You are on page 1of 121

INSTITUTO NACIONAL DE PESQUISAS DA AMAZÔNIA - INPA

PROGRAMA DE PÓS-GRADUAÇÃO EM BIODIVERSIDADE


E BIOTECNOLOGIA DA REDE BIONORTE

ANÁLISES EPIDEMIOLÓGICA, DE DISTRIBUIÇÃO GEOGRÁFICA E GENÉTICA


DOS ESCORPIÕES QUE OCORREM NO ESTADO DO AMAZONAS, BRASIL

CÍCERO LUCINALDO SOARES DE OLIVEIRA COSTA

MANAUS - AM
ABRIL/2016
CÍCERO LUCINALDO SOARES DE OLIVEIRA COSTA

ANÁLISES EPIDEMIOLÓGICA, DE DISTRIBUIÇÃO GEOGRÁFICA E GENÉTICA


DOS ESCORPIÕES QUE OCORREM NO ESTADO DO AMAZONAS, BRASIL

Tese de doutorado apresentada ao Curso de


Doutorado do Programa de Pós-Graduação em
Biodiversidade e Biotecnologia da Rede
BIONORTE, no Instituto Nacional de Pesquisas
da Amazônia - INPA, como requisito parcial para
a obtenção do Título de Doutor em
Biodiversidade e Conservação.

Orientador: Prof. Dr. WANDERLI PEDRO


TADEI.
Co-orientadora: Profa. Dra. IRACILDA CUNHA
SAMPAIO.

MANAUS - AM
ABRIL/2016
FICHA CATALOGRÁFICA
(a ser revisada pela biblioteca da Universidade).

___________________________________________________________________

Costa, Cícero Lucinaldo Soares de Oliveira.


Análises epidemiológica, de distribuição geográfica e genética dos
escorpiões que ocorrem no estado do Amazonas, Brasil/Cícero Lucinaldo
Soares de Oliveira Costa/Manaus, 2016.

Tese de Doutorado em Biodiversidade e Conservação - Rede de


Biodiversidade e Biotecnologia da Amazônia Legal, Programa de Pós-
Graduação em Biodiversidade e Biotecnologia, Instituto Nacional de
Pesquisa da Amazônia/INPA, 2016.

Orientador: Wanderli Pedro Tadei e Iracilda Cunha Sampaio.

1. Estado do Amazonas. 2. escorpiões. 3. escorpionismo. 4. distribuição


geográfica. 5. genética. 6. filogenia.

I. Título:

CDU xxx
__________________________________________________________________
Dados Internacionais de Catalogação na Publicação
CÍCERO LUCINALDO SOARES DE OLIVEIRA COSTA

ANÁLISES EPIDEMIOLÓGICA, DE DISTRIBUIÇÃO GEOGRÁFICA E GENÉTICA


DOS ESCORPIÕES QUE OCORREM NO ESTADO DO AMAZONAS, BRASIL

Tese de doutorado apresentada ao Curso de


Doutorado do Programa de Pós-Graduação em
Biodiversidade e Biotecnologia da Rede
BIONORTE, no Instituto Nacional de Pesquisas
da Amazônia - INPA, como requisito parcial para
a obtenção do Título de Doutor em
Biodiversidade e Conservação.

Orientador: Prof. Dr. WANDERLI PEDRO TADEI


Co-orientadora: Profa. Dra. IRACILDA CUNHA SAMPAIO

Banca examinadora
____________________
Prof. Dr. Wanderli Pedro Tadei
Orientador- Presidente da banca - INPA
____________________
Prof. Dr. Jorge Luis López-Lozano
Examinador 2 – FMT-AM

__________________
Prof. Dra. Antônia Queiroz Lima Souza
Examinador 3 – UFAM

____________________
Prof. Dr. Jair Max Furtunato Maia
Examinador 4 – UEA

____________________
Prof. Dra. Vera Margarete Scarpassa
Examinador 5 – INPA

MANAUS - AM
ABRIL/2016
DEDICATÓRIA

A Deus, por ter me concedido tantas bênçãos,


dentre elas, a de fazer parte de uma linda
família, onde o verdadeiro significado da
palavra amor é refletida diariamente através
do respeito, carinho, lealdade e,
principalmente, pelo compartilhamento dos
momentos felizes e difíceis.
AGRADECIMENTOS

Expressar agradecimentos de maneira formal não é nada fácil, principalmente se


levarmos em conta a imperfeição humana. No entanto, foi com a colaboração de inúmeras
pessoas que este sonho foi concretizado. Diante disso, agradeço a todos que de forma direta
ou indireta contribuíram para a realização deste trabalho, que pode representar o fechamento
de um ciclo e o recomeço de uma nova era.
Meu Deus, muito obrigado por se fazer presente em minha vida e ser o
responsável por todas as minhas alegrias, a te, Senhor, meu primeiro obrigado;
Dr. Tadei, agradeço pela oportunidade, confiança, paciência, ensinamentos e
apoio dado durante toda essa trajetória, confesso que foram 4 anos de muitos aprendizados;
À Dra. Iracilda Sampaio, a pessoa que primeiro me estendeu as mãos para que eu
pudesse entrar no mundo científico. Professora, você foi e sempre será minha “mãezona”,
obrigado;
Ao Professor Nelson Fé, uma pessoa brilhante, sem o qual esse trabalho não teria
ido adiante. Seu Nelson, muito obrigado;
Ao Dr. Spartaco, pela simplicidade e visão inovadora, sem a qual o Programa não
teria se tornado uma realidade;
À Dra. Antônia Souza, pela sua contribuição ao Programa em um dos momentos
mais difíceis, sua fase inicial;
Ao INPA, UFAM e FMT, pela estrutura disponibilizada;
Aos meus colegas de turma, em especial à doutoranda Dolores Fonseca e ao
doutorando João Marcelo Lima pelo apoio moral, técnico e até financeiro;
À Dra. Dina (UFAM), pela paciência e contribuição na corrida do
sequenciamento;
Ao pessoal do laboratório de malária e dengue, pela amizade e incentivo dado
durante o curso. Agradeço, em especial, ao amigo do peito e técnico de coleta, senhor A.
Katytha e a, também amiga do peito e técnica de laboratório, Wal;
À minha “vó” Maria Camilo, in memorian, e ao primo “Preto” pela oportunidade
que me deram de estudar;
À família Feitosa, pela força em um dos momentos mais difíceis da minha vida;
À família Sales, pelo incentivo, admiração e respeito. Meus amigos, essa vitória
também é de vocês;
À família Zequi, pessoal com quem convivi e aprendi a admirar. Meu amigo,
agradeço por tudo, dos ensinamentos científicos, aos momentos de lazer nas churrasqueiras do
Di Fiori/Maria da Fé;
A todos que contribuíram com a minha educação formal, começando pela Dona
Delita no Casulo (creche) da Boa-Fé, comunidade rural onde nasci e estudei até os 10 anos de
idade. Às Professoras Maria do Carmo (in memorian) e Rita da Escola Pedro Teixeira, onde
estudei nas salas multiseriadas até a quarta série, hoje, quinto ano. A todos os Professores das
escolas José de Alencar e Álvaro Adolfo, onde conclui a segunda etapa do fundamental e o
ensino médio, respectivamente. Aos Professores das Faculdades Integradas do Tapajós, onde
graduei. Agradeço em especial ao Professor Albino Luciano, que com suas aulas me
direcionou para o mundo da genética;
A todos os colegas com quem estudei, do “Verão”, “Rosa”, Cley, “Francy”,
“Rony”, “Valdinho”, da Escola Pedro Teixeira, passando pela “Poleta” do José de Alencar e
Nely do Álvaro Adolfo, até chegar aos inesquecíveis amigos Artemizia, Éder, Heloísa,
Jackeline, Odirley, Rosivana, Taty e muitos outros das Faculdades Integradas do Tapajós;
Aos meus pais. Zaca/Tereza, meu muito obrigado, vocês são minha fonte de
inspiração;
Aos meus sobrinho(a)s, cunhado(a)s, sogro e sogra (Mano/Eliene) e aos meus
irmãos Cléia, Vando, Tiago, (Luciano e Luciana in memorian), por estarem sempre na torcida
positiva, amo vocês.
Ao “Meu bole”, pelo carinho, amor, compreensão, e, principalmente, pelos nossos
filhos, um agradecimento especial, te amo;
Lala/Biel, agradeço pelo carinho e amor, vocês são as relíquias do papai, amo
vocês.
Evolução, um plano de Deus para criar a
humanidade (Francis Collins)
RESUMO

Os escorpiões são invertebrados que pertencem à ordem Scorpiones, classe Arachnida.


Embora seja um grupo diverso e importante do ponto de vista médico, são poucos estudados
no Estado do Amazonas, estado detentor da maior escorpionfauna brasileira. A carência de
dados é associada, principalmente, ao baixo número de especialistas na região. Diante disso, e
considerando que o conhecimento é um passo importante para a tomada de decisões, é que a
presente pesquisa apresentou três propostas diferentes. A primeira (capítulo I) abordou a
situação do escorpionismo (acidentes por escorpiões) no estado. A segunda (capítulo II)
revelou o atual contexto da distribuição geográfica das espécies que ocorrem no Amazonas. A
terceira (capítulo III) utilizou-se a ferramenta molecular, por meio do DNA mitocondrial
(16S), para gerar sequências gênicas possíveis de serem usadas em estudos taxonômicos e
filogenia molecular. Para atingir o primeiro objetivo foram usados os dados disponíveis no
Sistema Nacional de Agravos e Notificações – SINAN acerca das picadas que ocorreram no
Amazonas entre os anos de 2008 e 2014. Informações das coleções aracnológicas do INPA,
UFAM e FMT/AM, coletas de campo e dados de publicações foram utilizados na produção
do segundo capítulo. Espécimes das coleções aracnológicas citadas, juntamente com
exemplares coletados em campo, foram usados para gerar as sequências gênicas apresentadas
como proposta do capítulo III. Os resultados mostraram que, embora a taxa anual média de
escorpionismo no Amazonas de 8.14 casos por 100 mil habitantes esteja abaixo da brasileira,
que gira em torno de 17.7 casos por 100 mil habitantes, algumas de suas regiões apresentaram
índices alarmantes. Neste contexto, destaque para o município de Apuí, que revelou números
assustadores, 273 casos por 100 mil habitantes. O estudo mostrou que as espécies Tityus
metuendus, T. matthieseni, T. bastosi e T. silvestris são as principais envolvidas em acidentes
nos municípios de Manaus, Apuí, Tabatinga e Rio Preto da Eva, respectivamente. Os
resultados do capítulo II, relacionados à distribuição geográfica, consolidam o Estado do
Amazonas como o detentor da maior escorpionfauna do Brasil. Entretanto, mostra que a
distribuição das espécies no Estado não está bem compreendida. Além disso, confirmaram os
dados de endemismo das regiões do Rio Negro e Manaus, colocando de forma inédita, a
primeira região como àquela que apresenta o maior número de espécies endêmicas do Estado,
dezessete no total. Por fim, a pesquisa apresenta os resultados referentes à parte genética. Os
achados mostraram que as divergências nucleotídicas intra-específica foram menores que
entre espécies não relacionadas, confirmando dados da literatura. A partir das árvores geradas
pelos algoritmos de Máxima Parcimônia e Neighbor-Joining foi possível inferir que o
agrupamento dos Tityus estão de acordo com o que é apresentado pela taxonomia morfológica
vii
convencional. Em relação às espécies Brotheas amazonicus, Broteochactas polisi e
Chactopsis amazonicus, todos representantes da família Chactidae, os resultados podem
aclarar ou ainda resolver uma grande discussão em torno da permanência do gênero
Chactopsis dentro da família citada. Os resultados deste estudo certamente serão utilizados na
fundamentação de outras pesquisas ou ainda na tomada de decisões acerca do escorpionismo
no Estado do Amazonas.

Palavras-Chave: Estado do Amazonas, escorpiões, acidentes, distribuição geográfica, gene


16S, relações evolutivas.

ABSTRACT

Scorpions are invertebrates from the order Scorpiones (Arachnida). Although it is a diverse
group and important from a medical perspective, there are very few studies on scorpions in
Amazonas, the state with the largest scorpionfauna of Brazil. This lack of data is associated
mainly to the low number of specialists in the region. Thus, and taking into account that
knowledge is an important step in decision making, this research has three different proposals:
first (chapter I), to cover the current situation of scorpionism (accidents with scorpions) in the
state; second (chapter II), to present the geographical distribution of scorpion species in
Amazonas; and third (chapter III), to sequence the 16S gene, for as many scorpion species as
possible so that this data can be used in taxonomical and phylogenetic studies. For the first
objective, the Sistema Nacional de Agravos e Notificações – SINAN was accessed to obtain
data on envenomations that occurred in the state of Amazonas between 2008 and 2014.
Information from the arachnid collections of Instituto Nacional de Pesquisa da Amazônia -
INPA, Universidade Federal do Amazonas - UFAM and Fundação de Medicina Tropical do
Amazonas - FMT/AM, field collecting and literature data were used as data for the second
chapter. Specimens from the above mentioned collections and from the field collecting were
used to obtain the genetic sequences for the chapter III proposal. Results demonstrate that,
although the average annual rate of scorpionism in Amazonas is of 8.14 cases per 100
thousand habitants, which is below the national average (17.7), some of its regions presented
alarming rates. Among these, the municipality of Apuí is highlighted with 273 cases per 100
thousand habitants. This study demonstrated that the species Tityus metuendus, T.
matthieseni, T. bastosi and T. silvestris are the main ones involved in accidents in the
municipalities of Manaus, Apuí, Tabatinga and Rio Preto da Eva, respectively. The
geographical distribution results of chapter II reinforce the status of Amazonas as the
viii
Brazilian state with the largest scorpionfauna of the country, however the species distribution
is still not completely known. Furthermore, the distributional data confirmed the endemism of
the Rio Negro and Manaus regions, placing the former, for the first time, as the region with
the highest number of endemic species of the state (17 spp.). The findings from the molecular
study (chapter III) demonstrate that the nucleotide intra-specific divergence was smaller than
the inter-specific divergence, confirming data from the literature. Based on the trees from the
Maximum Parsimony and Neighbor-Joining analyses it is possible to assume that the Tityus
grouping is in accordance to what is presented by traditional taxonomy. The findings
regarding the species Brotheas amazonicus, Broteochactas polisi and Chactopsis amazonicus,
all from the family Chactidae, can help clarify or even resolve the issue regarding the
placement of the genus Chactopsis in this family. All proposals presented for the current
study were met and the results obtained will certainly be used as base for other researches or
even in decision making regarding scorpionism in Amazonas.

Keywords: State of Amazonas, scorpions, envenomations, geographical distribution, 16S


gene, evolutionary relationships.

ix
LISTA DE FIGURAS

CAPÍTULO I
Figura 1 - Divisão do Estado do Amazonas em 13 microrregiões.................................... 9

Figura 2 - Correlação entre índices pluviométricos e acidentes no Estado do Amazonas


13
durante os anos de 2008 a 2014........................................................................................

CAPÍTULO II
Figura 1 - Mapa de distribuição das espécies escorpiônicas com registros para o estado
92
do Amazonas (Apêndice I)................................................................................................

Figura 2 - Esquema representativo da família Buthidae no Estado do Amazonas,


34
Brasil........................................................................................................................

Figura 3 - Esquema representativo da família Chactidae no Estado do Amazonas,


42
Brasil........................................................................................................................

CAPÍTULO III
Figura 1 - Morfologia externa dorsal e ventral de um escorpião...................................... 60

Figura 2 - Armadilha de pitfall montada no Ramal do Brasileirinho/Manaus e busca


68
ativa realizada em comunidade rural do município de Tabatinga.....................................

Figura 3 - Exemplar de Tityus dinizi Lourenço, 1997, em ambiente natural, coletado


no município de Tabatinga e exemplar de Brotheas amazonicus Lourenço, 1988 69
proveniente da coleção da FMT........................................................................................

Figura 4 - Eletroforese em gel de agarose da amplificação de um fragmento do gene


72
16S de escorpiões..............................................................................................................

Figura 5 - Sequências nucleotídicas provenientes da reação de sequenciamento............. 72

Figura 6 - Árvore filogenética gerada pelo método evolutivo NJ (apêndice IV).............. 103

Figura 7 - Árvore filogenética gerada pelo método evolutivo MP (apêndice IV)............ 104

Figura 8 - Rearranjo dos Tityus em NJ e MP.................................................................... 79

Figura 9 - Organização dos representantes da família Chactidae segundo o método


82
Neighbor-Joining...............................................................................................................

x
LISTA DE TABELAS

CAPÍTULO I
Tabela 1 - Frequências das notificações dos acidentes escorpiônicos nas microrregiões
11
do Estado do Amazonas entre os anos de 2008 a 2014.....................................................

Tabela 2 - Variáveis mais representativas relacionadas ao escorpionismo no Amazonas


16
entre os anos de 2008 e 2014 (1.986 acidentes)................................................................

Tabela 3 – Frequência dos acidentes segundo a gravidade do caso, a soroterapia e a


evolução clínica do acidentado no Estado do Amazonas entre os anos de 2008 a 2014 17
(1.986 acidentes)...............................................................................................................

CAPÍTULO III
Tabela 1 - Famílias e distribuição geográfica dos escorpiões........................................... 61

Tabela 2 - Espécimes de escorpiões utilizados nas análises genéticas............................. 69

Tabela 3 - Estimativa de divergência nucleotídica entre as sequências dos escorpiões


101
estudados (apêndice III)....................................................................................................

Tabela 4 - Matriz de estimativa de substituições nas sequências dos exemplares de


77
Ananteris...........................................................................................................................

Tabela 5 - Média de divergência evolutiva entre as sequências do gene ribossomal 16S


dos escorpiões provenientes das Coleções Aracnológicas (CA) e Coletas de Campo 78
(CC)...................................................................................................................................

xi
LISTA DE SÍMBOLOS

Sigla/abreviatura Significado
ºC Graus Celsius
COI Citocromo Oxidase Subunidade I
DNA Ácido Desoxirribonucleico
DNTPs Desoxirribonucleotídeos Fosfatados
FMT-AM Fundação de Medicina Tropical do Estado do Amazonas
IBGE Instituto Brasileiro de Geografia e Estatística
ICMBIO Instituto Chico Mendes de Conservação da Biodiversidade
Indel Inserção ou deleção de nucleotídeos
INMET Instituto Nacional de Meteorologia
INPA Instituto Nacional de Pesquisas da Amazônia
Mg Miligramas
MgCl Cloreto de magnésio
mL Mililitro
mM Milimolar
DNAmt DNA mitocondrial
PCR Reação em Cadeia da Polimerase
pH Potencial de Hidrogênio
PHRED Phil’s Read Editor
RNA Ácido Ribonucleico
RPM Rotação por minuto
RNAr RNA ribossomal
SINAN Sistema de Informação de Agravos de Notificação
TAQ Thermus aquaticus
RNAt RNA transportador
UFAM Universidade Federal do Estado do Amazonas

xii
SUMÁRIO
Resumo.............................................................................................................................. vii
Abstract............................................................................................................................. viii
Lista de Figuras................................................................................................................. x
Lista de Tabelas................................................................................................................. xi
Lista de Símbolos.............................................................................................................. xii
1 Introdução Geral............................................................................................................. 1
Capítulo I - O perfil do escorpionismo e as principais espécies escorpiônicas
3
envolvidas nos acidentes no Estado do Amazonas, Brasil................................................
1 Considerações Gerais..................................................................................................... 3
1.1 O panorama mundial do escorpionismo............................................................... 3
1.2 O escorpionismo no Brasil................................................................................... 4
2 Justificativa.................................................................................................................... 7
3 Objetivos........................................................................................................................ 8
3.1 Objetivo geral....................................................................................................... 8
3.2 Objetivos específicos........................................................................................... 8
4 Material e Métodos........................................................................................................ 9
4.1 Área de estudo...................................................................................................... 9
4.2 Fontes de informações......................................................................................... 9
4.3 Análises estatísticas.............................................................................................. 10
5 Resultados e Discussão.................................................................................................. 11
6 Conclusões..................................................................................................................... 19
7 Referências Bibliográficas............................................................................................. 20

Capítulo II - Levantamento da distribuição geográfica das espécies escorpiônicas que


29
ocorrem no Estado do Amazonas......................................................................................
1 Considerações Gerais..................................................................................................... 29
2 Justificativa.................................................................................................................... 31
3 Objetivos........................................................................................................................ 32
3.1 Objetivo Geral...................................................................................................... 32
3.2 Objetivos Específicos........................................................................................... 32
4 Material e Métodos........................................................................................................ 33
4.1 Área de Estudo..................................................................................................... 33
4.2 Dados da Distribuição Geográfica....................................................................... 33
4.3 Coletas de Campo................................................................................................ 33
5 Resultados e Discussão.................................................................................................. 34
5.1 As coletas de campo e o levantamento junto às coleções aracnológicas............. 47
xiii
6 Conclusões..................................................................................................................... 52
7 Referências Bibliográficas............................................................................................. 53

Capítulo III - Identificação molecular e inferências filogenéticas dos escorpiões que


ocorrem no Estado do Amazonas, 60
Brasil...........................................................................
1 Considerações Gerais..................................................................................................... 60
1.1 Sistemática da Ordem Scorpiones........................................................................ 60
1.2 Registros de escorpiões no Brasil........................................................................ 62
1.3 A sistemática dos escorpiões com o advento do DNA barcoding....................... 62
1.4 Estudos genéticos com as espécies brasileiras..................................................... 64
2 Justificativa.................................................................................................................... 66
3 Objetivos........................................................................................................................ 67
3.1 Objetivo Geral...................................................................................................... 67
3.2 Objetivos específicos........................................................................................... 67
4 Materiais e Métodos....................................................................................................... 68
4.1 Área de abrangência da pesquisa e coleta de escorpiões..................................... 68
4.2 Material utilizado nas análises............................................................................. 68
4.3 Coleta de material biológico e extração de DNA................................................ 70
4.4 Isolamento e amplificação do gene mitocondrial rRNA 16S.............................. 71
4.5 Sequenciamento dos produtos das PCRs............................................................. 72
4.6 Qualidade e alinhamento das sequências............................................................. 72
4.7 Os índices de divergências evolutivas e a construção de árvores
73
filogenéticas...............................................................................................................
5 Resultados e Discussão.................................................................................................. 74
5.1 As divergências nucleotídicas entre os escorpiões.............................................. 74
5.2 As divergências entre as sequências provenientes das CA e CC......................... 77
5.3 As Árvores Filogenéticas..................................................................................... 78
6 Conclusões..................................................................................................................... 83
7 Referências Bibliográficas............................................................................................. 84
Apêndice I - Apresentação do alinhamento e das sequências geradas no programa
92
BioEdit..............................................................................................................................
Apêndice II - Estimativa de divergência nucleotídica entre as sequências dos
100
escorpiões estudados.........................................................................................................
Apêndice III - Árvores filogenéticas................................................................................ 102

xiv
xv
1 Introdução Geral
Os escorpiões são artrópodes que pertencem à ordem Scorpiones, classe

Arachnida (POLIS, 1990). Possuem existência comprovada há mais de 400 milhões de anos e

ampla distribuição geográfica. Segundo MacArthur (1972), ao contrário da maioria dos

animais, os escorpiões são mais diversos em regiões subtropicais, principalmente entre as

latitudes 23° e 38° graus norte, decrescendo em relação aos polos e ao equador. Entretanto,

Lourenço (2001) coloca o continente sul-americano como uma das regiões mais importantes

do planeta em termos de diversidade de escorpiões, especialmente aquelas regiões que exibem

um grande endemismo no número de espécies, como é o caso da região amazônica.

Em termos de biodiversidade de espécies escorpiônicas, a região norte é a mais

representativa do Brasil, já que mais de 50%, das aproximadas 140 espécies descritas para o

país, encontram-se na região (BRAZIL & PORTO, 2010; LOURENÇO et al. 2011; OCHOA

et al., 2013). Neste cenário, destaque para o Estado do Amazonas que apresenta o maior

número de registros de espécies (LOURENÇO et al., 2005; LOURENÇO et al., 2011). Três

das quatro famílias de escorpiões descritas para o Brasil ocorrem no Estado, são elas,

Buthidae Koch, 1837, Chactidae Pocock, 1893 e Liochelidae Fet & Bechly, 2001

(LOURENÇO, 2002).

Em alguns países, o escorpionismo, termo relacionado aos acidentes causados

pela picada de escorpiões, é considerado um problema de saúde pública. Chippaux & Goyffon

(2008) chamam a atenção para as espécies pertencentes aos gêneros Buthus Leach, 1815,

Leiurus Ehrenberg, 1828, Androctonus Ehrenberg, 1828, Centruroides Marx, 1890 e Tityus

Koch, 1836, as mais perigosas para o homem, os últimos, com registros de ocorrências no

Estado do Amazonas.

Dados do SINAN (2015) mostram que no Brasil, entre os anos de 2008 a 2014,

praticamente meio milhão pessoas foram picadas por escorpiões, das quais, 581 evoluíram

para morte, o que ratifica o escorpionismo como um sério problema de saúde pública.

1
Os escorpiões podem ser classificados, de acordo com seu padrão ecológico, em

dois grupos, os especialistas e os oportunistas. Os escorpiões que fazem parte do segundo

grupo são os grandes responsáveis pelos acidentes que necessitam de intervenção médica. No

entanto, conforme salienta Lewis et al. (2009), existe uma carência de dados básicos sobre o

comportamento e distribuição destes animais, o que contribui para a falta de desenvolvimento

de políticas públicas de conservação das espécies e prevenção contra o escorpionismo em

áreas antropizadas. Outro gargalo relacionado a este grupo de animais está associado à

carência de estudos genéticos. Lourenço (2000) relata que à medida que ocorre o

aprofundamento dos estudos sobre escorpiões, torna-se mais frequente a necessidade de

reavaliações e mudanças naquilo que já foi descrito na literatura especializada. Assim, a

abordagem molecular, ferramenta conhecida como código de barras de DNA, ou DNA

barcoding, pode ser usada para caracterizar espécies e minimizar os problemas associados à

falta de taxonomistas especializados ou ainda para dirimir dúvidas em casos de espécies

crípticas (HEBERT et al., 2003). Os exemplos do uso de dados genéticos como auxílio

taxonômico são inúmeros, Parmakelis et al. (2013), por exemplo, relataram que os atributos

morfológicos comumente utilizados para delinear espécies do gênero Euscorpius Thorell,

1876, que ocorrem na região do mediterrâneo, não foram suficientes para apontar a unidade

mais basal da taxonomia, problemática resolvida através da abordagem molecular.

Diante do exposto e considerando a diversidade da escorpionfauna do Amazonas,

a falta de dados acerca da distribuição das espécies, a carência de estudos relacionados ao

escorpionismo e a ausência total de estudos genéticos voltados para este grupo de animais no

Estado, é que a presente pesquisa apresenta, em três capítulos independentes, estudos

relacionados ao escorpionismo, a distribuição geográfica e à caracterização molecular de

espécies escorpiônicas que ocorrem no Estado do Amazonas.

2
Capítulo I - O perfil do escorpionismo e as principais espécies escorpiônicas envolvidas
nos acidentes no Estado do Amazonas, Brasil
1 Considerações Gerais
1.1 Panorama mundial do escorpionismo
Os escorpiões são invertebrados terrestres com ampla distribuição geográfica,
com a exceção da Antártida, estão presentes em todos os continentes (SOLEGLAND & FET,
2003). Em alguns países, especialmente aqueles inseridos entre os trópicos, o escorpionismo é
tratado como um problema de saúde pública, não só pela incidência, mas também pela
potencialidade do veneno de algumas espécies em determinar quadros clínicos graves, às
vezes fatais (POLIS, 1990).
As espécies mais perigosas para o homem pertencem à família Buthidae. Áreas
como o Norte da África, Centro-Oeste da Índia, América Central e América do Sul estão entre
as que apresentam maiores riscos de acidentes (CHIPPAUX & GOYFFON, 2008).
No continente africano vários países sofrem com os ataques de escorpiões.
Segundo Hellal et al. (2012), na Algéria, o envenenamento por escorpiões é considerado um
grave problema médico, principalmente no sul do país, onde mais de 2 mil picadas são
registradas anualmente, sendo que, desse total, em média 10 pessoas são acometidas
fatalmente. De acordo com pesquisa realizada por Laid et al. (2012), a incidência de acidentes
no país chega a 170 para grupo de 100 mil habitantes por ano e a evolução clinica para óbito
gira em torno de 0,38% dos acidentes. Dados de (EL OUFIR et al., 2008; HMIMOU et al.,
2008) apontam que em Marrocos o sexo mais acometido pelos acidentes é o masculino e que
os índices de casos que evoluem para morte são altíssimos, aproximadamente 6,59% do total.
Na Turquia, conforme dados de Adiguzel (2010), os óbitos relacionados à picada de
escorpiões chegaram a 12,50% dos casos, um dos mais elevados do mundo. Segundo a
pesquisa, o expressivo índice de letalidade está associado à potência do veneno dos escorpiões
Androctonus crassicauda Olivier, 1807, considerada a espécie escorpiônica mais perigosa do
mundo.
Na Ásia, os dados relacionados ao escorpionismo são heterogêneos, países como
o Japão e as Coréias do Norte e Sul não possuem registros de acidentes epidemiológicos com
escorpiões (CHIPPAUX & GOYFFON, 2008). De outra forma, assim como descrevem Gupta
et al. (2008), os índices são elevados na China e Índia. No Irã, inúmeras espécies estão
envolvidas com acidentes, destaque para Androctonus crassicauda, Mesobuthus eupeus Koch,
1839 e Hemiscorpius lepturus Peters, 1861, uma vez que apresentam alto poder de letalidade
(JALALI et al., 2010; PIPELZADEH et al., 2007).

