Virus Research 243 (2018) 25–30

Contents lists available at ScienceDirect

Virus Research
journal homepage: www.elsevier.com/locate/virusres

Transcriptional analysis of the putative glycosyltransferase gene (amv248) of MARK

the Amsacta moorei entomopoxvirus
⁎
Cihan Inana,b, Hacer Muratoglub, Basil M. Arifc, Zihni Demirbaga,
a
Department of Biology, Faculty of Sciences, Karadeniz Technical University, Trabzon, Turkey
b
Department of Molecular Biology and Genetics, Faculty of Sciences, Karadeniz Technical University, Trabzon, Turkey
c
Laboratory for Molecular Virology, Great Lakes Forestry Centre, Sault Ste. Marie, Ontario, Canada

A R T I C L E I N F O A B S T R A C T

Keywords: Amsacta moorei entomopoxvirus (AMEV), the most studied member of the genus Betaentomopoxvirus, was in-
Amsacta moorei entomopoxvirus itially isolated from Red Hairy caterpillar larvae, Amsacta moorei. According to genome sequence and previous
AMEV studies it was shown that amv248 encodes a putative glycosyltransferase that is the only conserved attachment
Glycosyltransferase protein in betaentomopoxviruses. Transcriptional analysis of the amv248 gene by RT-PCR and qPCR showed that
Transcriptome
transcription starts at 6 h post infection (hpi). Also, transcription was not affected by a DNA replication inhibitor
AMV248
but was severely curtailed by a protein synthesis inhibitor. These results indicate that amv248 belongs to the
intermediate class of gene expression. 5′ and 3′ untranslated regions analysis revealed that transcription initiates
at position –126 relative to the translational start site, and ends between 50 and 83 bases after the stop codon. To
narrow down the size and location of the gene’s promoter, the upstream region as well as several different sized
deletions thereof were generated and cloned upstream of a luciferase reporter gene. The constructs were used to
measure the Firefly and Renilla luciferase activities in dual assays. The results showed that luciferase activity
decreased when bases –198 to –235 of amv248 upstream region were missing. Sequence analysis among the
intermediate gene promoters of AMEV showed that TTTAT(T/A)TT(T/A)2TTA is possibly a common motif,
however, further investigations are needed to confirm this conclusion.

1. Introduction
Poxviruses have a linear terminally closed dsDNA genome, replicate
in the cytoplasm and infect both vertebrate and invertebrate hosts
(Moss, 2012). They belong to the family Poxviridae. A member of this
family is Variola virus that caused millions of deaths around the world
and, due to concerted efforts by the World Health Organization (WHO),
it was eradicated in 1977. Poxviruses are considered large viruses,
composed of a rather complex structure and have been classified into
two subfamilies, the Chordopoxvirinae infecting vertebrates and the
Entomopoxvirinae infecting invertebrates. Discovery of en-
tomopoxviruses is attributed to Vago (Vago, 1963) and the subfamily
has 3 genera depending on the host insect, Alpha-, Beta- and Gam-
maentomopoxvirus, and an unclassified genus. Amsacta moorei en-
tomopoxvirus (AMEV) is the type species of the genus Betaentomo-
poxvirus that infects lepidopteran and orthopteran insects (Ozsahin
et al., 2014; Schmidt et al., 2012).
While most members of the genus Betaentomopoxvirus do not re-
plicate in cell culture, AMEV is easily grown and manipulated in cell
lines originally derived from Lymantria dispar (Ld652) (Winter et al.,
1995) and Estigmene acrea (EAA-BTI) (Granados and Naughton, 1975;
Marlow et al., 1993). AMEV is a potential candidate in gene therapy
and expression vectors (Ozsahin et al., 2014). As with baculoviruses,
entomopoxviruses are distinguished by being occluded in a proteinic
matrix called spheroids at the end of the replication cycle. The major
structural protein of spheroids is called spheroidin and is not essential
for virus replication (Perera et al., 2010). Spheroids afford the virions a
certain amount of protection from environmental inactivating agents
such as heat and desiccation (Hall and Moyer, 1991; Palmer et al.,
1995; Rohrmann, 1986). Bawden and her colleagues have sequenced
the AMEV genome and found it to consist 232,392 bases with 294 open
reading frames (ORFs) potentially encoding proteins of 60 or more
amino acids (Bawden et al., 2000). Later on, Guo and Yu (2007) have
re-analyzed AMEV genome, and indicated that it has 256 active protein
coding ORFs (Guo and Yu, 2007). To date, while seven entomopoxvirus
genomes have been fully sequenced, AMEV is the most studied so far
(Afonso et al., 1999; Bawden et al., 2000; Mitsuhashi et al., 2014; Thézé
et al., 2013).
In order to understand the molecular mechanisms of the virus re-
plication, several genes of AMEV have been studied to a certain detail.

