Food Chemistry 246 (2018) 156–163

Contents lists available at ScienceDirect

Food Chemistry
journal homepage: www.elsevier.com/locate/foodchem

Highly sensitive detection of gluten-containing cereals in food samples by T

real-time Loop-mediated isothermal AMPlification (qLAMP) and real-time
polymerase chain reaction (qPCR)
⁎
Alejandro Garrido-Maestu , Sarah Azinheiro, Pablo Fuciños, Joana Carvalho, Marta Prado
Department of Life Sciences, Nano4Food – Food Quality and Safety Research Group, International Iberian Nanotechnology Laboratory, Av. Mestre José Veiga s/n, 4715-
330 Braga, Portugal

A R T I C L E I N F O A B S T R A C T

Keywords: The treatment of gluten-related disorders is based on a lifelong, and strict, gluten-free diet. Thus, reliable and
Real-time Loop-mediated isothermal sensitive methods are required to detect the presence of gluten contamination. Traditional techniques rely on the
AMPlification (qLAMP) detection of these proteins based on specific antibodies, but recent approaches go for an indirect route detecting
Real-time PCR (qPCR) the DNA that indicates the presence of cereals with gluten content. In the current study two different DNA
α2-gliadin
amplification techniques, real-time PCR (qPCR) and real-time Loop-mediated isothermal AMPlification
Gluten
(qLAMP), were evaluated for their capability to detect and quantify gluten. Different detection strategies, based
Gluten-free food
on these DNA amplification techniques, were tested. Even though good specificity results were obtained with the
different approaches, overall qPCR proved more sensitive than qLAMP. This is the first study reporting a qLAMP
based-method for the detection of gluten-containing cereals, along with its evaluation in comparison with qPCR.

1. Introduction
Celiac disease (CD) is an autoimmune disorder associated with a
permanent intolerance to gluten proteins of wheat, barley, and rye. CD
is characterized by an inflammatory response that leads to atrophy of
the intestinal villi and malabsorption. Reactions to gluten are not lim-
ited to CD, and a spectrum of gluten-related disorders have been de-
scribed, including wheat allergy (WA), a food allergy that is im-
munoglobulin E (IgE) mediated (Mittag et al., 2004), and more
recently: non-celiac gluten sensitivity (NCGS) (Sapone et al., 2012).
Although different conditions, the treatment of gluten-related disorders
is based on a gluten-free diet (GFD). Besides the people needing to
follow a GFD for any of the conditions mentioned above, a new segment
of consumers has arisen who consume gluten-free products as a lifestyle
choice (Foschia, Horstmann, Arendt, & Zannini, 2016). As a result, in
the last 15 years, the global market of gluten-free products has in-
creased exponentially approaching 2.5 billion $ in global sales in 2010
(Sapone et al., 2012), and with an even higher growth since then,
reaching up to an estimated 6.2 billion $ by 2018 (Wieser, Koehler, &
Konitzer, 2014).
Gluten is a complex mixture of storage proteins from grains, which
are ingredients in a wide range of foods (Miranda-Castro, de-Los-
Santos-Álvarez, Miranda-Ordieres, & Lobo-Castañón, 2016). According
to the Codex Alimentarius and the European Union regulation, only
those products with a gluten content below 20 ppm or 20 mg/kg can be
labeled as “gluten-free” If the content does not exceed 100 mg/kg the
product can be labeled as “very low gluten” (EFSA, 2014; European
Commision, 2009; WHO, 2010).
The most frequently used methods for gluten detection in food
products are immunological based, due to their ease of use and rapid
analytical procedure. More than 15 immunochemical methods for de-
tecting gluten are marketed commercially, mainly ELISA kits and
Lateral Flow Devices (LFD), which have been recently reviewed (Bruins
Slot, van der Fels-Klerx, Bremer, & Hamer, 2015). However, there is still
a strong need for improvement due to the difficulties related to the full
extraction of gluten proteins from food matrixes, the choice of epitopes
to be used as targets for detection methods, and the lack of certified
reference materials (CRMs) (Bruins Slot et al., 2015; Diaz-Amigo &
Popping, 2012; Haraszi, Chassaigne, Maquet, & Franz, 2011).
As for allergens, although the detection of the offending protein is
desirable, this is not always feasible due to a lack of well-characterized
compounds, or lack of sensitive enough detection techniques (Prado
et al., 2016). DNA-based assays have proven to be useful tools by tar-
geting DNA as a marker for the presence of the offending ingredient
(Carmen Diaz-Amigo & Popping, 2013; M. Prado et al., 2016), both for
the detection of undeclared ingredients in food products, and for the

⁎
Corresponding author at: International Iberian Nanotechnology Laboratory, Av. Mestre José Veiga s/n, 4715-330 Braga, Portugal.
E-mail address: alejandro.garrido@inl.int (A. Garrido-Maestu).

https://doi.org/10.1016/j.foodchem.2017.11.005
Received 5 May 2017; Received in revised form 8 September 2017; Accepted 2 November 2017
Available online 06 November 2017
0308-8146/ © 2017 Elsevier Ltd. All rights reserved.