3
A espécie mais perigosa da Europa e que possui ampla distribuição geográfica no
continente é a Mesobuthus gibbosus Brulli, 1832 (KALTSAS & MYLONAS, 2007).
Entretanto, outras espécies são destaques no escorpionismo da região, é o caso dos escorpiões
Buthus occitanus Amoreux, 1789, envolvidos em acidentes no sul da França e na Península
Ibérica (PASTRANA et al., 2008). Na Itália, conforme salienta Dutto et al. (2010), os
acidentes são quase inexistentes, quando ocorrem, estão associados as espécies do gênero
Euscorpius.
Os acidentes por escorpiões na América do Norte e Central estão entre os mais
elevados do mundo. Nos Estados Unidos a incidência é maior no sul do país, com destaque
para os Estados do Texas e Arizona (FORRESTER & STANLEY, 2004). Langley (2005)
coloca a espécie Centruroides sculpturatus Ewing, 1928 como a mais perigosa da região e
salienta que, embora os números sejam elevados, o percentual de vitimados que evoluem para
óbito é muito baixo. No México, o escorpionismo está associado às espécies pertencentes a
dois gêneros, Centruroides e Tityus, ambos da família Buthidae (JESÚS et al., 2007). Celis et
al. (2007) mostraram que os índices de mortalidade em decorrência das picadas de escorpiões
no país estão entre os mais elevados do mundo. Neste estudo, os autores constataram que
entre os anos de 1979 e 2003 mais de 6 mil pessoas foram mortas por acidentes com
escorpiões.
Dentre os países sul-americanos, a Venezuela se destaca como um dos que
apresentam maior diversidade de espécies. Segundo Borges & Rojas-Runjaic (2007) um total
de 184 espécies já foram descritas para o país. Borges (2006) salienta que por ser um país
densamente habitado por exemplares do gênero Tityus, existe, por parte do poder público,
uma atenção especial em áreas mais críticas. A presença do estado foi constatada, por
exemplo, nos estudos desenvolvidos por Cermeño et al. (2011), em Bolívar, onde o índice de
acidentes girou em torno de 0,07 casos para um grupo de 100 mil habitantes. Abaixo da média
mundial, de 20 casos/100 mil habitantes, estão os índices de outros países da América do Sul,
é o caso da Argentina, Colômbia e Chile (DE ROODT et al., 2008; OTERO et al., 2008;
SCHENONE & FONTECILLA, 2008).

1.2 O escorpionismo no Brasil


Os primeiros relatos sobre estudos escorpiônicos no Brasil datam do início do
século XX e estavam voltados para área da taxonomia e estudo do veneno de algumas
espécies. Lucas (2003) relata que nos primeiros anos do século passado, o médico Vital
Brazil, por exemplo, desenvolveu estudos direcionados a produção de soro. Atualmente,

4
estudos sobre o escorpionismo são os mais explorados pelos pesquisadores que trabalham
com escorpiões no Brasil.
Estudo desenvolvido por Reckziegel & Junior (2014) mostraram que entre os anos
de 2007 e 2010, a taxa média anual de acidentes no Brasil ficou em torno de 45 mil casos. O
estudo revelou que os índices médios de acidentes e mortes relacionados ao escorpionismo
ficaram na ordem de 17,7 e 0,028 casos para grupo 100 mil habitantes. Cardoso et al. (2003)
relataram que todas as espécies de interesse médico que ocorrem no Brasil pertencem à
família Buthidae. Neste contexto, destaque para as espécies Tityus serrulatus Lutz & Mello,
1922 e Tityus bahiensis Perty, 1833, as mais perigosas para o homem.
Na região Nordeste do Brasil, a espécie Tityus stigmurus Thorell, 1876, endêmica
da região, é a principal responsável pelos envenenamentos (SINITOX, 2009). Um dos
agravantes no combate e controle dos acidentes na região é o fato da espécie ter se adaptado a
viver em grandes centros urbanos (ALVES et al., 2007). Estudos de Oliveira et al. (2012)
apontaram que na Paraíba a incidência de escorpionismo chegou a um patamar de 38,7 casos
para um grupo de 100 mil pessoas, a maioria deles associados à T. stigmurus. Dados
semelhantes foram encontrados em estudos desenvolvidos no Estado da Bahia (BARBOSA et
al., 2011).
No Sudeste do Brasil, a espécie que se destaca, pela sua associação com os
acidentes, é o Tityus serrulatus, a principal do ponto de vista epidemiológico do Brasil
(BRASIL, 2009). Horta et al. (2007), em estudo desenvolvido no Estado de Minas Gerais,
mostraram a periculosidade dos acidentes causados por esta espécie. A pesquisa revelou que a
letalidade chegou a 1,50% do total, bem mais elevada que a média brasileira de 0,16%.
A região Sul do Brasil é a que apresenta a menor biodiversidade de espécies
escorpiônicas. De acordo com Brazil & Porto (2010), apenas representantes das famílias
Bothriuridae Simon, 1880 e Buthidae são encontrados na região. Estudo desenvolvido em
Santa Catarina mostrou que, embora não tenha registros de óbitos, o Estado possui uma alta
incidência de escorpionismo (QUADROS et al., 2014). Por outro lado, Dorneles (2009) relata
que no Rio Grande do Sul os índices são baixos, dados semelhantes são apresentados para o
Estado do Paraná (BREDT & LITCHTENEKER, 2014).
A região Centro-Oeste é uma das mais biodiversa do Brasil. Espécies da família
Buthidae são amplamente distribuídas na região (BRASIL, 2009). Por este motivo, Brazil &
Porto (2010) chamam a atenção para os perigos associados com os acidentes causados pelos
representantes do grupo. Trabalho desenvolvido por Reckziegel & Junior (2014) mostrou que
as maiores taxas de acidentes com vítimas fatais, no Brasil, são da região.

5
A região Norte do Brasil é considerada, do ponto de vista de diversidade
escorpiônica, a principal do país. No Estado do Pará são encontrados representantes da
espécie Tityus obscurus Gervais, 1843, a mais importante da região (NETO et al., 2008;
PARDAL et al., 2014). No Estado do Amazonas ocorrem 46 espécies escorpiônicas (COSTA
et al., 2016). Contudo, pouco se sabe sobre quais estão envolvidas em casos de acidentes
graves (BRASIL, 2009; BRAZIL & PORTO, 2010).

6
2 Justificativa
A literatura especializada é incisiva em afirmar que os escorpiões constituem um
grupo de animais de importância médica, haja vista que podem causar acidentes com várias
complicações ao homem, inclusive levá-lo a morte. É importante ressaltar que a fauna
escorpiônica brasileira é biodiversa, consistindo de várias espécies capazes de provocar
acidentes graves, como é o caso de Tityus serrulatus e T. bahiensis, espécies comuns na
região Sudeste do país. No Nordeste existe a espécie T. stigmurus, endêmica da região e
associada aos acidentes fatais. A espécie T. obscurus, por estar envolvida com os acidentes
mais sérios, é considerada a principal do Estado do Pará. No Estado do Amazonas, que
embora se apresente como detentor da maior biodiversidade de escorpiões do país, algumas
delas capazes de provocar acidentes fatais, existe uma lacuna científica a respeito do
escorpionismo. Neste contexto, o presente trabalho apresenta dados científicos acerca dos
acidentes causados por escorpiões. Podendo, inclusive, ser usado como subsídios de políticas
públicas de prevenção e controle do escorpionismo.

7
3 Objetivos
3.1 Objetivo geral
Traçar o perfil do escorpionismo no Estado do Amazonas, Brasil.

3.2 Objetivos específicos


 Mapear as áreas de maior incidência de escorpionismo no Estado do Amazonas;
 Apresentar as características do acidentado;
 Verificar quais as principais espécies envolvidas nos acidentes.

8
4 Material e Métodos
4.1 Área de estudo
O estudo foi desenvolvido no Estado do Amazonas que, em conjunto com outros
seis, faz parte da região norte do Brasil. É o Estado de maior área geográfica do país e com
seus aproximados 4.000.000 (quatro milhões) de habitantes é o segundo mais populoso da
região (IBGE, 2015). O clima que prevalece em seu território é o equatorial, caracterizado
pela presença de altas temperaturas e elevados índices pluviométricos que oscilam entre 1750
mm e 3652 mm anual (AB’SÁBER, 2003; NIMER, 1989). A cobertura vegetal que prevalece
em seu território é o da Floresta Amazônica, a maior do planeta. Em relação a sua hidrografia,
é contemplado com uma rica malha fluvial, com destaque para o Rio Amazonas (RIBEIRO,
2003). Possui o relevo dominado pela presença da Planície Amazônica, contudo, apresenta as
maiores elevações do Brasil, é o caso do Pico da Neblina e do Pico 31 de Março, localizados
na fronteira com a Venezuela (JÚNIOR et al., 2011). Em decorrência de sua extensão
territorial e para um mapeamento mais preciso das áreas de maior incidência de
escorpionismo foi levado em consideração à divisão geopolítica apresentada pelo IBGE
(2002), que divide o estado em treze microrregiões, as quais são: Alto Solimões, Boca do
Acre, Coari, Itacoatiara, Japurá, Juruá, Madeira, Manaus, Parintins, Purus, Rio Negro, Rio
Preto da Eva e Tefé (figura 1).

Figura 1 – Divisão do Estado do Amazonas em 13 microrregiões


Fonte: IBGE (2002)

4.2 Fontes de informações


O perfil dos acidentados foi levantado a partir das informações capturadas no
banco de dados do Sistema de Informação de Agravos de Notificação (SINAN, 2015),

9
registradas entre primeiro de janeiro de 2008 e 31 de dezembro de 2014. Variáveis como o
sexo, gravidade do caso, soroterapia utilizada, evolução clínica do paciente, região anatômica
da picada, tempo para o atendimento médico, faixa etária e nível de escolaridade do
acidentado foram analisadas.
A determinação da espécie responsável pelo o acidente foi realizada a partir da
identificação dos espécimes depositados em unidades de atendimento aos acidentados
distribuídos ao longo do estado. A identificação foi baseada em chaves taxonômicas
morfológicas apresentadas por Lourenço (2002) e realizada por técnico especializado da
Fundação de Medicina Tropical do Amazonas. A autorização de coleta e transporte (43623-1)
foi concedida pelo Instituto Chico Mendes de Conservação da Biodiversidade (ICMBIO).

4.3 Análises estatísticas


As análises estatísticas foram realizadas através do software Bioestat (AYRES et
al., 2007) e SPSS® 14.0 package for Windows (SPSS, 2005). O teste não paramétrico de
Friedman foi usado para verificar a consistência dos dados de acidentes entre as 13
microrregiões estudadas. Além disso, foi usado para verificar a consistência dos dados
relacionados ao sexo, idade e nível de instrução do acidentado, área geográfica de ocorrência
do acidente (zona rural/urbana), região anatômica da picada e tempo para atendimento
médico. A correlação de Spearman foi utilizada para determinar o grau de associação entre os
níveis de precipitação pluviométrica e o número de acidentes causados por picadas de
escorpiões. Todos os testes foram realizados com um nível de significância de 5%. Os dados
referentes à gravidade de caso, soroterapia e evolução clínica do acidentado foram
apresentados por meio de estatística descritiva.

10
5 Resultados e Discussão
Entre os anos de 2008 e 2014 ocorreram 1.986 acidentes (tabela 1), o que
representa uma taxa média anual de escorpionismo na ordem de 8,14 casos/100 mil
habitantes. Das treze microrregiões que compõem o mapa geopolítico do Amazonas, nove
delas apresentaram média anual de acidentes por 100 mil habitantes acima da descrita para o
Estado, são elas: Alto Solimões, 9,24 casos; Japurá, 14,74 casos; Juruá, 11,43 casos; Madeira,
23,20 casos; Parintins, 8,67 casos; Purus 10,60 casos; Rio Negro, 11,26 casos; Rio Preto da
Eva, 32,01; e Tefé, 13,20 casos. As microrregiões com as menores taxas foram Manaus, 3,11
casos; Boca do Acre, 3,20 casos; e Coari, 4,92 casos.

Tabela 1 – Frequências das notificações dos acidentes escorpiônicos nas microrregiões do


Estado do Amazonas entre os anos de 2008 e 2014.
Total
2008 2009 2010 2011 2012 2013 2014
Microrregiões Número –
Número Número Número Número Número Número Número
Porcentagem
Alto Solimões 19 20 11 24 37 34 30 175 (8.81%)
Boca do Acre 01 01 01 02 03 02 01 11 (0.55%)
Coari 07 09 11 12 02 07 07 55 (2.77%)
Itacoatiara 08 12 08 11 09 13 18 79 (3.98%)
Japurá 02 03 04 05 04 04 04 26 (1.31%)
Juruá 10 09 14 23 24 24 15 119 (5.99%)
Madeira 28 23 47 53 60 60 57 328(16.51%)
Manaus 55 113 30 31 99 147 156 631(31.77%)
Parintins 28 27 17 13 29 23 30 167 (8.40%)
Purus 11 11 09 09 13 18 10 81 (4.01%)
Rio Negro 09 10 16 12 13 11 07 78 (3.92%)
Rio Preto da Eva 08 16 18 24 30 35 20 151 (7.60%)
Tefé 06 12 14 08 20 13 12 85 (4.28%)
Total por ano – 192 266 200 227 343 391 367
1986 (100%)
Número/Porcentagem 9,66% 13,39% 10,08% 11,43% 17,27% 19,69 18,48%
Fonte: Sistema de Informação de Agravos de Notificação (SINAN)

A taxa média de 8,14 casos de acidentes por 100 mil habitantes apresentada para o
Estado do Amazonas encontra-se abaixo da média brasileira e mundial, que são,
respectivamente, de 17,7 e 20 casos por 100 mil habitantes (CHIPPAUX & GOYFFON,
2008; RECKZIEGEL & JUNIOR, 2014). Entretanto, é mais alta que as de países fronteiriços,
como é o caso da Venezuela e Colômbia, que, embora sejam densamente povoados por
escorpiões, apresentam, respectivamente, taxas de 0,07 e 5 casos para o grupo de 100 mil
pessoas (CERMEÑO et al., 2011; OTERO et al., 2008).
A explicação para um índice de escorpionismo abaixo da média brasileira pode
estar relacionada aos hábitos ecológicos previsíveis e específicos da maioria dos escorpiões
descritos para o Amazonas. Outra hipótese seria o baixo poder da peçonha dos escorpiões do
estado em provocar acidentes com efeitos graves à saúde. Contudo, nenhum estudo foi
publicado no sentido de explicar a relação dos dois fatores com o escorpionismo no
11
Amazonas. Estudo realizado por Pardal et al. (2014) no Estado do Pará, com o veneno da
espécie Tityus obscurus, mostrou que a peçonha destes animais tem um elevado potencial em
causar efeitos graves ao acidentado, um dos fatores que certamente está contribuindo para que
o Estado vizinho apresente uma taxa de escorpionismo maior que a do Amazonas.
Os resultados do presente trabalho mostram que embora a média de acidentes no
Amazonas esteja abaixo da média nacional, nove de suas treze microrregiões apresentaram
elevados índices de escorpionismo, é o que ocorre, por exemplo, com a microrregião do
Madeira. Neste contexto, destaque para o município de Apuí, pois dos 328 registros de
acidentes para microrregião, 261 foram atribuídos ao município, o que equivale a 79,57% dos
casos. O índice médio anual de escorpionismo em Apuí para grupo de 100 mil habitantes é de
aproximadamente 200 casos, números que se elevam para 273/100 mil habitantes quando os
cálculos levam em conta apenas os registros de 2012, ano com maior número de acidentados.
Em um trabalho sobre o escorpionismo no município de Juiz de Fora (Minas Gerais), Santos
et al. (2010) constataram uma média de 12,77 casos de acidentes para um grupo de 100 mil
pessoas. Segundo os pesquisadores, por apresentar a referida taxa, o município mineiro é
inserido no grupo daqueles com alta incidência de escorpionismo. Os números apresentados
para Apuí chegam a ser até 20 vezes maiores que os dados colocados para Juiz de Fora, o que
tem preocupado as autoridades do serviço de saúde de Apuí, uma vez que outras regiões
consideradas historicamente referência em acidentes escorpiônicos apresentam taxas bem
inferiores que o município da microrregião do Madeira (COSTA, 2012; LAID et al., 2012;
PIPELZADEH et al., 2007; SANTOS et al., 2010). Os resultados encontrados para Apuí
podem estar relacionados ao crescimento desordenado da área urbana; melhoria das
notificações através do SINAN (FISZON & BOCHNER, 2008); ou ainda pela presença das
espécies oportunistas Tityus matthieseni Pinto-da-Rocha & Lourenço, 2000, Tityus metuendus
Pocock, 1897 e Tityus apiacas Lourenço, 2002, descritas para a região do Madeira.
Contrastando os dados apresentados para Apuí, estão os registros de acidentes
encontrados para Manaus, com uma taxa média anual de 3,35 casos/100 mil habitantes, a
capital amazonense apresentou um dos menores índices de escorpionismo do estado.
Lourenço et al. (2005) relataram que Manaus é o município do Amazonas que apresenta o
maior número de espécies descritas. Portanto, esperava-se um índice mais elevado de ataques,
o que não ocorreu. A explicação pode ser em decorrência da presença maciça de espécies não
sinantrópicas pertencentes aos gêneros Broteochactas Pocock, 1893 e Brotheas Koch, 1837,
que não apresentam relação com os registros de acidentes. Outra hipótese seria o baixo poder
de letalidade ou reações adversas graves entre as espécies que apresentam hábitos generalistas
descritas para o município de Manaus, que comumente estão envolvidas com os acidentes,
12
mas acabam não sendo registrados pelos órgãos oficiais, já que os acidentados não procuram
assistência médica.
Os dados apresentados na tabela 1 mostram que os anos de 2012, 2013 e 2014
tiveram o número de registros de acidentes aumentado em relação ao ano de 2008,
confirmado pelo teste de Friedman, que detectou uma diferença significativa (p<0,001 e
Fr=22,42). Até o presente momento nenhum trabalho foi publicado no sentido de explicar o
aumento de registro para o Estado do Amazonas. Contudo, os dados indicam que as
microrregiões de Manaus e Madeira respondem por aproximadamente 50% de todos os
acidentes. É importante ressaltar que as duas regiões passaram por mudanças ambientais nos
últimos anos, a primeira por um inchaço periférico urbano, ao passo que a segunda pelos
empreendimentos agrícolas. Em ambos os casos, o homem tem se aproximado do habitat
natural do animal, o que contribui, segundo Polis (1990), para que haja o acidente.
A figura 2 faz uma correlação entre a distribuição dos acidentes conforme os
meses do ano e o índice médio de precipitação pluviométrica do estado. Os dados indicam
que anualmente os acidentes são distribuídos em dois grupos distintos de meses, o primeiro
formado pelos meses de janeiro a junho, mais chuvosos, e o segundo, que reúne os meses de
julho a dezembro, com menores índices de precipitação. Os dados são consolidados pelo teste
de correlação de Spearman (p=0,030 e rs=0,625).

Figura 2 - Correlação entre índices pluviométricos e acidentes causados por


escorpiões no Estado do Amazonas durante os anos de 2008 a 2014.
Fonte: Adaptado de INMET (2015) e SINAN (2015)
13
Os resultados da correlação corroboram com os achados de Benmosbah et al.
(2013), que em conjunto com outros autores, defendem a hipótese de que a atividade dos
escorpiões está diretamente relacionada com os índices pluviométricos, o que pode provocar
um maior contato com o ser humano, causando os acidentes (ARAÚJO et al., 2010; CARMO
et al., 2013; MIRSHAMSI, 2013). Além disso, em relação ao Estado do Amazonas, é possível
inferir que os acidentes podem estar associados com a dinâmica das cheias e vazantes dos
rios, onde as invasões das águas no período chuvoso podem estar provocando a diminuição de
território dos escorpiões, permitindo maior aproximação com as populações ribeirinhas,
facilitando os acidentes.
Variáveis como a região geográfica (zona rural/urbana) dos municípios que
ocorreu a picada, o sexo e a idade do acidentado, a região anatômica e a escolaridade da
pessoa que sofreu o acidente, bem como o tempo médio entre a picada e o primeiro
atendimento médico foram analisadas (tabela 2). Em relação à região geográfica, os
resultados indicam uma maior prevalência de acidentes nas zonas rurais, 1092 ocorrências, o
que corresponde a 56,11% do total. Os resultados da presente pesquisa mostram que nas
microrregiões de Itacoatiara, Purus e Manaus, 62,82%, 61,72% e 58,79%, respectivamente,
das picadas foram registradas para as zonas urbanas dos municípios.
Os dados relacionados à prevalência de acidentados nas zonas rurais estão de
acordo com os apresentados por Cermeño et al. (2011) para o Estado de Bolivar, na
Venezuela e pelos descritos por Costa (2012) para o município de Santarém, na região oeste
do Estado do Pará. Entretanto, divergem de Bredt & Litchteneker (2014) e Brasil et al. (2013),
que descrevem, respectivamente, para os Estados do Paraná e São Paulo, índices maiores para
as regiões urbanizadas. É importante ressaltar que a consonância com os dados de Santarém e
Bolivar refletem muito mais o contexto do escorpionismo verificado no Amazonas, do que os
apresentados pelos os outros dois municípios.
Diferentemente dos dados apresentados para o Estado, o escorpionismo em
Manaus foi maior em sua zona urbana. Inúmeros trabalhos mostram que fatores ambientais
como a presença de lixo, associados à falta de infra-estrutura básica e a escassez de medidas
educativas podem influenciar na distribuição das espécies de escorpiões oportunistas em
centros urbanos (CRUZ et al., 1994; LIRA et al., 2015). Esses fatores, em conjunto com a alta
densidade demográfica da capital amazonense, praticamente 2 milhões de pessoas, podem ser
os grandes responsáveis pela maior incidência do escorpionismo na zona urbana da capital
amazonense.
Em relação ao sexo, a prevalência ficou por conta do masculino, das 1986
notificações, 1308 (65,88%) acometeram os homens, o que levou o teste estatístico de
14
Friedman, p=0,008, apresentar diferença estatística em relação ao sexo feminino. Resultados
semelhantes foram obtidos em Santarém e Belém, no Estado do Pará, regiões com condições
climáticas aproximadas à amazonense (COSTA, 2012; NETO et al., 2008; PARDAL et al.,
2014). Contudo, quando comparados com outras localidades do Brasil, os resultados da
pesquisa são rechaçados, é o caso dos estudos realizados por Oliveira et al. (2012) na Paraíba
e Silva et al. (2012) para Bahia, onde, respectivamente, 60% e 58% dos acidentes com
escorpiões envolveu o sexo feminino. Dessa forma, é possível inferir que não existe um
padrão de ataques de escorpiões relacionados ao sexo, pois há, de acordo com a região, muitas
variáveis envolvidas com os acidentes. Necessitando, portanto, de conhecimento regional para
tomadas de medidas preventivas.
Já em relação à região anatômica mais vulnerável ao acidente, os resultados
indicam que os membros superiores dos acidentados, com 46,98% dos casos, contra 44,87%
dos membros inferiores, são os mais suscetíveis. Os resultados estão de acordo com os
descritos por Santos et al. (2010) para o município de Juiz de Fora, Minas Gerais. De outra
forma, distorcem dos dados de Barbosa et al. (2012), que em trabalho desenvolvido na capital
do Estado de Minas Gerais, Belo Horizonte, apontam os membros inferiores como as mais
suscetíveis. Os estudos sobre escorpionismo mostram que não há um consenso em relação à
região anatômica mais acometida, contudo, é fato que os membros são os mais vulneráveis, e
esta informação deve ser considerada em políticas públicas de prevenção.
Quanto ao nível de escolaridade, os resultados demonstram que todos os grupos
são afetados pelo escorpionismo, com destaque para as pessoas que se enquadram no grupo
com ensino fundamental completo ou incompleto, que representaram 29,30% do total. Dados
semelhantes foram publicados por Oliveira et al. (2012) para o Estado da Paraíba, região
nordeste do Brasil e por Nodari et al. (2010) para o Estado do Paraná. A hipótese levantada
para explicar a maior vulnerabilidade deste grupo está no tipo de atividade econômica
desenvolvida, geralmente um trabalho braçal na roça ou de construção civil, que facilita o
contato com o animal.
O estudo revelou que o tempo de atendimento hospitalar de 66,27% dos casos, nas
três primeiras horas após o acidente, é compatível com dados disponíveis na literatura
(BARBOSA et al., 2012; BENMOSBAH et al., 2013; CERMEÑO et al., 2011; OLIVEIRA et
al., 2012; PARDAL et al., 2014). É importante salientar que o veneno escorpiônico é descrito
como sendo uma mistura complexa capaz de provocar variações fisiológicas, incluindo, por
exemplo, o bloqueio das atividades nervosas (MÉNEZ et al.,1992). Portanto, a assistência
médica deve ser prestada o mais rápido possível. Dessa forma, maiores serão as chances do

15
quadro clínico não evoluir para complicações mais graves, caso contrário, pode levar o
paciente a óbito.

Tabela 2 - Variáveis mais representativas relacionadas ao escorpionismo no Amazonas entre


os anos de 2008 e 2014 (1.986 acidentes).
Teste de Valor de
Variáveis Mais representativo Quantidade/percentual
Friedman P

Zona geográfica Rural 1.092 (54.98%) 7.00 0.008

Sexo Masculino 1.308 (65.86%) 7.00 0.008

Faixa etária 20 a 34 anos 564 (28.40%) 21.00 0.001

Membros
Região anatômica 933 (46.98%) 19.59 0.001
Superiores

Ensino
Nível escolar 582 (29.30%) 22.42 0.001
fundamental

Tempo para
até 3 horas 1.316 (66.27%) 19.07 0.001
atendimento
Fonte: Sistema de Informação de Agravos de Notificação (SINAN)

Dados inerentes à gravidade do acidente, à admissão de soroterapia e à evolução


clínica do acidentado por escorpião são apresentados na tabela 3. Quanto à gravidade do
acidente, 65,16% das notificações foram classificadas como leve, 25,63% moderada e 4,38%
grave. Resultados semelhantes foram encontrados por Cermeño et al. (2011) para o Estado de
Bolívar, na Venezuela e por Alves et al. (2007), no Estado do Ceará, Brasil.
Em relação à soroterapia, os resultados indicam que em 57,75% dos casos foram
ministrados o soro anti-escorpiônico, índice elevado quando comparado aos descritos por
Santos et al. (2010) e Silva et al. (2012), onde, respectivamente, apenas 2,10% e 7,50% dos
acidentados receberam o soro. Por possuir frações proteicas do animal usado para produzi-lo,
Amaral et al. (1994) classificaram o soro anti-escorpiônico como sendo um produto
heterólogo, o que pode provocar reações graves ao paciente. Por conta disso, deve ser
administrado de forma mais racional possível. No presente trabalho mais de 65% dos
acidentes foram diagnosticados como leve, o que de acordo com Brasil (2009) não seria
necessário o uso do soro. Aksel et al. (2014) relatam que em se tratando de casos leves, um
tratamento complementar à base de lidocaína tópica pode auxiliar na recuperação. Os
resultados do presente estudo apontam a necessidade de revisão dos critérios de avaliação e
diagnóstico dos casos de acidentes por escorpiões no Estado do Amazonas.
Em relação à evolução clínica dos pacientes, a pesquisa indicou que 95,07% dos
casos evoluíram para cura e que em apenas 0,40% dos registros ocorreram óbitos. Durante o
16
período analisado foram constatados oito óbitos, todos relacionados às pessoas com faixa
etária abaixo dos 15 anos, o que está de acordo com os dados da literatura, Campolina (2006),
por exemplo, relata que os acidentados pertencentes à faixa etária descrita apresentam 18
vezes mais riscos de morte se comparados às demais idades. O percentual de acidentes com
vítima fatal para o Amazonas ficou em torno de 0,030 casos por grupo de 100 mil habitantes,
acima da média nacional, que gira em torno de 0,028 casos (RECKZIEGEL & JUNIOR,
2014). O percentual de óbitos foi praticamente o mesmo dos descritos por Neto et al. (2008)
para o Estado do Pará.