⁎
Corresponding author.
E-mail address: zihni@ktu.edu.tr (Z. Demirbag).

http://dx.doi.org/10.1016/j.virusres.2017.10.006
Received 17 August 2017; Received in revised form 5 October 2017; Accepted 7 October 2017
Available online 08 October 2017
0168-1702/ © 2017 Elsevier B.V. All rights reserved.
C. Inan et al. Virus Research 243 (2018) 25–30

In previous studies spheroidin (Hall and Moyer, 1991; Marlow et al., Table 1
1998; Palmer et al., 1995), thymidine kinase (Gruidl et al., 1992), fi- Primers used in experiments.
lament-associated late protein (Alaoui-Ismaili and Richardson, 1998,
Primer Sequence (5′–3′)
1996), NAD+-dependent DNA ligase (Sriskanda et al., 2001), DNA to-
poisomerase (Petersen et al., 1997), SOD (Becker et al., 2004), iap (Li Transcriptional Analysis
et al., 2005a,b), p33 (Means et al., 2007), poly (A) polymerase (Becker GT-FW/GT-SP1-Fw GCATGTGCGTCATCACATA
GT-RV/GT-SP1-Rv TGCATTCTCCGCAACATC
et al., 2008), protein kinase (Muratoglu et al., 2016; Muratoğlu et al.,
GT-SP2-Rv CCCATCGAAACGTGAAACTT
2010), photolyase (Nalcacioglu et al., 2010) and esterase (Ozsahin GT-SP3-Rv GTGATGACGCACATGCTAAA
et al., 2014; Özsahin et al., 2015) genes have been functionally or polyG GACCACGCGTATCGATGTCGACGGGGGGGGGGGGGGGGV
transcriptionally characterized. However to date, no common tran- Anchor GACCACGCGTATCGATGTCGAC
scriptional and structural motif has been suggested for the AMEV genes GT-SP6-Fw GTAGATGTTGCGGAG
GT-UTR1-Rv CAACAAAAAACAATAATATCATTTATC
expression.
GT-UTR2-Rv CACAATAAAAAAATATACAACAAAAAA
The ORF amv248 was previously designated as a putative glyco- GT-UTR3-Rv GCATTTTCAAAAATTAATTTATCTAAATATAATC
syltransferase gene based on sequence analysis (Bawden et al., 2000).
qPCR Analysis
Further analysis showed that it has two conserved domains, one clas- GT-qFW/GT-SP2F TGGGAACTACCATCAAATCAACC
sified it into the glycosyltransferase family. Also Markine-Goriaynoff GT-qRV CAACCCATCGAAACGTGAAAC
reviewed glycosyltransferases (GT) and showed that two putative gly- Promoter Analysis
cosyltransferases (MSV206 (Afonso et al., 1999) and AMV248 (Bawden AMV248- GAAGATCTGAATGCATGATTAAAGTTATGTAT
et al., 2000)) are found in entomopoxvirus genomes (Markine- Promoter-F1
Goriaynoff et al., 2004). In recent studies, according to the sequence AMV248- GAAGATCTTGACTATGATAACAAATGAACGAAGA
Promoter-F2
analysis it was shown that ACV112 (Alphaentomopoxvirus) and
AMV248- GAAGATCTTTATATTTATTATTATAGTTTATGTATGA
AHEV225, CBEV285, CREV252 and MySEV274 (Betaentomopoxvirus) Promoter-F3
also encode putative glycosyltransferase (GT) proteins that show simi- AMV248- GAAGATCTAGAGAGATAATGCCAGAAG
larity with AMV248 but there are no additional studies about any en- Promoter-F4
AMV248- GAAGATCTCATATTGAAGATGTGTACGAAACTGA
tomopoxviral glycosyltransferases (Mitsuhashi et al., 2014; Thézé et al.,
Promoter-F 5
2013). Another conserved region of AMV248 suggests that this protein AMV248- GAAGATCTTCTAAGAGCATTGGATAATT
is a member of intracellular mature virion membrane protein family in Promoter-F6
which Vaccinia virus heparin sulfate binding protein H3 is another AMV248- CCCAAGCTTGTAATCTGTCAGAATTTCTTTTAATTG
member. H3 is one of the four attachment proteins in Vaccinia virus and Promoter-Rev