A. Garrido-Maestu et al. Food Chemistry 246 (2018) 156–163

evaluation of cleaning procedures for industrial equipment (Stephan & Table 1

Vieths, 2004). The use of DNA targets is interesting for methods re- Result comparison among qPCR and qLAMP in food samples.
quiring a high sensitivity since DNA is not affected by the variability of
Type of sample Number of Result
the phenotype, they present a high thermal stability, and DNA ampli- samples
fication methods, such as PCR and qPCR, allow the amplification of the qPCR qLAMP
number of copies of the initial DNA target. Moreover, they have the
Probe Sybr In-house Commercial
advantage of allowing the detection of individual species (Mujico,
Green I
Lombardía, Mena, Méndez, & Albar, 2011), or the simultaneous de-
tection of a collective allergen group (Marta Prado, Boix, & von Holst, Bread 1 + + + +
2012) depending on the designed primers and the chosen sequence, Wheat flour 2 + + + +
which gives an additional flexibility to this approach. Rye flour 1 + + + +
Spelt flour 1 + + + +
DNA amplification approaches based on polymerase chain reaction Rice flour* 1 + + + +
(PCR) (Dahinden, von Büren, & Lüthy, 2001) or more recently q PCR Barley grain 2 +/− + − −
(Mujico et al., 2011; Sandberg, Lundberg, Ferm, & Malmheden Yman, Rye grain 1 +/− + − −
2003; Zeltner, Glomb, & Maede, 2009) have been described for the Pasta 1 + + + +
Couscous 1 + + + +
detection of gluten-containing cereals.
Corn flour 1 − − − −
In recent years, an isothermal amplification technique named Loop- Gluten-free 1 − − − −
mediated isothermal AMPlification (LAMP) has been developed. LAMP cookies
allows the specific detection of DNA, likewise PCR/qPCR, but targeting Rice** 1 − − − −−
six to eight different sequences and being performed at a constant Corn 2 − − − −
Popcorn 1 − − − −
temperature. It has additional advantages over the former techniques,
being one of the most attractive the possibility of naked-eye result * In the package the producer indicated that may contain traces of gluten.
observation due to the formation of insoluble by-products (magnesium ** Without rinsing with water previous to DNA extraction, resulted positive. “+/−”
pyrophosphate) whenever the reaction is positive (presence of target indicate that one of the replicates within the sample failed to amplify.
sequence) (Mori, Kitao, Tomita, & Notomi, 2004; Notomi et al., 2000).
In this regard recent studies have also included the use of intercalating 2.2.2. Grains
dyes for naked-eye observation and/or for fluorescence tracking in real- When the samples consisted of grains, these were previously frozen
time assays (D’Agostino, Diez-Valcarce, Robles, Losilla-Garcia, & Cook, in liquid nitrogen and homogenized using a mortar and pestle until a
2015; D’Agostino et al., 2016; Hara-Kudo, Yoshino, Kojima, & Ikedo, fine powder was obtained. Regarding the rice sample, the grain was
2005; Ma et al., 2010; Tomita, Mori, Kanda, & Notomi, 2008; Zhang, washed with regular tap water, to eliminate traces of other cereals
Brown, & González-Escalona, 2011). which may contaminate the samples during the processing in the fa-
Surprisingly, to our knowledge, this relatively new technique has cility. Then, the DNA was extracted using the NucleoSpin Food and
not been previously applied for the detection gluten-containing cereals. Plant kits (Macherey-Nagel, Düren, Germany).
Thus, the goal of the current study was to evaluate the performance of a
LAMP based method for the specific detection of gluten-containing 2.3. Gene selection
cereals in food samples, and its comparison against qPCR.
The use of α2-gliadin gene as target for qPCR has been previously
reported to provide a good sensitivity for the detection of gluten-con-
2. Materials and methods taining cereals in foods (Martín-Fernández et al., 2015). Therefore, this
gene was selected for the design of the new methods. Sequences from
2.1. Samples common wheat, rye and barley: Triticum aestivum (AJ133612), Secale
cereale (JX843487) and Hordeum vulgare (HQ875781) were obtained
A total of 17 different samples, including grains and foods, were from GeneBank and aligned with CLC Sequence Viewer (C L C Bio-
purchased from local suppliers, and analyzed with the qPCR and Qiagen, 2016). The consensus sequence was used for primer design.
qLAMP approaches, described below, to evaluate the specificity of the
different protocols. A detailed list of the samples analyzed is provided 2.4. Primer design for qPCR and qLAMP
in Table 1.
In order to determine the real potential of each technique for The design of primers for qPCR was performed with Primer3 free
quantification/detection purposes, a binary model was prepared as online software (Untergasser et al., 2007). Along with the primers, a
described by Martín-Fernández, Costa, Oliveira, López-Ruiz, and Mafra hydrolysis probe was also designed. Regarding qLAMP, the design was
(2015). To this end, wheat flour was mixed with gluten-free corn flour performed with the free software Primer Explorer V4 (https://
in the following proportions: 50% (500000 mg/kg), 10% (100000 mg/ primerexplorer.jp/e/index.html). The specificity of all primers was
kg), 5% (50000 mg/kg), 1% (10000 mg/kg), 0.5% (5000 mg/kg), 0.1% verified in silico with BLAST® (Basic Local Alignment Search Tool,
(1000 mg/kg), 0.05% (500 mg/kg), 0.01% (100 mg/kg), 0.005 (50 mg/ https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD = Web&PAGE_TYPE=
kg), 0.002% (20 mg/kg) and 0.001% (10 mg/kg). Each sample was BlastHome), and later on with real food samples. For comparison pur-
processed as described in the Section 2.2.1 and analyzed in triplicate by poses, the use of an intercalating dye was also tested by qPCR. To this
the different amplification approaches (qPCR and qLAMP). end, the F3/B3 primers designed for qLAMP were selected, as seen in
Table 2.