Tabela 3 - Frequência dos acidentes segundo a gravidade do caso, a soroterapia e a evolução


clínica do acidentado por escorpiões no Estado do Amazonas entre os anos de 2008 e 2014
(1.986 acidentes).
Gravidade do caso

Ignorado/branco Leve Moderado Grave


96 – 4.83% 1.294 – 65.16% 509 – 25.63% 87 – 4.38%

Soroterapia
Ignorado/branco Sim Não
123 – 6.19% 1.147 – 57.75% 716 – 36.06%

Evolução Clínica
Ignorado/branco Cura Óbito
90 – 4.53% 1.888 – 95.07% 8 – 0.40%
Fonte: Sistema Nacional de Agravos e Notificações (SINAN)

A partir das análises e identificação das espécies adquiridas junto às unidades de


atendimento aos acidentados distribuídas ao longo do estado, foi possível verificar que a
espécie Tityus metuendus destacou-se como a principal responsável pelos acidentes com
intervenção médica na região de Manaus, uma vez que dos 130 exemplares adquiridos, 110
deles foram caracterizados como sendo da referida espécie, o que representa um percentual na
ordem de 85%. Na microrregião do Madeira, mais precisamente no município de Apuí, os
acidentes com necessidades de apoio médico foram associados à espécie T. matthieseni. Dos
80 indivíduos provenientes do referido município, 72 (90%) foram identificados como sendo
T. matthieseni. Conforme exemplares adquiridos junto ao Hospital do Exército de Tabatinga,
principal centro de saúde da região do Alto Solimões, a espécie T. bastosi Lourenço, 1984,
com um percentual de 83% dos casos, foi a que mais provocou acidentes com necessidades de
suporte hospitalar. Por outro lado, a espécie T. silvestris Pocock, 1897, representando 92%,

17
dos 54 espécimes adquiridos nos centros de saúde de Rio Preto da Eva, foi o grande destaque
da região. Cardoso et al. (2003) relataram que as espécies T. metuendus e T. silvestris estão
envolvidas em casos de acidentes com complicações mais graves no Estado do Amazonas.
Contudo, não delimitaram as áreas geográficas em que provocam acidentes. A partir da
compilação dos resultados foi possível afirmar que, dependendo da microrregião analisada,
existe uma variação na espécie causadora do acidente, entretanto todas pertencentes ao gênero
Tityus, corroborando dados da literatura (ALBUQUERQUE et al., 2009). É importante
salientar que o presente estudo é pioneiro para o Amazonas, Estado que apresenta a maior
biodiversidade de espécies escorpiônicas do Brasil, mas que até o presente momento não
havia estudos relacionados ao escorpionismo.

18
6 Conclusões
A proposta da presente pesquisa era traçar o perfil do escorpionismo no Estado do
Amazonas. Certamente, os resultados apresentados contribuíram para um melhor
entendimento acerca deste grave problema de saúde pública no Amazonas, uma vez que
apresentou dados inéditos dos acidentados e colocou quatro espécies como sendo as principais
responsáveis pelos acidentes, o que, provavelmente, será considerado em políticas de
prevenção aos acidentes. Além disso, mostra que as investigações sobre o entendimento do
escorpionismo no Estado devem continuar, já que a área é extensa e cada região apresenta
suas peculiaridades quanto às condições de ocupação de solo, atividade econômica, espécies
predominantes e muitas outras variáveis que podem favorecer os acidentes em uma região e
impedi-los em outras.

19
7 Referências Bibliográficas
AB’SÁBER, A.N. Os domínios de natureza no Brasil: potencialidades
paisagísticas. São Paulo: Ateliê Editorial, 159p. 2003.

ADIGUZEL, S. In vivo and in vitro effects of scorpion venoms in Turkey: A mini-


review. J. Venom. Anim. Toxins incl. Trop. Dis., 16 (2), 198-211, 2010.

ARAÚJO, C.S.; CANDIDO, D.M.; ARAÚJO, H.F.P.; DIAS, S.C.;


VASCONCELLOS, A. Seasonal variations in scorpion activities (Arachnida: Scorpiones) in
an area of Caatinga vegetation in Northeastern Brazil. Zoologia, 27, 372-376, 2010.

AMARAL, C.F.; DIAS, M.B.; CAMPOLINA, D. Children with adrenergic


manifestations of envenomation after Tityus serrulatus scorpion sting are protected from early
anaphylactic antivenom reactions. Toxicon, 32, 211-215, 1994.

AKSEL, G.; GÜLER, S.; DOĞAN, N.Ö.; ÇORBACIOĞLU, Ş.K. A randomized trial
comparing intravenous paracetamol, topical lidocaine, and ice application for treatment of
pain associated with scorpion stings. Human & experimental toxicology, 34 (6), 662-667,
2014.

ALBUQUERQUE, C.M.R.; PORTO, T.J.; AMORIM, M.L.P.; SANTANA-NETO,


P.L. Escorpionismo por Tityus pusillus Pocock, 1893 (Scorpiones; Buthidae) no Estado de
Pernambuco. Rev Soc Bras Med Trop, 42, 206-208, 2009.

ALVES, R.S.; MARTINS, R.D.; SOUSA, D.F.; ALVES, C.D.; BARVOSA, P.S.F.;
QUEIROZ, M.G.R. Aspectos epidemiológicos dos acidentes escorpiônicos no Estado do
Ceará no período de 2003 a 2004. Revista eletrônica Pesquisa Médica, 1 (3), 14-20, 2007;

AYRES, M.; AYRES, J.; AYRES, D.L.; SANTOS, A. BioEstat 5.0: aplicações
estatísticas nas áreas das ciências biológicas e médicas. Belém: Sociedade Civil Mamirauá,
364p. 2007.

BARBOSA, M.G.R.; BAVIA, M.E.; SILVA, C.E.; BARBOSA, F.R. Aspectos


Epidemiológicos dos Acidentes Escorpiônicos em Salvador, Bahia, Brasil. Ciência Animal
Brasileira, 4 (2), 155-162, 2011.
20
BARBOSA, A.D.; MAGALHÃES, D.F.; SILVA, J.A.; SILVA, M.X.; CARDOSO,
M.F.E.; MENESES, J.N.C. Epidemiological study of scorpion stings in Belo Horizonte,
Minas Gerais State, Brazil, 2005-2009. Cad. Saúde Pública, Rio de Janeiro, 28 (9), 1785-
1789, 2012.

BENMOSBAH, M.; GUEGUENIAT, P.; MAYENCE, C.; EGMANN, G.;


NARCISSE, E.; GONON, S. Epidemiological and clinical study on scorpionism in French
Guiana. Toxicon, 73, 56-62, 2013.

BORGES, A.; SOUSA, L. Escorpionismo en Venezuela: una aproximación molecular,


inmunológica y epidemiológica para su estudio. Revista Facultad de Farmacia (Caracas),
69, 15-27, 2006.

BORGES, A.; ROJAS-RUNJAIC, F.J.M. Tityus perijanensis Gonza´ lez-Sponga


(Scorpiones, Buthidae): Molecular assessment of its geographical distribution and venom
lethality of Venezuelan populations. Toxicon, 50, 1005-1010, 2007.

BRASIL, M.S. Secretaria de Vigilância em Saúde. Manual de Controle de


Escorpiões. Brasília, 2009. Disponível em:
http://portal.saude.gov.br/portal/arquivos/pdf/manual_escorpioes-web.pdf. Acesso em: 27 de
abr. 2015.

BRASIL, J.; Zumkeller, S.; Neto, J.B. Historical profile of scorpion in São Paulo,
Brazil. Revista Brasileira de Geografia Médica e da Saúde – Hygeia, 9 (17), 158 - 167,
2013.

BRAZIL, T.K.; PORTO, T.J. Diversidade de Escorpiões do Brasil: Os escorpiões.


Salvador: EDUFBA, 48p. 2010.

BREDT, C.S.; LITCHTENEKER, K. Avaliação Clínica e Epidemiológica dos


acidentes com animais peçonhentos atendidos no Hospital Universitário do Oeste do Paraná
2008-2012. Rev. Med. Res., Curitiba, 16 (1), 11-17, 2014.

21
CAMPOLINA, D. Georreferenciamento e estudo clínicoepidemiológico dos
acidentes escorpiônicos atendidos em Belo Horizonte, no serviço de toxicologia de Minas
Gerais. Dissertação de Mestrado em Medicina Tropical – Universidade Federal de Minas
Gerais, Belo Horizonte/MG, 2006.

CARDOSO, J.L.C.; FRANÇA, F.; WEN, F.H.; MÁLAQUE, C.M.S.; JÚNIOR, V.


Animais peçonhentos no Brasil: Biologia, clínica e terapêutica dos acidentes. 1ª Edição.
São Paulo: Savier Editora de Livros Médicos, 468p. 2003.

CARMO, R.F.R.; AMORIM, H.P.; VASCONCELOS, S.D. Scorpion diversity in two


types of seasonally dry tropical forest in the semi-arid region of Northeastern Brazil. Biota
Neotrop. 13 (2), 340-344, 2013.

CELIS, A.; GAXIOLA, R.R.; SEVILLA, G.E.; OROZCO, V.M.J.; ARMAS J.


Tendencia de la mortalidad por picaduras de alacrán en México, 1979-2003. Rev Panam
Salud Publica, 21 (6), 373-380, 2007.

CERMEÑO, V.; JULMAR, R.; JULMERY, J.; GÓMEZ, V.H.; ALMIRAIL, D.


Scorpion Envenomation in El Palmar, State of Bolivar, Venezuela. Kasmera, 39 (1), 43-48,
2011.

CHIPPAUX, J.P.; GOYFFON, M. Epidemiology of scorpionism: A global apprasial.


Acta Trop, 107, 71-79, 2008.

COSTA, C.L.S.O. Aspectos epidemiológicos do escorpionismo na região de


Santarém, Estado do Pará, Brasil. Revista Colombiana de Ciencia Animal, 4 (1), 59-68,
2012.

COSTA, C.L.S.O; FE, N.; SAMPAIO, I.; TADEI, W.P. Survey of the species of
scorpions that occur in the state of Amazonas, Brazil, with unpublished data from
geographical distribution. Check-List Journal of Species Lists and Distribution (no prelo,
2016).

CRUZ, E.F.BS. Biologia dos Escorpiões. Venenos Animais - Uma Visão Integrada.
Rio de Janeiro: Editora de Publicações Científicas, 150p. 1994.
22
DE ROODT, A.R.; GARCIA, S. I.; SALOMON, O.D.; SEGRE, L.; DOLAB, J.A.;
FUNES, R.F.; DE TITTO, E.H. Epidemiological and clinical aspects of scorpionism by Tityus
trivittatus in Argentina. Toxicon, 41, 971-977, 2008.

DORNELES, A.L. Frequência de acidentes causados por animais peçonhentos


ocorridos no Rio Grande do Sul, 2001-2006. Dissertação de Mestrado, Universidade Federal
do Rio Grande do Sul, Porto Alegre/Rio Grande do Sul, 2009.

DUTTO, M.; DUTTO, L.; SCAGLIONE, N.; BERTERO, M. Euscorpius (Scorpiones,


Euscorpiidae): three cases of stings in northwestern Italy. The Journal of Venomous Animals
and Toxins including Tropical Diseases, 16 (4), 659-663, 2010.

EL OUFIR R.; SEMLALI, I.; IDRISSI, M.; SOULAYMANI, A.; BENLARABI, S.;
KHATTABI, A.; AIT MOH, M.; SOULAYMANI, B.R. Risk factors for scorpion stings in
the beni mellal province of morocco. J. Venom. Anim. Toxins incl. Trop. Dis., 15 (4), 258-
273, 2008.

FISZON, J.T.; BOCHNER, R. Subnotificação de acidentes por animais peçonhentos


registrados pelo SINAN no Estado do Rio de Janeiro no período de 2001 a 2005. Rev Bras
Epidemiol, 11 (1), 114-127, 2008.

FORRESTER, M.B.; STANLEY, S. K. Epidemiology of scorpion envenomations in


Texas. Vet. Hum. Toxicol, 46, 219-221, 2004.

GUPTA, S.K.; PESHIN, S.S.; SRIVASTAVA, A.; KALEEKAL, T. A study of


childhood poisoning at National Poisons Information Centre, all India Institute of Medical
Sciences, New Delhi. J. Occup. Health, 45, 191-196, 2003.

HEBERT, P. D. N.; CYWINSKA, A.; BALL, S. L.; deWAARD, J. R. Biological


Identifications Through DNA Barcodes. Proc Royal Soc Lond B, 270, 313-322, 2003.

HELLAL, H.; GUERINIK, M.; GRIENE, L.; LAID, Y.; MESBAH, S.; MERAD, R.
Données épidémiologiques sur l’envenimation scorpionique en Algérie. Bull Soc Pathol
Exot, 105 (3), 189-193, 2012.

23
HORTA, F.M.B.; CALDEIRA, A.P.; SARES, J.A. Escorpionismo em crianças e
adolescentes: aspectos clínicos e epidemiológicos de pacientes hospitalizados. Rev Soc Bras
Med Trop., 40 (3), 351-353, 2007.

HMIMOU, R.; SOULAYMANI, A.M.; ARFAOUI, A.; ELOUFIR, G.; SEMLALI, I.;
SOULAYMANI, B. R. Risk factors caused by scorpion stings and envenomations in the
Province of Kelâa Des Sraghna (Morocco). J. Venom. Anim. Toxins incl. Trop. Dis., 14 (4),
628-640, 2008.

IBGE, Instituto Brasileiro de Geografia e Estatística. Estimativa Populacional.


Brasília, 2015. Disponível em: http://www.ibge.gov.br/estadosat/perfil.php?lang=&sigla=am.
Acesso em: 22 de jul. de 2015.

INMET, Instituto Nacional de Meteorologia. Banco de Dados Meteorológicos para


Ensino e Pesquisa. Brasília, 2015. Disponível em:
http://www.inmet.gov.br/portal/index.php?r=bdmep/bdmep. Acesso em: 18 de maio de 2015.

JALALI, A.; PIPELZADEH, M.H.; SAYEDIAN, R.; ROWAN, E.G. A review of


epidemiological, clinical and in vitro physiological studies of envenomation by the scorpion
Hemiscorpius lepturus (Hemiscorpiidae) in Iran. Toxicon, 55 (2), 173-179, 2010.

JESÚS, C.P.; ESPERANZA, V.D.; ÉCTOR, J.R.B.; ENRIQUE, V.S.; ELIA, L.L.;
MÓNICA, E.R.T. Distribución geográfica del alacranismo em el Estado de Guanajuato, Acta
Universitaria, 17 (2), 12-18, 2007.

JÚNIOR, O.B.N.; CESTARO, L.A.; SILVA, H.P. Geografia Física. Natal/RN:


EDUFRN Editora, 2a Edição, 294p, 2011.

KALTSAS, D.; MYLONAS, M. The Population Structure of Mesobuthus gibbosus


(Scorpiones: Buthidae) on Koufonisi Island (Central Aegean Archipelago, Greece).
Euscorpius, 55, 1-10, 2007.

LAID, Y.; BOUTEKDJIRET, L.; OUDJEHANE, R.; LARABA, D.; HELLAL, H.;
GUERINIK, M.; GRIENE, L. Incidence and severity of scorpion stings in Algeria. The
Journal of Venomous Animals and Toxins including Tropical Diseases, 18, 399-410, 2012.
24
LANGLEY, R.L. Animal-related fatalities in the United States - an update.
Wilderness Environ. Med., 16, 67-74, 2005.

LEWIS, S.L.; LLOYD, J.; SITCH, S.; MITCHARD, E.T.; LAURANCE, W.F.
Changing ecology of tropical forests: evidence and drivers. Annual Review of Ecology,
Evolution, and Systematics, 40, 529-549, 2009.

LIMA, M.H.P.; RODRIGUES, C.M.; SILVA, J.K.T.; MARTINS, P.C.; TERRON,


S.L.; SILVA, R.L.Z. Divisão Territorial do Brasil. Fundação Instituto Brasileiro de
Geografia e Estatística (IBGE). Brasília: Departamento de Estruturas Territoriais, 36p. 2002.

LIRA, A.F.A.; REGO, F.N.A.A.; ALBUQUERQUE, C.M.R. How important are


environmental factors for the population structure of co-occurring scorpion species in a
tropical forest?. Canadian Journal of Zoology, 93 (1), 15-19, 2015.

LOURENÇO, W.R. Panbiogéographie, les Familles des Scorpions et Leur Repartition


Géographique. Biogeographica, 76 (1), 21-39, 2000.

LOURENÇO, W.R. Scorpion diversity in Tropical South America: Implications for


conservation programs. In BROWNELL, P.; POLIS, G.P (eds.). Scorpion Biology and
Research. New York: Oxford University Press, p.406-415, 2001.

LOURENÇO, W.R. Scorpions of Brazil. Paris-France, Les Èditions de I’If, 307p.


2002.

LOURENÇO, W.R.; ADIS, J.; ARAUJO, J.S. A new synopsis of the scorpion fauna
of the Manaus region in Brazilian Amazonia, with special reference to an inundation forest at
the “Tarumã Mirim” river. Amazoniana, 18 (3/4), 241-249, 2005.

LUCAS, S.M. O laboratório de artrópodes do Instituto Butantan e os aracnídeos


peçonhentos. História, Ciências, Saúde-Manguinhos, Rio de Janeiro, 10 (3), 1025-1035,
2003.

MACARTHUR, R.H. Geographical ecology. New York: Harper and Row, 269p.
1972.
25
MÉNEZ, A.; BONTEMS, F.; ROUMESTAND, C.; GILQUIN, B.; TOMA, F.
Structural basis for functional diversity of animal toxins. Proceedings of the Royal Society of
Edinburgh. Section B. Biological Sciences, 99 (1-2), 83-103, 1992.

MIRSHAMSI, O. Ecological niche modeling of two scorpion species Mesobuthus


eupeus (C. L. Koch, 1839) and M. phillipsii (Pocock, 1889) from the Iranian Plateau and
Zagros region. Euscorpius, 154, 1-10, 2013.

NETO, A.M.; GUEDES, A.B.; CARMO, S.D.F.; CHALKIDIS, H.D.M.; COELHO,


J.S.; PARDAL, P.P.D.O. Aspectos do escorpionismo no Estado do Pará-Brasil. Revista
Paraense de Medicina, 22 (1), 49-55, 2008.

NIMER, E. Climatologia do Brasil. Rio de Janeiro: 2a Edição, IBGE, 421p. 1989.

NODARI, F.R.; LEITE, M.L.; NASCIMENTO, E. Aspectos demográficos, espaciais e


temporais de acidentes escorpiônicos ocorridos na área de abrangência da 3ª Regional de
Saúde -Ponta Grossa, PR, no período de 2001 a 2004. Cienc. Biol., 12, 15-26, 2010.

OLIVEIRA, H.A.; LOPES, Y.A.; BARROS, R.M.; VIEIRA, A.; LEITE, R.S.
Epidemiologia dos acidentes escorpiônicos ocorridos na Paraíba – Nordeste do Brasil. Biofar-
Revista de Biologia e Farmácia, 8 (2), 86-96, 2012.

OTERO, R.; NAVIO, E.; CESPEDES, A.; NUNEZ, J.; LOZANO, L.; MOSCOSO, R.
Scorpion envenoming in two regions of Colombia: clinical, epidemiological and therapeutic
aspects. Trans. R. Soc. Trop. Med. Hyg., 98, 742–750, 2008.

PASTRANA, J.; BLASCO, R.; ERCE, R.; PINILLOS, M.A. Picaduras y mordeduras
de animales. Anales Sis San Navarra, 26 (1), 225-241, 2008.

PARDAL, P.P.D.O.; ISHIKAWA, E.A.Y.; VIEIRA, J.L.F. Contribuição ao


conhecimento do escorpionismo e do escorpião Tityus obscurus Gervais, 1843 (Scorpiones,
Buthidae) de duas regiões distintas no Estado do Pará na Amazônia brasileira. Revista Pan-
Amazônica de Saúde, 5 (3), 73-74, 2014.

26
PARMAKELIS, A.; KOTSAKIOZ, P.; STATHI, I.; POULIKARAKOU, S.;
VICTOR, F. Hidden diversity of Euscorpius (Scorpiones: Euscorpiidae) in Greece revealed
by multilocus species-delimitation approaches. Biological Journal of the Linnean Society,
110, 728-748, 2013.

PIPELZADEH, M.H.; JALALI, A.; TARAZ, M.; POURABBAS, R.;


ZAREMIRAKABADI, A. An epidemiological and a clinical study on scorpionism by the
Iranian scorpion Hemiscorpius lepturus. Toxicon, 50, 984-992, 2007.

POLIS, G.A. The Biology of Scorpions. Stanford University Press, 587p. 1990.

QUADROS, R.M.; VARELA, A.R.; CAZARIN, M.G.; MARQUES, S.M.T. Scorpion


envenomations notified by sinan in the mountainous region of Santa Catarina, Brazil, 2000-
2010. REB, 7, 96-108, 2014.

RIBEIRO, W.C. Patrimônio ambiental brasileiro. São Paulo: Editora da


Universidade de São Paulo, 543p. 2003.

RECKZIEGEL, G.C.; JUNIOR, V.L.P. Analysis of the scorpionism in Brazil from


2000 to 2010. Rev Pan-Amaz Saude, 5 (1), 16-19, 2014.

SANTOS, P.L.C.; MARTINS, J.F.; VIEIRA, R.C.; RIBEIRO, L.C.; BARRETO. B.B.;
BARBOSA, N.R. Características dos Acidentes Escorpiônicos em Juiz de Fora - MG. Revista
APS, 13 (2), 164-169, 2010.

SCHENONE, F.; FONTECILLA, J. Brotes epidémicos de picaduras de escorpión en


habitantes de viviendas urbanas de construcción reciente. Bol Chil Parasitol, 53 (1/2), 35-37,
2008.

SILVA, R.M.. AMORIM, A.M.D.; BRAZIL, T.K. Envenomation by Tityus stigmurus


(Scorpiones; Buthidae) in Bahia, Brazil. Rev. Soc. Bras. Med. Trop., 33 (3), 239-245, 2012.

SINAN, Sistema Nacional de Agravos de Notificação. Acidentes por animais


peçonhentos - Notificações registradas no Sistema de Informação de Agravos de
Notificação. Brasília, 2015. Disponível em:
27
http://dtr2004.saude.gov.br/sinanweb/tabnet/dh?sinannet/animaisp/bases/animaisbrnet.def.
Acesso em: 15 de jan. 2015.

SINITOX, Sistema Nacional de Informações Toxico-Farmacológicas. Acidentes por


escorpiões no Brasil. Rio de Janeiro, 2009. Disponível em:
http://www.fiocruz.br/sinitox_novo/cgi/cgilua.exe/sys/start.htm. Acesso em 14 de mar. 2015.

SOLEGLAND, M.E.; FET, V. High level systematics and phylogeny of the extant
scorpions (Scorpiones: Orthosterni). Euscorpius, 11, 1-175, 2003.

SPSS for Windows. Version 14.0. Chicago, SPSS Inc. 2005.

28
Capítulo II - Levantamento da distribuição geográfica das espécies escorpiônicas que
ocorrem no Estado do Amazonas
1 Considerações Gerais
Os escorpiões são artrópodes que pertencem à ordem Scorpiones, classe
Arachnida. De acordo com Saldarriaga & Otero (2000) são animais com existência
comprovada a mais de 400 milhões de anos e que passaram, ao longo do tempo, por poucas
mudanças morfológicas. Polis (1990) relata que os escorpiões têm um alto poder de
adaptação, podendo serem encontrados em desertos, savanas, cerrados, florestas temperadas e
florestas tropicais.
MacArthur (1972) salienta que ao contrário da maioria dos animais, os escorpiões
são mais diversos em regiões subtropicais, principalmente entre as latitudes 23° e 38° graus
norte, decrescendo em relação aos polos e ao equador. Contudo, Lourenço (2001) coloca o
continente sul-americano como uma das regiões mais importantes do planeta em termos de
diversidade de escorpiões, especialmente aquelas regiões que exibem um grande endemismo
no número de espécies, como é o caso da região amazônica.
Em termos de biodiversidade de espécies escorpiônicas a região Norte é a mais
representativa do Brasil, já que mais de 50% de todas as espécies descritas para o país
encontram-se na referida área (BRAZIL & PORTO, 2010).
O Estado do Amazonas é aquele que apresenta, no Brasil, a maior quantidade de
espécies. Neste cenário, duas regiões merecem destaque, a microrregião de Manaus e a do
Alto Rio Negro, já que concentram a maioria das espécies endêmicas do Estado
(LOURENÇO, 2005a; LOURENÇO et al., 2005a). Três das quatro famílias de escorpiões
descritas para o Brasil ocorrem no Estado do Amazonas, são elas, Buthidae Koch, 1837,
Chactidae Pocock, 1893 e Liochelidae Fet & Bechly, 2001.
Embora o Brasil seja um país densamente habitado por escorpiões, a maior parte
dos estudos sobre escorpiões são voltados para questões epidemiológicas, assim, pouco se
sabe sobre o comportamento e ecologia das populações em seu habitat natural (LOURENÇO,
1994). McIntyre (1999) chama a atenção para a carência de estudos sobre dados básicos de
comportamento biológico e distribuição geográfica dos escorpiões. Contudo, mesmo que de
forma tímida, alguns trabalhos já foram publicados com esta vertente.
Estudo de Lourenço (1988) aponta que, em geral, os escorpiões são animais
antissociais, solitários e que interagem com seus coespecíficos somente durante o nascimento,
acasalamento, ou ainda em casos de canibalismo. Entretanto, existem exceções, é o caso da
espécie brasileira Opisthacanthus cayaporum Vellard, 1932, que mostra certa organização
social, vivendo, inclusive, em grupo. De acordo com o seu padrão ecológico, os escorpiões
29
são classificados em dois grupos, os especialistas e os oportunistas, sendo os últimos os mais
preocupantes para os órgãos de saúde, haja vista que estão envolvidos com a maioria dos
acidentes graves (POLIS, 1990).
Estudos mais recentes apontam a importância no conhecimento da ecologia e
distribuição desses animais, a partir das quais podem ser adotadas medidas de prevenção
contra o escorpionismo. Nogueira et al. (2008), por exemplo, relataram que os escorpiões
apresentam alta plasticidade de dispersão, o que se traduz em padrões irregulares de habitats,
podendo dificultar medidas preventivas contra acidentes. Carmo et al. (2013) mostraram que
algumas variáveis ambientais podem influenciar na distribuição espacial desses animais, entre
elas, destaque para a associação entre a temperatura e a precipitação. Estudos com este escopo
podem subsidiar políticas públicas de prevenção contra os acidentes em áreas antropizadas.

30
2 Justificativa
Assim como foi apresentado, os escorpiões são classificados em dois grupos,
sendo os escorpiões oportunistas os grandes responsáveis pelos acidentes que necessitam de
intervenção médica. No entanto, conforme salienta Lewis et al. (2009), existe uma carência de
dados básicos sobre o comportamento e distribuição destes animais, o que contribui para a
falta de desenvolvimento de políticas públicas de conservação das espécies e prevenção
contra o escorpionismo em áreas urbanas. Diante disso, levando-se em conta a biodiversidade
escorpiônica do Amazonas, a carência de estudos de distribuição geográfica desses animais e
o seu envolvimento com os acidentes fatais, é que o presente estudo apresentou como
proposta principal, o levantamento da distribuição das espécies de escorpiões que ocorrem no
Estado do Amazonas.

31
3 Objetivos
3.1 Objetivo Geral
Realizar um levantamento da distribuição geográfica das espécies escorpiônicas
que ocorrem no Estado do Amazonas.

3.2 Objetivos Específicos


 Atualizar os dados acerca da distribuição geográfica das espécies escorpiônicas que
ocorrem no Estado do Amazonas;
 Verificar quais as áreas de maior endemismo de espécies escorpiônicas;
 Relatar a ocorrência de espécies nos municípios do Estado do Amazonas.