the only conserved attachment protein in both chordopoxviruses and

entomopoxviruses. This protein has been well studied transcriptionally,
arabinofuranoside (Ara-C, Sigma; a DNA replication inhibitor) or with
functionally and structurally (da Fonseca et al., 2000a,b; Davies et al.,
cycloheximide (CHX, Sigma; a protein synthesis inhibitor) at final
2005; Lin et al., 2000; Moss, 2012; Singh et al., 2016).
concentrations of 200 and 100 μg/ml, respectively. The cells were
Collectively, the data suggest that amv248 encodes a putative gly-
harvested at 8 hpi.
cosyltransferase protein similar to Vaccinia virus H3 and has a sig-
One ml Trizol Reagent (Ambion) was added to each of infected and
nificant role in the initiation of virus replication. The present study was
uninfected cells in preparation for RNA extraction. Then, 0.2 ml
focused on the transcription of AMV248 and identification of its tem-
chloroform was added to each sample and incubated for 5 min at room
poral class along with studies on the 5′ and 3′ untranslated regions
temperature. The mixture was centrifuged at 12000g at 4 °C to separate
(UTRs) and promoter region.
the two phases. The upper phase was transferred to a new micro-
centrifuge tube, 0.5 ml isopropanol was added and incubated for
2. Material methods
10 min at 4 °C. Total RNA was pelleted at 12,000 g in a microfuge for
10 min at 4 °C. The pellet was washed with 75% ethanol, centrifuged at
2.1. Cells and virus
7500g and air dried. It was resuspended with 30 μl ddH2O and in-
cubated at 60 °C to linearize the RNA. Total RNA was treated with
The Ld652 cell line and wild-type AMEV stock used in this study
DNase I (Sigma).
were provided by Dr. R.W. Moyer (University of Florida, Gainesville,
Reverse transcription PCR (RT-PCR) was performed to detect the
USA). The cell line was maintained in 45% Excell-420 (Sigma) and 45%
target transcript. For this purpose, 2 μg of DNase-treated RNA was re-
Grace’s serum-free insect medium (Sigma) supplemented with 10%
verse transcribed with 200 units of M-MLV reverse transcriptase
fetal bovine serum (Gibco) at 28 °C. Ld652 cells were seeded at density
(Invitrogen) and 500 nM of oligo dT reverse primers (Table 1) in a total
of 1 × 105 cells/cm2 and infected with AMEV at a multiplicity of in-
reaction volume of 20 μl. Reactions were incubated at 37 °C for 50 min
fection (MOI) of 0.1. The virus was allowed to attach to the cell
and inactivated by heating at 70 °C for 15 min. The synthesized first-
monolayers at 28 °C while rocking gently on a platform (Heidolph) for
strand cDNA including all time course and transcriptional class samples
2 h. Then the inoculum was discarded and the cells were washed with
with mock inoculated control were amplified by PCR using specific
serum free medium. Fresh growth medium with FBS was added and
forward and reverse primers (Table 1). PCR was performed in a final
incubated at 28 °C. The cells were screened for cytopathic effects to
volume of 50 μl containing 200 nM each primer, 0.2 mM each dNTP in
indicate virus replication. Virus titers were determined by the endpoint
enzyme buffer and 0.5 units of Taq DNA polymerase (Promega). Am-
dilution assay (EPDA) at 4 days post infection (dpi) (Reed and Muench,
plification was carried out under the following conditions: 1 cycle of
1938).
denaturation at 95 °C for 3 min, 35 cycles of denaturation at 95 °C for
1 min, annealing at 56 °C for 30 s and extension at 72 °C for 1 min,
2.2. Temporal transcription of amv248
followed by a final cycle of elongation at 72 °C for 7 min. The PCR
products were analyzed in 1% agarose gels and stained with ethidium
Ld652 cells were seeded at a density of 9 × 105 cells/well in 6-well
bromide.
plates, allowed to attach overnight then infected with AMEV at an MOI
of 2. Infected cells were then harvested at 0, 3, 6, 12 and 24 h post
infection (hpi). To identify the transcriptional class, cells were pre-
treated for 1 h prior to infection with either cytosine β-D-