2.2. DNA extraction 2.5. qPCR

2.2.1. Food
DNA extraction and purification from food samples was accom-
plished with the NucleoSpin Food kit (Macherey-Nagel, Düren,
Germany) with the modifications described by Martín-Fernández et al.
(2015).
For comparison purposes, two different qPCR approaches were as-
sessed. The first one using the primers F3/B3 from the qLAMP design,
and SYBR® Green I as intercalating dye. The second approach consisted
on a newly designed set of primers and included a hydrolysis probe. In
both sets of experiments, the samples were analyzed in duplicate, and

157
A. Garrido-Maestu et al.
Table 2
Primer list for qPCR and qLAMP.
Detection Sequence 5′-3′
method
qLAMP a2g-F3* GCCAAGCCATCCACAATGT
a2g-B3* CAACTGGAGCAATGGTGC
a2g-FIP GGAAGGAGCCCTGGCCTGAT-
CAACCGTTGAGCCAGGTCT
a2g-BIP CAGGGCTCTGTCCAGCCTCA-
TGCAGGTAGCGTCTCTAGC
qPCR a2g-F CAGGGCTCTGTCCAGCCTCAAC
a2g-R TGCCAACTGGAGCAATGGTGCAA
FAM−
a2g-P CGCTAGAGA/ZEN/CGCTACCTGCAATGTGC-
IABkFQ
* F3/B3: outer primers, also used for qPCR with Sybr Green I. FIP/BIP: inner primers.
“ZEN” is an internal quencher proprietary from IDT
the reaction volume was fixed at 20 μL and sample volume at 2 μL. The
experiments were performed in a StepOne Plus™ Real-Time PCR system
(Applied Biosystems™, Foster City, CA, USA) with StepOne™ Software
v2.2.2.
2.5.1. Detection using intercalating dye (F3/B3-qPCR)
The F3/B3 primers from the qLAMP method were added at a final
concentration of 200 nM together with 10 μL of SsoAdvanced™
Universal SYBR® Green Supermix (Bio-Rad Laboratories, Inc., USA).
The thermal profile was: Hot Start at 98 °C for 3 min, followed by 55
cycles of dissociation at 95 °C for 30 s and annealing-extension at 65 °C
for 45 s. A melt curve analysis was performed at the end of the qPCR
run to verify the specificity of the reaction.
2.5.2. Detection using hydrolysis probe
In this approach, primers and probe were added at a final con-
centration of 100 nM and 200 nM respectively, with 10 μL Maxima
Probe/ROX qPCR Master Mix (Thermo Fisher Scientific Inc., Waltham,
MA, USA). The thermal profile consisted of 2 min at 50 °C for Uracil-
DNA Glycosylase (UDG) treatment, followed by 10 min at 95 °C hot
start polymerase activation, and 55 cycles of dissociation at 95 °C for
30 s and annealing-extension at 65 °C for 45 s.
2.6. qLAMP
To obtain an optimal performance of the newly designed qLAMP
method, two parameters were optimized, the amplification temperature
and the enhancers of the reaction (betaine and DMSO). The final re-
action volume was 20 μL, and sample volume 2 μL. For the steps of the
optimization process, the primer concentration was fixed at 1600 nM
for FIP/BIP and 200 nM for F3/B3, and the rest of the reaction com-
ponents were kept as indicated below. Regarding optimization of the
temperature, it was evaluated ranging from 60 °C to 65 °C for 60 min.
Regarding the supplements, betaine was added to the reactions at 0.6,
0.8, and 1.0 M final concentrations, while DMSO was tested at 5% and
7.5%. Additionally, a commercial master mix, as well as one in-house
prepared, were tested for comparison purposes. All these tests were
performed in duplicate.
Reactions for food sample analyses were performed in duplicate,
and the reactions contained: 5% DMSO; primer concentration was
1600 nM for FIP/BIP and 200 nM for F3/B3; amplification was ac-
complished at 65 °C for 90 min, with a post-amplification melting
analysis consisting in heating up to 98 °C for 15 s, cooling down to 80 °C
for 1 min, and then raising the temperature again up to 95 °C for 15 s,
acquiring fluorescence every 0.3 °C. The experiments were run in the
same thermocycler used for qPCR, where each cycle corresponds to
30 s, when the fluorescence was acquired.
158
Food Chemistry 246 (2018) 156–163
2.6.1. In-house master mix
The reaction mixture contained: 2 μL of 10X Isothermal
Amplification Buffer (New England BioLabs, Inc., Ipswich, Mass., USA),
0.35 mM dNTP mix (Thermo Fisher Scientific Inc., Waltham, MA, USA),
8 U Bst 2.0 WarmStart® DNA Polymerase (New England BioLabs, Inc.,
Ipswich, Mass., USA), and 1 μL of 1:500 dilution of Midori Green
(Nippon Genetics Europe GmbH, Düren, Germany) for fluorescence
detection. The remaining volume was completed with DNAse, RNAse
free water.
