such, substrates that could be uses to
directly generate ATP are the substrate of
these three enzymes.
cofactors. So far, we have studied two of these:
PDH and alpha ketoglutarate dehydrogenase. The
3rd is yet to come. Note: all of these enzymes
either acetylcoA or succinylCoA. Note also, there is
path or pharm point associated with these two,
but the 3rd is associated with maple syrup urine
disease.
 3
3
3
2

This is the very same complex 2 of ETC. 3+3+1+2+3 = 12 ATP

Remember, in the liver, insulin turns on

PFK-2, which overrides the inhibition of
citrate and keeps glycolysis going, to end
up not by producing ATP but to produce FAs.
 Oxidative phosphorylation
( ETC )
NADH contains high energy electrons and
by the time it reaches O2, these electrons
become of low energy.
Diet
Electron flowing from substance to
another, heading toward O2.
DH DH
DH: dehydrogenase
This energy is captures to produces ATPs. The amount of
energy per one ATP is 8.5 kcal. Since one NADH ( 56
kcal ) produce three ATPs ( 8.5*3 = 25.5 ), so, roughly
speaking, about 50% of the energy in NADH is captured
to produce ATP. The electrons in FADH contain lesser
energy.
Note also, about 80% of energy in the gas is lost in cars!
O2 sucking up electron
DH O2
Note: in glycolysis, when their is no O2, the "electron sucker" would be lactate.

Electron
Lactate
Lactate dehydrogenase
Lactate
Pyruvate NAD

NADH
Beginning of glycolysis

This process keep going maintaing

glycolysis running for a while, waiting for
O2.
 As shown in the figure, high energy electrons could be given to CoQ either from
NADH or via what is known as "bypass" reactions ( because they bypass complex
one ) , which are shown here: from glycolysis, Kerbs and beta oxidation.
Minor pathway, of low
Major enzyme in beta oxidation. So many importance for the board.
pathologies are associated with it, e.g. 10% of
sudden infant death syndrome is associated
with this enzyme.
 Toxic macrolide

The component of these complexes ( from 1 to 4 ) is of low importance with one exception, and this is
the fact that one of the cytochromes in complex 4 is iron containing. This iron exist in plus 3 state and
when complex 4 receives the electron from cytochrome C, this iron goes into plus 2 state. After that,
when the electron flows to O2, the iron return to plus 3 state and so on ( the valency of iron is
reciprocating, from plus 3 to plus 2 to plus 3 again ) . Cyanide kills by binding to iron in the plus 3 state,
keeping it as such, thus preventing the electron from binding to iron, stopping it's flow. Nitrate is an
oxidizing agent, converts the iron in Hb to plus 3 state, creating additional iron for cyanide to bind to. As
such, less cyanide will bind to plus 3 iron in complex 4. After 120 days, the RBCs will die and ferric
cyanide will be passed through the urine. Thiosulfate will chemically convert cyanate to thiocyanate,
which is less toxic. CO bind to this iron in its plus 2 state ( in addition to the fact that CO also bind to iron
plus 2 in Hb )

As the electron flowing from complex to another, their energy is decreasing as they generate free energy. This
energy is used to pump protons from the mitochondrial matrix to the outer membrane, generating gradient. As
in any gradient, these protons "wish" if they could return back. They only way they could do so is by passing
through a channel known as F0-F1 channel. ATP synthase is enzyme that reside in that channel, and it uses the
energy in the passing protons to make ATPs.
Oligomycin inhibits the passage of proton
via this channel, as such, their level builds
up in the outer membrane, dropping the
PH, leading to denaturation of enzymes
that works in this area.
 This bleb is known in histology
as elementary body. This where
the ATPs are made.
Most present in the brown fat in the
neck of newborn and hypernatant
animal ( DNP works all over the
body ).
2,4-DNP is a base that could pickup protons. After
that, it could easily cross the mitochondrial
membrane, giving those protons off in the matrix,
dissipating proton gradient. As such, instead of the
fact that electrons are still flowing, but no new ATPs
are being made ( i.e. there is uncoupling between
oxidation and phosphyraltion ). This substance was
though as potential anti-obesity agent ( because
calories are dissipated as heat ). The side effect of
hyperthermia leading to refuting of this idea.
 Glycogen metabolism
Glycogen only exist in the liver and muscles. While the liver store glycogen only to give it the
other tissue in form of glucose in between meals, muscle store glycogen for their own use.

Glycogen
Glycogen
breakdown
syntheis

There are two important phosphorylases for

The fate of this molecule depends on its the board: this is one if them, and is other is
location. In the liver, the phosphate is purine nucleoside phosphorylase in purine
removed by the phosphatase enzyme, and metabolism.
the remaining glucose is released into
circulation. In the muscles however, this
molecules is used to generate energy.
Free glucose would be too
osmotic driving the water inside
the cell.
Two reasons:
1. Branched glycogen is more water soluble ( linear
glycogen is known as starch ).
2. Branched glycogen provide a lot of terminal
glucose ( 8-10%). These terminal glucose are target
for phosphorylases to act upon releasing glucose
more fast. Linear glycogen has only two terminal
glucose.
 Glycogen storage diseases: 6 diseases

In response to hypoglycemia as in diabetics.

 Milder form of Von Geirk's
because it does not affects
A:B, C:D gluconeogesis.

Unlike other glycogen storage diseases, the structure of glycogen is abnormal

in these two diseases.
In Von Gierke disease, the glucose from glycogen
breakdown and that is generated via gluconeogensis
could not exit the liver leading to severe. In Hers
however, we only have a problem with glycogen
glucose. Both patients have hepatomegally .

Very Poor Childern Are Malnourished and Hungry.

Gluconeogenesis
 The height energy
compound in the cell

Pyruvate could not be reversed directly to There are three sources of carbon that the
PEP. So, it must first enter the liver uses to make glucose:
mitochondria to be converted into OAA 1. Lactate or pyruvate
which is then shuttled out and converted 2. alanine. This is most important source.
into PEP. Note; of the 20 AAs, 18 are glucogenic ( of
these, some are also ketogenic ). Lysine
This is the first of three critical enzymes in and lucine are just ketogenic.
metabolism that are ABC carboxylases ( i.e. 3. Glycerol.
requiring A: ATP, B: biotin, C: CO2 ).
Obligate activator means that the this activator must
be present to turn on the enzyme. This is not the
case in allosteric activator in which the enzyme
could work without the presence of the activator, but
it's working is alt better in the presence of it. The
other example of obligate activator is in urea cycle.
Obviously, gluconeogenesis is
energy requiring process.
This energy is from FAs.