26
C. Inan et al.
2.3. Transcriptional kinetics of amv248
Quantitative real-time polymerase chain reaction (qPCR) was per-
formed with 5X HOT FIREPol EvaGreen qPCR Mix Plus (Solis BioDyne)
on the CFX Connect Platform (Bio-Rad). The primer pairs used in the
reactions are listed in Table 1. The PCR conditions were as follows:
initial denaturation 95 °C for 12 min, followed by 45 cycles of 95 °C for
15 s (denaturation), 58 °C for 30 s (annealing) and 72 °C for 30 s (ex-
tension). Gene expression was normalized to a housekeeping gene
(actin), that was previously tested and no significant differences in
expression level are found between 0 and 24 h after AMEV infection
(data not shown) and relative expression was calculated. Target gene
levels are presented as a ratio of levels in treated versus corresponding
control groups, according to the ΔΔCq method (Bio-Rad Real-Time PCR
Applications Guide).
2.4. Detection of the 5′ untranslated region (UTR)
The 5′ UTR of the amv248 mRNA was determined by rapid ampli-
fication of cDNA ends (RACE) using a 3′/5′ RACE Kit (Roche). First-
strand cDNA was synthesized from 2 μg of DNase-treated RNA at 24 hpi
using the primer GT-SP1-Rv (Table 1). Because of the high AT content
of the AMEV genome, the purified cDNA was tailed with poly dG. This
cDNA was then used as a template for PCR with the GT-SP2-Rv primer
and oligo dG anchor primer. The PCR product was then used as tem-
plate in second PCR by using GT-SP3-Rv and PCR anchor (Roche) pri-
mers. The final PCR product was analyzed on a 1% agarose gel and the
detected band was cloned into pGEM-T Easy Vector (Promega). Then
colonies were selected from petri dish and then clones were validated
with restriction analysis. After that validated ten clones were Sanger
sequenced (Macrogen, Netherlands) using both T7 and SP6 primers in
pGEM-T vector (Promega) for further analysis.
2.5. Detection of 3′ UTR
The 3′ UTR of the amv248 mRNA was determined by PCR amplifi-
cation. To identify the putative termination region, 3 reverse primers
were selected (Table 1). Total RNA was isolated from infected cells at
24 hpi and treated with DNaseI. The RNA was used as a template for
cDNA synthesis using oligo-dT primer supplied with 3′/5′ RACE kit
(Roche). After cDNA synthesis, PCR was performed using GT-SP6-Fw
and GT-UTR1-Rv, GT-UTR2-Rv and GT-UTR3-Rv primers. The products
were analyzed on 1% agarose gel and the detected bands then gel
purified. Obtained products were then Sanger sequenced (Macrogen,
Netherlands) using specific primers, and sequences were confirmed.
2.6. Promoter analysis
Promoter analysis was performed as described by Ozsahin et al.,
(Ozsahin et al., 2014). Seven primers (Table 1) were designed to
27
Virus Research 243 (2018) 25–30
Fig. 1. Quantitative analysis of amv248 gene transcription.
qRT-PCR was carried out using total-RNA isolated from
AMEV infected cells with MOI of 2 at 0, 3, 6, 12 and 24 hpi.
Each bar shows standard errors for loaded three independent
samples in experiment.
generate PCR fragments that may include the promotor region of
amv248. The amplified putative promotor regions were ligated into the
pSP-Luc-NF vector. In order to investigate promoter regions, Ld652
cells were seeded at 9 × 105 per well of 6-well plate and incubated
overnight. The cells were infected with AMEV at an MOI of 2. After 4
hpi, the cells were co-transfected with 2 μg of generated recombinant
plasmids and 2 μg of the internal control plasmid pIC-IE-1 with the aid
of Cellfectin (Invitrogen). The control plasmid consisted of the Auto-
grapha californica nucleopolyhedrovirus immediate early 1 (IE-1)
promoter region and the hr5 region (Jarvis et al., 1996) upstream of the
Renilla luciferase reporter gene in the pRL-nul vector (Promega) and
used to normalize transfection. After 24 h of incubation, cells were
harvested and the Firefly and Renilla luciferase activities were mea-
sured by Dual- Luciferase Reporter Assay System (Promega) according
to the manufacturer’s instructions.
3. Results
3.1. Transcriptional level, time and temporal class of amv248
To determine the transcriptional level, time and class of amv248,
total RNA was extracted from infected and uninfected cells and treated
with DNaseI. The RNA samples were used as template to synthesize
cDNA. RT-qPCR time course analysis showed that although transcrip-
tion started at 3 hpi, the level over background was not statistically
significant (Fig. 1). These results also confirmed with conventional PCR
that showed transcription levels of amv248 increases gradually at 6, 12
and 24 hpi (data not shown).
Transcription of amv248 was not affected by an inhibitor of DNA
replication (Ara-C), however, a protein synthesis inhibitor (CHX) pre-
vented transcription totally (Fig. 2). The data demonstrate that amv248
belongs to intermediate transcription class of EPV gene expression.
3.2. 5′/3′ UTR of amv248
Typically, a functional gene consists of a translation sequence in-
cluding start and stop codons and also untranslated regions (UTRs; in
Fig. 2. Determination of the transcriptional class of amv248 gene by RT-PCR. The ex-
pected product size was 654 bp. (Marker: 100 bp standards, Control: sample from mock
infected Ld652 cells, AMEV: Cells were infected in the presence of either the DNA re-
plication inhibitor, Ara-C, or a protein synthesis inhibitor, CHX.
C. Inan et al. Virus Research 243 (2018) 25–30

Fig. 3. Transcription initiation site of amv248 gene (5′ UTR).

Dashed underline: Anchor primer polyC region. Dashed long
underline: GT-SP3-Fw primer, * Matching sequences. Arrow
shows transcriptional initiation base (−126). Rectangle
shows start codon.

