Original article

Relationship of TOP2A mRNA Expression with

Neoadjuvant Chemotherapeutic Response in Breast
Cancer
Prihantono Prihantono1, Mochammad Hatta2, Andi Asadul Islam1, Christian Binekada3,
Andi Nilawati Usman4
1
Department of Surgery, Medical Faculty, Universitas Hasanuddin, Makassar, Indonesia
2
Molecular Biology and Immunology Laboratory, Medical Faculty, Universitas Hasanuddin, Makassar, Indonesia
3
Department of Surgery, Medical Faculty, Universitas Haluoleo, Kendari, Indonesia
4
Halal center, Universitas Hasanuddin, Makassar, Indonesia

Corresponding Author: Dr. Prihantono, Department of Surgery, Medical Faculty, Universitas Hasanuddin,
Makassar, Indonesia. Email: prihantono.md@gmail.com

Abstract
Background: Anthracycline is commonly used in the neoadjuvant chemotherapy for breast
cancer. However, not all patients benefit from Anthracycline chemotherapy. Studies suggest that
expression of TOP2A associated with Anthracycline-based chemotherapy sensitivity. Purpose:
To know the relationship between the profile of mRNA expression of TOP2A and chemotherapy
response in locally advanced breast cancer. Method: an observational study, 30 breast cancer
tissue samples pre-chemotherapy treated using cyclophosphamide-doxorubicin-5fluouracyl
regiment. Detection of mRNA expression of TOP2A using qRT-PCR techniques. Clinical
response to neoadjuvant chemotherapy based on RECIST criteria. Results: Mean value of
TOP2A mRNA expression in breast cancer patients pre-chemotherapy was 9.753±2.755, range
4.470–13.810. Mean value of TOP2A mRNA expression in breast cancer patients which
responsive to chemotherapy was 10.601±2.208. Mean value of TOP2A mRNA expression in
breast cancer patients which nonresponsive to chemotherapy was 6.969±2.648. Mean difference
were 3.632, significant with p-value =0.001(p<0.05). There is a positive correlation between
TOP2A mRNA expression with the clinical response with a value of r =0.475; this correlation
was significant with p-value=0.004 (p<0.05). Conclusion: There is a significant correlation
between the profile of mRNA expression of TOP2A baseline with clinical response to
neoadjuvant chemotherapy.
Keywords: Breast Cancer, Chemotherapy, mRNA, TOP2A, qRT-PCR

1. Introduction
Breast cancer is number one cancer among women worldwide with incidence 1,383,500 and
mortality 438,000 in 2011 . The rate of breast cancer in Indonesia 48,998 and death 19,750 in
2012, the majority coming at an advanced stage at diagnosis . Chemotherapy plays an essential
role in the treatment of advanced breast cancer . Chemotherapy induces tumor cell death and
reducing tumor mass, but the effectiveness of chemotherapy is limited by drug toxicity and
inhibited by chemoresistance . Anthracycline is most widely used in the neoadjuvant
chemotherapy for breast cancer. However, not all patients benefit from Anthracycline
chemotherapy . To achieve proper treatment for the right patients, predictive marker is needed so
that it can be avoided beneficial therapeutic and toxic effects of chemotherapy drugs
TOP2A gene codes for the enzyme topoisomerase IIα, an enzyme which catalyzes the opening
and integration of the DNA double strand, maintain proper DNA topology by introducing
double-strand breaks to relieve the tension created by processes like DNA replication .
Expression of TOP2A peaks during G2 and mitosis. This pattern of expression supports a role for
TOP2A in relaxing the positive supercoiling that develops as the replication fork advances during
the S phase and in mitotic events, such as chromosome decatenation, and kinetochore and
centromere function (9). Anthracycline bind and stabilize the topoisomerase IIα release of
double-stranded DNA, causing cessation of the cell cycle and apoptosis . Studies mentioned
TOP2A expression related to chemotherapy response in breast cancer . Despite these
achievements, at present, the data are inconclusive concerning the predictive role of the TOP2A
gene or protein status due to the different methods and study designs used and the retrospective
nature of most analyses. The study aim was to evaluate whether mRNA expression of TOP2A
pre-chemotherapy is related to chemotherapy response in breast cancer.