2.6.2. Commercial master mix
When the analyses were performed with the commercial master
mix, the primers, DMSO, water and sample (in the concentrations de-
tailed above) were added to 10 μL of GspSSD Isothermal Master Mix
(OptiGene Ltd., Horsham, UK).
2.7. Evaluation of the limit of detection with pure DNA
An amplification curve was created with tenfold dilutions of wheat
flour DNA extract ranging from 150 to 0.0015 ng/μL in Tris-EDTA 1X
(TE1X, 100 mM Tris-HCl, 1 mM EDTA, pH 7.5). DNA extracts were
amplified in duplicates for each dilution, by both qPCR and qLAMP
methods. DNA extract was obtained from wheat flour as described in
Section 2.2.1.
2.8. Mathematical modeling
The newly developed qLAMP method was evaluated using a regular
Real-Time PCR system. The main objective was to get more information
about the process in real-time, and allow a comparison among the
different chemistries, the use of enhancer/supplements, comparison
with qPCR, and evaluation of the performance criteria. However, the
software in qPCR systems is designed to perform data analysis of qPCR
results, which are based on cycle of quantification (Cq), values calcu-
lated by determining the point at which the fluorescence produced in
each sample reaches the chosen threshold limit, and it is inversely re-
lated to the starting copy number of the target sequence. However,
qLAMP is an isothermal reaction, which implies that all biochemical
events take place in parallel and the total time of the reaction is mea-
sured rather than the number of cycles. Therefore not following cycles
as qPCR, results are expressed as Time-to-threshold (Tt) which is the
measure of the reaction time at which the fluorescence of each sample
exceeds the threshold. In order to avoid infra- or overestimation errors
in the determination of the Tt values, that would lead to false negatives
or false positives, the Tt values were calculated by mathematical
modeling the qLAMP kinetics using a sigmoid equation (reparametrized
Gompertz) as described by Garrido-Maestu, Fuciños, Azinheiro,
Carvalho, and Prado (2017).
3. Results
3.1. Optimization of the qLAMP assay
The optimization of the temperature of the qLAMP assay showed
that the optimal amplification temperature was 65 °C, as shown in
Fig. 1a where an estimated Tt reduction of 28 min was obtained respect
to the reaction performed at 60 °C. Regarding the supplements, better
results were obtained with DMSO rather than with betaine, being the
best results obtained with a 5% concentration, as depicted in Fig. 1b
where a Tt reduction of about 15 min was obtained respect to the re-
action performed with 1 M Betaine.
3.2. Specificity of new primers designed for qPCR and qLAMP
The specificity of all newly designed primers was satisfactorily
confirmed by BLAST. In addition to this, a total of 17 samples were
A. Garrido-Maestu et al.
Fig. 1. a) qLAMP temperature optimization. b) qLAMP supplement optimization. Each cycle corresponds to 30 s.
analyzed, 6 without gluten-containing cereals and 11 with gluten-con-
taining cereals, which were all correctly identified with the newly de-
signed qPCR assays (probe and intercalating dye), while the qLAMP
tests failed to detect gluten-containing cereals in the samples consisting
of grains (barley and rye). Also, two rice samples (flour and grains),
which should not contain gluten, obtained a positive result regardless
the DNA amplification method applied (Table 1).
3.3. Pure DNA LoD
Pure DNA obtained from wheat flour was selected as the reference
material, and was ten-fold serially diluted to assess the lowest
159
Food Chemistry 246 (2018) 156–163
detectable concentration. It was observed that the qPCR method with
the hydrolysis probe presented the lowest LoD, reaching 0.0015 ng/μL,
followed by the qPCR with the intercalating dye, which reliably de-
tected down to 0.15 ng/μL, as shown in Fig. 2a and b. Regarding the
qLAMP approaches, the in-house mixture reached reliably 0.15 ng/μL
while with lower concentrations some replicates failed to amplify, and
the determined Tt values were not statistically significative (Table S1);
in this regard, similar results were obtained with the commercial master
mix as shown in Fig. 2c–d.
A. Garrido-Maestu et al.
Fig. 2. LoD with pure DNA. a) Probe qPCR, b) SYBR Green qPCR c) qLAMP results obtained with in-house master mix. d) qLAMP results obtained with commercial master mix. Gray lines
represent the 95% confidence bands for the linear estimation.
3.4. Detection of gluten-containing cereals in food samples and evaluation
of the quantification potential in a binary model
Whenever qPCR approaches were selected, whether using hydro-
lysis probe or intercalating dye, even the samples with the lowest
percentage of wheat flour were detected (0.001%) (Table S2), although
for quantification purposes the lower limit of the linear range should be
set at 0.005% for the hydrolysis probe and 0.01% for the intercalating
dye (Fig. 3a and b).
Regarding the qLAMP methods, the lowest detectable concentration
was 0.005% when the commercial master mix was selected, while with
the in-house master mix the limit of detection was 0.1% (Table S2).
Regarding quantification, the lower limits were set at 0.1% for the
commercial master mix and 1% for the in-house mixture. At con-
centrations lower than those, the determined Tt values had high con-
fidence intervals and, despite being statistically significative (Table S2),
including them in the quantification range increased the deviation from
linearity (Fig. 3c and d).