So, in carnitine deficiency, where no beta

oxidation occurs, there would be hypoglycemia.
 This is same to figure of gluconeogenesis
The exact target of it is not known.

As this enzyme antagonizes the action of

the enzyme PFK-1, the same molecules
While the FAs of the lipids are
that activate one of them inactivate the
used to generate energy to fuel
other and vice versa.
gluconeogenesis, their glycerol is
used as a source of carbon for
that newly produced glucose.

So, beta oxidation pathway is used to run gluconeogenesis. As such, when this pathway is not
working, as in the disease of MCAT deficiency, one would expect to see severe hypoglycemia.
 Cori cycle

Carl Ferdinand Cori

This is called
alanine cycle

Lactic acidosis in the muscle and blood

would cause the person to feel fatigued.
Alanine cycle: in the muscle, amino group is added to pyruvate to make the AA alanine. Alanine is
dumped into the blood ( does not change PH ), picked up the liver, which take the amino group off
to make urea and the remaining pyruvate is then used to make pyruvate.

Despite the fact that Cori cycle does change the PH and alanine cycle does not, the body still
prefer Cori cycle because Cori cycle keeps glycolysis running.
 Alcohol Metabolism

Hangover effect
ETC

By inhibiting this enzyme, this drug puts

After exercise, NAD is used to convert lactic
acid into pyruvate, decreasing acidosis. When
person drinks alcohol after exercise, this NAD
is diverted to alcohol metabolism, and the
lactic acid accumulate in the liver which is
then spills it into circulation, and the person
might die of lactic acidosis.
the alcoholic purposely in " hangover"
effect ( headache, nausea, etc.) . As such,
is forces the alcoholic psychologically to
quit ( because who want to be nauseating
and having headache all the time ?).
 The hexose monophosphate shunt
The PPP!

Not NAD!

So the functions of HMP:

1. To make ribose for nucleotides of DNA and RNA.
2. To make a reducing power in the form of NAPDH. This function of this molecule
depends on the cell.
This molecule once generated could also enter another complicated pathway that
is not important for the board with one exception; the enzyme transketolase
which needs thiamine pyrophosphate to generate sugars that are used for proper
brain functions. So this enzyme must work for proper brain function.
Other enzymes that require thiamine pyrophosphate are shown in the next
page...
 Deficient in marple syrup urine disease.

W-K is a genetic defect, in which point mutation in the gene responsible for
transketolase results in decreased affinity for thiamine-P-P. As such, the brain
does work as it should ( because this enzyme require thiamine-P-P to produce
sugars that are needed for brain function ). Symptoms include ataxia, psychosis,
opthamloplegia, etc. So, these patients are treated by giving them extra
thiamine in an attempt to improve the affinity between it and the enzyme.

Dietary deficiency of thiamine is called beri-beri. In this disease, in addition to

transketolase, the other 3, TLCFN-requiring enzyme are also be affected ( the T is
for thiamine ). So, W-K is just a part of beri-beri. Because alcohol inhibits
thiamine absorption, and it's has a low level of thiamine, alcoholic tends to
develop Beri-Beri.
 Pathological conditions: G6PDH deficiency and CGD

Three major features of G6PDH deficiency:

1. Immunodeficiency ( this is the only feature that present also in CGD ), the other two are not.
2. Hemolytic anemia ( G6PDH is the commonest cause of hemolytic anemia ).
3. Heinz bodies.
 Glycolysis

In met-hemoglobinemia, there is deficiency in this enzyme, as such, met-Hb in these

patients might reach up to 30% and looks blue because of anoxia. These patients are
treated by methylene blue which chemically gives electron back to met-Hb ( Fe+++)
converting it back to ( Fe++).

Glutathione is a tripeptide, with middle AA being cysteine, that contains sulfhydral group
( SH ). This group is electron donor ( reductant ), that gives electron to H2O2 to form
harmless H2O2. This step is mediated by glutathione which require selenium ( Se), and
this is way Se is considered as antioxidant. Note: Se is extremely toxic, so it should not be
supplement ( the hallmark of Se toxicity is garlicky breath ).
In G6PDH deficiency, every thing is going down,
and H2O2 accumulates, giving rise to Heinz bodies
and hemolytic anemia ( in addition to
immunodeficiency that occur as a results of this
pathway being defected in neutrophils ).

This is to explain Heinz bodies. In the periphery of Hb, there are cysteine residues
that has SH groups freely hanging. In patients with G6PDH deficiency, H2O2
accumulates and eventually converted to water by being reduced using the electrons
in SH groups of the Hb oxidizing them. Oxidized SH tends to cross link with each
other, form condensed Hb ( heinz bodies ), as such, these bodies are just covalently
linked Hb molecules. These oxidized SH groups may react with sulfur groups in the
cell membrane leading to hemolytic anemia. H2O2 itself is sharing in cell
membrane destruction.
These leads to what is known as episodic G6PDH deficiency. This enzyme is highly
polymorphic, meaning there are people that have 100% of activity of this enzyme, other
have 90%, 80%, 70%, 60% ( up to this point, every thing is OK ). People who have 50%
activity or less, tend to have this episodic deficiency. These people just have the amount
of activity that is enough to deal with the amount of oxidant that are endogenously
generated. As such, any exogenous factor that generate any additional amount of H2O2
will overwhelm the ability of this patients to detoxify this H2O2, leading to appearance of
features of the disease ( hemolytic anemia, Heinz bodies, immunodeficiency ).
 Found in fish oil

Note:
* There are 9 essential AAs in adults and 10 in infancy ( the difference is
arginine ).
* No essential CHO
* There are 6 essential lipids: the 4 fat soluble vitamins and linoleic and
linolenic.
Note: Arachidonic acid can be produced from linoleic acid so it's not essential.

This way of naming FAs goes like this: starting from omega carbon ( the last carbon,
which contains the carboxyl group ), where we would find the first double bond. e.g.
In omega 6 family, which contains linoleic and Arachidonic acid, the first double
bond is found in position 6 starting from the last carbon backward.
In saturated FAs, the carbons interact with each other very tightly, leading to decreased
cell membrane fluidity and flexibility. As such, when LDLs containing cholesterol are
attached to their receptor, they could not cross this rigid cell membrane to be internalized.
So, the higher the percentage of saturated fatty acids in the cell membrane, the higher
the levels of blood cholesterol is expected. That is way saturated is " bad"!. Cis fatty acids
have that nick, which offer fluidity to the membrane. Trans FAs, although they are
unsaturated, they have the same problem of saturated FAs.
The carbon 2 of the glycerol remains as 2-monoacylglyceride. Note: TGs
could not cross the cell membrane ( absorbed ) as such, because they are
too greasy. The first must be broken into 2-MAG and FAs and absorbed.
They are rejoined in the enterocyte.