2. Materials and Method

2.1. Samples
This observational study was carried out in the surgical oncology division of the Wahidin Sudiro
Husodo Hospital Makassar, Indonesia. Breast cancer Female patients, invasive ductal carcinoma
histopathological type including in this study. The patient had been undergoing chemotherapy,
targeting therapy or hormonal therapy was excluded from this research.
Samples consisted of 30 breast cancer patients with histopathologic findings of invasive ductal
carcinoma. All patients received cyclophosphamide (500 mg/m2 ), doxorubicin (50 mg/m2 ) and
5fluorouracyl (500 mg/m2 ) on day 1 (FAC regimen). Three cycles of neoadjuvant chemotherapy
were delivered every three weeks with filgrastim support. The clinical response was classified
according to the RECIST criteria . The tumor characteristics were determined with standardized
methods.
2.2. Isolation of Nucleic Acid
Extraction of Nucleic acid from breast cancer tissue was using diatom guanidinium
isothiocyanate (GuSCN) method. Each 500μl Breast cancer tissue was mixed with L6 buffer
(50mMTris-HCl, 5.25M GuSCN, 20mM EDTA, 0.1% Triton X100), then vortexed, and
centrifuged for 5min at 1,000 rpm. Then Incubated the samples at 18°C for 15 minutes and added
diatom suspension 20μl. Then centrifuged 15 seconds at 12,000 rpm to obtain pellet diatom.
Then washed with L2 buffer (5.25M GuSCN in 0.1M Tris-HCl, pH6.4), rinsed with ethanol 70%
and acetone, and dried by incubation for 10 minutes at 56°C. The pellet was mixed with Tris-HCl
60μl of 10mM, pH 8.0, 1mM EDTA buffer and eluted the nucleic acid was by incubation for 10
minutes at 56°C. After sedimentation of the diatom by centrifugation, the supernatant was
collected and stored at -20°C until Real-Time PCR was performed .
2.3. Expression mRNA TOP2A Genes by Real-Time PCR
Detection of mRNA expression of TOP2A was done according to Real-time PCR method.
Specific primers for mRNA TOP2A were used: TOP2A forward: 5’-
CATTGAAGACGCTTCGTTATGG -3’ and TOP2A reverse: 5’-
o
CCAGTTGTGATGGATAAAATTAATCAG-3’. Cycle RT PCR for TOP2A was 94 C for 3
minute; 94oC for 30 second 38 cycles and next step is PCR: 51 oC for 30 second; 72oC for 30
second. Also, specific primers of GAPD were used GAPDH forward: 5’-
TGTGGTTCCTGCATGAAGACA-3’ and GAPDH reverse: 5’-
GTGACAGCGGAAGTGGTATTGTAC-3’. One-Step Quantitative RT-PCR System according to
the manufacturer’s instructions. Real-time PCR was performed using gene expression assays
(TaqMan; Applied Biosystems, Foster City, CA) and a PCR system (ABI PRISM 7900HT Fast
Real-Time PCR System; Applied Biosystems). Each sample was measured in triplicate.
2.4. Data Analysis
Data analysis of TOP2A mRNA expression used Wilcoxon test, to see the correlation using the
Pearson and Spearman test.
2.5. Ethical Clearance
This study was obtained Ethical approval from Committee of Ethics Research, Medical Faculty,
Universitas Hasanuddin, Makassar, Indonesia. Register; UH15060492.
3. Results
The research was performed in the period from August 2015 to November 2016; subjects were
breast cancer patients who met the inclusion-exclusion criteria. Of the 30 patients, all presented
with clinical stage III A and III B at the time of initial diagnosis. Mean tumor size
prechemotherapy was 10.2 cm (range, 5 –23 cm), Mean tumor size postchemotherapy was 5.4
cm (range, 2 –12 cm), and all underwent modified radical mastectomy surgery. Youngest of the
subject was 28 years, and oldest was 64 years old, the mean age of subjects was 50.3 years.
Analysis of the age and clinical response to chemotherapy between age ≤50 years and >50 years,
statistically no significant association with p=0.581 (p>0.05). Histopathologic grading meet
Nottingham criteria were low grade 6.7%, moderate grade 63.3% and high grade 30%. Analysis
of grade and clinical response to chemotherapy have no significant statistically with p=0.408
(p>0,05). Immunohistochemistry examination obtained ER+ 26.7%, PR+ 36.6% and Her2+
56.6%. Analysis of the hormone receptor with chemotherapy response, no significant
statistically. Clinical response to neoadjuvant chemotherapy; responsive 76.7% and
nonresponsive 23.3%. The characteristics of samples were shown in table 1.
Table 1. Clinicopathology feature and relation with clinical response

Clinicopathology n (%) p

Age 0.581
≤ 50 14 (46,7%)
> 50 16 (53,3%)
Grade 0.408
Low Grade 2 (6,7%)
Moderate Grade 19 (63,3%)
High Grade 9 (30 %)
Immunohistochemistry
ER 8 (26,7%) 0.060
PR 11 (36,6%) 0.515
HER2 17 (56,6%) 0.340
Clinical response
Responsive 23 (76,7%)
Nonresponsive 7 (23,3%)
p=chi square

Figure 1-2. Amplification curve of mRNA expression of TOP2A using qRT-PCR.