These values were set with the concentrations from which all re-
plicates amplified, as whenever one of the replicates failed to amplify,
the sample was considered negative.
4. Discussion
The application of DNA methods for the detection of gluten-con-
taining cereals, was initially intended for confirmation of protein assays
(Miranda-Castro et al., 2016; Sandberg et al., 2003). However, in recent
years they have been gaining interest as fast and reliable alternatives,
particularly since the development of qPCR due to its advantages in
terms of specificity, possibility of quantification, and rapidity respect to
conventional PCR (Martín-Fernández et al., 2015; Sandberg et al.,
2003; Zeltner et al., 2009). Moreover, DNA methods seem an inter-
esting alternative taking into account that some of the gluten-related
disorders are not actually exclusively trigger by gluten (Volta, Caio,
160
Food Chemistry 246 (2018) 156–163
Tovoli, & De Giorgio, 2013)
LAMP based methods are becoming increasingly applied for point-
of-care and limited-resource settings allowing in-situ analysis, due to the
possibility of performing nucleic acid amplification without the need of
expensive laboratory equipment such as thermocyclers, a high toler-
ance for inhibitors and the possibility of detecting results with the
naked eye (Oscorbin, Belousova, Zakabunin, Boyarskikh, & Filipenko,
2015). For their application in such conditions, LAMP based methods
need to be thoroughly optimized and evaluated, since there are several
factors that might influence their speed and analytical sensitivity, in-
cluding: the annealing events taking place that might compete with
each other, and influence as well the speed of isothermal reactions, and
the influence of the template’s innate secondary structures due to the
absence of multiple denaturation steps (Khorosheva, Karymov, Selck, &
Ismagilov, 2016). In the absence of specific guidelines for optimization
as for qPCR, sensitivity of newly developed LAMP methods are typically
evaluated by using 10-fold serial template dilutions that are then
compared to the sensitivities of a PCR method. The use of real-time
measurement of product amplification for optimizing analysis condi-
tions, provides quantitative data that allows comparison among the
effect of the different parameters, and gives a quantification potential to
the method. However, in order to use regular Real-Time PCR systems, a
mathematical model was proposed to calculate the corresponding Tt
values.
The optimization of the qLAMP methods focused on the temperature
and the supplementation of the reactions with either betaine or DMSO.
The estimated optimal temperature was 65 °C. Concerning the optimi-
zation focused on the supplements added to the reaction, our results
agree with those of Wang et al., who reported an increased performance
of the qLAMP reactions whenever DMSO was added rather than be-
taine. However, our optimal concentration was obtained with 5% in-
stead with 7.5% as reported by them (Wang, Brewster, Paul, &
Tomasula, 2015).
The first step in the evaluation of the newly developed DNA
A. Garrido-Maestu et al.
Fig. 3. Flour mix comparison, only the linear range was represented. a) results obtained with qPCR and probe b) results obtained with qPCR and SYBR Green c) results obtained with
qLAMP in-house mixture of the quantification range d) results obtained with qLAMP commercial master mix of the quantification range. Gray lines represent the 95% confidence bands
for the linear estimation.
amplification approaches (qPCR and qLAMP) consisted in the con-
firmation of the specificity of the new primers and probes. In this sense,
an in silico analysis performed with BLAST yielded good results for all
the oligonucleotides. When the specificity analyses were performed in
vitro, with the corresponding protocols, to confirm the BLAST results, a
false positive was obtained for the rice flour. Nevertheless, these results
were later considered as correct because the producer of the flour in-
dicated that it might contain traces of gluten. Indeed, rice grain rinsed
with tap water, previous to DNA extraction, did not give a positive
amplification result, meanwhile if the rinsing step was omitted a false
positive result was obtained. These results were consistent within both
techniques in their different approaches, and highlight the sensitivity of
both. It is important to bear in mind the importance of identifying cross-
contamination during the processing or storage of raw materials or the
final product, as this particular case exemplifies, and to identify how
and when this cross-contamination occurred, since low allergen con-
centration may trigger allergenic reactions in sensitized individuals
(Prado et al., 2016). Sensitive enough methods are therefore required,
and DNA methods involving DNA amplification have shown to provide
the required sensitivity.
Even though good sensitivity results were obtained, gluten-con-
taining grain samples (two barleys and one rye) were not detected by
qLAMP. Nevertheless, this lack of amplification seemed related to the
extraction protocol rather than to the sensitivity of the technique. In
this sense, it is worth mentioning that even though positive results were
obtained with qPCR, a delay in the Cq values was also observed.
Moreover, in those cases, replicates of the same samples produced in-
consistent amplification. This, in combination with the fact that
whenever flour instead whole grain was used for the analyses, gluten-
containing cereal was always correctly detected, which emphasizes the
hypothesis that it is an issue related to the type of sample rather than to
the performance of the DNA amplification techniques. Indeed, previous
studies have already reported difficulties in the extraction of DNA from
161
Food Chemistry 246 (2018) 156–163
plant/seed samples (Demeke, Malabanan, Holigroski, & Eng, 2017;
Hasan et al., 2012; Xin & Chen, 2012). Although, not the scope of the
present study, these results suggest the need for improving DNA ex-
traction protocols from certain matrixes, and study the effect in dif-
ferent amplification protocols.