32
4 Material e Métodos
4.1 Área de Estudo
Ver página 9 do capítulo I.
4.2 Dados da Distribuição Geográfica
As informações acerca da distribuição geográfica dos escorpiões foram adquiridas
a partir dos dados disponíveis em publicações científicas, em fichas de tombos das coleções
aracnológicas da Universidade Federal do Amazonas - UFAM, Instituto Nacional de Pesquisa
da Amazônia - INPA e da Fundação de Medicina Tropical do Amazonas – FMT/AM e através
de coletas de campo realizadas em vários municípios do Estado do Amazonas.

4.3 Coletas de Campo


As coletas de campo foram realizadas a partir da autorização de número 43625-1,
emitida pelo Instituto Chico Mendes (ICMBIO). Espécimes de escorpiões foram coletados
por meio da técnica de pitfall e por meio de busca ativa entre os anos de 2012 e 2014, nos
municípios de Apuí, Benjamin Constant, Careiro da Várzea, Coari, Iranduba, Manacapuru,
Manaus, Presidente Figueiredo, Rio Preto da Eva, Silves e Tabatinga. Os animais coletados
foram posteriormente identificados a partir dos seus atributos morfológicos usando-se a chave
taxonômica proposta por Lourenço (2002).

33
5 Resultados e Discussão
De acordo com o levantamento da literatura, para o Estado do Amazonas já foram
descritas 46 espécies de escorpiões, números que representam praticamente um terço de toda
a fauna escorpiônica brasileira catalogada, cerca de 140 espécies, que estão distribuídas em
três famílias diferentes - Buthidae, Chactidae e Liochelidae (LOURENÇO & PINTO-DA-
ROCHA, 2000; LOURENÇO et al. 2005a; BRAZIL & PORTO, 2010; LOURENÇO et al.
2011; OCHOA et al. 2013). A figura 1 (apêndice I) apresenta o atual contexto da distribuição
das espécies escorpiônicas com registros para o Estado do Amazonas.
A família Buthidae (figura 2) é representada por 25 espécies distribuídas nos
gêneros Ananteris Thorell, 1891, Microtityus Kjellesvig-Waering, 1966 e Tityus Koch, 1836,
os quais apresentam, respectivamente, seis, uma e dezoito espécies diferentes. É a família
mais importante do ponto de vista médico, já que nela estão incluídas os escorpiões do gênero
Tityus, os principais responsáveis por acidentes considerados graves no Brasil
(STOCKMANN & YTHIER, 2010).

Figura 2 – Esquema representativo das espécies pertencentes à família Buthidae no Estado do


Amazonas, Brasil.
34
A distribuição geográfica das espécies pertencentes à família Buthidae que
ocorrem no Estado do Amazonas é listada abaixo:
 Gênero Ananteris Thorell, 1891
 Ananteris cryptozoicus Lourenço, 2005
É um escorpião com holótipo descrito para região de floresta secundária
conhecida como capoeira, nas adjacências do rio Tarumã Mirim, coordenadas geográficas 03°
02'52.11"S, 060° 17'53.41"W, no município de Manaus, Estado do Amazonas. O escorpião é
caracterizado pelo pequeno tamanho, 11 mm de comprimento, principalmente se comparado
com outras espécies do mesmo gênero (LOURENÇO, 2005b). Os dados das coleções
aracnológicas apontam o registro da espécie somente para a referida região. No levantamento
de campo não foram encontrados exemplares da espécie.
 Ananteris dekeyseri Lourenço, 1982
Espécie descrita a partir de um holótipo coletado através da técnica de pitfall, no
Km 350 da BR 319, 05° 19'15.25"S, 061° 59'55.25"W, microrregião do Madeira, no Estado
do Amazonas (LOURENÇO, 1982). Conforme registros de tombo da coleção aracnológica do
INPA, a espécie também ocorre na Reserva Ducke, 02° 57'41.65"S, 059° 56'15.71"W e no
município de Presidente Figueiredo, 01° 47'59.28"S, 059° 14'32.71"W. Em decorrência do
presente trabalho, exemplares de A. dekeyseri foram coletados através de busca ativa na zona
urbana de Manaus, coordenadas geográficas 03° 04'2.26"S, 059° 58'47.60"W.
 Ananteris madeirensis Lourenço & Duhem, 2010
É uma espécie que foi descrita a partir de um holótipo coletado através da técnica
de pitfall, no Km 350 da BR 319, 05° 23'46.20"S, 061° 54'31.60"W, na microrregião do
Madeira, Estado do Amazonas (LOURENÇO & DUHEM, 2010a). Os levantamentos
realizados junto às coleções aracnológicas do estado confirmam a presença da espécie para a
referida região. Na pesquisa de campo, exemplares de A. madeirensis não foram encontrados
em outras áreas do Amazonas, o que sugere que a distribuição da espécie pode estar restrita ao
sudeste do Estado.
 Ananteris nairae Lourenço, 2004
Espécie descrita a partir de um holótipo macho oriundo do município de Coari,
04° 55'53"S, 065° 18'13"W, região central do Estado do Amazonas. Coletas posteriores
mostraram que a espécie também ocorre na região do Alto Rio Negro, 00° 7'43.60"S, 067°
04'22.34"W, extremo oeste do Estado. Sendo, portanto, um dos representantes do gênero com
distribuição mais a oeste do Brasil (LOURENÇO, 2004). Nas coletas de campo não foram
encontrados exemplares da espécie.

35
 Ananteris palmari Botero-Trujillo & Noriega, 2011
Espécie descrita a partir do holótipo fêmea coletado na Reserva Natural de
Palmari, 04° 17'21.86"S, 070° 17'38.36"W, no município de Atalaia do Norte. É uma espécie
que apresenta relação simpátrica com outros escorpiões, como é o caso dos Tityus bastosi
Lourenço, 1984 e alguns representantes do gênero Chactopsis Kraepelin, 1912, que ocorrem
na microrregião do Alto Solimões (BOTERO-TRUJILLO & NORIEGA, 2011). As
informações das coleções aracnológicas fazem referência apenas à localidade de descrição da
espécie. Nas coletas de campo não foram encontrados exemplares de A. palmari.
 Ananteris pydanieli Lourenço, 1982
Espécie descrita a partir de exemplares coletados em área de floresta tropical na
região do Rio Urucu, 04° 55'53"S, 065° 18'13"W, município de Coari, no Estado do
Amazonas. Coletas recentes mostram que a espécie é mais comum do que se previa
originalmente. Na Reserva Ducke, por exemplo, é facilmente coletado pela técnica de pitfall
em áreas de platôs (LOURENÇO, 2004). Registros de tombos das coleções aracnológicas do
INPA e FMT indicam que a espécie ocorre, ainda, na região urbana de Manaus, o que foi
confirmado pelas nossas coletas, 03° 5'58.00"S, 059° 59'1.54"W.

 Gênero Microtityus Kjellesvig-Waering, 1966


 Microtityus vanzolinii Lourenço & Eickstedt, 1983
É uma espécie em que seus representantes são caracterizados por apresentarem
pequeno porte. O gênero Microtityus é exclusivo da fauna neotropical, seus representantes são
encontrados principalmente nas ilhas caribenhas e extremo norte da América do Sul. Contudo,
a espécie M. vanzolinii foi descrita para o município de Barcelos, microrregião do Rio Negro,
00° 59'12.66"S, 062° 55'58.21"W, no Estado do Amazonas, Brasil (BOTERO-TRUJILLO et
al., 2009). Os registros das coleções fazem referência apenas à região acima descrita. Não
foram encontrados exemplares da espécie nas coletas de campo realizadas em decorrência
deste trabalho.

 Gênero Tityus Koch, 1836


 Tityus apiacas Lourenço, 2002
Espécie descrita para o Estado do Amazonas a partir de um exemplar coletado no
município de Coari, 04° 8'36.56"S, 063° 8'22.28"W e depositado no Laboratório de
Aracnologia da Universidade Federal do Amazonas (LOURENÇO, 2002b). Outros tombos da
espécie foram registrados na coleção aracnológicas da UFAM, e todos eles fazem alusão às

36
coletas proveniente do município de Coari. Contudo, registros da FMT (sem coordenadas
geográficas) incluem o município de Apuí como área de ocorrência da espécie.
 Tityus adisi Lourenço & Pézier, 2002
Espécie descrita para região de floresta inundada (igapó) na área do rio Tarumã
Mirim, com as seguintes coordenadas geográficas, 03° 1'44.47"S, 060° 17'40.85"W, a área
fica localizada nas adjacências da cidade de Manaus, no Estado do Amazonas (LOURENÇO
et al., 2005a). Exemplares da espécie foram encontrados nas coleções aracnológicas, todos
eles faziam alusão à região do Tarumã Mirim. Durante o presente trabalho, inúmeras coletas
foram realizadas em áreas de igapós nas imediações de Manaus. Contudo, nenhum exemplar
da referida espécie foi coletado.
 Tityus bastosi Lourenço, 1984
Espécie descrita para o município de São Paulo de Olivença, 03° 28'32.32"S, 068°
58'7.85"W, na microrregião do Alto Solimões e para a microrregião de Tefé, 03° 24'56.06"S,
064° 43'45.10"W (LOURENÇO et al., 2005a). Exemplares da espécie foram obtidos através
de busca ativa realizada em região de mata primária no município de Tabatinga. As coletas,
realizadas nas coordenadas geográficas 04° 14'34.37"S, 069°55'29.21"W ratificou a presença
da espécie para a região do Alto Solimões e colocou, pela primeira vez, Tabatinga como zona
de distribuição da espécie.
 Tityus canopensis Lourenço & Pezier, 2002
Espécie descrita para região de floresta inundada (igapó) na área do rio Tarumã
Mirim, 03° 02'55.60"S, 060° 17'50.29"W, nas adjacências da cidade de Manaus, Estado do
Amazonas (LOURENÇO et al., 2005a). Os dados das coleções aracnológicas confirmam a
descrição acima. Durante as coletas de campo não foram obtidos exemplares da espécie.
 Tityus clathratus Koch, 1844
Espécie descrita primariamente para a microrregião do Rio Negro, 00° 48'8.78"N,
066°00'26.69"W. Em publicação recente, Lourenço (2012a) apresenta a espécie como
endêmica da região da Serra do Imeri. Entretanto, de acordo com o tombo de 0652/2006 da
coleção aracnológicas do INPA, a referida espécie também pode ser encontrada em Presidente
Figueiredo, 00° 54'56.82"S, 060°27'7.60"W, município adjacente à cidade de Manaus.
 Tityus dinizi Lourenço, 1997
Espécie descrita a partir de exemplares coletados nas coordenadas geográficas 00°
48'8.78"N, 066°0'26.69"W, município de Santa Isabel do Rio Negro, no Estado do Amazonas,
onde levantou-se a hipótese de endemismo por Lourenço (2005a). Contudo, outros tombos
mostraram que a área de abrangência de T. dinizi é bem maior do que se imaginava. Nas
coleções aracnológicas de INPA, UFAM e FMT foi possível verificar que existem registros
37
desta espécie com as seguintes coordenadas geográficas, 02° 32'0.80"S, 061° 13'12.61"W; 00°
58'53.42"S, 062° 56'3.42"W; 02° 58'5.24"S, 059°55'38.82"W e 04° 14'09.00"S, 069°
56'17.00"W, respectivamente, para os municípios de Novo Airão, Barcelos, Manaus e
Tabatinga. Além disso, em coletas de campo do presente estudo foram capturados exemplares
nas coordenadas geográficas 04° 14'40.90"S, 069° 55'24.45"W, município de Tabatinga,
ratificando a presença da espécie na região do Alto Solimões e refutando a hipótese
apresentada por Lourenço.
 Tityus gasci Lourenço, 1981
Espécie descrita a partir do holótipo macho depositado no Museu Nacional de
História Natural de Paris, na França. O referido exemplar foi coletado no extremo sul da
Guina Francesa. Em seguida outros indivíduos foram descritos para o município de Urucará,
região nordeste do Estado do Amazonas, 01° 41'53.83"S, 058° 30'26.74"W (LOURENÇO,
1981; LOURENÇO & PINTO-DA-ROCHA, 2000). Na coleção aracnológica do INPA
existem registros para as coordenadas geográficas 01° 43'38.22"S, 058° 29'33.60"W, oriundas
de Urucará. No levantamento de campo não foram encontrados registros da espécie para
outras regiões do Estado.
 Tityus lokiae Lourenço, Adis & Araújo, 2005
Espécie descrita a partir de um holótipo fêmea capturado em região de floresta
inundada pelo rio Tarumã Mirim, 03° 01'54.5"S, 060° 06'44.4"W, nas adjacências da cidade
de Manaus, capital do Estado do Amazonas (LOURENÇO et al., 2005a). Os dados das
coleções aracnológicas indicam que a referida espécie ocorre apenas na área do Tarumã
Mirim. No levantamento de campo não foram encontrados registros da espécie.
 Tityus matthieseni Pinto-da-Rocha & Lourenço, 2000
É uma espécie que foi descrita a partir de exemplares coletados nas adjacências do
rio Matupiri, município de Manicoré, microrregião do Madeira, coordenadas geográficas 05°
35'9.46"S, 061° 15'32.16"W, no Estado do Amazonas, Brasil (PINTO-DA-ROCHA &
LOURENÇO, 2000). Na coleção aracnológica da FMT existem registros da espécie para o
município de Apuí, coordenadas geográficas 07o 11'49.00"S, 059° 53'27.00W. Nas coletas
realizadas em área de igapós do município de Careiro da Várzea, 03° 13'52.23"S, 059°
48'23.37"W, exemplares de T. matthieseni foram capturados. Além disso, representantes da
espécie foram coletados em regiões alagadiças de Manaus, 03° 5'0.04"S, 059° 51'58.89"W e
no município de Apuí, 07° 11'56.68"S, 059° 53'8.56"W.
 Tityus metuendus Pocock, 1897
É uma espécie que ocorre em praticamente todo o Estado do Amazonas (Lourenço
2011). Apresenta um alto grau de plasticidade ambiental e, consequentemente, tem sido
38
registrada em ambientes antrópicos, em floresta de terra firme e submersas, em epífitas e
bromélias (LOURENÇO, 2005a). O que foi confirmado pelos dados de tombo nas coleções
aracnológicas do Amazonas e, também, pelas capturas realizadas em decorrência deste
trabalho. Registros de tombos nas coleções aracnológicas do INPA, UFAM e FMT foram
vistos para os municípios de Novo Aripuanã, 05° 7'30.50"S, 060° 22'27.44"W; Presidente
Figueiredo, 02° 2'57.46"S, 060° 1'26.21"W; Manaus, 03° 6'6.93"S, 060° 0'37.58"W; Silves,
02° 50'15.56"S, 058° 12'45.68"W; Rio Preto da Eva, 02° 41'54.82"S, 059° 41'48.98"W;
Careiro da Várzea, 03° 11'50.04"S, 059° 49'29.65"W; adjacências do Rio Purus, município de
Beruri, 03° 42'52.86"S, 061° 27'5.79"W; e Reserva Adolfo Ducke/Manaus, 02° 41'54.82"S,
059° 41'48.98"W. Além disso, exemplares da espécie foram coletados na área urbana de
Manaus, 03° 2'13.36"S, 059° 57'56.86"W; Careiro da Várzea 03° 13'51.53"S, 059°
48'23.47"W; Iranduba 03° 12'37.54"S, 060°11'42.14"W; Presidente Figueiredo 02° 3'21.95"S,
060°1'26.69"W e Tabatinga 044° 14'35.61"S, 069°55'26.00"W.
 Tityus neblina Lourenço, 2008
É uma espécie descrita como endêmica para a região da serra do Imeri, 00°
47'54.12"N, 066° 0'57.58"W, município de Santa Isabel do Rio Negro. Lourenço (2008)
apresenta T. neblina como uma espécie exclusiva de floresta tropical de altas altitudes. As
referências de tombo acerca desta espécie nas coleções aracnológicas do Amazonas somente
fazem alusão à Serra do Imeri. Em nossa pesquisa de campo não encontramos nenhum
exemplar de T. neblina, o que contribui para confirmar o endemismo desta espécie para a
microrregião do alto Rio Negro.
 Tityus nelsoni Lourenço, 2005
Espécie endêmica da região do alto Rio Negro, mais precisamente do município
de São Gabriel da Cachoeira, 00° 15'22.06"S, 067° 4'54.94"W. Segundo Lourenço (2005a), a
espécie T. nelsoni apresenta hábitos ecológicos previsíveis, uma vez que são encontradas
apenas em locais de elevadas altitudes e com alto índice de precipitação pluviométrica. As
informações disponíveis nas coleções aracnológicas restringem a área de ocorrência de T.
nelsoni à região serrana do Alto Rio Negro. Nas coletas de campo não foram encontrados
exemplares da espécie.
 Tityus raquelae Lourenço, 1988
De acordo com Lourenço (2012b), a espécie foi descrita a partir de um único
exemplar coletado em região de vegetação fechada no município de Rio Preto da Eva, Estado
do Amazonas, 02° 41'23.79"S, 059° 44'3.77"W. Contudo, o levantamento realizado nas
coleções aracnológicas do Amazonas indicam que T. raquelae ocorre em outros municípios

39
do Estado, como é o caso de Presidente Figueiredo, 02° 3'7.45"S, 060° 1'5.45"W e Manaus,
coordenadas geográficas 03° 4'1.79"S, 059° 58'46.87"W.
 Tityus rionegrensis Lourenço, 2006
Espécie descrita para floresta tropical do município de São Gabriel da Cachoeira,
00° 7'6.50"S, 067° 1'55.58"W, no Estado do Amazonas. Todos os registros encontrados nas
coleções aracnológicas do Amazonas fazem referência ao referido município. Corroborando,
portanto, o endemismo descrito por Lourenço (2006). Não foram encontrados exemplares da
espécie nas coletas de campo.
 Tityus silvestris Pocock, 1897
É uma espécie que apresenta alto grau de plasticidade ambiental, podendo ser
encontrada em floresta de terra firme, ambientes antrópicos, em epífitas e em troncos de
árvores parcialmente submersas (LOURENÇO, 2005a). Os dados descritos para T. silvestres
o colocam como sendo encontrado em praticamente todas as regiões do Estado, o que foi
confirmado pelo levantamento bibliográfico e em registros de tombos nas coleções
aracnológicas. O tombo 275 FMT, por exemplo, refere-se a um exemplar coletado nas
coordenadas geográficas 2° 38'09.7"S, 060° 56'44.5"W, município de Novo Airão. Contudo,
em nenhum momento a literatura faz alusão ao extremo oeste do Amazonas, mais
precisamente aos municípios de Benjamin Constant 04° 22'49.31"S, 070° 1'52"W e Tabatinga
04° 14'35.61"S, 069° 55'26"W, onde foram capturados em decorrência das coletas de campo.
 Tityus strandi Werner, 1939
Espécie descrita para a comunidade de Sacambú 03° 16'18.32"S, 060° 57'5.18"W,
município de Manacapurú, no Estado do Amazonas (WERNER, 1939). Na coleção
aracnológica úmida do INPA existem vários tombos com referência à localidade diversa da
descrição original, como Beruri, 04° 35'21.00"S, 062° 4'45.65"W; Barcelos, 00° 59'44.49"S,
062° 56'18.15"W; Coari, 04° 05'60.49"S, 063° 08'40.5"W; e Manaus, 02° 54'27.34"S, 060°
2'17.58"W. Nas coletas de campo, realizadas durante este estudo, exemplares da espécie
foram encontrados nas coordenadas geográficas 03° 05'20.3"S, 060°00'40.5"W, em Manaus e
04° 08'36.56"S, 063° 08'22.28"W, em Coari.
 Tityus sylviae Lourenço, 2005
Lourenço (2005a) descreveu a espécie baseada em um holótipo coletado na região
do médio Rio Negro, mais precisamente para o município de Barcelos, coordenadas
geográficas 01° 52'34"S, 061° 35'15"W, de onde foi coletado no interior de um tronco caído.
Informações das coleções aracnológicas restringem a área de abrangência à Região do Negro.
Nenhum exemplar de T. sylviae foi encontrado em decorrência do levantamento de campo
deste trabalho.
40
 Tityus unus Pinto-da-Rocha & Lourenço, 2000
Espécie descrita para as coordenadas geográficas 01° 6'33.97"S, 066° 1'31.95"W,
localidade de São João, no município de Santa Isabel do Rio Negro, microrregião do Rio
Negro, Estado do Amazonas (PINTO-DA-ROCHA & LOURENÇO, 2000). Os exemplares
presentes nas coleções aracnológicas do Estado somente fazem alusão ao referido município.
É importante destacar que na pesquisa de campo representantes do grupo não foram
encontrados, o que contribui para ratificar o endemismo da espécie sugerido pelos autores
responsáveis pela sua descrição.
Outro grande grupo que compõe a fauna escorpiônica do Amazonas é a família
Chactidae (figura 3), que apresenta registros de ocorrência apenas nas Américas. No Brasil é a
segunda em diversidade de espécies. Seus representantes podem ser encontrados nas regiões
norte, nordeste e centro-oeste do país (MONOD & LOURENÇO, 2001). Contudo, é na região
amazônica que estão os maiores registros. Neste cenário, destaque para o Amazonas, Estado
no qual já foram catalogadas 20 espécies diferentes, número que representa cerca de 50% dos
representantes do grupo no Brasil (BRAZIL & PORTO, 2010).
No Estado do Amazonas a família é composta por 7 gêneros, são eles:
Auyantepuia Gonzalez-Sponga, 1978; Broteochactas Pocock, 1893; Brotheas Koch, 1837;
Chactas Gervais, 1844; Chactopsis Kraepelin, 1912; Teuthraustes Simon, 1878; e
Vachoniochactas Gonzalez-Sponga, 1978.

41
Figura 3 - Esquema representativo da família Chactidae no Estado do Amazonas, Brasil.

A distribuição geográfica das espécies pertencentes à família Chactidae com


ocorrência no Estado do Amazonas é listada abaixo:

 Gênero Auyantepuia Gonzalez-Sponga, 1978


 Auyantepuia mottai Lourenço & Araujo, 2004
Espécie descrita a partir do holótipo encontrado nas coordenadas geográficas 01°
55'18.45"S, 059° 28'5.32"W, estação de Balbina, município de Presidente Figueiredo, no
Estado do Amazonas (LOURENÇO & ARAÚJO, 2004). Os registros das coleções somente
fazem referência à área de descrição original da espécie. No levantamento de campo não
foram encontrados representantes de A. mottai.

42
 Gênero Broteochactas Pocock, 1893
 Broteochactas fei Pinto-da-Rocha & Brescovit, 2002
É uma espécie descrita para região de vegetação primária da Reserva Florestal
Adolpho Ducke, 02° 56'59.71"S, 059° 54'53.61"W, a qual fica localizada no município de
Manaus, Estado do Amazonas (PINTO-DA-ROCHA et al., 2002). Todos os exemplares
obtidos junto às coleções aracnológicas faziam referência à aludida área. No levantamento de
campo não foram encontrados representantes da espécie.
 Broteochactas cauaburi Lourenço, Araújo & Franklin, 2010
Lourenço et al. (2010) descreveram a espécie a partir de exemplares coletados nas
adjacências do rio Cauaburi, de onde vem a etimologia da espécie, região do Alto Rio Negro,
Estado do Amazonas, mais precisamente nas coordenadas geográficas 00° 17'44"S, 066°
00'17"W, município de São Gabriel da Cachoeira. Os dados das coleções somente fazem
referência à localidade tipo. No levantamento de campo não foram encontrados representantes
da espécie.
 Broteochactas niemeyerae Lourenço, Ponce de Leao Giupponi & Pedroso, 2011
Espécie descrita para o município de Barcelos, no Estado do Amazonas, em área
de elevadas altitudes, próxima a Serra do Imeri, região de fronteira do Brasil com a
Venezuela, 01° 12'26.4"N, 064° 47'18.1"W. Todas as referências acerca da espécie fazem
alusão à referida área. Na pesquisa de campo, representantes do grupo não foram encontrados,
o que contribui para dar robustez ao endemismo da espécie para a retromencionada área,
assim como propuseram Lourenço et al. (2011).
 Broteochactas polisi Monod & Lourenço, 2001
Espécie descrita para a reserva Cabo Frio, uma região de floresta tropical distante
a cerca de 80 Km da região metropolitana de Manaus, 02° 30'00"S, 060° 07'60.00"W. A área
é caracterizada por uma vegetação típica de terra firme com árvores apresentando copas de
aproximadamente 50 metros de altura do solo (LOURENÇO et al., 2001; LOURENÇO et al.,
2010). Nas coleções aracnológicas do Estado foram encontrados registros da espécie para as
coordenadas geográficas 01° 55'18.45"S, 059°28'5.32"W, Presidente Figueiredo e 02°
59'3.87"S, 059°55'21.60"W, Reserva Ducke/Manaus. Nas coletas de campo exemplares da
espécie foram capturados em Manaus, coordenadas geográficas 03° 05'58.00"S,
059°59'154"W.

43
 Gênero Brotheas Koch, 1837
 Brotheas amazonicus Lourenço, 1988
Inicialmente descrita apenas para a região de Manaus, no Estado do Amazonas,
atualmente existem registros para o Estado de Roraima (LOURENÇO et al., 2005b). Os
tombos nas coleções aracnológicas do Amazonas mostram que a espécie ocorre em região de
floresta primária dos municípios de Tefé, 04° 5'19.41"S, 065°18'5.91"W; Juruá, 03°
11'57.61"S, 065° 51'36"W; Presidente Figueiredo, 01° 47'53.71"S, 059° 59'2.71"W; Reserva
Ducke/Manaus, 02° 58'19.01"S, 059° 54'51.32"W; Reserva do Jaú, 01° 52'36.23"S, 061°
06'30.04"W, Novo Airão; e Silves 02° 41'46.56"S, 058°28'29.65"W. Em coletas realizadas
decorrentes do presente estudo, exemplares da espécie foram capturados nas coordenadas 03°
12'46.50"S, 060° 26'35.30"W, município de Manacapuru e em 02° 50'15.56"S, 058°
12'45.68"W, Silves.
 Brotheas caramaschii Lourenço, Ponce de Leao Giupponi & Pedroso, 2011
Espécie descrita para o município de Barcelos, 01° 12'26.40"N, 064°47'18.10"W,
em área de elevadas altitudes próximas à Serra do Imeri, no Estado do Amazonas, região de
fronteira do Brasil com a Venezuela (LOURENÇO et al., 2011). Exemplares da espécie estão
depositados no museu de história natural do Rio de Janeiro, Brasil, e de Paris, na França. Não
foram encontrados registros de B. caramaschii em outras regiões do Estado, o que contribui
para consolidar o endemismo da espécie para a região de descrição original da espécie.
 Brotheas henriquesi Lourenço & Machado, 2004
Lourenço & Machado (2004) descreveram a espécie a partir de exemplares
coletados no Parque Nacional do Jaú, 01° 52'33.60"S, 061° 35'16.80"W, no município de
Novo Airão. Os autores relatam que a referida espécie é endêmica da Região do Rio Negro,
hipótese corroborada pelos nossos achados, haja vista que os registros das coleções somente
fazem referência à área supracitada. Além disso, nas coletas de campo não foram encontrados
exemplares da espécie.
 Brotheas jourdani Lourenço, 1997
De acordo com Lourenço (1997) é uma espécie endêmica da região da serra do
Imeri, coordenadas geográficas 00° 48'8.99"N, 066° 26'0.00"W, município de São Gabriel da
Cachoeira, no Estado do Amazonas. No levantamento de campo não foram encontrados
representantes da espécie.

44
 Gênero Chactas Gervais, 1844
 Chactas braziliensis Lourenço, Aguiar & Franklin, 2005
O holótipo foi descrito para a região sudoeste do Estado do Amazonas, 07°
6'39.60"S, 073° 5'24.00"W, município de Guajará, fronteira com o Peru (LOURENÇO et al.,
2005b), a espécie foi a primeira do gênero a ser reportada para o Brasil. Os dados das
coleções aracnológicas fazem referência apenas à área de descrição da espécie. Nas coletas de
campo não foram encontrados exemplares da espécie.