both upstream and downstream regions). To determine a function, 5′

and 3′ UTR regions of a gene should be studied transcriptionally. Rapid
amplification of cDNA ends (RACE) method is commonly used for de-
tection of UTR regions (Ozsahin et al., 2014). This technique is based on
detection of UTR regions using gene specific primers with predesigned
poly-Nucleotide tagged and anchor primers. Also determining UTR re-
gions are important to understand viral promoter regions. 5′ UTR re-
gion of amv248 was determined using a modified protocol of the user’s
manual from Roche 5′/3′ RACE kit was applied. Since the genome of
AMEV is A-T rich, polyG tail ligated to 5′ end of cDNA produced with
GT-SP1-Rv primer. PolyC and GT-SP2-Rv primers pair were used to
synthesize the first PCR product then an additional PCR was performed
with anchor and GT-SP3-Rv primers. The final product was analyzed on
a 1% agarose gel, cloned into pGEM-T Easy vector and used to trans-
form E. coli JM101 competent cells. Plasmid DNA from selected co-
lonies was extracted and digested with EcoRI to validate the correct
Fig. 5. Activity of luciferase reporter gene constructs for promoter analysis of amv248.
fragment and sequenced. Sequence results show that amv248 tran-
The X-axis shows the ratio of firefly luciferase activity to Renilla luciferase activity for
scription starts at 126 bases upstream of the translational start codon each fragment of amv248,and the Y-axis shows fragment size of each generated plasmid.
(Fig. 3).
The 3′ untranslated region of amv248 was detected by specific PCR.
4. Discussion
Random primers (3 reverse and 1 forward) were designed for the
downstream region. Single strand cDNA was synthesized from 2 μg RNA
To date, 13 different AMEV genes have been transcriptionally stu-
using oligo-dT as a reverse primer and this template then used as a
died (Table 2) but none is involved in the entry fusion complex that
template for PCR amplification using 3 different primers. The products
facilitates entry of the virus into permissive cells. The entry fusion
were then analyzed by gel electrophoresis (Fig. 4) and acquired pro-
complex of vaccinia virus has been elucidated to a certain extent and
ducts were sequenced and validated. The results showed that amv248 3′
the H3 component of this complex is a homolog of amv248. H3 has been
UTR is located between 50 and 83 bases after stop codon.
studied transcriptionally and functionally [33–36]. However, the data
presented here are the first structural and transcriptional study of an
AMEV gene, the product of which is likely to be essential for viral at-
3.3. The promoter region of amv248
tachment and entry fusion mechanism.
Time course analysis demonstrated that transcription of amv248
To determine the promoter region of amv248 gene, 6 recombinant
starts at 6 hpi and continued for 24 h. The results were confirmed by
plasmids containing 387, 314, 269, 235, 198, 126 bp of amv248 up-
quantitative PCR. This information is exactly similar to another inter-
stream of the start site were generated and corrected via sequencing.
mediate gene, lipase of AMEV (Ozsahin et al., 2014).
The generated plasmids and the control (pIC-IE) were used to measure
The transcriptional class of amv248 was determined by employing
the expression level as indicated by luciferase activity. The results
inhibitors of either DNA replication or protein synthesis. This is the
showed that the most luciferase activity loss occurred when bases in
most common approach for determining viral transcription classes
upstream region between –198 and –235 were missing (Fig. 5). These
(Muratoğlu et al., 2010; Nalcacioglu et al., 2010; Ozsahin et al., 2014).
findings indicate that the promoter region of amv248 includes the
Viral genes that belong to early class of gene expression are transcribed
missing bases.
in the presence of an inhibitor of DNA replication (ex. Ara-C) or a
protein synthesis inhibitor (CHX). However, transcription of the late
genes is prevented by either inhibitor. Genes that are transcribed in the
presence of Ara-C but not CHX are termed intermediate genes. Tran-
scription of amv248 and amv133 designates them as intermediate genes
(Table 2).
While vaccinia virus genes have been transcriptionally divided into
three distinct classes as early, intermediate and late genes, all ORFs of
AMEV were divided into 4 distinct groups named early (109 ORF),
potentially early (26 ORF), late (75 ORF) and potentially late (79 ORF)
Fig. 4. PCR amplified 3′ UTR products for transcription termination region analysis.
based on their specific motif sequences in upstream regions (Bawden
Bands yielded by GT-UTR1 and GT-UTR2 primers were used to determine the 3′ UTR after
et al., 2000). It was suggested that amv248 is a potentially late gene
sequence analysis..