More than 6% fat in the stool.

TG 2-monoacylglycerol

H
Lipase
+ 2 FAs
( intestine ) H
Where are all these ingredients coming from?
CO2: dissolved in all liquids in the body including cytoplasm
ATP : from CHO breakdown ( glycolysis and TCA )
AcetylcoA: also from CHO but note, CHO's acetylcoA is formed within the mitochondria, and their
is no transporter for it to get out to cytoplasm where lipogenesis is occurring. As such, it first
must condenses with OAA to form citrate ( as in Krebs ), but because the enzyme isocitrate DH is
inhibited by high levels of ATP, this citrate will not enter into Krebs, instead, it will shuttled out
to cytoplasm, at which, it would be cleaved by a low yield enzyme to OAA and acetylcoA ( so the
direct source of acetylcoA is citrate ).
NAPDH : two sources : 1. HMP shunt
2. From that OAA part of that citrate. OAA is first converted to malate, which, in turn, converted
to pyruvate by Malic enzyme, and this step uses NADP to generate NADH.
 ATP

Only two enzymes are important in lipogenesis after the point of generated ingredients: acetylcoA
carboxylase and fatty acid synthase.

1. AcetylcoA carboxylase is the 2nd example of these ABC-requiring enzymes ( ATP, biotin, CO2 ).
Note: the first one is pyruvate carboxylase located in the mitochondria in the above chart.
2. Fatty acid synthase: it condenses those multiple malonyl CoA that are made by the previous
enzyme to make, at the end, one palimtic acid ((16:0): 16 carbon, no double bonds )). This FA
goes to ER for elongation and desaturation ( to generate other FAs ). Human could no do
desaturation step beyond carbon 9, this is why linoleic and linolenic acids are essential.
 This enzyme is regulated at allosteric ( by citrate ),
genetic and phosphorylation level ( by insulin and
glucagon ).

The newly synthesized FAs are packed in TGs, which are then shipped out
of the liver in VLDL to adipose tissue. Alcohol has may effect in the liver,
e.g. Alcohol is high caloric, leading to production of large amount of FAs.
But the main reason for fatty liver in alcoholic is the fact that alcohol
inhibits VLDL assembly. As such, TGs stay floating in the liver because they
have no receptor to get them out of the liver.
This is the newly synthesized FAs, which is produced from
high CHO meal. These FAs need glycerol to become TGs
that is shipped out of the liver in VLDL. This glycerol comes
from two sources:
1. DHAP, which comes from glycolysis.
2. Glycerol itself that is recycled from adipose. The only
organ that could deal with glycerol is the liver, because
the liver has the enzyme glycerol kinase that activates
glycerol by putting phosphate.
Why the body makes this ester bond and store
FAs as TGs? Because the OH of glycerol and
COOH of the FAs are water soluble, and the
body "want" to make fat that are lipid soluble,
because fats don't drag water with them, cause
cellular swelling and limiting its spaces, so,
this ester bond, which render these two
molecule 100% lipid soluble has to be made.
The class of enzymes that cleave this ester
bond are known as lipases ( they are many,
e.g pancreatic lipase,lipoprotein lipase,
hormone sensitive lipase, etc ).
Ester bonds are also found in the phospholipids,
and is cleaved by enzymes known as
phospholipases ( and they are many, e.g.
Phospholipase A1 which cleaves ester bond on
the carbon 1 in the glycerol, and Phospholipase
A2, which cleaves the FA on carbon 2, which is
sometimes the FA known as arachidonic acid that
is important in pharmacology, Phospholipase C
that mediates Gq coupled receptors such as
alpha 1, see the next page ... ).
Phospholipase C cleaves the membrane
phospholipid into diacylglycerol ( shown
in red ) and IP3.
 One egg contains 250 mg

The polar part in cholesterol.

Note: the enzyme that cleaves the ester
bond in CEs is known as esterase ( not
lipase as in TGs ). It removes cholesterol
from FAs ( deeserify cholesterol ). This
step is necessary because CEs could not be
absorbed as such ( the same idea of TGs ).
In the enterocyte, CEs are remade by an
enzyme known as ACAT.
CEs are molecules that are formed by uniting
cholesterol and any fatty acid via ester bond.
Cholesterol has a part that is polar ( the OH ),
while CEs are 100% lipid soluble. As such,
cholesterol esters don't mix with the plasma,
causing problems.
Because the plasma lipids takes 8-8 hrs
postprandial to return to basal level, the
patient should be fasting for this duration
for his plasma level of cholesterol being
measured.
 Lipoproteins

This is different that glycoproteins, in which there is

chemical ( covalent ) linkage between lipids and
CHO. The lipid part is cholesterol, CEs, TGs, fat-soluble
vitamins, etc.
The protein part is known as apoproteins ( there are
20 or more of these, the most important are the
above shown 4; A, B, E, C ). All of these has Roman
numeral that is attached to them ( like ApoC 2 ), and
these are not important. Note: the numbers that are
attached to ApoB, i.e 100, 48, are not roman and are
important.
Anything polar is outside ( e.g. That black dot, which represents the
OH group of cholesterol ), and the greasy part is inside.
 Dietary lipids

In the blood, HDLs and VLDLs bang As mentioned previously, lipoprotein

with each other, and ApoC and ApoE lipase cleaves the ester bond in TGs,
get transferred from HDLs to VLDLs. producing FAs that get absorbed and
stored in adipose, and remnant flows
away to the liver.

ApoE interact with receptor

to eternalize the remnant. ApoC is given beak to HDLs.