 Gênero Chactopsis Kraepelin, 1912


 Chactopsis amazonicus Lourenço & Francke, 1986
Descrita para a região de Manaus, 02° 59'0.29"S, 059° 55'10.48"W, no Estado do
Amazonas, é considerada uma espécie terrícola, contudo existem exemplares coletados em
troncos de árvores, principalmente em regiões de florestas que são sazonalmente inundadas
(LOURENÇO & FRANCKE, 1986). Nas coleções aracnológicas foram encontrados registros
para o município de Presidente Figueiredo, coordenadas geográficas 00° 54'56.82"S, 060°
27'7.60"W. Em coletas de campo, representantes do grupo foram capturados em Manaus,
coordenadas geográficas 02° 41'54.82"S, 059° 41'48.98"W.
 Chactopsis buhrnheimi Lourenço, 2003
Espécie descrita a partir de holótipo coletado no município de Guajará, 07°
6'39.00"S, 073° 05'25.00"W, no Estado do Amazonas, região de fronteira com o Peru. De
acordo com Lourenço (2003), o exemplar foi coletado em área de floresta primária, no
interior de bromélias terrestres. No levantamento de campo não foram encontrados
representantes da espécie.
 Chactopsis insignis Kraepelin, 1912
Espécie descrita, a princípio, para uma localidade incerta do Peru, e que foi
posteriormente ratificada, por Lourenço & Francke (1986) para região de Iquitos. Lourenço
(2002b) e mais recentemente Ochoa et al. (2013) publicaram trabalhos colocando-a como
também pertencente à fauna escorpiônica brasileira, uma vez que ocorre no município de
Jutaí, sudoeste do Estado do Amazonas, 04° 39'00"S, 068° 18'60"W. Além disso, acrescentam
que é uma espécie típica da floresta tropical primária da Bacia Amazônica, e que vive
simpatricamente com representantes da família Buthidae, como é o caso dos escorpiões Tityus
bastosi, T. metuendus e representantes do gênero Ananteris.
 Chactopsis sujirima González-Sponga, 1982
Descrita para Bacia do Rio Orinoco, na Venezuela e para a Serra do Tapirapecó,
01° 16'60"N, 064° 39'00"W, município de Barcelos, microrregião do Rio Negro, no Estado do
45
Amazonas, Brasil (GONZÁLEZ-SPONGA, 1982). No levantamento de campo não foram
encontrados representantes da espécie.
 Chactopsis yanomami Lourenço, Ponce de Leao Giupponi & Pedroso, 2011
Espécie descrita para o município de Barcelos, 01° 12'25.20"N, 064° 47'16.80"W,
em área de elevadas altitudes, nas adjacências da serra do Imeri, Estado do Amazonas, região
de fronteira do Brasil com a Venezuela, sendo colocada por Lourenço et al. (2011) como uma
espécie endêmica da região. No levantamento de campo não foram encontrados
representantes da espécie.

 Gênero Teuthraustes Simon, 1878


 Teuthraustes amazonicus Simon, 1880
Espécie descrita para Pebas, uma pequena cidade localizada ao longo do Rio
Solimões, na Amazônia peruana e também no município de Benjamin Constant, microrregião
do Alto Solimões, 04° 37'50.54"S, 070° 3'45.73"W, no Estado do Amazonas. Distingue-se
das demais espécies do gênero pelo fato de ocorrer em regiões de planície da Amazônia
(LOURENÇO, 1995). No levantamento de campo não foram encontrados representantes da
espécie.
 Teuthraustes braziliensis Lourenço & Duhem, 2010
É uma espécie que juntamente com T. amazonicus são as únicas do gênero
encontradas em regiões de baixas altitudes na Amazônia, 05° 15'48.54"S, 069° 37'9.42"W
(município de Jutaí), uma vez que, os demais representantes do grupo são descritos para
regiões serranas da Amazônia (LOURENÇO & DUHEM, 2010b). No levantamento de campo
não foram encontrados representantes da espécie.
 Teuthraustes lisei Lourenço, 1994
Espécie descrita para área de elevadas altitudes na Serra do Imeri, coordenadas
geográficas 0° 50'17.78"N, 065° 56'52.23"W, município de Santa Isabel do Rio Negro, local
onde a precipitação media anual varia entre 3000 a 4000 mm (BROWN, 1982; LOURENÇO,
1994). Dados das coleções aracnológicas fazem referência apenas à área de descrição original
da espécie. No levantamento de campo não foram encontrados representantes de T. lisei.
 Teuthraustes newaribe Lourenço, Ponce de Leao Giupponi & Pedroso, 2011
Espécie descrita para o município de Barcelos, no Estado do Amazonas, em área
de elevadas altitudes da Serra do Imeri, 01° 12'25.20"N, 064° 47'16.80"W, região de fronteira
do Brasil com a Venezuela (LOURENÇO et al., 2011). No levantamento de campo não foram
encontrados representantes da espécie.

46
 Gênero Vachoniochactas Gonzalez-Sponga, 1978
 Vachoniochactas ashleeae Lourenço, 1994
Segundo Lourenço & Duhem (2009) os representantes desta espécie vivem em
formação vegetal presente em montanha de Tepuys dispostas na porção brasileira da Serra do
Imeri, 00° 30'14.07"N, 066° 09'20.69"W, município de Santa Isabel do Rio Negro, região
noroeste do Estado do Amazonas.

A outra família presente no Estado do Amazonas é a Liochelidae, que embora


apresente ampla distribuição geográfica no mundo, no Brasil, ocorre apenas o gênero
Opisthacanthus Peters, 1861, o qual é representado por duas espécies, a O. borboremai
Lourenço & Fe, 2003, endêmica do Estado do Amazonas e a O. cayaporum Vellard, 1932,
que ocorre no Estado do Pará e Tocantins (FET et al., 2000; LOURENÇO & FÉ, 2003;
BRAZIL & PORTO, 2010).
 Gênero Opisthacanthus Peters, 1861
 Opisthacanthus borboremai Lourenço & Fe, 2003
É a primeira espécie do gênero a ser descrita para uma área de floresta tropical
brasileira. Seus representantes vivem em grupos agregados e estão distribuídos ao longo das
bordas do médio Rio Negro, 00° 28'0.00"S, 065° 01'60"W, município de Santa Izabel do Rio
Negro, Estado do Amazonas. Em decorrência do presente trabalho, coletas foram realizadas
em diversas regiões do Estado. Contudo, em nenhuma delas representantes do grupo foi
capturado, o que contribui para reforçar a hipótese de endemismo da espécie defendida por
Lourenço & Fé (2003).

5.1 As coletas de campo e o levantamento junto às coleções aracnológicas


Através das coletas de campo realizado nos municípios de Apuí, Benjamin
Constant, Careiro da Várzea, Coari, Iranduba, Manacapuru, Manaus, Presidente Figueiredo,
Rio Preto da Eva, Silves e Tabatinga foram coletados 53 espécimes de escorpiões. Após a
identificação dos exemplares, o número supracitado revelou um quantitativo de 11 espécies, 5
gêneros e 2 famílias diferentes, são elas: Ananteris dekeyseri, A. pydanieli, Brotheas
amazonicus, Broteochactas polisi, Chactopsis amazonicus, Tityus bastosi, T. dinizi, T.
matthieseni, T. metuendus, T. silvestres e T. strandi.
Paralelamente, no levantamento realizado junto às coleções aracnológicas do
Estado do Amazonas foram obtidos dados de 35 espécies, representando 10 gêneros e 3
famílias diferentes, são elas: Ananteris cryptozoicus, A. dekeyseri, A. madeirensis, A. nairae,
A. palmari, A. pydanieli, Auyantepuia mottai, Brotheas amazonicus, B. henriquesi,
47
Broteochactas fei, B. polisi, B. cauaburi, B. niemeyerae, Chactas braziliensis, Chactopsis
amazonicus, Microtityus vanzolinii, Opisthacanthus borboremai, Teuthraustes lisei, Tityus
adisi, T. apiacas, T. canopensis, T. clathratus, T. dinizi, T. gasci, T. lokiae, T. matthieseni, T.
metuendus, T. neblina, T. nelsoni, T. raquelae, T. rionegrensis, T. silvestris, T. strandi, T.
sylviae e T. unus.
Os resultados obtidos a partir do levantamento de campo indicam que o
entendimento acerca da distribuição geográfica das espécies que ocorrem no Estado do
Amazonas não está compreendido. Exemplares das espécies A. pydanieli, B. amazonicus,
Tityus metuendus e T. silvestres foram capturados na microrregião de Manaus, o que
corrobora com dados da literatura (LOURENÇO, 2004, 2005a; LOURENÇO et al., 2005a).
Entretanto, são contrariados quando se leva em conta a distribuição geográfica descrita para T.
silvestres, que segundo Almeida (2010) ocorre nas regiões leste, central e sudeste do Estado.
Contudo, exemplares da espécie foram coletados nos municípios de Tabatinga e Benjamin
Constant, microrregião do Alto Solimões, extremo oeste do Amazonas.
Além de T. silvestris, na microrregião do Alto Solimões foram capturados
exemplares das espécies Tityus bastosi, T. dinizi e T. metuendus. Neste caso, os achados estão
de acordo com os resultados de outros trabalhos (LOURENÇO, 2005a, 2011; LOURENÇO et
al., 2005a).
A presença da espécie T. bastosi, descrita até então para os municípios de Tefé e
São Paulo de Olivença (LOURENÇO et al. 2005a), como pertencente à fauna escorpiônica do
município de Tabatinga é outro dado inédito do presente trabalho e ratifica a presença da
espécie na microrregião do Alto Solimões.
Os resultados relacionados à distribuição de T. metuendus, que é do ponto de vista
epidemiológico a principal espécie do Amazonas, confirmam dados da literatura, uma vez que
se encontram distribuídos em todo o Estado.
Os dados de distribuição obtidos para microrregião do Madeira coadunam com
outros trabalhos, Pinto-da-Rocha & Lourenço (2000), por exemplo, relataram a ocorrência da
espécie Tityus matthieseni para referida região. Da mesma forma, Lourenço & Duhem (2010a)
colocam a área como região de ocorrência da espécie Ananteris madeirensis. Em relação à
espécie T. matthieseni é importante ressaltar que alguns de seus exemplares foram coletados
no município de Careiro da Várzea, o que é outro achado importante da pesquisa, uma vez
que até então seus registros estavam restritos à microrregião do Madeira.
A associação entre os dados das coletas, registros das coleções aracnológicas e os
disponíveis na literatura especializada contribuíram para reforçar a hipótese defendida por
Lourenço et al. (2005a), em que os autores ressaltam Manaus e adjacências como um grande
48
centro da escorpionfauna amazônica. No trabalho citado, os autores apresentam 14 espécies já
catalogadas para o centro de endemismo de Manaus. Os resultados aqui compilados permitem
elevar esses números para 17 espécies, são elas: Auyantepuia mottai, Ananteris cryptozoicus,
A. dekeyseri, A. pydanieli, Brotheas amazonicus, Brotheochactas fei, B. polisi, Chactopsis
amazonicus, Tityus adisi, T. canopensis, T. dinizi, T. lokiae, T. matthieseni, T. metuendus, T.
raquelae, T. silvestris e T. strandi. É importante ressaltar que o acréscimo ficou por conta das
espécies Ananteris cryptozoicus, descrita por Lourenço (2005b), em um momento posterior ao
trabalho citado; T. dinizi, que a princípio fora colocada como endêmica da região do Rio
Negro, porém registros das coleções aracnológicas indicam que ocorrem na Reserva Adolfo
Ducke/Manaus; e da espécie T. matthieseni, coletada em decorrência deste trabalho. Além
disso, foi possível verificar que Ananteris cryptozoicus, Tityus adisi, T. canopensis, T. lokiae,
T. raquelae, Auyantepuia mottai, Broteochactas fei, B. polisi e Chactopsis amazonicus, 9, das
17 espécies descritas, são endêmicas da região.
Outro centro de biodiversidade de escorpiões do Amazonas é a região do médio e
alto Rio Negro, representada pelos municípios de Barcelos, Santa Izabel do Rio Negro e São
Gabriel da Cachoeira. Estudos apresentados por Lourenço (1994, 2005a) e Lourenço et al.
(2011) mostram que na referida área ocorrem 18 espécies, distribuídas em 8 gêneros e 3
famílias. Em conjunto, os três trabalhos descrevem 13 espécies como sendo endêmicas da
região. A partir do levantamento realizado foi possível mostrar que nesses municípios já
foram catalogadas 23 espécies, distribuídas em 9 gêneros e 3 famílias diferentes, são elas:
Ananteris nairae, Microtityus vanzolinii, Tityus clathratus, T. dinizi, T. neblina, T. nelsoni, T.
rionegrensis, T. sylviae, T. silvestres, T. strandi, T. unus, Broteochactas cauaburi, B.
niemeyerae, Brotheas caramaschii, B. henriquesi, B. amazonicus, B. jourdani, Chactopsis
sujirima, C. yanomami, Teuthraustes lisei, T. newaribe, Vachoniochactas ashleeae e
Opisthacanthus borboremai. Desse total, 17 delas são colocadas como endêmicas para a
região, as exceções ficam por conta de Ananteris nairae, Tityus clathratus, T. dinizi, T.
silvestres, T. strandi e Brotheas amazonicus.
Os dados apresentados confirmam a biodiversidade da fauna escorpiônica do
Amazonas, diversidade esta já estendida para outros grupos de organismos e ratificadas,
dentre outros, pelos estudos de Kinupp & Magnusson (2005) para plantas e de Mendonça et
al. (2005) para peixes. No presente trabalho, tal característica pode ser expressa pela
diversidade alfa existente no centro de endemismo do médio/alto Rio Negro, pela diversidade
beta verificada entre o referido centro e a região de Manaus, ou ainda pela diversidade gama,
quando verificado o Estado do Amazonas como um todo.

49
Várias hipóteses foram postuladas na tentativa de explicar a diversidade da região
amazônica. Haffer (2008) enumera as mais importantes, e coloca os fatores históricos
associados aos ecológicos, ocorridos no mioceno e pleistoceno, como os principais
responsáveis pelo processo de especiação. Lourenço & Ëîóðåíñî (2014) lembram que tais
fatores são estendidos para explicar a biodiversidade em outros centros de endemismo das
regiões tropicais.
A hipótese de Museu colocada por Fjeldså (1994), seguida do efeito fundador,
parece se encaixar muito bem para explicar a presença das espécies Teuthraustes braziliensis
e T. amazonicus em terras baixas do Amazonas. De acordo com Lourenço & Duhem (2010b),
todas as espécies do gênero descritas para a América do Sul ocorrem em regiões de elevadas
altitudes do continente, seja nos Andes do Peru, Equador e Colômbia, ou ainda na região
serrana do Imeri. Neste caso, os exemplos ficam por conta das espécies T. adrianae González-
Sponga, 1975, T. akananensis González-Sponga, 1984, T. carmelinae Scorza, 1954, T.
maturaca González-Sponga, 1991, T. reticulatus González-Sponga, 1991 e T. lisei, com a
exceção da última, que foi descrita para o território brasileiro, as demais ocorrem do lado
Venezuelano da serra.
A hipótese dos Gradientes Ecológicos ou diferenciação parapátrica defendida por
Endler (1977) poderia ser usada para explicar a diversificação de alguns escorpiões
percententes à família Buthidae. O trabalho de Lira et al. (2013), por exemplo, mostra que,
embora as espécies Ananteris mauryi Lourenço, 1982 e Tityus pusillus Pocock, 1893
coexistam em ambientes similares de floresta tropical, exploram nichos diferenciados, o que
corrobora com o postulado de Endler.
Lourenço (2013), o maior estudioso de escorpiões da Amazônia brasileira, supõe
que o padrão de distribuição dos animais, em grande parte, está relacionado a eventos
históricos recentes, especialmente os que ocorreram no Mioceno e Pleistoceno. Dessa forma,
o pesquisador consolida sua opinião sobre a Teoria dos Refúgios proposta por Haffer para
explicar os centros de endemismo da Amazônia, em especial o da Serra do Imeri.
Contudo, é importante destacar que os escorpiões são animais que existem há
mais de 300 milhões de anos e que evidências robustas mostram a diversificação de vários
grupos ainda no gondwana, é o caso de espécies pertencentes às famílias Liochelidae e
Chactidae. No primeiro caso, Menon (2007) cita o exemplo da espécie Protoischnurus
axelrodorum Carvalho e Lourenço, 2001, e coloca a espécie Araripescorpius ligabuei
Campos, 1986, como exemplo da segunda.
Outros indícios mostram a diversificação dos escorpiões em um momento bem
anterior ao descrito pelas hipóteses que colocam o Mioceno, Plioceno e Pleistoceno como os
50
principais períodos para explosão e diversificação da fauna tropical. Neste caso, o exemplo
vem do gênero Opistacanthus, que possui espécies descritas para a Amazônia brasileira e
também para ilha de Madagascar, na África, mais um exemplo de origem gondwana para os
escorpiões e um reforço para teoria das placas tectônicas. Diante das controvérsias, é
importante apresentar as suposições de Aleixo & Rossetti (2007), os quais colocam que as
mudanças ocorridas na Amazônia não foram homogêneas, já que diferentes regiões
experimentaram eventos geológicos e ecológicos mais acentuados que outras áreas da bacia, o
que afetou diretamente o padrão de distribuição e diversificação das espécies.
Diante disso, pode-se acrescentar que a pergunta acerca do padrão de distribuição
e biodiversidade dos escorpiões que ocorrem no Estado do Amazonas está longe de ser
respondida. Entretanto, parece estar claro que a distribuição e a diversificação das espécies
não segue uma única hipótese.
Os resultados da presente pesquisa nos fornecem subsídios para salientar que,
embora a diversidade de espécies escorpiônicas do Amazonas seja a maior do Brasil, ainda é
subestimada, haja vista que as dimensões geográficas do estado, aliada às características da
vegetação, encarecem os custos relacionados ao conhecimento científico. Dificultando, dessa
forma, o acesso às áreas mais remotas. Considerando estes aspectos, certamente, o número de
espécies aumentará com novas pesquisas e, que, provavelmente, outros centros de endemismo
serão descritos em um futuro próximo.
A atualização dos dados de distribuição das espécies, em conjunto com as novas
coletas, serão úteis em futuros trabalhos de biogeografia, o que pode contribuir para entender
o padrão de distribuição e diversificação dos escorpiões e de outros grupos de organismos na
Amazônia. Além disso, o conhecimento gerado a partir do presente trabalho pode ser usado
como ferramenta fundamental na prevenção dos acidentes e tratamento dos acidentados por
escorpiões no Estado, já que o escorpionismo, termo relacionado aos acidentes causados por
picadas de escorpiões, é um problema de saúde pública. Costa et al. (2016), em estudo
desenvolvido no Estado do Amazonas, constataram índices elevados de acidentes, alguns com
óbito. Neste cenário, destaque para as espécies Tityus bastosi, T. metuendus, T. matthieseni e
T. silvestres, todas pertencentes ao gênero Tityus, colocado por Brazil & Porto (2010) como o
gênero mais importante, do ponto de vista médico, do Brasil.

51
6 Conclusões
O presente trabalho consolida o Estado do Amazonas como detentor do maior
número de espécies de escorpiões descritas para o território brasileiro. Ratifica a família
Buthidae como a mais representativa do ponto de vista de biodiversidade no Estado do
Amazonas. Além disso, mostra que a distribuição da escorpionfauna no Estado não está bem
compreendida, o exemplo fica por conta da coleta de Tityus silvestres para os municípios de
Tabatinga e Benjamin Constant. Os registros de espécies descritas para as regiões de Manaus
e Rio Negro confirmam dados da literatura relacionados ao endemismo de escorpiões nas
duas áreas, e coloca, de forma inédita, a microrregião do Rio Negro como aquela que
apresenta o maior número de espécies escorpiônicas endêmicas do Estado do Amazonas, 17
no total, contra as 9 registradas para a microrregião de Manaus.

52
7 Referências Bibliográficas
ALEIXO, A.; ROSSETTI, D.F. Avian gene trees, landscape evolution, and
geology: towards a modern synthesis of Amazonian historical biogeography?. Journal of
Ornithology, 148 (2), 443-453, 2007.

ALMEIDA, R.B.D. Atlas das espécies de Tityus C.L. Koch, 1836 (Scorpiones,
Buthidae) do Brasil. Tese de Doutorado-Instituto de Biociências da Universidade de São
Paulo, São Paulo, 2010.

BOTERO-TRUJILLO, R.; ERAZO-MORENO, M.C.; PÉREZ, G.A. A new


species of Microtityus Kjellesvig-Waering (Scorpiones: Buthidae) from northern Colombia,
Zootaxa, 2120, 27-38, 2009.

BOTERO-TRUJILLO, R.; NORIEGA, J.A. On the identity of Microananteris,


with a discussion on pectinal morphology, and description of a new Ananteris from Brazil
(Scorpiones, Buthidae). Zootaxa, 2747, 37-52, 2011.

BRAZIL, T.K.; PORTO, T.J. Diversidade de Escorpiões do Brasil. Os


escorpiões. Salvador: EDUFBA. 48p. 2010.

BROWN, K.S. Paleoecology and regional patterns of evolution in neotropical


forest butterflies. In: PRANCE, G.T. (ed.). Biological Diversification in the Tropics. New
York: Columbia University Press, p. 255-308, 1982.

CARMO, R.F.R.; AMORIM, H.P.; VASCONCELOS, S.D. Scorpion diversity in


two types of seasonally dry tropical forest in the semi-arid region of Northeastern Brazil.
Biota Neotrop. 13 (2), 340-344, 2013.

COSTA, C.L.S.O; FE, N.; SAMPAIO, I.; TADEI, W.P. Scorpionism profile, and
the main scorpion species involved, in the state of Amazonas, Brazil. Journal of the
Brazilian Society of Tropical Medicine (no prelo, 2016).

ENDLER, J. A. Geographic variation, speciation, and clines. New Jersey:


Princeton University Press, 262p. 1977.

53
FET, V.; SISSOM, W.D.; LOWE, G.; BRAUNWALDER, M.E. Family
Euscorpiidae. In: Catalog of the scorpions of the world (1758-1998). New York: New York
Entomological Society, p. 355-381, 2000

FJELDSÅ, J. Geographical patterns for relict and young species of birds in Africa
and South America and implications for conservation priorities. Biodiversity & Conservation,
3 (3), 207-226, 1994.

GONZÁLEZ-SPONGA, M.A. Tres nuevas especies venezolanas del género


Chactopsis (Scorpionida: Chactidae). Boletín de la Academia de Ciencias Físicas,
Matemáticas y Naturales de Venezuela, 42, 127-146, 1982.

HAFFER, J. Hypotheses to explain the origin of species in Amazonia. Brazilian


Journal of Biology, 68 (4), 917-947, 2008.

KINUPP, V.F.; MAGNUSSON, W.E. Spatial patterns in the understorey shrub


genus Psychotria in central Amazonia: effects of distance and topography. Journal of
Tropical Ecology, 21 (4), 363-374, 2005.

LEWIS, S.L.; LLOYD, J.; SITCH, S.; MITCHARD, E.T.; LAURANCE, W.F.
Changing ecology of tropical forests: evidence and drivers. Annual Review of Ecology,
Evolution, and Systematics, 40, 529-549, 2009.

LIRA, A.F.; SOUZA, A.M.; SILVA, A.A.; ALBUQUERQUE, C.M. Spatio-


temporal microhabitat use by two co-occurring species of scorpions in Atlantic rainforest in
Brazil. Zoology, 116 (3), 182-185, 2013.

LOURENÇO, W.R. Tityus gasci, nouvelle espèce de Scorpion Buthidae de


Guyane française. Bulletin du Muséum National d’Histoire Naturelle, Paris, 4 (3), 841-845,
1981.

LOURENÇO, W.R. Révision du genre Ananteris Thorell, 1891 (Scorpiones,


Buthidae) et description de six espèces nouvelles. Bulletin du Muséum national d’Histoire
naturelle, Paris, 4, 119-151, 1982.

54
LOURENÇO, W.R. Considérations biogéographiques, écologiques et évolutives
sur les espèces néotropicales d’Opisthacanthus Peters, 1861 (Scorpiones, Ischnuridae).
Studies on Neotropical Fauna and Environment, 23 (1), 21-53, 1988.

LOURENÇO, W.R. Scorpion biogeographic patterns as evidence for a Neblina-


São Gabriel endemic center in Brazilian Amazonia. Revista de la Academia Colombiana de
Ciencias Exactas, Fisicas y Naturales, 19 (72), 181-185, 1994.

LOURENÇO, W.R. Considérations sur la biogéographie des espèces appartenant


au genre Teuthraustes Simon, 1878 (Chelicerata, Scorpiones, Chactidae). Revue
Arachnologique, 10 (11), 201-206, 1995.

LOURENÇO, W.R. Le remarquable endémisme de la faune scorpionique du


‘Tepui’ de la Neblina en Amazonie. Biogeographica, 73 (2), 95-96, 1997.

LOURENÇO, W.R. Scorpion diversity in Tropical South America: Implications


for conservation programs. In: BROWNELL, P.; POLIS, G.A. (eds.). Scorpion Biology and
Research. New York: Oxford University Press, p. 406-415, 2001.

LOURENÇO, W.R. Scorpions of Brazil. Paris: Les Éditions l’ If, 308p. 2002a.

LOURENÇO, W. R. New records of scorpions for the Neotropics (Arachnida).


Revue Suisse de Zoologie, 109 (1), 127-141, 2002b.

LOURENÇO, W.R. Le genre Chactopsis Kraepelin (Scorpiones, Euscorpiidae (ou


Chactidae) en Amazonie Brésilienne. Biogeographica, 79 (4), 167-174, 2003.

LOURENÇO, W.R. The genus Ananteris Thorell (Scorpiones, Buthidae) in the


Brazilian amazonia. Revista Ibérica de Aracnología, 9, 137-140, 2004.

LOURENÇO, W.R. Scorpion diversity and endemism in the Rio Negro region of
Brasilia Amazonia, with the description of two new species of Tityus C. L. Koch (Scorpiones,
Buthidae). Amazoniana, 18 (3/4), 203-213, 2005a.

55
LOURENÇO, W.R. Humicolous buthoid scorpions: a new species from Brazilian
Amazon. Comptes rendus Biologies, 328 (10), 949-954, 2005b.

LOURENÇO, W.R. Nouvelle proposition de découpage sous générique du genre


Tityus C.L. Koch, 1836 (Scorpiones, Buthidae). Boletín Sociedad Entomológica Aragonesa,
39, 55-67, 2006.

LOURENÇO, W.R. Description of Tityus (atreus) neblina sp. n. (Scorpiones,


Buthidae), from the ‘Parque Nacional do Pico da Neblina’, in Brazil/Venezuela, with
comments on some related species. Boletín Sociedad Entomológica Aragonesa, 43: 75-79,
2008.

LOURENÇO, W.R. The distribution of noxious species of scorpions in Brazilian


Amazonia: the genus Tityus C. L. Koch, 1836, subgenus Atreus Gervais, 1843 (Scorpiones,
Buthidae). Entomologische Mitteilungen aus dem Zoologischen Museum Hamburg, 15
(185), 287-301, 2011.

LOURENÇO, W.R. Further considerations on Tityus (archaeotityus) Clathratus


C. L. Koch, 1844 and description of two associated new species (Scorpiones, Buthidae).
Boletín de la Sociedad Entomológica Aragonesa, 50, 277-283, 2012a.

LOURENÇO, W.R. Descrição do macho de Tityus (Tityus) raquelae Lourenço,


1988 (Scorpiones, Buthidae), espécie da Amazônia Brasileira. Revista Iberica de
Arachnologia, 21, 65-68, 2012b.

LOURENÇO, W.R. A new species of Grosphus Simon, 1880 (Scorpiones,


Buthidae) from Central Madagascar. Entomologische Mitteilungen aus dem Zoologischen
Museum Hamburg, 16 (189), 57-62, 2013.

LOURENÇO, W.R.; FRANCKE, O.F. A new species of Chactopsis from Brazil


(Scorpiones, Chactidae). Amazoniana, 9 (4), 549-558, 1986.

LOURENÇO, W.R.; PINTO-DA-ROCHA, R. Additions to the knowledge of the


Chactidae of Brazilian Amazonia (Arachnida: Scorpiones). Amazoniana, 16 (1/2), 259-274,
2000.
56
LOURENÇO, W.R.; FÉ, N.F. Description of a new species of Opisthacanthus
Peters (Scorpiones, Liochelidae) to Brazilian Amazonia. Revista Ibérica de Aracnología, 8,
81-88, 2003.

LOURENÇO, W.R.; MACHADO, A.M. A new species of Brotheas (Scorpiones,


Chactidae) from the Rio Negro region in the State of Amazonas, Brazil. Revista Ibérica de
Aracnología, 10, 65-68, 2004.

LOURENÇO, W.R.; ARAÚJO, J.S. Nouvelles considérations sur le genre


Auyantepuia Gonzalez-Sponga (Scorpiones, Chactidae) et description d une nouvelle espèce
pour la région de Manaus, en Amazonie brésilienne. Acta Biológica Paranaense, 33, 1-11,
2004.