28
C. Inan et al.
Table 2
Summary of transcriptional studies of some AMEV genes.
ORF Gene name Transcription starts at Transcription presence
(hpi) Ara-C
amv016 thymidine kinase 3 +
amv197 protein kinase 4 +
amv038 Poly(A) polymerase 6 +
amv133 Lipase 6 +
amv025 dna photolyase 8 –
amv248 Putative glycosyltransferase 6 +
a
ND: Not determined.
strictly based on the vaccinia late promoter upstream sequence motif,
TAAAT (Davison and Moss, 1989). In earlier studies, Becker et al.
(2008) mentioned the early/late transcription of amv038 and Ozsahin
et al. (2014) showed that amv133 that encodes lipase is an intermediate
gene (Becker et al., 2008; Ozsahin et al., 2014). As in the case of
amv133, our findings showed that amv248 requires host protein
synthesis while DNA replication is not necessary for its function.
Therefore, amv248 is an intermediate AMEV gene.
Structural studies on a gene also include determination of the un-
translated regions and promoter region. The 5′ and 3′ UTR and pro-
moter regions of amv248 were determined in this study. Unlike many
other viruses, the AMEV genome is very A-T rich. For this reason, we
modified 5′ RACE method slightly and added polyG tag to the 5′ end of
the gene. The results showed that transcription of amv248 gene starts
with guanine base at base 126 upstream of the translational start site. In
order to determine transcription termination region, PCR based method
was followed. Our results indicated that transcription of amv248 gene
terminates between 50 and 83 bases after the stop codon.
A previous study on amv133 gene showed that it has a 77 bp of 5′
UTR region, however, no data on the 3′ UTR was offered (Ozsahin et al.,
2014). To date, the gene encoding protein kinase was the only one
whose 5′ and 3′ UTRs were determined (Muratoğlu et al., 2010). This
gene has 54 bp of 5′ UTR and two 3′ UTR transcripts of 22 and 32
nucleotides long, respectively.
To determine promoter region in amv248 and hence the conserved
regions in the intermediate transcriptional class of AMEV genes, dual
luciferase assays were performed. The results showed that the promoter
activity decreased when the bases between –198 and –235 were de-
leted. Therefore, this is the part of the genome where, at least most of
the promoter region is located. Further investigations are required to
narrow down the exact promoter region. Sequence alignments of in-
termediate genes amv133 and amv248 promoter regions indicate that
“TTTATATTTATTA” sequence showed homology to the sequence
mentioned before by Ozsahin et al. (2014). However, further in-
vestigations are needed to confirm that this is a common promotor
motif for intermediate genes.
Taking all the data collectively, all the results obtained in this study
showed that amv248 gene is transcriptionally active, expressed as an
intermediate gene and its transcription starts between 3 and 6 h post
infection. Also, at least part or most of the promoter region is from –235
and –198 bases, and the transcript of the gene varies between 1046 and
1080 bases in length with both 5′ and 3′ UTR regions (Fig. 6).
While Yang et al. (2011) have determined that the VACV h3l or-
tholog of amv248 encodes a protein in intermediate gene class (Yang
29
Virus Research 243 (2018) 25–30
Transcription presence Gene Class Reference
CHX
NDa early Becker et al. (2004)
+ early
NDa early late Becker et al. (2008)
– intermediate Ozsahin et al. (2014)
– late Nalcacioglu et al. (2010); Ozsahin
et al. (2014)
– intermediate This study
Fig. 6. Transcriptional structure scheme of amv248
gene. Scheme shows that amv248 transcript varies
between 1046 and 1079 bases. While grey region
shows amv248 open reading frame, blue and pink
regions indicate the conserved protein family se-
quences. (For interpretation of the references to
colour in this figure legend, the reader is referred to
the web version of this article.)
et al., 2011), the current study showed that both AMV248 and H3
proteins have conserved sequences that belong to the intermediate
transcriptional class.
Acknowledgment
This work was supported financially by The Scientific and
Technological Research Council of Turkey, TUBITAK, [Project No.
113Z219].
References
Özsahin, E., Sezen, K., Demirbag, Z., 2015. Amsacta moorei entomopoxvirus encodes a
functional esterase (amv133) with protease activity. Intervirology 58, 41–48. http://
dx.doi.org/10.1159/000369018.