In terms of speed, the qLAMP methods proved to be faster than both
qPCRs, being completed the analyses in about 90 min against the
110 min and 140 min for the qPCR-probe and the qPCR-SYBR respec-
tively. This is an advantage of qLAMP approaches over the qPCR
whenever fast results are needed, being possible to reduce it further if a
turbidity or colorimetric product detection is implemented (Arunrut
et al., 2016; Goto, Honda, Ogura, Nomoto, & Hanaki, 2009; Mori et al.,
2004).
The following step consisted in the determination of the LoD (lowest
detectable analyte) which was assessed with pure wheat flour DNA. The
best results were obtained with the qPCR-probe method, followed by
the F3/B3-qPCR and then both qLAMP approaches, proving that qPCR
provides higher sensitivity for the detection of gluten-containing cer-
eals.
Finally, due to the absence of certified reference materials (CRMs)
for wheat, a binary mixture model containing various proportions of
wheat and corn flour was built as described by Martín-Fernández at al.,
(Martín-Fernández et al., 2015). Following this approach, similar re-
sults as those obtained for the LoD with pure wheat DNA were obtained.
In this sense, the lowest quantification limits were obtained with qPCR
reaching 0.005% and 0.01% when using the hydrolysis probe and
SYBR® Green I respectively. It was even possible to detect gluten-con-
taining cereals in lower proportion mixtures (0.002% and 0.001%),
although those samples fell out of the linear range and were not con-
sidered for quantification purposes (Fig. 3a and b). The obtained qPCR
results are in agreement with those reported by Martín-Fernández et al.
(2015).
Regarding the qLAMP methods, the limit of detection and
A. Garrido-Maestu et al.
quantification were 0.005% and 0.1% when the commercial master mix
was selected, while with the in-house master mix the obtained values
were ten times higher (0.1% and 1%). Within the qLAMP assays, more
uniform results among replicates were achieved with the commercial
master mix. This may be related to the higher number of pipetting steps
required for the in-house method (Bst pol, dNTP, buffer, DMSO, pri-
mers, and water) compared to the commercial master mix (mix, DMSO,
primers, and water). Also, the commercial mix contains inorganic
pyrophosphatase thus no pyrophosphate is accumulated, making the
solutions clear even in positive reactions and so avoiding any possible
interference associated with the increase in turbidity in the fluorescence
detection; resulting overall in an enhancement of both limits, detection
and quantification.
5. Conclusions
In the current study four different approaches based on two dif-
ferent DNA amplification techniques were successfully developed,
tested and compared, being this the first study to describe the devel-
opment of a specific method for the detection of gluten based on
qLAMP. All protocols behave equally well in terms of specificity.
Regarding the sensitivity, the best results were obtained by qPCR. It is
worth to highlight that, even though the qLAMP approaches were not
suitable for seeds, they provided the fastest results for the rest of the
samples.
Acknowledgements
This work was supported by a Marie Curie COFUND Action (Project
No: 600375. NanoTRAINforGrowth – INL Fellowship programme in
nanotechnologies for biomedical, environment and food applications),
by the project Nanotechnology Based Functional Solutions (NORTE-01-
0145-FEDER-000019), supported by Norte Portugal Regional
Operational Programme (NORTE2020), under the PORTUGAL 2020
Partnership Agreement, through the European Regional Development
Fund (ERDF), and by NANOIMMUNOTECH S.L. in the framework of the
project Smart Factory for Safe Foods (SF4SF) supported by FEDER
Innterconecta 2015 (EXP-00082964/ITC-20151195).
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in the
online version, at http://dx.doi.org/10.1016/j.foodchem.2017.11.005.
References
Arunrut, N., Kampeera, J., Sirithammajak, S., Sanguanrut, P., Proespraiwong, P.,
Suebsing, R., & Kiatpathomchai, W. (2016). Sensitive visual detection of AHPND
bacteria using loop-mediated isothermal amplification combined with DNA-functio-
nalized gold nanoparticles as probes. PLoS One, 11(3), e0151769.
Bio-Qiagen, C. L. C. (2016). CLC sequence viewer. Denmark: Aarhus.
Bruins Slot, I. D., van der Fels-Klerx, H. J., Bremer, M. G. E. G., & Hamer, R. J. (2015).
Immunochemical detection methods for gluten in food products: Where do we go
from here? Critical Reviews in Food Science and Nutrition, 8398(March), http://dx.doi.
org/10.1080/10408398.2013.847817.
D’Agostino, M., Diez-Valcarce, M., Robles, S., Losilla-Garcia, B., & Cook, N. (2015). A
loop-mediated isothermal amplification-based method for analysing animal feed for
the presence of Salmonella. Food Analytical Methods, 8(10), 2409–2416. http://dx.doi.
org/10.1007/s12161-015-0148-0.
D’Agostino, M., Robles, S., Hansen, F., Ntafis, V., Ikonomopoulos, J., Kokkinos, P., &
Cook, N. (2016). Validation of a loop-mediated amplification/iso 6579-based method
for analysing soya meal for the presence of Salmonella enterica. Food Analytical
Methods, 9(11), 2979–2985. http://dx.doi.org/10.1007/s12161-016-0602-7.