To summarize: all dietary TGs ends in adipose,

and all dietary cholesterol ends in the liver.
Endogenously produced lipids

They are so huge, to an extend that when

the pure into the blood, the turn it whitish.
Cholesterols have OH groups that face the
aqueous environment. Cholesterols are located
in lipoproteins and plasma ( PM ) membrane of
any cell to control fluidity. So, if a lipoprotein
with OH groups in the surface bang against
plasma membrane, cholesterol could leak out of
the lipoprotein to fuse with PM increasing
fluidity to an extend that the function of PM and
the receptor being affected. As such, all
cholesterol in lipoproteins better converted into
CEs that are hydrophobic and located in the
interior of lipoprotein and could not diffuse out
of it. This conversion takes place in the surface
of HDLs and is mediated by LCAT which is
activated by ApoA.
IDL has many fates:
One: is to be removed by the liver. The identity of
the receptor that mediates this is controversial.
Two: to be further catabolized in the blood. This
process goes like this: cholesterols are transferred
from IDL to HDL which has ApoA and LCAT that are
capable of converting cholesterol to CEs. CEs are
then given back to IDL. As this process goes on, till
all cholesterol in IDL is converted to CEs. Why
cholesterol should be converted to CEs is explained
to the left.
Three: after all cholesterol is converted to CEs, IDL
sometimes loose it's ApoE and get converted into
LDL, which has a single copy of ApoB-100.
To summarize :
There are 6 lipoproteins; three are made by an organ
( chylomicron, VLDL and HDLs ), and three are degradation
products ( chylomicron remnant,IDL and LDL).
Note also:
IDL does not appear in lipid profile because its a transient
product, that is either removed by the liver, or converted
to LDL.

ApoA: LCAT Activation

ApoB-48: Chylomicron assembly and secretion
ApoB-100: LDL uptake by extrahepatic cells
Apo-C II: lipoprotein lipase activation
Apo-E III, VI: VLDL and Chylomicron reuptake be the liver.
In the phagolysosome, the low PH dissociate the LDL particle form it's receptor, which is then
recycled to the cell membrane. Every time this receptor is recycled, a few % is lost, and is get
replaced by LDL-receptor gene expression ( shown to the left ). The enzyme esterase cleaves CEs
into cholesterols. Unlike FAs, CHO, and AAs, that when get high in the cell, they could be burn to
CO2 and H2O and get rid of, humans have no enzyme system that is capable of burning those
cholesterol rings. As such, cholesterol is a hard molecule to get rid of. So, tight regulation of cell
levels of cholesterol is vital.
Dietary cholesterol is much cheaper than endogenously produced one, as such, when the diet
contains enough amount of cholesterol, the enzyme HMG coA that produces cholesterol is
inhibited. Also this cholesterol activates the enzyme LCAT that produces CEs from cholesterol for
purpose of storage ( note: LCAT is located in enterocytes ). Also this cholesterol inhibit LDL-
receptor gene expression.
In his condition, the lost % of the LDL-
receptor is not replaced and the patient
tends to have high levels of LDL in the
blood. In addition, as the cells starve for
cholesterol, and they start to make it,
worsen the condition.
LDL is not "bad". The bad is the oxidized LDL. The free radicals oxidize LDL by taking electrons from that
single copy of ApoB-100. By doing so, the entire LDL become defective and is not able to binds to its
receptor which is found on surface of all cells of the body except RBCs. As such, this defective, foreign-
looking LDL will be engulfed by macrophages by a receptor known as scavenger receptor -A ( SR-A). Unlike
LDL receptor, SR-A is not down regulated by cholesterol, as such, macrophage will continue to take up
oxidized LDLs till the it become bloated with cholesterol at which point it gets into sub-endothelium and
be converted to what is known as " Foam-Cell ". Foam cell is not capable to function as macrophage
anymore, and when it dies, it releases its contents, which dissolve in the blood except cholesterol which
precipitates as " fatty streaks" in the vessels wall, leading to initiation of an inflammatory process which
will end by atheroma formation. VitaminE is believed to prevent this process by circulating with LDL
attached to it ( because it's lipid-soluble ) and acts as electron donor to the free radicals.

HDL is considered "good" because it's capable of taking free cholesterol and convert it into CEs by virtue
of it LCAT and ApoA-1 and then transfer it to the liver via HDL receptor on the liver known as SR-B1, and
this process is know as reverse cholesterol transport or give it back to LDL.
Hyperlipidemias

Chylomicron 500-600 mg/dl

 Cholesterol synthesis
All these carbons come from glucose.
In adults, most of cells are in G0 state, i.e. they
are not growing. As such, no new cholesterol is
needed in cell membrane ( because it's already
their ). In children, cholesterol is readily used to
produce new cell membranes and that is why
children don't tend to have high cholesterol in
plasma.
The only important enzyme located in
every cell that has ER ( i.e except RBCs ).
This is a lipid that transport sugars from
the cytoplasm to the lumen of the ER.
This is the top regulatory enzyme in bile acid synthesis
found in the liver. It's negatively inhibited by bile acids
during their cycling in enterohepatic circulation.
Note: bile acids has to recycled by a carrier because they
are potent emulsifiers and might lead to massive
destruction if they where to go by themselves. Albumin
is this carrier.
What the boxes and texts are saying is, the activity of already produced and
the new production of this enzyme are inhibited by cholesterol ( allosteric )
and glucagon ( genetic and phosphorylation ).
Insulin turn on this enzyme by dephosphorylation and gene induction.
All of the six, currently available statins target this
enzyme. As shown in the plot, they are competitive
inhibitors ( no change in Vmax ), because these drugs
looks like HMG-coA.
By inhibition of HMG-CoA reductase, these drug reduces
cholesterol level, which is great, but also inhibiting the
production of franesyl PPi which is needed to produce CoQ
of the ETC. As such, statins reduced ATP production in
muscle and liver, and so liver and muscle problems are
expected patients take statins. This problem could be
solved by taking a substance known as " CoQ 10 " with
statins.
Cholestyramine contains "amine" groups which are positively charges. As such,
they act as big sponge that absorb the negatively charged bile acids ( bile acid
sequestratants ). This complex is not absorbable and passed out, depriving the
body from bile acids, releasing the inhibition from the enzyme 7alpha-
hydroxylase, leading to production of more bile acids. As such, most of the body
cholesterol will be directed to make bile acids ( that arrow become major ),
decreasing total body cholesterols. High fiber diet does the same.
 TG Mobilization
In starvation, exercise, etc.
Note: the carbons of glucose could be used to
build FAs but the reverse is not true. However,
the energy that is needed to make glucose is
provided form beta oxidation. There is
pathology point associated with this, any thing
goes wrong with beta oxidation would affect
gluconeogenesis. Also acetylcoA of beta
oxidation is an obligate activator of the one of
the key enzyme of gluconeogenesis; pyruvate
carboxylase.
By turning on PEP carboxykinase. All of these
hormones act at the genetic level. Cortisol acts by
binding a zinc finger receptor that goes to nucleus
and mediates the response, and glucagon acts by
phosphorylation of transcription factor called Cerb,
which goes to nucleus and bind to enhancer region
called CRE ( cyclic AMP response element ) mediating
the response by inducing the gene responsible for
PEP carboxykinase.
 Beta oxidation of FAs
The process of removal of electrons ( oxidation ) from carbon 3 of fatty acids ( beta carbon ).
These electrons eventually go to oxygen, and half of their energy is captured to make ATP. It
occurs in the mitochondrial matrix.
FAs don't enter to the matrix directly. As soon as they entered the mitochondria, they
will activated to fatty acyl CoA by a low yield enzyme ( FA acyl CoA synthase ) using
ATP. This is some what analogous to the beginning of glycolysis, when the glucose is
activated by hexokinase. FA acyl CoA also don't enter the matrix directly. Acyl group
must first be added to it and CoA must be removed by the action of the enzyme
carnitine acyltransferase-1( CAT-1 ) , to form FA-carnitine, which is transported to the
matrix via carnitine transporter. In the matrix CAT-2 remove that acyl group and adding
CoA creating again FA-CoA. We don't know why this is happening but there pathology
point attached to this area ( problems of genes responsible for CAT-1, CAT-2, carnitine
transporter ).
The yellow box speaks to the regulation of these steps so far. CAT-1 is inhibited by
malonyl CoA, which comes from the top step in the FAs synthesis ( carboxylation of
acetylcoA gives malonyl CoA ).
The pathway of beta oxidation is shown is the red box. There are multiple enzymes, only one is
important ( because there is pathology associated with it ). Suppose that the FA in the FA-CoA
contains 18 carbon, by the end of one cycle of beta oxidation, there will 1 NADH, 1 FADH2,
acetylcoA and the remaining 16 carbon that will enter the cycle again ( 18 carbon - 2 ( of the
acetylcoA ) = 16 ). That NADH and FADH2 will enter ETC to give 5 ATPs ( 3 from NADH and 2 from
FADH2 ). The acetylcoA get into TCA. So beta oxidation alone gives 5 ATPs and beta oxidation plus
TCA give 17. The remaining 16 carbon will keep going into beta oxidation, giving 5 ATPs and
splitting off 2 carbon in form of acetylcoA per cycle until all of the 16 carbon burned off.