Afonso, C.L., Tulman, E.R., Lu, Z., Oma, E., Kutish, G.F., Rock, D.L., 1999. The genome of
Melanoplus sanguinipes entomopoxvirus. J. Virol. 73, 533–552.
Alaoui-Ismaili, M.H., Richardson, C.D., 1996. Identification and characterization of a fi-
lament-associated protein encoded by Amsacta moorei entomopoxvirus. J. Virol. 70,
2697–2705.
Alaoui-Ismaili, M.H., Richardson, C.D., 1998. Insect virus proteins (FALPE and p10) self-
associate to form filaments in infected cells. J. Virol. 72, 2213–2223.
Bawden, a L., Glassberg, K.J., Diggans, J., Shaw, R., Farmerie, W., Moyer, R.W., 2000.
Complete genomic sequence of the Amsacta moorei entomopoxvirus: analysis and
comparison with other poxviruses. Virology 274, 120–139. http://dx.doi.org/10.
1006/viro.2000.0449.
Becker, M.N., Greenleaf, W.B., Ostrov, D.A., Moyer, R.W., 2004. Amsacta moorei en-
tomopoxvirus expresses an active superoxide dismutase. J. Virol. 78, 10265–10275.
http://dx.doi.org/10.1128/JVI.78.19.10265.
Becker, M.N., Todd, T.M., Moyer, R.W., 2008. An Amsacta moorei entomopoxvirus or-
tholog of the poly(A) polymerase small subunit exhibits methyltransferase activity
and is non-essential for virus growth. Virology 375, 624–636. http://dx.doi.org/10.
1016/j.virol.2008.02.023.
Davies, D.H., McCausland, M.M., Valdez, C., Huynh, D., Hernandez, J.E., Mu, Y., Hirst, S.,
Villarreal, L., Felgner, P.L., Crotty, S., 2005. Vaccinia virus H3L envelope protein is a
major target of neutralizing antibodies in humans and elicits protection against lethal
challenge in mice. J. Virol. 79, 11724–11733.
Davison, A.J., Moss, B., 1989. Structure of vaccinia virus late promoters. J. Mol. Biol. 210,
771–784. http://dx.doi.org/10.1016/0022-2836(89)90108-3.
Granados, R.R., Naughton, M., 1975. Development of Amsacta moorei entomopoxvirus in
ovarian and hemocyte cultures from Estigmene acrea larvae. Intervirology 5, 62–68.
Gruidl, M.E., Hall, R.L., Moyer, R.W., 1992. Mapping and molecular characterization of a
functional thymidine kinase from Amsacta moorei entomopoxvirus. Virology 186,
507–516.
Guo, F.-B., Yu, X.-J., 2007. Re-prediction of protein-coding genes in the genome of
Amsacta moorei entomopoxvirus. J. Virol. Methods 146, 389–392. http://dx.doi.org/
10.1016/j.jviromet.2007.07.010.
Hall, R.L., Moyer, R.W., 1991. Identification, cloning, and sequencing of a fragment of
Amsacta moorei entomopoxvirus DNA containing the spheroidin gene and three
vaccinia virus-related open reading frames. J. Virol. 65, 6516–6527.
Jarvis, D.L., Weinkauf, C., Guarino, L.A., 1996. Immediate-early baculovirus vectors for
foreign gene expression in transformed or infected insect cells. Protein Exp. Purif. 8,
191–203. http://dx.doi.org/10.1006/prep.1996.0092.
C. Inan et al.
Li, Q., Liston, P., Moyer, R.W., 2005a. Functional analysis of the inhibitor of apoptosis
(iap) gene carried by the entomopoxvirus of Amsacta moorei. J. Virol. 79,
2335–2345. http://dx.doi.org/10.1128/JVI.79.4.2335-2345.2005.
Li, Q., Liston, P., Schokman, N., Ho, J.M., Moyer, R.W., 2005b. Amsacta moorei
Entomopoxvirus inhibitor of apoptosis suppresses cell death by binding Grim and
Hid. J. Virol. 79, 3684–3691. http://dx.doi.org/10.1128/JVI.79.6.3684-3691.2005.
Lin, C.-L., Chung, C.-S., Heine, H.G., Chang, W., 2000. Vaccinia virus envelope H3L
protein binds to cell surface heparan sulfate and is important for intracellular mature
virion morphogenesis and virus infection in vitro and In vivo. J. Virol. 74,
3353–3365. http://dx.doi.org/10.1128/JVI.74.7.3353-3365.2000.
Markine-Goriaynoff, N., Gillet, L., Van Etten, J.L., Korres, H., Verma, N.,
Vanderplasschen, A., 2004. Glycosyltransferases encoded by viruses. J. Gen. Virol.
85, 2741–2754. http://dx.doi.org/10.1099/vir.0.80320-0.
Marlow, S.A., Billam, L.J., Palmer, C.P., King, L.A., 1993. Replication and morphogenesis
of Amsacta moorei entomopoxvirus in cultured cells of Estigmene acrea (salt marsh
caterpillar). J. Gen. Virol. 74, 1457–1461. http://dx.doi.org/10.1099/0022-1317-74-
7-1457.
Marlow, S.A., Wilson, L.E., Lawrie, A.M., Wilkinson, N., King, L.A., 1998. Assembly of
Amsacta moorei entomopoxvirus spheroidin into spheroids following synthesis in
insect cells using a baculovirus vector 1. pp. 623–628.
Means, J.C., Penabaz, T., Clem, R.J., 2007. Identification and functional characterization
of AMVp33, a novel homolog of the baculovirus caspase inhibitor p35 found in