Dahinden, I., von Büren, M., & Lüthy, J. (2001). A quantitative competitive PCR system to
detect contamination of wheat, barley or rye in gluten-free food for coeliac patients.
European Food Research and Technology, 212(2), 228–233. http://dx.doi.org/10.
1007/s002170000252.
Demeke, T., Malabanan, J., Holigroski, M., & Eng, M. (2017). Effect of source of DNA on
the quantitative analysis of genetically engineered traits using digital PCR and real-
time PCR. Journal of AOAC International, 100(2), 492–498. http://dx.doi.org/10.
5740/jaoacint.16-0284 492-498(7).
162
Food Chemistry 246 (2018) 156–163
Diaz-Amigo, C., & Popping, B. (2012). Gluten and gluten-free: Issues and considerations
of labeling regulations, detection methods, and assay validation. Journal of AOAC
International, 95(2), 337–348. http://dx.doi.org/10.5740/jaoacint.SGE_Diaz-Amigo.
Diaz-Amigo, C., & Popping, B. (2013). Real-time PCR analysis of food allergens and
gluten. In David Rodríguez-Lázaro (Ed.). Real-time PCR in food science: Current tech-
nology and applications (pp. 239–252). Burgos: Caister Academic Press.
EFSA (2014). Scientific Opinion on the evaluation of allergenic foods and food ingredients
for labelling purposes. EFSA Journal, 12(11), 1–277. http://dx.doi.org/10.2903/j.
efsa.2014.NNNN.
European Commision (2009). Commission regulation (EC) No. 41/2009 of 20 January
2009 concerning the composition and labeling of foodstuffs suitable for people in-
tolerant to gluten. Official Journal of the European Union, 52(41), 3–5.
Foschia, M., Horstmann, S., Arendt, E. K., & Zannini, E. (2016). Nutritional therapy
-Facing the gap between coeliac disease and gluten-free food. International Journal of
Food Microbiology, 239(2016), 113–124. http://dx.doi.org/10.1016/j.ijfoodmicro.
2016.06.014.
Garrido-Maestu, A., Fuciños, P., Azinheiro, S., Carvalho, J., & Prado, M. (2017).
Systematic Loop-mediated isothermal amplification assays for rapid detection and
characterization of Salmonella spp., Enteritidis and Typhimurium in food samples.
Food Control, 80, 297–306. http://dx.doi.org/10.1016/j.foodcont.2017.05.011.
Goto, M., Honda, E., Ogura, A., Nomoto, A., & Hanaki, K. I. (2009). Colorimetric detection
of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue.
BioTechniques, 46(3), 167–172. http://dx.doi.org/10.2144/000113072.
Hara-Kudo, Y., Yoshino, M., Kojima, T., & Ikedo, M. (2005). Loop-mediated isothermal
amplification for the rapid detection of Salmonella. FEMS Microbiology Letters, 253(1),
155–161.
Haraszi, R., Chassaigne, H., Maquet, A., & Franz, Ulberth. (2011). Analytical methods for
detection of gluten in food-method developments in support of food labeling legis-
lation. Journal of AOA C International, 94(4), 1006–1025.
Hasan, S., Prakash, J., Vashishtha, A., Sharma, A., Srivastava, K., Sagar, F., ... Mishra, S.
(2012). Optimization of DNA extraction from seeds and leaf tissues of
Chrysanthemum (Chrysanthemum indicum) for polymerase chain reaction.
Bioinformation, 8(5), 225–228. http://dx.doi.org/10.6026/97320630008225.
Khorosheva, E. M., Karymov, M. A., Selck, D. A., & Ismagilov, R. F. (2016). Lack of
correlation between reaction speed and analytical sensitivity in isothermal amplifi-
cation reveals the value of digital methods for optimization: Validation using digital
real-time RT-LAMP. Nucleic Acids Research, 44(2), e10. http://dx.doi.org/10.1093/
nar/gkv877.
Ma, X. Jun, Shu, Y., Nie, K. Long, Qin, M., Wang, D. Yan, Gao, R. Bao, ... Dong, X. Ping
(2010). Visual detection of pandemic influenza A H1N1 Virus 2009 by reverse-
transcription loop-mediated isothermal amplification with hydroxynaphthol blue
dye. Journal of Virological Methods, 167(2), 214–217. http://dx.doi.org/10.1016/j.
jviromet.2010.03.027.
Martín-Fernández, B., Costa, J., Oliveira, M. B. P. P., López-Ruiz, B., & Mafra, I. (2015).
Screening new gene markers for gluten detection in foods. Food Control, 56, 57–63.
http://dx.doi.org/10.1016/j.foodcont.2015.02.047.
Miranda-Castro, R., de-Los-Santos-Álvarez, N., Miranda-Ordieres, A. J., & Lobo-Castañón,
M. J. (2016). Harnessing aptamers to overcome challenges in gluten detection.
Biosensors, 6(2), http://dx.doi.org/10.3390/bios6020016.
Mittag, D., Niggemann, B., Sander, I., Reese, I., Fiedler, E. M., Worm, M., ... Reese, G.
(2004). Immunoglobulin E-reactivity of wheat-allergic subjects (baker’s asthma, food
allergy, wheat-dependent, exercise-induced anaphylaxis) to wheat protein fractions
with different solubility and digestibility. Molecular Nutrition and Food Research,
48(5), 380–389. http://dx.doi.org/10.1002/mnfr.200400016.