LCAT=long chain acylCoa dehydrogenase. It acts on long chain fatty acids, removing two
carbon at a time, till the fatty acid become medium chain ( 10 carbon or less ), at which
point MCAT take over ( MCAT = medium chain acylCoA dehydrogenase ). When the fatty
acid become 6 carbon in length, SCAT kicks in to complete the rest of the cycle ( SCAT :
small chain acylCoA ).
 Autosomal recessive

Carnitine acetyltransferase / Carnitine palmitoyltransferase.

When FAs are accumulating due to MCAT deficiency,

This differentiate it from MacArdle
the enter another pathway ( omega oxidation ),
disease, in which, the biopsy reveal
which, at the end, produces dicarboxylic acid, which
glycogen granules.
appears in the blood ( dicarboxylic acidemia ), and
in the urine ( dicarboxylic aciduria ).

MCAD: Medium Chain Acyl-CoA dehydrogenase. This enzyme is responsible

for making double bond which is necessary for beta oxidation to run.
- Gluconeogenesis is fueled by beta oxidation.
- Ketone bodies are synthesized from acetylcoA of beta oxidation, so, no
beta oxidation on ketone bodies.
See next page for LCAD ...
 Propionate metabolism

The 3rd ABC requiring

In addition to odd-C FAs, 4 AAs

generate propionyl CoA.
These AA are: valine, methionine, isoleucine and
threonine ( add odd carbon FF = VOMIT pathway ).

99 plus of our FAs are of even-C type.

This go to oxidation, 2 carbon at a time These FAs at end generate propionyl CoA. Non
up the end of all carbons. No problem. of these carbons of odd-C FAs could end up
forming glucose, except the last three carbons.
This enzyme is one of only two enzymes in the body that require B12 as
cofactor. When this enzyme is defective, due one of the 4 reasons listed above,
methylmalonyl-CoA accumulates in the blood ( methylmalonic acidemia ) and
eventually appear in urine ( methylmalonic aciduria ).
Vitamin B12 itself ( cyanocobalamin ) could not be used as a cofactor, unless
the cyano group is replaces by either methyl group or adenosine making
methyl cobalamin or adenosine cobalamin. Those are the co enzyme form of B
12. Some people could not make these form.
 Ketone Bodies metabolism

The liver is the only

This has nothing to do with HMG-CoA of organ that could
FAs synthesis: this is in the mitochondria produce ketones.
of the liver only, and that is in the ER of
every cell except RBCs.

This is the acetoacetate. This is a beta ketoacid

which are inherently unstable, which is reduced
immediately to beta hydroxybutyric acid. Also
one carbon could come off the molecule giving
rise to acetone, which is useless in terms of
energy production, but used diagnostically.
Since there is no hormonal control, how the liver knows when to produce ketones? In
starvation, acetylcoA is produced in abundant amount. In the liver mitochondria, acetylcoA
usually enters TCA once it's produced, and it must first be condensed with OOA to form
citrate that enters TCA. In starvation ( 90 min after high CHO diet ) however, this OOA is
used in gluconeogensis, so acetylcoA has no choice except to condense with each other
forming HMG-CoA, which is the first molecule of ketone synthesis pathway.
 This why the liver could make ketone
So one acetoacetate gives 24 ATPs, bodies but could not use them.
lots of energy!

No gluconeogensis happens in extra hepatic tissues,

as such, there is plenty of OAA even in starvation.
 Sphingolipids: glycolipids and glycoproteins

If that CHO chain attached to Serine or

thrionine is said to be O-linked, and if it's
attached to nitrogen of sperigine is said to
be N-linked.
 Sphingolipids synthesis. This is not a big deal, but it's important to understand Sphingolipids
break down which is associated with many pathology. No important enzymes.