 Figure 3. Box Plot Graph of mRNA expression of TOP2A and chemotherapy responsiveness
Table 2. Comparison expression of mRNA TOP2A pre-chemotherapy with clinical response
Responsive Non Responsive
mRNA Expression (Mean±SD) (Mean±SD) Mean difference p*
(n=23) (n=7)

TOP2A 10.601±2.208 6.969±2.648 3.632 0.001

p = * Wilcoxon test

Mean value of TOP2A mRNA in breast cancer patients prechemotherapy which responsive to
chemotherapy was 10.601±2.208 whereas on nonresponsive was 6.969±2.648. In the responsive
group expression of TOP2A mRNA higher than nonresponsive group by 3.632. There was a
significant correlation between expression of TOP2A mRNA prechemotherapy with clinical
response to chemotherapy, p = 0.001 (p<0.05). Amplification curve of mRNA expression of
TOP2A using qRT-PCR shown in figure 1-2. Comparison of TOP2A mRNA expression pre-
chemotherapy with the clinical response shown in figure 1 and table 2.
Tabel 3. Correlations expression of mRNA TOP2A pre-chemotherapy and clinical response

mRNA Expression Correlation with

P*
(Mean±SD) Clinical response (r)

mRNA TOP2A 9.753±2.755 0.475 0.004

p = * Pearson test
This study showed a positive correlation between mRNA expression of TOP2A
prechemotherapy with clinical response to chemotherapy with a value of r = 0.475; this
correlation was insignificant with p = 0.004 (p<0.05). Correlations expression of mRNA TOP2A
pre-chemotherapy and clinical response is shown in table 3.
4. Discussion
This study showed the insignificant relationship between age, grade and immunohistochemistry
profiles with clinical chemotherapy response. Previous research also mentioned no relationship
between age and complete pathological response .
In our study, we found a correlation between mRNA expression of TOP2A prechemotherapy
with clinical response to chemotherapy. Topoisomerase is the primary target of Anthracycline-
based chemotherapy as doxorubicin and epirubicin, which are also called topoisomerase
inhibitors . TOP2A expression is associated with higher sensitivity to a substance which works
on the enzyme topoisomerase, for example, Anthracycline . TOP2A protein expression was
found to be an independent predictor of pathological complete response after neoadjuvant
docetaxel-epirubicin chemotherapy, and the probability of pathological complete response
increased by almost 50% with every 10% increase in the TOP2A-positive tumor cells . Several
previous studies also indicate that adjuvant therapy is containing Anthracycline more effective in
patients whose tumors experienced TOP2A amplification . Other studies have shown that
TOP2A gene deletion may also increase the sensitivity of breast cancer against Anthracycline .
Survey of 352 patients with breast carcinoma was given chemotherapy epirubicin, TOP2A
expression examined with immunohistochemical methods, FISH and qPCR. The results showed
that the expression of mRNA TOP2A and protein expression of TopoIIa very related to each
other. Some studies also mentioned that TOP2A protein expression correlated well with TOP2A
mRNA expression . High mRNA expression of TOP2A was an independent prognostic factor
adversely for Overall survival . Investigation of topoIIα protein expression in 99 primary tumors
and residual tumor in locally advanced breast cancer treated with anthracycline-based
neoadjuvant chemotherapy, Co-expression of HER-2 / Topo IIα found to be significantly
correlated with clinical response to chemotherapy. The researchers concluded TopoIIα
expression, together with HER-2, may help to select patients who could benefit from
anthracycline-based neoadjuvant chemotherapy and identify the risk of disease recurrence or
death is higher . Studies reported the TOP2A protein expression and HER2 in conjunction with a
predictive for response to anthracycline-based chemotherapy in breast cancer. TOP2A gene
amplification is also associated with anthracycline-based neoadjuvant chemotherapy sensitivity,
and TOP2A should be included as a predictive marker in breast cancer . Other Study examined
the mRNA expression TOP2A in breast cancer using real-time polymerase chain reaction (RT-
PCR), conclude that TOP2A expression in triple negative breast cancer patients more responsive
to antiangiogenic therapy and antimetastatic.
5. Conclusion
There is a significant correlation between expression of mRNA TOP2A baseline with clinical
response to neoadjuvant chemotherapy in breast cancer. Our findings suggest that mRNA
expression of TOP2A is a useful tool for the estimation of the sensitivity of breast cancer to
anthracycline-based chemotherapy.