LOURENÇO, W.R.; ADIS, J.; ARAÚJO, J.D.S. A new synopsis of the scorpion
fauna of the Manaus region in Brazilian Amazonia, with special reference to an inundation
forest of the Tarumã Mirím river. Amazoniana, 18 (3/4), 241-249, 2005a.

LOURENÇO, W.R.; AGUIAR, N.O.; FRANKLIN, E. First record of the scorpion


genus Chactas Gervais, 1844, for Brazil with description of a new species from western State
of Amazonas (Scorpiones: Chactidae). Zootaxa, 984, 1-8, 2005b.

LOURENÇO, W.R.; DUHEM, A.B. The genus Vachoniochactas González-


Sponga (Scorpiones, Chactidae), a model of relictual distribution in past refugia of the
Guayana region of South America. Comptes rendus Biologies, 332 (12), 1085-1091, 2009.

LOURENÇO, W.R.; DUHEM, A.B. Further considerations on the genus


Ananteris Thorell, 1891 (Scorpiones, Buthidae) in Brazilian Amazonia and description of two
new species. Boletín de la Sociedad Entomológica Aragonesa, 47, 33-38, 2010a.

LOURENÇO, W.R.; DUHEM, A.B. The geographical pattern of distribution of


the genus Teuthraustes Simon (Scorpiones, Chactidae) in South America and description of a
new species. Comptes rendus Biologies, 333 (11), 858-863, 2010b.

57
LOURENÇO, W.R.; ARAUJO, J.; FRANKLIN, E. Further additions to the
Chactidae scorpions of brazilian Amazonia (arachnida: scorpiones: Chactidae). Boletín de la
Sociedad Entomológica Aragonesa, 47, 135-138, 2010.

LOURENÇO, W.R.; DE LEÃO GIUPPONI, A.P.; PEDROSO, D.R. New species


of Chactidae (Scorpiones) from the upper Rio Negro in Brazilian Amazonia. Boletın de la
Sociedad Entomológica Aragonesa, 49, 65-73, 2011.

LOURENÇO, W.R.; ËÎÓÐÅÍÑÎ, Â.Ð. Micro-endemic and vicariant populations


of Opisthacanthus Peters, 1861 (Scorpiones: Hormuridae) in Madagascar, with descriptions
of two new species. Arthropoda Selecta, 23 (4), 383-391, 2014.

MACARTHUR, R.H. Geographical ecology. New York: Harper and Row, 269p.
1972.

MCINTYRE, N.E. Influences of urban land use on the frequency of scorpions


stings in the Phoenix, Arizona, metropolitan area. Landscape and Urban Planning, Texas,
45, 47-55, 1999.

MENDONÇA, F.P.; MAGNUSSON, W.E.; ZUANON, J. Relationships between


Habitat Characteristics and Fish Assemblages in Small Streams of Central Amazonia. Copeia,
4, 751-764, 2005.

MENON, F. Higher systematics of scorpions from the Crato Formation, Lower


Cretaceous of Brazil. Palaeontology, 50 (1), 185-195, 2007.

MONOD, L.; LOURENÇO, W.R. A new species of Broteochactas POCOCK,


1890 from Brazilian Amazonia (Scorpiones, Chactidae). Scorpions, 20, 195-202, 2001.

OCHOA, J.A.; ROJAS-RUNJAIC, F.J.; PINTO-DA-ROCHA, R.; PRENDINI, L.


Systematic Revision of the Neotropical Scorpion Genus Chactopsis kraepelin, 1912
(Chactoidea: Chactidae), with descriptions of two new genera and four new species. Bulletin
of the American Museum of Natural History, 378 (1), 1-121, 2013.

58
PINTO-DA-ROCHA, R.; LOURENCO, W.R. Two new species of Tityus from
Brazilian Amazonia (Scorpiones, Buthidae). Revue arachnologique, 13, 187-195, 2000.

PINTO-DA-ROCHA, R.; GASNIER, T.R.; BRESCOVIT, A.D.; APOLINÁRIO,


F.B. Broteochactas fei, A new scorpion species (Scorpiones, Chactidae) from Brazilian
Amazonia, with notes on its abundance and association with termites. Revista Ibérica de
Aracnología, 31 (12), 195-202, 2002.

POLIS, G.A. The Biology of Scorpions. Stanford: Stanford University Press,


587p. 1990.

SALDARRIAGA, M.; OTERO, R. Los escorpiones: aspectos ecológicos,


biológicos y toxinológicos. Medunab, 3 (7), 17-23, 2000.

STOCKMANN, R.; YTHIER, E. Scorpions of the World. France: NAP editions,


565p. 2010.

WERNER, FR. Neu-Eingänge von Skorpionen im Zoologischen Museum in


Hamburg. Festschrift Zum, 60, 171-193, 1939.

59
Capítulo III - Identificação molecular e inferências filogenéticas dos escorpiões que
ocorrem no Estado do Amazonas, Brasil
1 Considerações Gerais
1.1 Sistemática da Ordem Scorpiones

A ordem Scorpiones é uma das mais primitivas dentro da classe Arachnida


(POLIS, 1990). Classicamente, os representantes deste grupo são caracterizados por
apresentarem o opistossoma, parte posterior do corpo, dividido em dois segmentos, o
mesossoma e o metassoma (figura 1) (STOCKWELL, 1989). Além disso, são caracterizados
por apresentarem um par de glândulas de veneno associadas ao télson e uma estrutura
sensorial na região ventral do mesossoma, chamado de pentes.

pd

ql
ps
et
pn

ms pe

es
tl

mt

Figura 1 - Morfologia externa dorsal e ventral de um


escorpião: ps=prossoma; ms=mesossoma; mt=
metassoma; pd=pedipalpo; ql=quelícera; pe=perna;
tl=télson; et=esterno; pn=pentes; es=estigmas
respiratórios.
Fonte: Adaptado de Candido et al. (2005).

Atualmente existem mais de 1900 espécies de escorpiões descritas, as quais estão


distribuídas em 165 gêneros (STOCKMANN & YTHIER, 2010). A classificação interna da
ordem é motivo de inúmeras discussões, não existindo um consenso em relação ao número de
famílias existentes (REIN, 2013). A tabela 1 traz a divisão em 18 famílias proposta por
Prendini & Wheeler (2005), que por ser a mais aceita, será adotada no presente trabalho.

60
Tabela 1 - Famílias e distribuição geográfica dos escorpiões.
Quantidade de
Famílias Distribuição Geográfica
Gêneros
América do Sul, Austrália e Índia (Himalaia)
Bothriuridae Simon, 1880 15
Todos os continentes com exceção da
Buthidae C.L. Koch, 1837
Antártica 78

América do Sul, América Central e México


Chactidae Pocock, 1893 11
Bangladesh, Índia, Indonésia, Malásia,
Nepal,
Chaerilidae Pocock, 1893 01
Cingapura, Sri Lanka e Vietnã

América do Norte, América Central, norte da


Diplocentridae Karsch, 1880 América do Sul, Antilhas e Oriente Médio 08

África do Norte, Sul da Europa, Oriente


Médio,
Euscorpiidae Laurie, 1896 04
Sul da Ásia Central, México e Guatemala

Oriente Médio
Hemiscorpiidae Pocock, 1893 02
Madagascar
Heteroscorpionidae Kraepelin,
01
1905
América do Sul, América do Norte, Turquia
Iuridae Thorell, 1876 e Grécia
06

Austrália, África, Américas Central e do Sul,


Liochelidae Fet and Bechly, Antilhas,
08
2001 Índia, Sudeste Asiático, Ilhas do Pacífico e
Madagascar
03
Microcharmidae Lourenço,
Madagascar
1996
01
Pseudochactidae Gromov, 1998 Sul da Ásia Central
04
África, sul e sudeste Asiático, Indonésia e
Scorpionidae Latreille, 1802
Oriente Médio
06
Scorpiopidae Kraepelin, 1905 China, Índia, Tailândia e Vietnam
Superstitioniidae Stahnke, 1940 México e sudoeste dos Estados Unidos 04
02
Troglotayosicidae Lourenço,
França, Espanha e Amazônia (Equador)
1998
Urodacidae Pocock, 1893 Austrália 01

Vaejovidae Thorell, 1876 México, sul e sudoeste dos Estados Unidos 10

Fonte: (PRENDINI & WHEELER, 2005).

61
1.2 Registros de escorpiões no Brasil
De acordo com Brazil & Porto (2010), a fauna escorpiônica brasileira encontra-se
distribuída em quatro famílias, são elas: Bothriuridae, Buthidae, Chactidae e Liochelidae
dentro das quais são encontrados 23 gêneros e cerca de 140 espécies.
A família Bothriuridae é a terceira em diversidade de espécies, seus representantes
estão presentes em todas as regiões do país, contudo, não ocorre no Estado do Amazonas. É
mais comum em faixa litorânea, sendo o Estado do Rio de Janeiro o que apresenta maior
diversidade de espécies, 4 no total (BRAZIL & PORTO, 2010; LOURENÇO, 2002).
A família Buthidae é do ponto de vista de diversidade de espécies e médico-
epidemiológico a mais importante do Brasil e do mundo. São mais de 900 espécies já
catalogadas, distribuídas em 87 gêneros diferentes (REIN, 2013; STOCKMANN & YTHIER,
2010). No Brasil já foram registradas 82 espécies e 8 gêneros, as quais encontram-se
distribuídas por todas as regiões do país. O Amazonas é o Estado brasileiro com a maior
diversidade de espécies, 25 no total (BRAZIL & PORTO, 2010; COSTA et al. 2016).
A família Chactidae é exclusiva das Américas, seus representantes são, com raras
exceções, descritos apenas para as florestas tropicais (MONOD & LOURENÇO, 2001). Com
registros de ocorrência para as regiões norte, nordeste e centro-oeste, é, de acordo com Brazil
& Porto (2010), a segunda família em diversidade de espécies do Brasil. Na Amazônia estão
os maiores registros, neste cenário, destaque para o Amazonas, Estado no qual ocorrem 20 das
40 espécies já registradas para o Brasil (COSTA et al., 2016).
A família Liochelidae apresenta representantes em todos os continentes, sua maior
biodiversidade de espécies encontra-se na África. No Brasil é descrito apenas um gênero, que
é representado pelas espécies Opisthacanthus borboremai Lourenço & Fe, 2000 e O.
cayaporum Vellard, 1932. A primeira endêmica do Estado do Amazonas, ao passo que a
segunda apresenta registros para os Estados do Pará e Tocantins (BRAZIL & PORTO, 2010;
FET et al., 2003; LOURENÇO & FÉ, 2003).

1.3 A sistemática dos escorpiões com o advento do DNA barcoding


Dentre as organelas presentes no hialoplasma da célula dos organismos superiores
encontram-se as mitocôndrias, estruturas responsáveis pelo processo de respiração celular, e
que possui DNA próprio, o DNA mitocondrial (DNAmt) (ANDERSON et al., 1981). O
genoma mitocondrial representa de 1 a 2% do DNA nuclear, possui duplo filamento circular,
genoma haplóide, é organizado de forma econômica e em animais é composto por cerca de
16.500 pares de bases, que codificam 37 genes, dos quais 13 transcrevem proteínas, 2 rRNAs
e 22 tRNA (CHOI et al., 2007; WARRIOR et al., 1985). O número de sequências do DNAmt
62
pode chegar a 10.000 cópias em uma única célula, o que ajuda na obtenção de sequências
nucleotídicas, especialmente em amostras diminutas ou degradadas. Além disso, Jarreta
(1999) revelou que a taxa de variação entre sequências de espécies próximas é até 10 vezes
maiores em genes mitocôndrias do que em genes nucleares.
Hebert et al. (2003) desenvolveram a estratégia conhecida como DNA barcoding
ou código de barras do DNA, onde sequências gênicas do DNAmt são usadas para
caracterizar espécies. A região do genoma mitocondrial escolhida para gerar o código de
barras de DNA foi o gene da Citocromo Oxidase Subunidade I (COI). Entretanto, outro
fragmento do genoma mitocondrial, o gene rRNA, se mostrou uma ferramenta acurada na
discriminação de espécies. Segundo Vences et al. (2005), a sequência deste gene pode ser
usada em pesquisa taxonômica de seres vivos, podendo auxiliar na identificação correta de
espécimes, ampliar e estimular a taxonomia dos vários grupos de organismos. Miller et al.
(2014) mostraram que o gene mitocondrial 16S de escorpiões apresentam alta variação
haplotípica inter-específica, podendo serem usados na determinação de espécies e filogenia
molecular. De acordo com Hebert et al. (2004), os benefícios em se estabelecer bancos de
DNA barcoding completos dos principais grupos taxonômicos é uma oportunidade para
minimizar a atual situação sobre a caracterização da diversidade biológica em grande escala.
O uso das ferramentas da biologia molecular como suporte à taxonomia e
filogenia de escorpiões tem se tornado imprescindível para resolução de dúvidas,
principalmente, àquelas concernentes às espécies consideradas crípticas. Parmakelis et al.
(2013) relataram que os atributos morfológicos comumente utilizados para delinear espécies
do gênero Euscorpius Thorell, 1876, que ocorrem na região do mediterrâneo, não foram
suficientes para apontar a unidade mais basal da taxonomia. A pesquisa revelou que tal
problemática foi resolvida através da abordagem genética. Neste cenário, em que o
conhecimento e o uso das ferramentas moleculares vieram para contribuir com a taxonomia
tradicional, surgiram inúmeras publicações. Gantenbein et al. (2001), por exemplo, mostraram
relações de parentesco entre indivíduos pertencentes ao gênero Centruroides Marx, 1890 a
partir do sequenciamento e comparação das sequências do gene mitocondrial 16S. Prendini et
al. (2003), através do uso da ferramenta molecular, sugeriram redefinições de espécies dentro
de vários grupos. Resultados semelhantes foram obtidos por Soleglad & Fet (2003), que
através do uso do gene mitocondrial 16S apresentaram resultados contundentes em relação à
filogenia dos escorpiões pertencentes ao gênero Centruroides.
Outros estudos com o emprego do gene 16S, como uma ferramenta molecular, no
auxílio à taxonomia tradicional surgiram. Teruel et al. (2006) mostraram a robustez da
ferramenta na identificação e filogenia de indivíduos pertencentes à família Buthidae que
63
ocorrem em Cuba. Borges & Runjaic (2007) conseguiram assegurar que, embora haja
diferença entre a composição química no veneno da espécie venezuelana Tityus perijanensis
González-Sponga, 1994, a divergência nucleotídica intra-específica é muito baixa,
sustentando a hipótese que a diferença encontrada nos venenos podem ser fruto de sua
ecologia e distribuição geográfica. Coelho et al. (2014) puseram fim na antiga discussão
envolvendo a espécie Androctonus amoreuxi Audouin, 1826, presentes no norte da África,
quando sugeriram a divisão do grupo em duas subespécies, a A. a. amoreuxi e A. a levvi.

1.4 Estudos genéticos com as espécies brasileiras


Os estudos genéticos voltados para os escorpiões distribuídos ao longo do
território brasileiro foram impulsionados pela espécie Tityus serrulatus Lutz & Mello, 1922, a
principal do ponto de vista médico-epidemiológico do Brasil. Martin-Eauclaire et al. (1992),
por exemplo, na busca de entender a composição e a estrutura da neurotoxina beta aplicaram a
técnica de cDNA. O estudo revelou que o peptídeo apresenta padrões de formação
biossintéticos semelhantes ao da neurotoxina beta presente nos escorpiões que ocorrem no
velho mundo. Esta ferramenta também foi usada por Diego-García et al. (2005), a partir da
qual estabeleceram relações de parentesco entre os Tityus costatus Karsch, 1879, que ocorrem
nas regiões Nordeste, Sudeste e Sul do Brasil, com as espécies do gênero Tityus
conhecidamente perigosas ao homem. A técnica do cDNA também esteve presente no estudo
de Guerrero-Vargas et al. (2012), que foi importante na separação dos escorpiões Tityus que
vivem ao sul da Amazônia em relação às espécies, do mesmo gênero, distribuídas ao norte da
região.
O gene mitocondrial 16S esteve presente em alguns estudos, em trabalho
desenvolvido com escorpiões do Estado do Pará, Costa et al. (2008) evidenciaram que o gene
ribossomal 16S é uma ferramenta robusta em estudos filogenéticos de escorpiões. Além disso,
concluíram que a abordagem molecular é eficaz no discernimento de espécies consideradas
crípticas. Estudando a espécie Opisthacanthus cayaporum, que é endêmica do Estado do Pará,
Silva et al. (2009) conseguiram, através do gene 16S, estabelecer uma relação de parentesco
evolutivo com o escorpião australiano Liocheles australasiae Fabricius, 1775. Segundo a
pesquisa, os resultados obtidos refletem a possível ancestralidade entre as duas espécies, haja
vista, que de acordo com a teoria das placas tectônicas as duas áreas faziam parte de um só
complexo, a pangéia. O gene ribossomal 16S também foi empregado no estudo de Yamaguti
(2011), quando foi usado para estabelecer a filogenia do gênero Rhopalurus Thorell, 1876, os
resultados obtidos mostraram sincronia entre o que foi apresentado pela taxonomia tradicional
e molecular.
64
No Brasil, recentemente, Pardal et al. (2014) publicaram um trabalho sobre os
escorpiões Tityus obscurus Gervais 1843 que ocorrem no Estado do Pará. Na oportunidade,
revelaram através do 16S divergências evolutivas entre os representantes do oeste e nordeste
do Estado. Martins et al. (2015) publicaram um trabalho acerca do genoma mitocondrial
completo da espécie Tityus serrulatus, o primeiro trabalho dessa natureza para a América do
Sul. Os resultados da pesquisa apresentaram algumas particularidades, dentre elas, o código
iniciador CTG para o gene Citocromo Oxidade 1 e o tamanho do gene ribossomal 16S, menor
que dos demais escorpiões relatados até o presente momento. Além disso, mostraram, a partir
de inferências filogenéticas, a monofilia da família Buthidae.

65
2 Justificativa
A ferramenta molecular para auxiliar na identificação de espécies escorpiônicas é
um complemento importante para as metodologias convencionais baseadas em caracteres
morfológicos (HEBERT et al., 2003; HEBERT et al., 2004; PRENDINI & WHEELER,
2005). A identificação taxonômica com base em atributos morfológicos tem suas limitações,
as chaves de identificação, por exemplo, são na maioria dos casos restritas a um estágio do
ciclo de vida da espécie. Outro gargalo encontrado está relacionado à plasticidade fenotípica
exibida por alguns representantes de uma população. Neste caso, a objetividade da ciência
pode abrir espaço para interpretações subjetivas do pesquisador, levando, não raramente, a
uma identificação errônea. A taxonomia tradicional de escorpiões é retratada com
preocupação por um dos maiores especialistas no assunto. Lourenço (2000) relatou que
quanto mais se aprofundam os estudos sobre os escorpiões, torna-se mais frequente a
necessidade de reavaliações e mudanças naquilo que já foi descrito. Diante disso, e
considerando a diversidade de espécies descritas para o Estado do Amazonas, a carência de
pesquisadores na região, a ausência total de trabalhos com a abordagem taxonomia molecular
e, principalmente, levando em conta que as técnicas da biologia molecular se revelaram
ferramentas importantes à taxonomia tradicional, o presente trabalho tornou-se necessário,
uma vez que as sequências gênicas geradas serão úteis para o conhecimento da diversidade
genética e taxonomia dos escorpiões que ocorrem nesta unidade da federação.

66
3 Objetivos
3.1 Objetivo Geral
Gerar sequências do gene 16S do DNA mitocondrial para auxiliar na identificação
de espécimes de escorpiões.

3.2 Objetivos específicos


 Verificar se existem divergências entre as sequências gênicas obtidas dos exemplares
pertencentes às coleções aracnológicas em relação às provenientes das coletas de
campo;
 Construir cladogramas que reflitam as relações filogenéticas entre as espécies.

67
4 Materiais e Métodos
4.1 Área de abrangência da pesquisa e coleta de escorpiões
A área de abrangência da pesquisa continuou sendo o Estado do Amazonas,
seguindo os moldes daquilo que foi descrito na página 9 do capítulo I.
As coletas de campo foram realizadas através do método de pitfall e busca ativa
em vários municípios do Estado (figura 2). As coletas de campo foram realizadas sob a
anuência do Instituto Chico Mendes de Conservação da Biodiversidade (ICMBIO), através da
autorização número 43625-1.
Os espécimes coletados foram acondicionados em recipientes individualizados
contendo álcool diluído a 80%. Posteriormente foram identificados através de seus atributos
morfológicos (LOURENÇO, 2002), esta etapa foi realizada em parceria com o a Fundação de
Medicina Tropical.

Figura 2 - À esquerda, armadilha de pitfall montada no Ramal do Brasileirinho/Manaus. À


direita, busca ativa realizada em comunidade rural do município de Tabatinga.
Fotos: Cícero Costa e Soldado Diego (Exército Brasileiro/Tabatinga)

4.2 Material utilizado nas análises


A presente pesquisa contou com os exemplares de escorpiões coletados em campo
(CC), que se somaram aos espécimes provenientes das coleções aracnológicas (CA) do Estado
do Amazonas (figura 3). Neste caso, representadas pelo Instituto de Pesquisa da Amazônia
(INPA), Universidade Federal do Amazonas (UFAM) e Fundação de Medicina Tropical do
Amazonas (FMT/AM). Um total de 72 espécimes, totalizando 9 espécies diferentes foram
utilizados no trabalho. Cada espécie foi representada por 8 exemplares, sendo que 4 eram
provenientes das CC e 4 das CA. A tabela 2 apresenta a origem dos exemplares estudados, as
coordenadas geográficas e o município de coleta.

68
Figura 3 - À esquerda, exemplar de Tityus dinizi Lourenço, 1997, em ambiente natural,
coletado no município de Tabatinga. À direita, exemplar de Brotheas amazonicus Lourenço,
1988 proveniente da coleção da FMT.
Fotos: Cicero Costa

Tabela 2 - Espécimes de escorpiões utilizados nas análises genéticas.


Coordenadas Total de
Espécie Município Origem
geográficas amostra
05° 19' 15.25"S
Humaitá CA-FMT 3
061° 59' 55.25"W
Ananteris dekeyseri 02° 57' 41.65"S
Manaus CA-INPA 1
Lourenço, 1982 059° 56' 15.71"W
03° 04' 2.26"S
Manaus CC 4
059° 58' 47.60"W
02° 30' 00"S
Manaus CA-INPA 02
060° 07' 60.00"W
Broteochactas polisi Presidente 01° 55' 18.45"S
Monod & Lourenço, CA-INPA 02
Figueiredo 059° 28' 5.32"W
2001
03° 05' 58.00"S
Manaus CC 04
059° 59' 1.54"W
02° 41' 46.56"S
Silves CA-FMT 04
058° 28' 29.65"W
02° 50' 15.56"S
Brotheas amazonicus Silves CC 02
058° 12' 45.68"W
03° 12' 46.50"S
Manacapuru CC 02
060° 26' 35.30"W
Presidente 00° 54' 56.82"S,
Chactopsis amazonicus CA-INPA 04
Figueiredo 060° 27' 7.60"W
Lourenço & Francke,
02° 41' 54.82"S,
1986 Manaus CC 04
059° 41' 48.98"W
04° 14′ 09.00″ S,
Tabatinga CA-INPA 04
Tityus dinizi 69° 56′ 17.00″ W
Lourenço, 1997 04°14'40.90"S
Tabatinga CC 04
069° 55'24.45"W
07° 11′ 49.00″ S
Tityus matthieseni Apuí CA-INPA 04
059° 53′ 27.00″ W
Pinto-da-Rocha &
Careiro 03°13'52.23"S
Lourenço, 2000 CC 04
Castanho 059° 48' 23.37"W
03° 6' 6.93"S
Manaus CA-UFAM 03
Tityus metuendus 060° 0' 37.58"W
Pocock, 1897 02°41'54.82"S
Rio Preto da Eva CA-FMT 01
059°41'48.98"W
69
03° 5' 58.00"S
Manaus CC 02
059° 59' 1.54"W
04°14' 35.61"S
Tabatinga CC 02
069° 55' 26"W
03° 1' 44.47"S
Manaus CA-FMT 04
Tityus silvestris 060° 17' 40.85"W
Pocock, 1897 Benjamin 04°22'49.31"S
CC 04
Constant 070°1'52"W
00°59'44.49"S
Barcelos CA-INPA 02
062°56'18.15"W
04° 05' 60.49"S
Coari CA-INPA 02
063° 08' 40.5"W
Tityus strandi
04° 08' 36.56"S
Coari CC 02
063° 8' 22.28"W
03°05'20.3"S
Manaus CC 02
060°00'40.5"W
Fonte: Coleções Aracnológicas (INPA, UFAM e FMT) e Coletas de Campo (Cícero Costa)

4.3 Coleta de material biológico e extração de DNA


Após as coletas de campo e identificação dos espécimes, foram extraídos
fragmentos de tecido muscular da região dos pedipalpos e colocados, juntamente com álcool
96%, em tubo eppendorf de 1,5 mL, conforme sugerido por (PARMAKELIS et al., 2006). O
mesmo procedimento foi adotado para os exemplares das coleções aracnológicas. O DNA
total foi isolado utilizando-se o protocolo fenol-clorofórmio proposto por Sambrook et al.
(1989), adaptado para microtubos de 1,5 mL. Os procedimentos da técnica podem ser
descritos da seguinte maneira: colocar cerca de 20 mg de tecido muscular de cada espécime
em tubo de 1,5 mL e adicionar 300 μL de tampão de homogeneização, 300 μL de tampão de
lise, 5 μL de RNAse (10 mg/mL) e incubar na estufa a 37 ºC por 40 minutos; adicionar 15 μL
de proteinase K (10 mg/mL), misturar bem e incubar por 3 horas em banho-maria a 55 ºC;
deixar esfriar a temperatura ambiente e adicionar 700 μL de fenol-clorofórmio-álcool isoamil
(25:24:1), misturar manualmente por 10 minutos para homogeneizar a mistura; centrifugar a
10.000 rotações por minuto (rpm) por 10 minutos; remover cuidadosamente o sobrenadante e
transferi-lo para um novo tubo; repetir este passo com 700 μL de clorofórmio-álcool isoamil
(24:1); transferir o sobrenadante para um novo tubo; adicionar 100 μL de acetato de sódio pH
4.8 e misturar bem; adicionar 700 μL de isopropanol para precipitar o DNA; agitar
gentilmente até visualizar a nuvem de DNA; se não aparecer sedimento, congelar por no
mínimo 1 hora; centrifugar por 10 minutos a 10.000 rpm; descartar o sobrenadante
cuidadosamente para não perder o sedimento; adicionar 200 μL de etanol a 70%; centrifugar
por 5 minutos a 10.000 rpm; descartar o sobrenadante cuidadosamente para não perder o
sedimento; secar o sedimento a 37 ºC (em estufa), observando sempre para não secar muito;

70
dissolver em 50 μL de tampão de eluição (TE); visualizar o DNA total em gel de agarose a
1% (5 μL de DNA + 3 μL de corante azul) ou quantificá-lo através do aparelho nanodrop.

4.4 Isolamento e amplificação do gene mitocondrial rRNA 16S


O isolamento de um fragmento de cerca de 500 pares de bases do gene
mitocondrial rRNA 16S foi realizado através da Reação em Cadeia da Polimerase (PCR),
usando-se os primers descritos por Parmakelis et al. (2006) listados a seguir: forward
(CGATTTGAACTCAGATCA) e reverse (GTGCAAAGGTAGCATAATCA).
Para a realização da PCR, com volume final de 25 μL, foi usado o seguinte
protocolo: 4 μL de DNTPs (1,25 mM); 2,5 μL de solução tampão (10X); 2,25 μL de solução
de MgCl 25 mM; 1 μL de DNA total (100 ng/μL); 0,50 μL de cada oligonucleotídio (16
pmol); 0,25 μL da enzima Taq polimerase (5 U/μL); água ultra-pura estéril para completar o
volume final de 25 μL.
As reações de PCR foram realizadas em um termociclador de marca/modelo
“Eppendorf”/“Mastercycler Gradient”, o qual foi programado para as seguintes etapas: um
ciclo inicial de desnaturação de 5 minutos a 94 ºC, seguido de 30 ciclos de 30 segundos a 94
ºC para desnaturação, 1 minuto a 55 ºC para hibridização e 2 minutos a 72 ºC para extensão;
após os 30 ciclos, um ciclo adicional de extensão por 7 minutos a 72 ºC. Após o término das
reações, os produtos da PCR foram corridos em eletroforese através do gel de agarose corado
com gel red a 1%. Para isso, foram utilizados 5 μL da solução proveniente da reação de PCR
e 3 μL do corante Gel Red. Em seguida foram visualizados (figura 4) em aparelho
transiluminador ultra-violeta de marca/modelo “Proteinsimple”/FluorChem FC3;
quantificados em aparelho nanodrop de marca/modelo “Thermo”/“ND-200c” e purificados
com o uso do kit da “invitrogen/life technologies”.
Todo o processo de extração, reação de amplificação gênica (PCR), quantificação
e purificação do DNA foi realizado no Laboratório de Biologia Molecular de Malária e
Dengue do Instituto Nacional de Pesquisas da Amazônia (INPA).