1. There is an enzyme condenses the AA serine
with FA to form Sphingolipid building block;
sphingosine. Carbon 1 of this molecule
contains OH group. Another enzyme puts
another FA to sphingosine to form ceramide.
Once ceramide is generated, there are several
enzymes compete for it, one of them is to put
CDP-choline ( the activated form of choline )
to produce the Sphingolipid sphingomyelin.
2. Other sets of enzymes could take this ceramide and add to it
sugars such as glucose or galactose to produce glucocerebroside
or galactocerebroside respectively. These are glycolipids. Then
another enzymes could add on top of this sugar another sugars
such as galactose, NAC ( from the class hexose amines) , NANA
( from the class sialic acid ). Gangliosides are glycolipids that
contains at least one sialic acid ( GM2 : ganglio monosialic acid,
the # is not important ). GD = gangliodisialic acid, GT=
gangliotrisialic acid and so on.
 Sphingolipidosis : three diseases

Tay-Sachs - Gaucher This also occurs in Niemann-Pick.

One of the diseases that are treated

with enzyme replacement therapy.
The enzyme is injected in the blood, it
looks foreign to macrophages so
taken up, and in the lysosomes it
founds these glucocerebroside and
breaks them. Nice strategy!
 Niemann-Pick

This phosphotransferse puts " ZIP" codes that demarcates the proteins ( enzymes )
that are destined to go to lysosomes. As such, when this enzyme is deficient, all
lysosomal enzymes are absent.

In Sphingolipidoses, the inclusions are formed from

one class of molecule ( like Sphingolipids ), while
in I-cell disease, it's going to mix bag of junk! All
kind of foods.
Low PH denatures dietary proteins exposing
the peptide bonds in globular proteins making
these bonds accessible to proteolytic enzymes.
Pepsinogen is auto-cleaved to pepsin because Low protein diet is recommended
of this low PH. and also we advise the patient to
drink a lot of water to dilute that
cystine
Because Trp is used to make niacin at
a rate of 1 mg/day.
 Nitrogen Metabolism

These are class of enzymes that remove amino group from AA. There are at
least 20 transaminases ( the # of AA ). All of them require pyridoxal-p, the
active from of B6.

No matter what the AA is, the first step in

> Urea don't change PH.
catabolism is to remove amino group ( ammonia ),
> Non polar; crosses the membranes easily
leaving just the carbon skeleton. This skeleton is
> Nontoxic
used either to produce energy, or a precursor for
molecules synthesis such as epinephrine. The amino
group has no energy and is highly toxic, so the
body get rid of it immediately either in form of
urea or ammonia as it is. Dont confuse urea ( the end product of
protein metabolism ) with urate ( or uric acid,
the end product of purine metabolism ).
 Intestine

This figure speaks to the generation

of ammonia ( the 3% ) that is
excreted by the kidney. Urea
generation is discussed in the next
page.

The rest of the % of NH3 is

excreted in other forms of
Urea comes from every tissue because these transaminases are nitrogen, such as creatinine.
everywhere. these transaminases not only act on proteins, but
also on other molecules, e.g. Adenosine deaminase that remove
amino group from adenosine. This ammonia don't get out to the
blood as such ( because it changes the PH ), but it's added to the
AA glutamate to produce glutamine by the enzyme glutamine
synthase, which is dumped to the blood. In the kidney, the
reverse reaction takes place, and the ammonia is get rid of as
ammonium. This glutamine could also go to intestine at which,
same reaction occurs and the generated ammonia ( in addition
to that produced by bacteria ) get via portal system to the liver
where it get dealt with. See the next page ...
 Ammonia in the portal blood does
not cause a problem because it get
removed quickly by the liver.

Note: glutamine could be considered as a

transporter for ammonia. But it's not like
that transport of albumin for e.g. because
ammonia is a part of glutamine.
 What happens in muscles in situations of starvation

This star represents the

path of nitrogen of AAs.

Although alanine contains

NH3, it don't change PH
because it's a neutral AA.

The body will get rid of N and make

Glutamate also could change the PH of use of C ( gluconeogenesis ).
the plasma, so, the body does not dump it
as such into the blood, it first converted to
alanine. Glutamate will be generated in
the liver. In the liver, this glutamate could
enter either one of two fates as explained
in the next page.

The next page will further the fate of this N ( that star )...
Glutamate in the liver could either be worked upon by an enzyme that deaminase it
to alpha keto-glutarate and the ammonia enter ammonia pole in the liver that is used
to make urea, or deaminated by another enzyme which puts this NH3 in oxaloacetate
to generate aspartate which is considered the other source of ammonia for urea
synthesis.
So, one NH2 groups in urea comes from NH3 and the other comes from aspartate.
And that NH3 itself has two sources : glutamate ( that comes from alanine ) in the
liver and portal blood ammonia that comes from glutamine and intestinal bacteria.
See the next page ...

Note that, these amino transaminases are used to diagnose liver damage;
aspartate transaminases ( AST ) and alanine transaminases ( ALT ).
 The other source
One source of one of Ns in urea

Alanine

Glutamine
Glutamate
Intestinal bacteria
Aspartate
Portal blood ammonia
 Urea cycle: 5 enzymes, only two are important
Urea cycle begins in the liver's mitochondria

OTC

Carbamoyl phosphate
High protein meal stimulates N-
synthetase 2 is located in
Acetylgutamate, the 2nd example of
pyrimidine pathway.
obligate activator, which in turn
stimulate the enzyme Carbamoyl
This enzyme condenses the Carbamoyl phosphate 1.
group of the Carbamoyl phosphate with
ornithine generating citrulline which get
So arginine is not an essential AA in
to the cytoplasm.
adults ( i.e. people with negative N
balance ), because oviausly, it could
be synthesized out of urea cycle.
Once in the cytoplasm, citrulline condenses with aspartate ( the source
of the 2nd NH2 ) to form argininosuccinate. Fumarate is removed
( which represents the 4 carbons brought by aspartate ) leaving off the
NH2 group to form arginine, the naturally occurring AA. So, arginine is
not an essential AA in adults because it could be made in urea cycle.
Children and people with positive nitrogen balance ( eat more of AA
than they loose ) arginine is essential because they don't break enough
AA to run urea cycle and produce arginine. Once arginine is made, it
splits off enzymatically to urea and arginase which regenerate
ornithine to keep the cycle going. Urea leaves the liver to the blood to
the kidneys to get rid of. High BUN diagnose renal problem and low
BUN diagnose liver malfunction.
Used to diagnose liver damage

One source
One source
If the enzyme OTC is defective, it's substrate ( Carbamoyl-P ) builds up and
starts to leak out to cytoplasm where it enters pyrimidine synthesis pathway,
in which oratic acid is the first molecule in this pathway. As such, orotic acid
also builds up and appear in the urine. In Carbamoyl phosphate synthetase
deficiency, this Carbamoyl-P is not made yet, so no orotic acid.
What happens to that carbon Skelton

Each of these
areas will
discussed
separately.
 What happens to that carbon Skelton

This is THB, which is a coenzyme.