Mori, Y., Kitao, M., Tomita, N., & Notomi, T. (2004). Real-time turbidimetry of LAMP
reaction for quantifying template DNA. Journal of Biochemical and Biophysical
Methods, 59(2), 145–157. http://dx.doi.org/10.1016/j.jbbm.2003.12.005.
Mujico, J. R., Lombardía, M., Mena, M. C., Méndez, E., & Albar, J. P. (2011). A highly
sensitive real-time PCR system for quantification of wheat contamination in gluten-
free food for celiac patients. Food Chemistry, 128(3), 795–801. http://dx.doi.org/10.
1016/j.foodchem.2011.03.061.
Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., &
Hase, T. (2000). Loop-mediated isothermal amplification of DNA. Nucleic Acids
Research, 28(12), e63. http://dx.doi.org/10.1093/nar/28.12.e63.
Oscorbin, I. P., Belousova, E. A., Zakabunin, A. I., Boyarskikh, U. A., & Filipenko, M. L.
(2015). Comparison of fluorescent intercalating dyes for quantitative loop-mediated
isothermal amplification (qLAMP). BioTechniques, 58(June), 308–317. http://dx.doi.
org/10.2144/000114432.
Prado, M., Boix, A., & von Holst, C. (2012). Novel approach for the simultaneous de-
tection of DNA from different fish species based on a nuclear target: Quantification
potential. Analytical and Bioanalytical Chemistry, 403, 3041–3050. http://dx.doi.org/
10.1007/s00216-012-5852-7.
Prado, M., Ortea, I., Vial, S., Rivas, J., Calo-Mata, P., & Barros-Velázquez, J. (2016).
Advanced DNA- and protein-based methods for the detection and investigation of
food allergens. Critical Reviews in Food Science and Nutrition, 56(16), 2511–2542.
http://dx.doi.org/10.1080/10408398.2013.873767.
Sandberg, M., Lundberg, L., Ferm, M., & Malmheden Yman, I. (2003). Real Time PCR for
the detection and discrimination of cereal contamination in gluten-free foods.
European Food Research and Technology, 217(4), 344–349. http://dx.doi.org/10.
1007/s00217-003-0758-4.
Sapone, A., Bai, J. C., Ciacci, C., Dolinsek, J., Green, P. H. R., Hadjivassiliou, M., ...
Fasano, A. (2012). Spectrum of gluten-related disorders: Consensus on new nomen-
clature and classification. BMC Medicine, 10(1), 13. http://dx.doi.org/10.1186/1741-
7015-10-13.
Stephan, O., & Vieths, S. (2004). Development of a real-time PCR and a sandwich ELISA
for detection of potentially allergenic trace amounts of peanut (Arachis hypogaea) in
A. Garrido-Maestu et al.
processed foods. Journal of Agricultural and Food Chemistry, 52(12), 3754–3760.
http://dx.doi.org/10.1021/jf035178u.
Tomita, N., Mori, Y., Kanda, H., & Notomi, T. (2008). Loop-mediated isothermal ampli-
fication (LAMP) of gene sequences and simple visual detection of products. Nature
Protocols, 3(5), 877–882.
Untergasser, A., Nijveen, H., Rao, X., Bisseling, T., Geurts, R., & Leunissen, J. A. M.
(2007). Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Research,
35(Suppl. 2), W71–W74. http://dx.doi.org/10.1093/nar/gkm306.
Volta, U., Caio, G., Tovoli, F., & De Giorgio, R. (2013). Non-celiac gluten sensitivity:
Questions still to be answered despite increasing awareness. Cellular and Molecular
Immunology, 10(10), 383–392. http://dx.doi.org/10.1038/cmi.2013.28.
Wang, D., Brewster, J., Paul, M., & Tomasula, P. (2015). Two methods for increased
specificity and sensitivity in loop-mediated isothermal amplification. Molecules,
20(4), 6048–6059. http://dx.doi.org/10.3390/molecules20046048.
WHO and FAO. (2010). Joint FAO/WHO food standards programme Codex committee on
163
Food Chemistry 246 (2018) 156–163
food hygiene.
Wieser, H., Koehler, P., & Konitzer, K. (2014). Celiac disease and gluten: Multidisciplinary
challenges and opportunities. In P. Koehler, W. Herbert, & K. Konitzer (Eds.). London:
Academic Press Elsevier.
Xin, Z., & Chen, J. (2012). A high throughput DNA extraction method with high yield and
quality. Plant Methods, 8(1), 26. http://dx.doi.org/10.1186/1746-4811-8-26.
Zeltner, D., Glomb, M. A., & Maede, D. (2009). Real-time PCR systems for the detection of
the gluten-containing cereals wheat, spelt, kamut, rye, barley and oat. European Food
Research and Technology, 228(3), 321–330. http://dx.doi.org/10.1007/s00217-008-
0937-4.
Zhang, G., Brown, E. W., & González-Escalona, N. (2011). Comparison of real-time PCR,
reverse transcriptase real-time PCR, loop-mediated isothermal amplification, and the
FDA conventional microbiological method for the detection of Salmonella spp. in
produce. Applied and Environmental Microbiology, 77(18), 6495–6501. http://dx.doi.
org/10.1128/AEM.00520-11.