Acknowledgements:
Our gratitude also for all breast cancer patients that have participated in this study.

Footnote
Conflicts of Interest: No conflicts of interest to declare.
Funds: This study supported by funds from the Ministry of Research, Technology and High
Education of the Republic Indonesia through postgraduate scholar program.

References

1. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA: a cancer
journal for clinicians. 2011;61(2):69-90.
2. Rhodes A, Yip C. Comparison of breast cancer in Indonesia and Malaysia–a clinicopathological
study between Dharmais Cancer Centre Jakarta and University Malaya Medical Centre, Kuala
Lumpur. Asian Pacific Journal of Cancer Prevention. 2011;12:2943-6.
3. Youlden DR, Cramb SM, Yip CH, Baade PD. Incidence and mortality of female breast cancer in the
Asia-Pacific region. Cancer biology & medicine. 2014;11(2):101-15.
4. Gong C, Yao H, Liu Q, Chen J, Shi J, Su F, et al. Markers of tumor-initiating cells predict
chemoresistance in breast cancer. PloS one. 2010;5(12):e15630.
5. Press MF, Sauter G, Buyse M, Bernstein L, Guzman R, Santiago A, et al. Alteration of
topoisomerase II–alpha gene in human breast cancer: Association with responsiveness to
anthracycline-based chemotherapy. Journal of Clinical Oncology. 2011;29(7):859-67.
6. Lee A, Lim W, Moon B-I, Paik N-S, Koh S-H, Song J-Y. Chemotherapy response assay test and
prognosis for breast cancer patients who have undergone anthracycline-and taxane-based
chemotherapy. Journal of breast cancer. 2011;14(4):283-8.
7. Fountzilas G, Dafni U, Bobos M, Kotoula V, Batistatou A, Xanthakis I, et al. Evaluation of the
prognostic role of centromere 17 gain and HER2/topoisomerase II alpha gene status and protein
expression in patients with breast cancer treated with anthracycline-containing adjuvant
chemotherapy: pooled analysis of two Hellenic Cooperative Oncology Group (HeCOG) phase III
trials. BMC cancer. 2013;13(1):1.
8. Connolly RM, Stearns V. Current approaches for neoadjuvant chemotherapy in breast cancer.
European journal of pharmacology. 2013;717(1):58-66.
9. Gudkov AV, Zelnick CR, Kazarov AR, Thimmapaya R, Suttle DP, Beck WT, et al. Isolation of
genetic suppressor elements, inducing resistance to topoisomerase II-interactive cytotoxic drugs,
from human topoisomerase II cDNA. Proceedings of the National Academy of Sciences.
1993;90(8):3231-5.
10. Biesaga B, Niemiec J, Ziobro M, Wysocka J, Kruczak A. Prognostic potential of topoisomerase IIα
and HER2 in a retrospective analysis of early advanced breast cancer patients treated with adjuvant
anthracycline chemotherapy. The Breast. 2011;20(4):338-50.
11. Meng H, Chen R, Li W, Xu L, Xu L. Correlations of TOP2A gene aberrations and expression of
topoisomerase IIα protein and TOP2A mRNA expression in primary breast cancer: a retrospective
study of 86 cases using fluorescence in situ hybridization and immunohistochemistry. Pathology
international. 2012;62(6):391-9.
12. Vang Nielsen K, Ejlertsen B, Møller S, Trøst Jørgensen J, Knoop A, Knudsen H, et al. The value of
TOP2A gene copy number variation as a biomarker in breast cancer: Update of DBCG trial 89D.
Acta Oncologica. 2008;47(4):725-34.
13. Wang J, Xu B, Yuan P, Zhang P, Li Q, Ma F, et al. TOP2A amplification in breast cancer is a
predictive marker of anthracycline-based neoadjuvant chemotherapy efficacy. Breast cancer research
and treatment. 2012;135(2):531-7.
14. Eisenhauer E, Therasse P, Bogaerts J, Schwartz L, Sargent D, Ford R, et al. New response evaluation
criteria in solid tumors: revised RECIST guideline (version 1.1). European journal of cancer.
2009;45(2):228-47.
15. Boom R, Sol C, Salimans M, Jansen C, Wertheim-van Dillen P, Van der Noordaa J. Rapid and simple
method for purification of nucleic acids. Journal of clinical microbiology. 1990;28(3):495-503.