Phenylketonuria is a genetic disease due to deficiency

in phenylalanine hydroxylase ( and rarely due to
deficiency in THB ). Is called phenylketonuria not In alcaptonurea, the dark blue color of urine is
phenylalaninurea because when phenylalanine rises, due to homogentistic acid in the urine.
it encounters a transaminase that takes off that Note:
amino group generating phenylketones that appear Pink or red urine = porphyria
in the urine. These ketones and phenylalanine cause Brown or tea colored urine = hyperbilirubinuria.
the feature of this disease. The patient diet should
contains low phenylalanine ( not no Phe, because its
an essential AA ).

This is the molecule that discussed earlier in
FAs metabolism. The short pathway above it is
a refresher.
Maple Syrup Urine
This is not called leucine, isoleucine,
valine dehydrogenase because the
enzyme works on these AA after their
amino group is removed ( i.e. is acts on
ketoacids which is carbon skeleton ). Is
oxidizes these carbon skeleton to make
acetylcoA and propionyl-CoA. It's the
3rd and last enzyme in metabolism
that require TLCFN, all of them make a
CoA of a product. The first two example
were : PDH and alpha keto glutarate
dehydrogenase.
 Met

Threonine and methionine plus valine and isoleucine

AAs that generate propionyl CoA along with odd
carbon FAs. ( the VOMIT pathway )
Met has a sulfur group that is not an elector donor ( unlike sulfhydral group ) because it's attached to methyl
group ( CH3 ). Met condensed enzymatically with adenosine ( from ATP ) to S-adenosylmethionine ( SAM )
which acts as methyl donor for biosynthesis of certain molecules such as epinephrine. When this methyl is
donated, the remaining molecule is called S-adenosylhomocysteine, which gives rise to the dangerous
molecule of homocysteine after adenosine is removed. Homocysteine is labeled as dangerous because it has
sulfur group hanging freely acting as a reducing agent ( electron donor ). Once generated, homocysteine get
into one of two reactions mediated by two competing enzymes : cystathionine synthase and homocysteine
methyl transferase. Cystathionine synthase, using vit B6 as a cofactor, converts homocysteine to cystathionine
which is then converted to alpha ketobutyrate and to propionyl which get into Krebs to generate energy.
Homocysteine methyltransferase, using methyl tetrahydrofolate and Vit B12 as cofactor, it transfers CH3 to
homocysteine ( i.e. regenerating methionine, so some books may call this enzyme methionine synthase ).
This enzyme is the 2nd e.g. of enzyme using Vit B12 ( along with methyl malonylCoA mutase ).
Think of this pathway as a pathway of
methionine metabolism and always Methionine
start from methionine. Adenosine

S-adenosyl methionine ( SAM )

X ( e.g. NoreEpinephrine )
The enzyme here is methionine
Methyl transferase synthase
Folic acid which is
X- methyl activated By B12
E.g. Epinephrine
S-adonosyl homocysteine

Adenosine

Homocysteine

Serine, B6, cystathionine synthatase

Homocysteinuria

Cystathionine

Cysteine B6, cystathionase

Alpha keto glotarate TCA

When of these two enzymes is deficient, homocysteine builds up in the blood and then into urine
( homocystinuria ), leading to features listed in the box to the upper right. Homocysteine is depicted in blue
with the sulfhydral group ( SH ) hanging out. This group is an electron donor, which could donate an electron to
free radicals in the body. Then the sulfurs start to cross-link with each another ( forming homocystine, note the
difference between homocysteine and homocystine ) and with sulfurs of cysteines in various proteins in the
body, leading to junky little particles floating in the blood giving rise to strokes and all other downstream
pathologies.
Note: vitamin deficiencies, B12, folate, and B6 cause of homocystineuria more common than genetic disorders
of enzymes.
 Catecholamine Synthesis

Tyrosine is
beginning point of
many
catecholamine

Shown in lower right is structure of tyrosine, which contains phenol group and 1 hydroxyl
group . The enzyme tyrosine hydroxylase, which requires THB, add another hydroxyl group
( OH ) to tyrosine generating 3,4-Dihydroxylphenylalanine ( 3,4-DOPA ). This molecules is
then converted to dopamine by the enzyme DOPA decarboxylase, which requires B6.
Dopamine is then converted to norepinephrine by addition of another OH by the enzyme
dopamine hydoxylase which requires VitC and Cu+2. Remember in collagen synthesis, proline
and lysine hydroxylase also requires VitC to put hydroxyl groups into proline and lysine.
Once norepinephrine is generated, it sees an enzyme that requires S-adenosyl-methionine to
be converted to epinephrine. S-adenosyl-methionine is a CH3 donor.

Path and pharm points

 Folate synthesis

This portion is discussed in SAM and THF are considered as

AAs metabolism 5 pages ago. one carbon donors. While SAM
Folate is a vitamin. The enzyme dihydrofolate acting on this donates only CH3, THF could
folate carries two successive reactions: converting the folate to donate this carbon one of the
dihydrofolate ( DHF ), which is a coenzyme in many reactions, following forms shown in the box :
and then converts this DHF to tetrahydrofolate ( THF ) which is a Methylene Carbon
carrier for 1 carbon unit, which usually comes from the AAs Ser Methanol carbon
and Gly. Depending on when this one carbon attached to THF, Keto carbon
the product get its name whether is formyl THF, methenyl THF, Carboxyl ( formyl ) carbon
methylene THF, etc. These products are the active form of folate
which gets into purine synthesis.
In folate deficiency, megaloblastic anemia develop. While the cytoplasm increases in size ready to divide,
the DNA could not be replicated because of folate deficiency, leading to megaloblasts.

Note: the active folate is tiny because all folate is readily converted to the reduced form ( methyl THF )
which is the storage form of folate, which is not used to make purine and pyrimidines. To convert this
inactive, storage form to active form, the enzyme homocysteine methyl transferase is needed. This is the
only enzyme in the body that uses this methyl THF. This enzyme needs Vit B12 as a cofactor, and this
why megaloblastic anemia could develop in Vit B12 deficiency. Note also, some people give extra folate
to treat megaloblastic anemia in VitB12 deficiency, because the folate pills contain active folate that
overcome Vit B12 deficiency.
 Requires B6

In homocystinuria due to B12 deficiency, methylmalonate rises in the blood

because the enzyme that metabolizes it ( methylmalonylCoA mutase ) also
requires B12.