71
1CP 2 3 4 5 6 7 8 9 10 11 12CN

500pb

100pb

Figura 4 - Eletroforese em gel de agarose da amplificação de


um fragmento do gene 16S de escorpiões

4.5 Sequenciamento dos produtos das PCRs


Os produtos das PCRs purificados, contendo os fragmentos do gene 16S, foram
sequenciados utilizando-se o método didesoxiterminal (SANGER et al., 1977), etapa realizada
no Laboratório do Instituto de Ciências Biológicas da Universidade Federal do Amazonas
(UFAM).

4.6 Qualidade e alinhamento das sequências


A qualidade das sequências foi verificada seguindo Togawa & Brígido (2003). As
sequências com valores de PHRED igual ou inferior a 20 foram descartadas (figura 5). As
sequências que apresentaram um padrão de qualidade passível de serem analisadas foram
alinhadas de forma automática através do programa BioEdit (HALL, 1999), as regiões
ambíguas foram corrigidas visualmente e manualmente. As sequências obtidas serão
depositadas no GenBank.

Figura 5 - Sequências provenientes da reação de sequenciamento. À esquerda uma sequência


apta para análise, à direita uma sequência sem qualidade, descartada.

72
4.7 Os índices de divergências evolutivas e a construção de árvores filogenéticas
Dados relacionados ao percentual de divergência evolutiva entre as sequências e a
construção das árvores filogenéticas foram gerados a partir dos métodos de reconstruções
evolutivos Neighbor-Joining (NJ) e Máxima Parcimônia (MP), dispostos no programa Mega6
(TAMURA et al., 2013). Os agrupamentos das árvores geradas foram apoiados pelo teste
estatístico bootstrap (FELSENSTEIN, 1985), corrido com 1000 pseudoréplicas e valor de
significância ao nível de p<5%.

73
5 Resultados e Discussão
5.1 As divergências nucleotídicas entre os escorpiões
Após o processo de análise e verificação do produto proveniente do
sequenciamento, um total de 52 sequências do gene mitocondrial 16S, com tamanho de 372
pares de base (pb), foram obtidas a partir dos exemplares provenientes das coleções
aracnológicas e coletas de campo. As sequências representam um total de 09 espécies, 05
gêneros e 02 famílias diferentes, são elas: Ananteris dekeyseri, Tityus dinizi, T. matthieseni, T.
metuendus, T. silvestris e T. strandi (família Buthidae); Brotheas amazonicus, Broteochactas
polisi e Chactopsis amazonicus (família Chactidae). No apêndice I são listadas as sequências
completas de todos os exemplares utilizados.
A tabela 3 (apêndice II) apresenta os dados das divergências nucleotídicas entre as
sequências gênicas dos indivíduos estudados. A taxa variou de 0% a 2% entre os exemplares
da espécie Ananteris dekeyseri; de 0% a 4% entre os Tityus dinizi; de 0% a 6% entre os Tityus
matthieseni; de 0% a 16% entre os Tityus metuendus; de 0% a 6.7% entre os Tityus strandi; de
0% a 4% entre os Broteochactas polisi. Entre as sequências dos representantes de Tityus
silvestris, Brotheas amazonicus e Chactopsis amazonicus não ocorreram variações. A partir
dos dados da tabela 3 foi possível estabelecer a distância evolutiva entre os gêneros
envolvidos no trabalho. A taxa média foi de 59% entre Ananteris Thorell, 1891 e Tityus Koch,
1836; de 52% entre Ananteris e Brotheas Koch, 1837; de 76% entre Ananteris e
Broteochactas Pocock, 1893; de 60% entre Ananteris e Chactopsis Kraepelin, 1912; de 51%
entre Tityus e Brotheas; de 69% entre Tityus e Broteochactas; de 54% entre Tityus e
Chactopsis; de 66% entre Brotheas e Broteochactas; de 40% entre Brotheas e Chactopsis; e
de 65% entre Broteochactas e Chactopsis. A variação entre os representantes do gênero
Tityus, grupo mais representativo da pesquisa, alcançou uma média de 31% de divergência.
Ao publicar o artigo intitulado identificação biológica através de código de barras,
Hebert et al. (2003) abriam um campo promissor para a taxonomia biológica. Também
conhecido como DNA barcoding, o sistema proposto tinha como premissa fundamental a
identificação de espécies a partir de um pequeno segmento de DNA. Embora a proposta
inicial fosse padronizar o processo de identificação a partir de um trecho do gene mitocondrial
Citocromo Oxidade I, ou simplesmente COI, outros genes se mostraram fundamentais. Nesse
sentido, destaque para o gene ribossomal 16S, que se apresentou como uma ferramenta
acurada na identificação de espécimes e em filogenia molecular de escorpiões (FET et al.,
2013; MILLER et al., 2014).
Neste trabalho, foram geradas sequências nucleotídicas que certamente serão
usadas como código de barras na identificação de espécimes escorpiônicas que ocorrem no
74
Estado do Amazonas. Hebert et al. (2004) relataram que um passo fundamental na
identificação de espécimes a partir de sequências gênicas é a definição da variação
nucleotídica intra e inter-específica para as populações em estudo. Embora alguns grupos não
tenham apresentado variações entre seus representantes, os resultados da presente pesquisa
demonstraram que a diversidade nucleotídica variou de forma significativa entre os
representantes de cada população, alcançou o índice máximo de 2% entre os Ananteris
dekeyseri, ao passo que entre Tityus metuendus chegou a 16% de diferenças. Contudo, a maior
variação foi registrada entre os exemplares de grupos diferentes, neste caso, alcançou uma
média de divergência na ordem de 76% entre Ananteris e Broteochactas. Assim, os dados da
presente pesquisa refletem os pressupostos do DNA barcoding proposto por Hebert et al.
(2003), que preconizam a variação genética dentro de uma mesma espécie como sendo menor
que a variação inter-específica (HAJIBABAEI et al., 2006; HEBERT & LANDRY, 2009;
WARD et al., 2005).
Os índices máximos de divergências encontrados entre os representantes de
Ananteris dekeyseri, 2%; de 4% para os Broteochactas polisi; de 6% para os T. matthieseni; e
de 6.7% para os Tityus strandi estão dentro dos padrões de divergências relatados nas
populações de escorpiões do gênero Euscorpius (FET & SOLEGLAD, 2005; TROPEA et al.,
2015). Por outro lado, a taxa de variação encontrada intra-específica para Tityus metuendus,
16%, que embora não esteja muito distante dos 11% encontrados por Pardal et al. (2014) para
os Tityus obscurus, é normalmente observada entre indivíduos congêneres, é o que foi
detectado, por exemplo, no trabalho de Teruel et al. (2006), onde encontraram divergências
inter-específica variando de 6.8% a 16% entre os exemplares de escorpiões do gênero
Centruroides Marx, 1890.
Os escorpiões T. metuendus são classificados como generalistas, vivem em
praticamente todos os tipos de ambientes e possuem ampla distribuição geográfica na
Amazônia, sendo encontrados em todos os estados do norte do Brasil e ainda no Peru (FET &
LOWE, 2000; LOURENÇO, 1983, 2011). Esta ampla distribuição, associada aos diferentes
habitats, podem ter permitido que populações de T. metuendus passassem por pressões
seletivas distintas, o que pode ser a explicação para a elevada taxa de divergência nucleotídica
encontrada entre os seus representantes.
A média de divergência de 31% encontrada entre os Tityus, grupo mais
representativo do trabalho, é considerada elevada quando comparada com os índices de outros
grupos. Entre os Euscorpius, Salomone et al. (2007) encontraram um percentual de 17.7%,
entre os Androctonus Ehrenberg, 1828, a taxa de divergência relatada por Coelho et al.
(2014), foi ainda menor, 9.2%. Os Tityus compõem o maior gênero de escorpiões, das cerca
75
de 1800 espécies conhecidas, 220 delas são classificadas neste grupo (LOURENÇO, 2015).
Esta multiplicidade de representantes sempre foi alvo de muita divergência em relação a sua
taxonomia, por conta disso, inúmeros estudos mostraram a necessidade de uma redivisão do
gênero (GONZÁLEZ-SPONGA, 1996; LOURENÇO, 1986; LOURENÇO & EICKSTEDT,
1988). Assim, pode-se inferir que a diversidade genética encontrada para os Tityus corrobora
e reflete os achados da literatura baseados em dados morfológicos.
A elevada taxa de divergência encontrada entre os Ananteris e Tityus, 59%,
superior aos 52% apresentados entre Ananteris e Brotheas e dos 54% de Tityus e Chactopsis,
que são de famílias diferentes, foi outro achado interessante da pesquisa. Não há publicações
disponíveis falando acerca do padrão de divergência genética dos Ananteris. Entretanto, é
importante ressaltar que todos os exemplares deste grupo apresentaram em suas sequências
alguns blocos de indel (inserção), com destaques para os presentes nas posições 102/109, com
tamanho de 8 pares de base; 168/178, com tamanho de 11 pares de bases; e 220/251, com
tamanho de 32 pares de bases, que não configuram nos outros representantes da família
Buthidae presentes no estudo.
Além disso, se diferenciaram em relação aos demais escorpiões estudados por
apresentarem altas taxas de transições em relação às transversões, 2.37 (tabela 4), contra os
1.26 dos demais grupos, e ainda, por possuírem elevados índices de guanina, 25.61%,
praticamente o dobro dos 13.19% apresentados pelos outros exemplares. Estes achados
mostram uma ampla divergência no padrão de distribuição nucleotídica entre os exemplares
de Ananteris e os demais escorpiões estudados. Dados da literatura indicam que a taxa de
transição em relação à transversão do gene ribossomal 16S em escorpiões gira em torno de
1.30 e os índices de guanina variam de 10% a 13% (GANTENBEIN et al., 2000;
SALOMONE et al., 2007), distorcendo, portanto, dos achados para Ananteris e corroborando
com os descritos para os demais escorpiões estudados. Este padrão diferenciado dos
Ananteris, sacramentado pela presença das três inserções, das elevadas taxas de transições em
relação às transversões e dos altos índices de guanina podem ser os responsáveis pelo o
elevado valor de divergência nucleotídica em relação aos demais representantes da família
Buthidae.
Além das divergências entre os representantes de uma mesma espécie, entre
indivíduos do mesmo gênero e entre gêneros diferentes, foi possível verificar as diferenças
entre as famílias. Neste caso, os resultados mostraram que as divergências nucleotídicas
encontradas entre os representantes da família Buthidae (Ananteris/Tityus) e família
Chactidae (Brotheas/Broteochactas/Chactopsis) variaram de 51% a 76%. Taxa superior à

76
colocada por Gantenbein et al. (1999), quando apresentaram um percentual de 44% de
divergência entre os representantes das duas famílias.

Tabela 4 - Matriz de estimativa de substituições nas sequências dos


exemplares de Ananteris.
Nucleotídeos A T/U C G
A - 4.74 3.00 33.78
T/U 3.27 - 2.88 3.79
C 3.27 4.56 - 3.79
G 29.16 4.74 3.00 -
Fonte: (TAMURA-NEI, 1993; TAMURA et al., 2013).

5.2 As divergências entre as sequências provenientes das CA e CC


O percentual de divergências entre as sequências provenientes das coleções
aracnológicas (CA), entre as sequências oriundas das CA e coletas de campo (CC) e as
divergências entre as sequências provenientes das CC foram organizadas na tabela 5.
A tabulação dos dados mostra que em Ananteris dekeyseri não houve variação
entre as sequências provenientes das CA, entre os exemplares das CA e CC e entre os
representantes das CC a variação média ficou em torno de 1%. O confronto entre as
sequências dos representantes de Tityus dinizi mostrou que a divergência média entre os
exemplares provenientes das CA foi de 1%, mesmo percentual foi encontrado entre os
representantes das CA e CC, a maior média de divergência ficou entre os CC, 2%. Para os
Tityus matthieseni, os percentuais médios foram de 5.4% entre os exemplares de CA, de 5%
entre as sequências de CA e CC e de 0.3% entre os representantes de CC. Nos Tityus
metuendus os índices ficaram na casa dos 3% entre os exemplares provenientes das CA, de
7.4% entre as sequências CA e CC e de 8.7% para os representantes das CC. As sequências
que representam os Tityus strandi apresentaram divergência média na ordem de 9% entre os
exemplares provenientes das CA e de 6% entre os exemplares de CA e CC, entre as
sequências analisadas só havia uma proveniente das CC, por conta disso, não foi possível
estabelecer o cotejamento. Em Broteochactas polisi os índices de divergências ficaram na
casa dos 1.4% entre as sequências oriundas das CA, de 2% entre as sequências das CA e CC e
de 3% entre os exemplares de CC. Para as sequências originadas a partir dos exemplares de
Brotheas amazonicus, Chactopsis amazonicus e Tityus silvestris não houve divergências.
Os dados apresentados indicam que os escorpiões depositados nas coleções
aracnológicas estão em condições de serem estudados do ponto de vista genético, o que vem a
ser outro achado interessante do presente trabalho. Das 52 sequências geradas, 25 delas são
provenientes de exemplares dispostos nas coleções do INPA, UFAM e FMT. Os resultados
mostraram certa homogeneidade na taxa de variação das sequências dos representantes das

77
coleções aracnológicas, quando comparadas às taxas de variação dos exemplares provenientes
das coletas de campo. Nos permitindo supor que as divergências encontradas são fruto do
processo evolutivo da espécie e não alterações provocadas pela exposição ao fixador. Santos
et al. (2002) falam da importância do aproveitamento do material disposto nas coleções
biológicas para o conhecimento da diversidade genética das espécies brasileiras. Além disso,
relatam a necessidade da preservação de tecidos dos animais em álcool, com concentração
mínima de 70%, para manutenção de suas propriedades moleculares. É importante acrescentar
que as espécies obtidas junto às coleções encontravam-se fixadas em álcool 80%.

Tabela 5 - Média de divergência evolutiva entre as


sequências do gene ribossomal 16S dos escorpiões
provenientes das Coleções Aracnológicas (CA) e
Coletas de Campo (CC).
Espécie CAxCA CAxCC CCxCC
Ananteris dekeyseri 0% 1% 1%
Tityus dinizi 1% 1% 2%
Tityus matthieseni 5.4% 5% 0.3%
Tityus metuendus 3% 7.4% 8.7%
Tityus silvestris 0% 0% -
Tityus strandi 9% 6% -
Brotheas amazonicus 0% 0% 0%
Broteochactas polisi 1.4% 2% 3%
Chactopsis amazonicus - 0% 0%
Fonte: (TAMURA-NEI, 1993; TAMURA et al., 2013).

5.3 As Árvores Filogenéticas


As figuras 6 e 7 (apêndice III) apresentam as árvores filogenéticas geradas através
dos métodos de Neighbor-Joining (NJ) e Máxima Parcimônia (MP). Dos 372 sítios das
sequências analisadas, 128 deles mostraram-se conservados e 239 variáveis, destes, 232 com
sinais informativos para parcimônia. A árvore mais parcimoniosa foi gerada com 615 passos,
apresentou índice de consistência de 0.68 e 0.94 de índice de retenção.
A topologia da árvore gerada pelo método de NJ mostra a formação de três grupos
distintos de escorpiões, um formado pelo gênero Tityus, apoiado pelo valor de bootstrap de
56%, outro formado pelos representantes dos gêneros Brotheas, Broteochactas e Chactopsis,
sustentado pelo valor de bootstrap de 76% e um grupo formado pelos exemplares do gênero
Ananteris, que enraíza a árvore.
A árvore gerada pelo método de MP mantém o grupo dos Tityus, com elevação do
valor do bootstrap para 80%. Entretanto, internaliza os exemplares do gênero Ananteris e
separa os Broteochactas, que passam a serem os enraizadores da árvore, dos demais
chactídeos.
78
As topologias das árvores geradas pelos métodos de Neighbor-Joining (NJ) e
Máxima Parcimônia (MP) se apresentaram de forma similares. As diferenças notadas ficaram
restritas, basicamente, ao posicionamento dos representantes do gênero Ananteris e
Broteochactas. Até o presente momento nenhum trabalho foi publicado no sentido de explicar
a controvérsia e a flexibilidade dos Ananteris em relação à filogenia de outros escorpiões.
Contudo, o trabalho de Yamaguti (2011) relata que o referido gênero se posiciona como o
mais basal dentro da família Buthidae, o que não aconteceu nas duas árvores apresentadas. Já
em relação aos Broteochactas é congruente inferir que o arranjo formado pelo método de NJ
reflete muito mais história evolutiva do grupo, uma vez que juntamente com os Brotheas e
Chactopsis são classificados como pertencentes a uma mesma família, a Chactidae.
Internamente, nas duas configurações das árvores, forma-se um grande clado com
exemplares de Tityus, que se subdivide em três grupos menores, um formado pelos T. strandi,
outro formado pelos T. silvestris e o grupo maior que reúne representantes de T. dinizi, T.
matthieseni e T. metuendus (figura 8). O grupo dos Tityus strandi se apresenta como o mais
basal de todos, os cinco representantes da espécie se rearranjam formando um grupo
monofilético apoiado com valor de bootstrap de 100% em ambas as topologias. O mesmo
valor de bootstrap foi notado nas duas árvores para o agrupamento dos Tityus silvestris. Os
valores de bootstrap do grupo formado por T. dinizi, T. matthieseni e T. metuendus ficou em
99% e 98% para NJ e MP, respectivamente.
T matthieseni C da Varzea/CC 104 T matthieseni C da Varzea/CC 104
T matthieseni C da Varzea/CC 240A T matthieseni C da Varzea/CC 240A
T matthieseni C da Varzea/CC 103 T matthieseni C da Varzea/CC 103
T matthieseni C da Varzea/CC 108 T matthieseni C da Varzea/CC 108
T matthieseni Apu/CA 261 T matthieseni Apui/CA 110
T matthieseni Apui/CA 110 T matthieseni Apui/CA 260
T matthieseni Apui/CA 260 T matthieseni Apu/CA 261
T metuendus R P da Eva/CA 66 T metuendus Manaus/CA 91
T metuendus Manaus/CA 91 T metuendus Manaus/CC 130
T metuendus Manaus/CC 130 T metuendus Manaus/CC 65
T metuendus Manaus/CC 65 T metuendus Manaus/CA 17
T metuendus Manaus/CA 17 T metuendus Manaus/CA 18
T metuendus Manaus/CA 18 T metuendus R P da Eva/CA 66
T metuendus Tabatinga/CC 107 T metuendus Tabatinga/CC 107
T metuendus Tabatinga/CC 252 T metuendus Tabatinga/CC 252
T dinizi Tabatinga/CC 246 T dinizi Tabatinga/CC 106
T dinizi Tabatinga/CA 247 T dinizi Tabatinga/CA 247
T dinizi Tabatinga/CC 46 T dinizi Tabatinga/CC 46
T dinizi Tabatinga/CA 112 T dinizi Tabatinga/CC 246
T dinizi Tabatinga/CA 245 T dinizi Tabatinga/CA 112
T dinizi Tabatinga/CC 105 T dinizi Tabatinga/CA 245
T dinizi Tabatinga/CC 106 T dinizi Tabatinga/CC 105
T silvestris Manaus/CA 19 T silvestris Manaus/CA 67
T silvestris Manaus/CA 67 T silvestris Manaus/CA 19
T silvestris B Constant/CC T silvestris B Constant/CC
T strandi Barcelos/CA 68
T strandi Barcelos/CA 68
T strandi Barcelos/CA 109
T strandi Barcelos/CA 109
____ T strandi Coari/CA 75 ____ T strandi Coari/CA 75
T strandi Coari/CA 66
0.05 0.05 T strandi Coari/CA 66
T strandi Coari/CC
T strandi Coari/CC
B polisi P Figueiredo/CA 87
C amazonicus P Figueiredo/CA
B polisi Manaus/CC 91
Figura 8 - Mostrando o rearranjo dos Tityus em NJ, à esquerda e MP, à direita.
B polisi Manaus/CA 128
C amazonicus Manaus/CC
C Amazonicus Manaus/CC 94

Fonte: (FELSENSTEIN, 1985; SAITOU & NEI, 1987; NEI & KUMAR, 2000; TAMURA et al.,
B polisi P Figueiredo/CA 148
B polisi Manaus/CC 90
B amazonicus Manacapuru/CC 202 A
B amazonicus Manacapuru/CC 202 B
2013). C Amazonicus Manaus/CC 94
B amazonicus Silves/CC 48
C amazonicus Manaus/CC
B amazonicus Silves/CA 99
C amazonicus P Figueiredo/CA
B amazonicus Silves/CC 50
B amazonicus Manacapuru/CC 202 A
B amazonicus Silves/CA 51
B amazonicus Manacapuru/CC 202 B
B amazonicus Silves/CA 98
B amazonicus Silves/CC 48
A dekeyseri Manaus/CC 112
B amazonicus Silves/CC 50
B amazonicus Silves/CA 51
A dekeyseri Manaus/CC 113 79
A dekeyseri Humaita/CA 103
B amazonicus Silves/CA 98
A dekeyseri Manaus/CA 77
B amazonicus Silves/CA 99
A dekeyseri Manaus/CC 95
A dekeyseri Manaus/CC 113
A dekeyseri Humaita/CA 79
A dekeyseri Manaus/CC 112
A dekeyseri Manaus/CA 106
A dekeyseri Manaus/CC 95
B polisi Manaus/CC 90
Os três clados gerados para os Tityus corroboram com a reorganização do gênero
em três grandes grupos, Asthenes, Bahiensis e Clathratus, proposto por Lourenço (2002). O
referido trabalho, juntamente com o estudo de Lourenço et al. (2006) mostraram que os T.
silvestris são escorpiões de pequeno porte, possuem dimensões do corpo variando entre 25
mm e 45 mm e apresentam coloração variada, por conta disso são incluídos dentro do grupo
dos “Tityus clathratus”. Já os exemplares de T. strandi são classificados como escorpiões de
médio porte, apresentam comprimento total do corpo variando entre 60 mm e 70 mm e
possuem coloração variando do amarelo ao marrom amarelado, por isso são inseridos no
grupo dos “Tityus bahiensis”. Por outro lado, os exemplares de T. dinizi, T. metuendus e T
matthieseni são considerados escorpiões de grande porte, com tamanho que podem variar de
75 mm e 100 mm e, em geral, apresentam coloração variando do marrom ao negro,
características que os fazem serem colocados dentro do grupo dos “Tityus asthenes”. Diante
disso, e considerando a topologia das árvores, com o agrupamento isolado dos T. silvestris, a
independência do clado dos T. strandi e a formação do grupo que reúne exemplares de
T.dinizi, T. metuendus e T. matthieseni é coerente afirmar que os resultados apresentados são
congruentes com os dados taxonômicos baseados em análises morfológicas.
Caminhando para a região mais interna do clado formado pelos Tityus dinizi, T.
matthieseni e T. metuendus foi possível observar que os exemplares pertencentes à espécie T.
dinizi, coletados no município de Tabatinga, se organizam de forma independente juntamente
com dois representantes de T. metuendus, também oriundos de Tabatinga, formando um
grupo apoiado com valor de bootstrap de 100% nos dois tipos de árvores. Os atributos
morfológicos usados nas chaves de identificação mostram uma estreita relação entre as duas
espécies, o que os fazem serem inseridos dentro do subgênero T. (Atreus) Gervais, 1843
(LOURENÇO, 2002, 2011). Embora apresentem várias características em comum, a presença
dos dois exemplares de T. metuendus agrupando com os T. dinizi em ambas as árvores é
controvérsia. Vachon (1974) relata que a taxonomia de Tityus é complexa e que os atributos
morfológicos usualmente utilizados para caracterizar o grupo taxonômico mais basal não são
incisivos o suficiente para discriminar espécies crípticas. Além disso, é importante ressaltar a
carência de guias que possam auxiliar na identificação das espécies escorpiônicas brasileira,
uma vez que, atualmente existem apenas dois disponíveis, o já defasado “Escorpiões sul-
americanos” de Mello-Leitão (1945) e o mais atual “Scorpions of Brazil” de Lourenço (2002).
Assim, fica a dicotomia em relação ao agrupamento dos dois exemplares, se é fruto de um
processo de evolução gênica ou uma possível falha de identificação taxonômica. Neste
sentido, é importante citar o trabalho de Nwani et al. (2011), que colocam a identificação

80
errônea dos espécimes que darão origem as sequências gênicas como um dos grandes gargalos
do DNA barcoding.
A subdivisão entre os exemplares de T. matthieseni e T. metuendus, os outros dois
grupos que formavam um grande clado de Tityus, juntamente com os T. dinizi, é apoiada pelo
bootstrap de 99% em NJ e pelos desprezíveis 41% em MP. Em relação aos exemplares de T.
metuendus, é importante destacar a posição do exemplar proveniente do município de Rio
Preto da Eva, que aparece como mais basal em relação ao grupo de Manaus na árvore
formada por NJ e como uma linhagem independente, em relação ao grupo
T.matthieseni/T.metuendus, na árvore MP, no primeiro caso apoiado pelo bootstrap de 92%,
ao passo que no segundo o valor foi de 99%. As duas árvores também separam os exemplares
de T. matthieseni, de um lado estão os representantes de Careiro da Várzea e do outro, os
provenientes do município de Apuí, a confiabilidade do arranjo é dada por 99% de bootstrap
para NJ e de 95% para MP.
As divisões apresentadas entre o exemplar de T. metuendus de Rio Preto da Eva e
os Tityus de Manaus e das espécies de T. matthieseni, em representantes do município de
Apuí e de Careiro da Várzea, indicam que eventos locais podem estar sendo responsáveis
pelas diferenças evolutivas refletidas nos cladogramas, haja vista que o raio de dispersão dos
escorpiões é muito curto. Segundo Polis et al. (1985) limita-se a cerca de 30 metros por ano, o
que pode dificultar a troca de material gênico entre os representantes de populações
diferentes. Achados semelhantes foram colocados por Fet et al. (2006) para os escorpiões
Euscorpius italicus, que se agruparam na árvore filogenética conforme à região geográfica de
coleta.
A árvore formada pelo método evolutivo NJ agrupou os representantes de
Brotheas, Broteochactas e Chactopsis, todos pertencentes à família Chactidae, em um grande
clado suportado pelo valor de bootstrap de 76% (figura 9). Neste agrupamento, o gênero
Broteochactas é colocado como o mais basal dos três. Os representantes dos gêneros Brotheas
e Chactopsis se organizaram formando um clado contundentemente apoiado pelo bootstrap de
100% em NJ e MP. Internamente, as espécies pertencentes ao gênero Brotheas se agruparam
formando um clado respaldado pelo bootstrap de 100% para NJ e MP, valores semelhantes
foram encontrados para o agrupamento dos representantes do gênero Chactopsis. Entre os três
gêneros representados, as duas filogenias geradas mostraram uma relação mais estreita entre
os Brotheas e os Chactopsis, já que se apresentaram como grupos irmãos, apoiados por
valores de bootstrap de 100%, em ambos os métodos de reconstrução filogenética.
O posicionamento dos Chactopsis nas duas árvores foi outro achado interessante
do presente trabalho, haja vista que existe uma grande discussão em relação a sua
81
T matthieseni C da Varzea/CC 240A
T matthieseni C da Varzea/CC 103
T matthieseni C da Varzea/CC 108
T matthieseni Apu/CA 261
T matthieseni Apui/CA 110
T matthieseni Apui/CA 260

permanência dentro da famíliaTChactidae. Soleglad


metuendus R P da Eva/CA 66 & Sissom (2001) transferiram o gênero
T metuendus Manaus/CA 91

para a família Euscorpiidae,Tsendo posteriormente ratificado por Soleglad & Fet (2003) e Fet
metuendus Manaus/CC 130
T metuendus Manaus/CC 65
T metuendus Manaus/CA 17
& Soleglad (2005). Entretanto, inúmeros trabalhos discordaram de tal classificação
T metuendus Manaus/CA 18

(BOTERO-TRUJILLO, 2008;TTmetuendus
metuendus Tabatinga/CC 107
FLÓREZ & MATTONI, 2007; LOURENÇO et al., 2011;
Tabatinga/CC 252
T dinizi Tabatinga/CC 246
OCHOA et al., 2013; PRENDINI & WHELER, 2005), diante dos quais, o gênero foi
T dinizi Tabatinga/CA 247
T dinizi Tabatinga/CC 46
novamente realocado à famíliaTChactidae. O objetivo
dinizi Tabatinga/CA 112 deste trabalho não era entrar nesta seara,
T dinizi Tabatinga/CA 245
contudo, é importante acrescentar
T dinizi que toda 105
Tabatinga/CC a discussão em torno do gênero Chactopsis foi
T dinizi Tabatinga/CC 106
realizada a partir de dados morfológicos. Portanto,
T silvestris Manaus/CA 19 os achados do presente estudo, o primeiro
T silvestris Manaus/CA 67
com abordagem molecular, podem contribuir
T silvestris para resolver ou aclarar o posicionamento dos
B Constant/CC
T strandi Barcelos/CA 68

Chactopsis na filogenia dos escorpiões.