16. Prihantono P, Hatta M, Binekada C, Sampepajung D, Haryasena H, Nelwan B, et al. Ki-67
Expression by Immunohistochemistry and Quantitative Real-Time Polymerase Chain Reaction as
Predictor of Clinical Response to Neoadjuvant Chemotherapy in Locally Advanced Breast Cancer.
Journal of Oncology. 2017;2017.
17. Müller BM, Kronenwett R, Hennig G, Euting H, Weber K, Bohmann K, et al. Quantitative
determination of estrogen receptor, progesterone receptor, and HER2 mRNA in formalin-fixed
paraffin-embedded tissue—a new option for predictive biomarker assessment in breast cancer.
Diagnostic Molecular Pathology. 2011;20(1):1-10.
18. Mitas M, Mikhitarian K, Walters C, Baron PL, Elliott BM, Brothers TE, et al. Quantitative real ‐time
RT‐PCR detection of breast cancer micrometastasis using a multigene marker panel. International
journal of cancer. 2001;93(2):162-71.
19. Luangdilok S, Samarnthai N, Korphaisarn K. Association between pathological complete response
and outcome following neoadjuvant chemotherapy in locally advanced breast cancer patients.
Journal of breast cancer. 2014;17(4):376-85.
20. Rouzier R, Perou CM, Symmans WF, Ibrahim N, Cristofanilli M, Anderson K, et al. Breast cancer
molecular subtypes respond differently to preoperative chemotherapy. Clinical Cancer Research.
2005;11(16):5678-85.
21. Burgess DJ, Doles J, Zender L, Xue W, Ma B, McCombie WR, et al. Topoisomerase levels
determine chemotherapy response in vitro and in vivo. Proceedings of the National Academy of
Sciences. 2008;105(26):9053-8.
22. Tanner M, Isola J, Wiklund T, Erikstein B, Kellokumpu-Lehtinen P, Malmström P, et al.
Topoisomerase IIα gene amplification predicts favorable treatment response to tailored and dose-
escalated anthracycline-based adjuvant chemotherapy in HER-2/neu–amplified breast cancer:
Scandinavian Breast Group Trial 9401. Journal of clinical oncology. 2006;24(16):2428-36.
23. Nikolényi A, Sükösd F, Kaizer L, Csörgő E, Vörös A, Uhercsák G, et al. Tumor topoisomerase II
alpha status and response to anthracycline-based neoadjuvant chemotherapy in breast cancer.
Oncology. 2011;80(3-4):269-77.
24. Di Leo A, Gancberg D, Larsimont D, Tanner M, Jarvinen T, Rouas G, et al. HER-2 amplification and
topoisomerase IIα gene aberrations as predictive markers in node-positive breast cancer patients
randomly treated either with an anthracycline-based therapy or with cyclophosphamide,
methotrexate, and 5-fluorouracil. Clinical Cancer Research. 2002;8(5):1107-16.
25. Knoop AS, Knudsen H, Balslev E, Rasmussen BB, Overgaard J, Nielsen KV, et al. Retrospective
analysis of topoisomerase IIa amplifications and deletions as predictive markers in primary breast
cancer patients randomly assigned to cyclophosphamide, methotrexate, and fluorouracil or
cyclophosphamide, epirubicin, and fluorouracil: Danish Breast Cancer Cooperative Group. Journal
of Clinical Oncology. 2005;23(30):7483-90.
26. O’malley F, Chia S, Tu D, Shepherd L, Levine M, Bramwell V, et al. Topoisomerase II alpha and
responsiveness of breast cancer to adjuvant chemotherapy. Journal of the National Cancer Institute.
2009;101(9):644-50.
27. Järvinen T, Kononen J, Pelto-Huikko M, Isola J. Expression of topoisomerase IIalpha is associated
with rapid cell proliferation, aneuploidy, and c-erbB2 overexpression in breast cancer. The American
journal of pathology. 1996;148(6):2073.
28. Brase JC, Schmidt M, Fischbach T, Sültmann H, Bojar H, Koelbl H, et al. ERBB2 and TOP2A in
breast cancer: a comprehensive analysis of gene amplification, RNA levels, and protein expression
and their influence on prognosis and prediction. Clinical Cancer Research. 2010;16(8):2391-401.
29. Sayed-Ahmed MM, Hafez MM, Al-Shabanah OA, Al-Rejaie SS, Aleisa AM, Al-Yahya AA, et al.
Increased expression of biological markers as potential therapeutic targets in Saudi wttiomen with
triple-negative breast cancer. Tumori. 2012;99(4):545-54.