This due to methylmalonic acid and odd
carbon FAs get incorporated in myeline
sheath.
This arrow does not work in VitB12
deficiency, leading to elevation in
methylmalonylCoA ( MMCoA ).
Heme Synthesis

These parts will be reviewed separately

 Heme Synthesis : three important enzymes

Because most of the heme comes from these two

tissues, prophoryia the terms " hepatic porphyria "
and "erythropoietic porphyria" are common in use.

Don't worry about roman #s in these enzymes

and products.
 Pb= lead

Previous to this what was made were porphyrin

precursors. Porphyrins have the ability to
absorb light, as such, their accumulation within
the cells is associated with photophobia.
B6 is needed by the first enzyme in heme
pathway. Iron is required by the last enzyme
and Pb knocks out the last enzyme.

Too much iron in the mitochondria.

The daily requirement is 1mg, only
10% of this is absorbed.
Iron Metabolism Iron in cells or plasma must
bound to proteins ( ferritin
and transferrin ) because
free iron form insoluble
salts. One transferrin binds 2
iron.

Most of body iron go to marrow

Since no metabolic pathway to get rid of

iron, the only way to control it's level in
the body is by controlling its absorption.
The protein HFE plays central role in this.
Some ways to get rid of iron are;
bleeding, hear cutting, nails trimming,
etc.

Homosiderin is a ferritin that has too

much iron lead to an extent that it
precipitates.
Bilirubin Metabolism
 Bilirubin Metabolism

RBCs, cytochromes

This is the only place is the

body in which CO is produced.
Glucuronate is glucose with carboxyl group
on carbon 6. UDP-Glucuronate is glucuronate
donor.
Flora takes up the two molecules of
glucuronate ( sugars ) and metabolize then
via glycolysis generating NADH. The electrons
in this NADH could go two carbon making
methane, sulfur to make hydrogen sulfide or
to bilirubin converting it to urobilinogen .

For pathological condition associated with this pathway ...

 Because it should never backs up in the
blood from the liver after conjugation.
Two reasons why newborn develop hyperbilirubinemia:
1. At birth, massive RBCs destruction occurs because of
HbF.
2. The enzyme UDP-glucuronase is induced only after
birth, so the enzyme might not be ready when the first
molecules of indirect bilirubin reach the liver. Bilirubin
may reach up to 6-10 mg/dl. Blue light ( not uv light )
in phototherapy leads to fragmentation of bilirubin.
Fragments water soluble and the baby could deal with
it.
When the enzyme UDP-Glucuronate
transferase is defective, the indirect bilirubin
could rise to a level of 30-50 mg/dl and
congenital jaundice and these kids usually
succumb at age of 6-12 months.
Gilbert is a benign syndrome affecting 6-8%
of population. There is point mutation in the
gene and the enzyme works fine but not
optimally ( 2-3 mg/ml indirect bilirubin ).
This pathological, e.g. direct bilirubin when
there is obstruction in biliary system. Or in
hepatitis, when conjugated bilirubin spilled into
blood ( instead of bile ) then to urine.
Purines and Pyrimidines Synthesis
 Pyrimidine Synthesis : 2 important enzymes

From HMP shunt

This molecule acts

as methyl donor.
Here we have all CUT

The methyl group

comes from these AA.

This enzyme is located in the cytoplasm

This is the first
cytoplasm of all nucleated cells except RBCs. pyrimidine
Carbamoyl Phosphate synthetase 1 is located
precursor.
in liver mitochondria ( urea cycle ).

Pathology tie in
Problems of the enzyme ornithine transcarbamoylase ( OTC ), which is located in
the liver mitochondria, was discussed in urea cycle. when this enzyme is defective,
its substrate, carbamoyl-P leaks out to cytoplasm and enter the pathway of
Pyrimidine synthesis ( which is located in the cytoplasm of all nucleated cells ),
leading to production of excess amount of orotic acid. Some of this orotic acid will
be used to produce Pyrimidine, and some will be spilled out to urine ( so orotic
aciduria is diagnostic for OTC diffecicency ). Note: orotic aciduria could also results
when either one of two enzymes downstream from orotic acid is deficient. The
difference between orotic aciduria due to one of these enzymes and that due to OTC
deficiency is this : in OTC deficiency there is also hyperammonemia and low BUN
level.
Pharm tie in
 Purine Synthesis: only one enzyme

This enzyme puts amino group in the place of phosphate group in the
molecule PRPP, generating 5-Phosporibosylamine, which is converted after
many steps to IMP. IMP is a nucleotide made of ribose, Phosphate and the
base hypoxanthine.

This inhibition regulates this pathway; when one of

these nucleosides is made in excess, it's synthesis is
inhibited by negative feedback,

Pharm tie in
 Purine Salvage = Purine Catabolism: two important enzymes. Pyrimidine salvage is of
no pathological or pharmacological importance.

Uric acid is not very water soluble, as such,
too much of it in the urine will back up into
the body, gets into joints and so on.
Allopurinol inhibits Xanthine oxidase,
preventing these bases, which are more
water soluble, from being converted to uric
acid.
The other phosphorylase is
located in the glycogenolysis.
Xanthine oxidase takes 10% of all of
these two bases ( hypoxanthine and
guanine ) and converts them to
xanthine then to uric acid.
 Since allopurinol affects the Vmax not
So, exercise could
the Km, as such, it's a noncompetitive
inhibitor of Xanthine oxidase.
worsen gouty arthritis .

enzyme hypoxanthine-guanine phosphoribosyltransferase ( HGPRT).

As such, excess nucleosides from salvage
pathway, inhibit purine synthesis pathway
by inhibiting this enzyme.
When this enzyme is defective, the tragic disease, Lesch-Nyhan develops. When this enzyme is defective, the salvage
pathway is decreased, leading to greater percentage of these bases to enter excretion pathway and levels of uric acid
skyrockets. On the other hand, the negative feedback inhibition of the enzyme amidotransferase will be lost, leading to
activation of the pathway of purine synthesis increasing their levels in the body, with subsequent more increase in uric
acid levels. As such, these patients tends to have hyperuricemia and severe attacks of gout in their childhood. The
severity may be decreased with allopurinol and cholchicine, but these patients usually succumb at a very early age.
... The End ...