Amsacta moorei entomopoxvirus. Virology 358, 436–437. http://dx.doi.org/10.
1016/j.virol.2006.08.043.
Mitsuhashi, W., Miyamoto, K., Wada, S., 2014. The complete genome sequence of the
Alphaentomopoxvirus Anomala cuprea entomopoxvirus, including its terminal
hairpin loop sequences, suggests a potentially unique mode of apoptosis inhibition
and mode of DNA replication. Virology 452–453, 95–116. http://dx.doi.org/10.
1016/j.virol.2013.12.036.
Moss, B., 2012. Poxvirus cell entry: how many proteins does it take? Viruses 4, 688–707.
http://dx.doi.org/10.3390/v4050688.
Muratoğlu, H., Nalçacıoğlu, R., Demirbağ, Z., 2010. Transcriptional and structural ana-
lyses of Amsacta moorei entomopoxvirus protein kinase gene (AMV197, pk). Ann.
Microbiol. 60, 523–530. http://dx.doi.org/10.1007/s13213-010-0082-8.
Muratoglu, H., Nalcacioglu, R., Arif, B.M., Demirbag, Z., 2016. Genome-wide analysis of
differential mRNA expression of Amsacta moorei entomopoxvirus, mediated by the
gene encoding a viral protein kinase (AMV197). Virus Res. 215, 25–36. http://dx.doi.
org/10.1016/j.virusres.2016.01.010.
Nalcacioglu, R., Dizman, Y.A., Vlak, J.M., Demirbag, Z., van Oers, M.M., Akturk, Y., Vlak,
J.M., Demirbag, Z., Van Oers, M.M., 2010. Amsacta moorei entomopoxvirus encodes
a functional DNA photolyase (AMV025). J. Invertebr. Pathol. 105, 363–365. http://
dx.doi.org/10.1016/j.jip.2010.06.013.
Ozsahin, E., Sezen, K., Demirbag, Z., 2014. Transcriptional analysis of ORF amv133 of
30
Virus Research 243 (2018) 25–30
Amsacta moorei entomopoxvirus. Arch. Virol. 159, 2541–2547. http://dx.doi.org/
10.1007/s00705-014-2096-1.
Palmer, C.P., Miller, D.P., Marlow, S.A., Wilson, L.E., Lawrie, A.M., King, L.A., 1995.
Genetic modification of an entomopoxvirus: deletion of the spheroidin gene does not
affect virus replication in vitro. J. Gen. Virol. 76 (Pt 1), 15–23.
Perera, S.C., Wong, P., Krell, P.J., Arif, B.M., 2010. Expression of heterologous genes in
the Amsacta moorei entomopoxvirus. J. Virol. Methods 165, 1–8. http://dx.doi.org/
10.1016/j.jviromet.2009.05.015.
Petersen, B.O., Hall, R.L., Moyer, R.W., Shuman, S., 1997. Characterization of a DNA
topoisomerase encoded by Amsacta moore entomopoxvirus. Virology 230, 197–206
S0042682297984956 [pii].
Reed, L.J., Muench, Hugo, 1938. A simple method of estimating fifty per cent endpoints.
Am. J. Hyg. 27, 493–497. http://dx.doi.org/10.1016/j.jvs.2011.05.096.
Rohrmann, G.F., 1986. Polyhedrin structure. J. Gen. Virol. 67, 1499–1513. http://dx.doi.
org/10.1099/0022-1317-67-8-1499.
Schmidt, F.I., Bleck, C.K.E., Mercer, J., 2012. Poxvirus host cell entry. Curr. Opin. Virol. 2,
20–27.
Singh, K., Gittis, A.G., Gitti, R.K., Ostazeski, S.A., Su, H.-P., Garboczi, D.N., 2016. The
vaccinia virus H3 envelope protein, a major target of neutralizing antibodies, exhibits
a glycosyltransferase fold and binds UDP-glucose. J. Virol. 90http://dx.doi.org/10.
1128/JVI.02933-15. JVI. 02933-15.
Sriskanda, V., Moyer, R.W., Shuman, S., 2001. NAD+-dependent DNA ligase encoded by
a eukaryotic virus. J. Biol. Chem. 276, 36100–36109. http://dx.doi.org/10.1074/jbc.
M105643200.
Thézé, J., Takatsuka, J., Li, Z., Gallais, J., Doucet, D., Arif, B., Nakai, M., Herniou, E.A.,
2013. New insights into the evolution of Entomopoxvirinae from the complete
genome sequences of four entomopoxviruses infecting Adoxophyes honmai,
Choristoneura biennis, Choristoneura rosaceana, and Mythimna separata. J. Virol.
87, 7992–8003. http://dx.doi.org/10.1128/JVI.00453-13.
Vago, C., 1963. A new type of insect virus. J. Invertebr. Pathol. 5, 275–276.
Winter, J., Hall, R.L., Moyer, R.W., 1995. The effect of inhibitors on the growth of the
entomopoxvirus from amsacta moorei in lymantria dispar (Gypsy moth) cells.
Virology 211, 462–473. http://dx.doi.org/10.1006/viro.1995.1428.
Yang, Z., Reynolds, S.E., Martens, C., Bruno, a, Porcella, D.P., Moss, S.F., 2011. Expression
profiling of the intermediate and late stages of poxvirus replication. J. Virol. 85,
9899–9908. http://dx.doi.org/10.1128/JVI.05446-11.
da Fonseca, F.G., Wolffe, E.J., Weisberg, A., Moss, B., 2000a. Effects of deletion or
stringent repression of the H3L envelope gene on vaccinia virus replication. J. Virol.
74, 7518–7528.
da Fonseca, F.G., Wolffe, E.J., Weisberg, A., Moss, B., 2000b. Characterization of the
vaccinia virus H3L envelope protein: topology and posttranslational membrane in-
sertion via the C-terminal hydrophobic tail. J. Virol. 74, 7508–7517.