T strandi Barcelos/CA 109
T strandi Coari/CA 75
T strandi Coari/CA 66
T strandi Coari/CC
B polisi P Figueiredo/CA 87
B polisi Manaus/CC 91
B polisi Manaus/CA 128
Broteochactas
B polisi P Figueiredo/CA 148
B polisi Manaus/CC 90
C Amazonicus Manaus/CC 94
C amazonicus Manaus/CC Chactopsis
C amazonicus P Figueiredo/CA
B amazonicus Manacapuru/CC 202 A
B amazonicus Manacapuru/CC 202 B
____ B amazonicus Silves/CC 48
0.05 B amazonicus Silves/CC 50
Brotheas
B amazonicus Silves/CA 51
B amazonicus Silves/CA 98
B amazonicus Silves/CA 99
A dekeyseri Manaus/CC 113
A dekeyseri Manaus/CC 112
Figura 9 - Organização dos representantes da família Chactidae segundo o modelo Neighbor-
A dekeyseri Manaus/CC 95
Joining. A dekeyseri Humaita/CA 103

Fonte: (FELSENSTEIN, 1985; SAITOU &AA NEI, dekeyseri Humaita/CA 79


1987; NEI & KUMAR, 2000; TAMURA et
dekeyseri Manaus/CA 77
al., 2013). A dekeyseri Manaus/CA 106

82
6 Conclusões
O objetivo principal do presente capítulo era gerar sequências do gene mitocondrial
16S de espécies escorpiônicas descritas para o Estado do Amazonas. As sequências gênicas
geradas são de espécimes coletados em campo e de exemplares provenientes das coleções
aracnológicas. Os resultados mostraram que a variação nucleotídica intra-específica foi menor
que entre representantes de espécies diferentes, corroborando com dados da literatura
especializa. Os achados indicam que o agrupamento dos Tityus nas duas árvores filogenéticas
geradas é congruente com a proposta de divisão do grupo em três subgrupos, Asthenes,
Bahiensis e Clathratus, já sugerida pela taxonomia tradicional, baseada em atributos
morfológicos. Além disso, as duas topografias mostraram que os Tityus metuendus são
parafilético e que os Brotheas estão evolutivamente mais próximos dos Chactopsis, que dos
Broteochactas. Este achado certamente contribuirá para aclarar a discussão em torno da
permanência do gênero Chactopsis dentro da família Chactidae. Por fim, os resultados
indicaram que os espécimes das coleções aracnológica estão em condições de serem
aproveitados em estudos genéticos, mostrou ainda que o gene 16S é uma ferramenta que pode
ser usada como barcoding para escorpiões.

83
7 Referências Bibliográficas
ANDERSON, S.; BANKIER, A.T.; BARRELL, G.T.; deBRUIJIN, M.H.L.;
COULSON, A.R. Sequence and Organization of the Human Mitochondrial Genome. Nature,
290:457-65, 1981.

BORGES, A.; ROJAS-RUNJAICC, F.J.M. Tityus perijanensis Gonza´ lez-


Sponga (Scorpiones, Buthidae): Molecular assessment of its geographical distribution and
venom lethality of Venezuelan populations. Toxicon, 50:1005-1010, 2007.

BOTERO-TRUJILLO, R.First record of the scorpion genus Chactopsis Kraepelin


in Colombia, with the description of Chactopsis carolinae sp. nov. (Scorpiones:
Chactidae). Zootaxa, 1743:34–42, 2008.

BRAZIL, T.K.; PORTO, T.J. Os escorpiões. Salvador: EDUFBA, 2010.

CANDIDO, D.M.; LUCAS, S.; SOUZA, C.A.R.D.; DIAZ, D.; LIRA-DA-SILVA,


R.M. Uma nova espécie de Tityus C. L. Koch, 1836 (Scorpiones, Buthidae) do Estado da
Bahia, Brasil. Biota Neutropica, 5(1):193-200, 2005.

CHOI, E.; PARK, S. J.; JANG, K.; HWANG, W. Complete mitochondrial


genome of a Chinese scorpion Mesobuthus martensii (Chelicerata, Scorpiones, Buthidae).
Full Length Research Paper. Mitochondrial DNA, 18(6):461-473, 2007.

COELHO, P.; SOUSA, P.; HARRIS, D.J.; VAN DER MEIJDEN, A. Deep
intraspecific divergences in the medically relevant fat-tailed scorpions (Androctonus,
Scorpiones). Acta tropica, 134:43-51, 2014.

COSTA, L.S.O.C. Identificação molecular e análises filogenéticas de


escorpiões da região oeste do Pará. Dissertação de Mestrado, Universidade Federal do
Estado do Pará – Belém, pp. 69, 2008.

DIEGO-GARCÍA, E.; BATISTA, C.V.F.; GARCÍA-GÓMEZ, B.I.; LUCAS, S.;


CANDIDO, D.M.; GÓMEZ-LAGUNAS, F.; POSSANI, L.D. The Brazilian scorpion Tityus
costatus Karsch: genes, peptides and function. Toxicon, 45:273-283, 2005.

84
FELSENSTEIN, J. Confidence limits on phylogenies: An approach using the
bootstrap. Evolution 39:783-791, 1985.

FET, V.; LOWE, G. Family Buthidae C. L. Koch, 1837. Pp. 54–286 in Fet, V., W.
D. Sissom, G. Lowe & M. E. Braunwalder. Catalog of the Scorpions of the World (1758–
1998). New York: The New York Entomological Society, 689 pp, 2000.

FET, V.; GANTENBEIN, B.; GROMOV, A.V.; LOWE, G.; LOURENÇO, W.R.
The first molecular phylogeny of Buthidae (Scorpiones). Euscorpius - Occasional
Publications in Scorpiology, 4:18-26, 2003.

FET, V.; SOLEGLAD, M.E. Contributions to scorpion systematics. I. On recent


changes in high-level taxonomy. Euscorpius 31:1-13, 2005.

FET, V.; GANTENBEIN, B.; KARATAS, A.; KARATAS, A. An extremely low


genetic divergence across the range of Euscorpius italicus (Scorpiones,
Euscorpiidae). Journal of Arachnology, 34(1):248-253, 2006.

FET, V.; GANTENBEIN, B.; GROMOV, A.; LOWE, G.; LOURENÇO, W.R.
The first molecular phylogeny of Buthidae (Scorpiones). Euscorpius, 2003(4): 1-10, 2013.

FLÓREZ, E.; MATTONI, C.I. Los escorpiones del género Chactopsis:


euscórpiidos o chactidos? Darwiniana 45 (supl.):83-95, 2007.

GANTENBEIN, B.; FET, V.; LARGIADÈR, C.R.; SCHOLL, A. First DNA


phylogeny of Euscorpius Thorell, 1876 (Scorpiones, Euscorpiidae) and its bearing on
taxonomy and biogeography of this genus. Biogeographica, 75(2):49-65, 1999.

GANTENBEIN, B.; FET, V.; BARKER, M.; SCHOLL, A. Nuclear and


mitochondrial markers reveal the existence of two parapatric scorpion species in the Alps:
Euscorpius germanus (CL Koch, 1837) and E. alpha Caporiacco, 1950, stat.
nov.(Euscorpiidae). Revue suisse de Zoologie,107(4), 843-870, 2000.

85
GANTENBEIN, B.; FET, V.; BARKER, M.D. Mitochondrial DNA markers
reveal a deep, divergent phylogeny in Centruroides exilicauda (Wood) (Scorpiones:
Buthidae). British Arachnological Society, 235-244, 2001.

GONZÁLEZ-SPONGA, M.A. Guía para identificar escorpiones de Venezuela.


Caracas: Cuadernos Lagoven, 1996.

GUERRERO-VARGAS, J. A.; MOURÃO, C.B.F.; QUINTERO-HERNÁNDEZ,


V.; POSSANI, L.D.; SCHWARTZ, E.F. Identification and phylogenetic analysis of tityus
pachyurus and tityus obscurus novel putative na+ channeel Scorpion toxins. Plos One,
7(2):14-23, 2012.

HAJIBABAEI, M.; JANZEN, D.H.; BURNS, J.M.; HALLWACHS, W.;


HEBERT, P.D. DNA barcodes distinguish species of tropical Lepidoptera. Proceedings of
the National Academy of Sciences of the United States of America, 103(4):968-971, 2006.

HALL, T.A. BioEdit: a user-friendly biological sequence alignment editor and


analysis program. Nucl. Acids. Symp. Ser., 41:95-98, 1999.

HEBERT, P.D.N.; CYWINSKA, A.; BALL, S.L.; deWAARD, J.R. Biological


Identifications Through DNA Barcodes. Proc Royal Soc Lond B, 270:313-322, 2003.

HEBERT, P.D.N.; STOECKLE, M.Y.; ZEMLAK, T.S.; FRANCIS, C.M.


Identification of Birds through DNA barcodes. PlosS Biol, 2:1657-1663, 2004.

HEBERT, P.D.; LANDRY, J.F. DNA barcodes for 1/1000 of the animal
kingdom. Biology letters, rsbl20090848, 2009.

JARRETA, María Begoña Martínez. La prueba del ADN en medicina forense: la


genética al servicio de la ley en el análisis de indicios criminales y en la investigación
biológica de la paternidad. Masson, 1999.

LOURENÇO, W.R. Contribution á la connaissance du scorpion amazonien Tityus


metuendus Pocock, 1897 (Buthidae). Studies on Neotropical Fauna & Environment,
18(4):185-193, 1983.
86
LOURENÇO, W.R. Diversité de la faune scorpionique de la région amazonienne;
centres d'endémisme; nouvel appui a la théorie des refuges forestiers du Pléistocène.
Amazoniana, 9(4):559-80, 1986.

LOURENÇO, W.R. Panbiogéographie, les Familles des Scorpions et Leur


Repartition Géographique. Biogeographica, 76(1):21-39, 2000.

LOURENÇO, W.R. Scorpions of Brazil. Paris-France, Les Èditions de I’If, p.


306, 2002.

LOURENÇO, W.R. The distribution of noxious species of scorpions in Brazilian


Amazonia: the genus Tityus C. L. Koch, 1836, subgenus Atreus Gervais, 1843 (Scorpiones,
Buthidae). Entomologische Mitteilungen aus dem Zoologischen Museum Hamburg,
15(185):287-301, 2011.

LOURENÇO, W.R. What do we know about some of the most conspicuous


scorpion species of the genus Tityus? A historical approach. Journal of Venomous Animals
and Toxins including Tropical Diseases, 21:1-12, 2015.

LOURENÇO, W.R.; EICKSTEDT, V.R.D. Considerações sobre a sistemática


de Tityus costatus (Karsch, 1879), provável espécie polimórfica de escorpião da Floresta
Atlântica do Brasil (Scorpiones, Buthidae). Iheringia Sér Zool, 68:3-11, 1988.

LOURENÇO, W.R.; FÉ, N.F. Description of a new species of Opisthacanthus


Peters (Scorpiones, Liochelidae) to Brazilian Amazonia. Revista Ibérica de Aracnología,
8:81-88, 2003.

LOURENÇO, W.R.; JESUS-JUNIOR, M.M.B G.; LIMEIRA, F. New species of


Tityus CL Koch, 1836 (Scorpiones, Buthidae) from the State of Maranhão in Brazil. Boletín
Sociedad Entomológica Aragonesa, 38(1), 117-120, 2006.

LOURENÇO, W.R.; GIUPPONI, A.P.L.; PEDROSO, D.R. New species of


Chactidae (Scorpiones) from the upper Rio Negro in Brazilian Amazonia. Boletín de la
Sociedad Entomológica Aragonesa, 49:65–73, 2011.

87
MARTIN-EAUCLAIRE, M.F.; CÉARD, B.; RIBEIRO, A.M.; DINIZ, C.R.;
ROCHAT, H.; BOUGIS, P.E. Molecular cloning and nucleotide sequence analysis of a cDNA
encoding the main beta-neurotoxin from the venom of the South American scorpion Tityus
serrulatus. FEBS Lett., 302(3):220-222, 1992.

MARTINS, A.P.V.; CARMO, A.O.D.; MESQUITA, F.O.; PIMENTA, R.J.G.;


CHAGAS, A.T.D.A.; KALAPOTHAKIS, E. Many unique characteristics revealed by the
complete mitochondrial genome of the scorpion Tityus serrulatus (Lutz e Mello 1922)
(Chelicerata; Arachnida). Mitochondrial DNA, 1-2, 2015.

MELLO-LEITÃO, C. Escorpiões sul-americanos. Museu Nacional, 1945.

MILLER, A.L.; MAKOWSKY, R.A.; FORMANOWICZ, D.R.; PRENDINI, L.;


COX, C.L. Cryptic genetic diversity and complex phylogeography of the boreal North
American scorpion, Paruroctonus boreus (Vaejovidae). Molecular phylogenetics and
evolution, 71:298-307, 2014.

NEI, M.; KUMAR, S. Molecular Evolution and Phylogenetics. Oxford


University Press, New York, 2000.

NWANI, C.D.; BECKER, S.; BRAID, H.E.; UDE, E. F.; OKOGWU, O. I.;
HANNER, R. DNA barcoding discriminates freshwater fishes from southeastern Nigeria and
provides river system-level phylogeographic resolution within some species. Mitochondrial
DNA, 22(1):43-51, 2011.

OCHOA, J.A.; ROJAS-RUNJAIC, F.J.; PINTO-DA-ROCHA, R.; PRENDINI, L.


Systematic revision of the neotropical scorpion genus Chactopsis Kraepelin, 1912
(Chactoidea: Chactidae), with descriptions of two new genera and four new species. Bulletin
of the American Museum of Natural History, 378(1):1-121, 2013.

PARDAL, P.P.O.; SHIKAWA, E.A.Y.; VIEIRA, J.L.F. “Contribuição ao


conhecimento do escorpionismo e do escorpião Tityus obscurus Gervais, 1843 (Scorpiones,
Buthidae) de duas regiões distintas no Estado do Pará na Amazônia brasileira." Revista Pan-
Amazônica de Saúde, 5(3):73-74, 2014.

88
PARMAKELIS, A.; STATHI, I.; SPANOS, L.; LOUIS, C.; MYLONAS, M.
Phylogeography of Iurus dufoureius (Brullé, 1832) (Scorpiones, Iuridae). Journal of
Biogeography, 33:251-260, 2006.

PARMAKELIS, A.; KOTSAKIOZ, P.; STATHI, I.; POULIKARAKOU, S.;


VICTOR, F. Hidden diversity of Euscorpius (Scorpiones: Euscorpiidae) in Greece revealed
by multilocus species-delimitation approaches. Biological Journal of the Linnean Society,
110:728-748, 2013.

POLIS, G.A. The Biology of Scorpions. Stanford University Press, pp. 414,
1990.

POLIS, G.A.; MCREYNOLDS, C.N.; FORD, G.R. Home range geometry of the
desert scorpion Paruroctonus mesaensis. Oecologia, 67:273–277, 1985.

PRENDINI, L.; CROWE, T.M.; WHEELER, W.C. Systematics and biogeography


of the family Scorpionidae (chelicerata; Scorpiones), with a discussion on phylogenetic
methods. Invertebrate Systematics, 17:185-259, 2003.

PRENDINI, L.; WHEELER, W.C. Scorpion higher phylogeny and classification,


taxonomic anarchy, and standards for peer review in online publishing. Cladistics 21(5):446-
494, 2005.

REIN, J. O. The Scorpion Files 2013. Disponível em: <


http://www.ntnu.no/ub/scorpion-files/2013>. Acesso em: 03 fev. 2014.

SAITOU, N.; NEI, M. The neighbor-joining method: A new method for


reconstructing phylogenetic trees. Molecular Biology and Evolution 4:406-425, 1987.

SALOMONE, N.; VIGNOLI, V.; FRATI, F.; BERNINI, F. Species boundaries


and phylogeography of the “Euscorpius carpathicus complex”(Scorpiones: Euscorpiidae) in
Italy. Molecular Phylogenetics and Evolution, 43(2):502-514, 2007.

SAMBROOK, J.; FRITSCH, E.F.; MANIATIS, T. Molecular cloning: a


laboratory manual. NewYork: 2ª Ed. Cold Spin Harbor Lab. Press, 1989.
89
SANGER, F.; NICHLEN, S.; COULSON, A.R. DNA sequencing with chain
termination inhitors. Proc. Natl. Acad. Sci U.S.A., 74:5463-5468, 1977.

SANTOS, F.R.; GUIMARÃES, P.E.; REDONDO, R.A. Bancos de DNA:


coleções estratégicas para estudos da biodiversidade. Lundiana, 3(1):93-98, 2002.

SILVA, E. C.; CAMARGOS, T. S.; MARANHÃO, A. Q.; SILVA-PEREIRA, I.;


SILVA, E.C.; POSSANI, L.D.; SCHWARTZ, E.F. Cloning and characterization of cDNA
sequences encoding for new venom peptides of the Brazilian scorpion Opisthacanthus
cayaporum. Toxicon, 54(3):252-61, 2009.

SOLEGLAD, M.E.; SISSOM, W.D. Phylogeny of the family Euscorpiidae


Laurie, 1896: a major revision. In V. Fet and P.A. (Selden editors), Scorpions 2001. In
memoriam Gary A. Polis, Burnham Beeches, Bucks, UK: British Arachnological Society,
6:25-111, 2001.

SOLEGLAD, M.E.; FET, V. High level systematics and phylogeny of the extant
scorpions (Scorpiones: Orthosterni). Euscorpius, 11:1-175, 2003.

STOCKMANN, R.; YTHIER, E. Scorpions of the World. Wear Virginia: N.A.P


Edition: 565 pp, 2010.

STOCKWELL, S.A. Revision of the phylogeny and higher classification of


scorpions (Chelicerata). Tese de Doutorado, University of California, Berkeley, pp. 413,
1989.

TAMURA, K.; NEI, M. Estimation of the number of nucleotide substitutions in


the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology
and Evolution, 10:512-526, 1993.

TAMURA, K.; STECHER, G.; PETERSON, D.; FILIPSKI, A.; KUMAR, S.


MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and
Evolution, 30:2725-2729, 2013.

90
TERUEL, R.; FET, V.; GRAHAM, M.R. The first mitochondrial DNA Phylogeny
of Cuban Buthidae (Scorpiones: Buthoidea). Boletin Sociedad Entomológica Aragonesa,
39:219-226, 2006.

TOGAWA, R.C.; BRÍGIDO, M.M. PHPH: Web based tool for simple
electropherogram quality analysis. In 1 st International Conference on Bioinformatics and
Computational Biology-IcoBiCoBi. RibeirãoPreto, 2003.

TROPEA, G.; FET, V.; PARMAKELIS, A.; KOTSAKIOZI, P.; STATHI, I. A


new species of Euscorpius from Bulgaria and Greece (Scorpiones: Euscorpiidae). Euscorpius,
207:1-15, 2015.

VACHON, M. Etude des caractères utilisés pour classer les familles et les genres
de Scorpions (Arachnides). 1. La trichobothriotaxie en arachnologie. Sigles trichobothriaux et
types de trichobothriotaxie chez les Scorpions. Bulletin du Muséum national d’Histoire
naturelle, 3:857-958, 1974.

VENCES, M.; THOMAS, M.; MEIJDEN, A.V.D.; CHIARI, Y.; VIEITES, D.R.
Comparative Performace of the 16S rRNA gene in DNA Barcoding of Amphibians.
Frontiers in Zoology, 2:5-17, 2005.

WARD, R.D.; ZEMLAK, T.S.; INNES, B.H.; LAST, P.R.; HEBERT, P.D. DNA
barcoding Australia's fish species. Philosophical Transactions of the Royal Society B:
Biological Sciences, 360(1462):1847-1857, 2005.

WARRIOR, R.; GALL, J. The Mitochondrial DNA of Hidra attenuata and Hydra
littoralis consists of two linear Molecules. Arch. Sc. Geneve, 3:439-45, 1985.

YAMAGUTI, H.Y. Análise filogenética e biogeográfica do gênero Rhopalurus


Thorell, 1876 (Arachnida: Scorpiones: Buthidae) (Doctoral dissertation, Universidade de
São Paulo), 2011.

91
APÊNDICE I

16 8

Figura 1 - Mapa de distribuição das espécies escorpiônicas com registros para o Estado do
Amazonas

92
Apêndice II – Apresentação do alinhamento e das sequências geradas no programa
BioEdit.

....|....| ....|....| ....|....| ....|....| ....|....|


10 20 30 40 50
A dekeyser GCTGCACCAT CGGGATGTCC TGATCCAACA TCGAGGTCGT AAACCCTATT
A dekeyser GCTGCACCAT CGGGATGTCC TGATCCAACA TCGAGGTCGT AAACCCTATT
A dekeyser GCTGCACCAT CGGGATGTCC TGATCCAACA TCGAGGTCGT AAACCCTATT
A dekeyser GCTGCACCAT CGGGATGTCC TGATCCAACA TCGAGGTCGT AAACCCTATT
A dekeyser GCTGCACCAT CGGGATGTCC TGATCCAACA TCGAGGTCGT AAACCCTATT
A dekeyser GCTGCACCAT CGGGATGTCC TGATCCAACA TCGAGGTCGT AAACCCTATT
A dekeyser GCTGCACCAT CGGGATGTCC TGATCCAACA TCGAGGTCGT AAACCCTATT
T dinizi T TTTGCAGAAA ATAGACTTTG TAATCCAACA TCGAGGTCGC AATTACGCTT
T dinizi T TTTGCAGAAA ATAGACTTTG TAATCCAACA TCGAGGTCGC AATTACGCTT
T dinizi T TTTGCAGAAA ATAGACTTTG TAATCCAACA TCGAGGTCGC AATTACGCTT
T dinizi T TTTGCAGAAG ATAGACTTTG TAATCCAACA TCGAGGTCGC AATTACGCTT
T dinizi T TTTGCAGAAA ATAGACTTTG TAATCCAACA TCGAGGTCGC AATTACGCTT
T dinizi T TTTGCAGAAA ATAGACTTTG TAATCCAACA TCGAGGTCGC AATTACGCTT
T dinizi T TTTGCAGAAA ATAGACTTTG TAATCCAACA TCGAGGTCGC AATTACGCTT
T matthies TCTGCAGAAA ATAGATTTTG TAATCCAACA TCGAGGTCGC AATTACACCT
T matthies TCTGCGGCAA ATGGATTTTG TAATCCAACA TCGAGGTCGC AATTACACCT
T matthies TCTGCGGAAA AAAGATTTTG TAATCCAACA TCGAGGTCGC AATTACACCT
T matthies TCTGCAGAAA ATAGATTTTG TAATCCAACA TCGAGGTCGC AATTACATCT
T matthies TCTGCAGAAA ATAGATTTTG TAATCCAACA TCGAGGTCGC AATTACATCT
T matthies TCTGCAGAAA ATAGATTTTG TAATCCAACA TCGAGGTCGC AATTACATCT
T matthies TCTGCAGAAA ATAGATTTTG TAATCCAACA TCGAGGTCGC AATTACATCT
T metuendu TCTGCAGAAA ATAGATTTTG TATTCCAACA TCGAGGTCGC AATCTCCCCT
T metuendu TCTGCAGAAA ATAGATTTTG TATTCCAACA TCGAGGTCGC AATCTCCCCT
T metuendu TCTGCAGAAA ATAGATTTTG TAATCCAACA TCGAGGTCGC AATCTCACCT
T metuendu TCTGCAGAAA ATAGATTTTG TAATCCAACA TCGAGGTCGC AATCTCACCT
T metuendu TCTGCAGAAA ATAGATTTTG TAATCCAACA TCGAGGTCGC AATCTCACCT
T metuendu TTTGCAGAAA ATAGACTTTG TAATCCAACA TCGAGGTCGC AATTACGCTT
T metuendu TCTGCAGAAA ATAGATTTTG TAATCCAACA TCGAGGTCGC AATCTCACCT
T metuendu TTTGCAGAAA ATAGACTTTG TAATCCAACA TCGAGGTCGC AATTACGCTT
T silvestr TTTGCATAAA GAAGGGAGAT TAATCCAACA TCGAGGTCGT AAGCATTTCT
T silvestr TTTGCATAAA GAAGGGAGAT TAATCCAACA TCGAGGTCGT AAGCATTTCT
T silvestr TTTGCATAAA GAAGGGAGAT TAATCCAACA TCGAGGTCGT AAGCATTTCT
T strandi TAAGAGGAAA AATGGAACTT TAATCCAACA TCGAGGTCAC TTGTTTATTT
T strandi TTTGCGGAAA AATGAAACTT TAATCCAACA TCGAGGTCAC TTGTTTATTT
T strandi TTCCTGAACG GTGGAAACTT TAATCCAACA TCGAGGTCAC TTGTTTATTT
T strandi TTTCTGCACC GTCGAAACTT TAATCCAACA TCGAGGTCAC TTGTTTATTT
T strandi TTCCTGAACG GTGGAAACTT TAATCCAACA TCGAGGTCAC TTGTTTATTT
B amazonic ACTGCGCCAA TTAGGAATCT TAATCCAACA TCGAGGTCAC AAACTTTTTT
B amazonic ACTGCGCCAA TTAGGAATCT TAATCCAACA TCGAGGTCAC AAACTTTTTT
B amazonic ACTGCGCCAA TTAGGAATCT TAATCCAACA TCGAGGTCAC AAACTTTTTT
B amazonic ACTGCGCCAA TTAGGAATCT TAATCCAACA TCGAGGTCAC AAACTTTTTT
B amazonic ACTGCGCCAA TTAGGAATCT TAATCCAACA TCGAGGTCAC AAACTTTTTT
B amazonic ACTGCGCCAA TTAGGAATCT TAATCCAACA TCGAGGTCAC AAACTTTTTT
B amazonic ACTGCGCCAA TTAGGAATCT TAATCCAACA TCGAGGTCAC AAACTTTTTT
B polisi P TACAAATAAA TTT--AATTT TAATCCAACA TCGAGGTCAT AAACTTTTTT
B polisi M TACATATAAA TTT--AATTT TAATCCAACA TCGAGGTCAT AAACTTTTTT
B polisi P TACATATAAA TTT--AATTT TAATCCAACA TCGAGGTCAT AAACTTTTTT
B polisi M TACATATAAA TTT--AATTT TAATCCAACA TCGAGGTCAT AAAATTTTTT
B polisi M TACATATAAA TTT--AATTT TAATCCAACA TCGAGGTCAT AAACTTTTTT
C amazonic GCTGCACAAA TTAGGATTCT TAATCCAACA TCGAGGTCAC AAACTTTTTT
C Amazonic GCTGCACAAA TTAGGATTCT TAATCCAACA TCGAGGTCAC AAACTTTTTT
C amazonic GCTGCACAAA TTAGGATTCT TAATCCAACA TCGAGGTCAC AAACTTTTTT

93
....|....| ....|....| ....|....| ....|....| ....|....|
60 70 80 90 100
A dekeyser GTTGATATGG ACTCTAGAAT AGGATTGCGC TGTTATCCCT AGGGTAACTT
A dekeyser GTTGATATGG ACTCTAGAAT AGGATTGCGC TGTTATCCCT AGGGTAACTT
A dekeyser GTTGATATGG ACTCTAGAAT AGGATTGCGC TGTTATCCCT AGGGTAACTT
A dekeyser GTTGATATGG ACTCTAGAAT AGGATTGCGC TGTTATCCCT AGGGTAACTT
A dekeyser GTTGATATGG ACTCTAGAAT AGGATTGCGC TGTTATCCCT AGGGTAACTT
A dekeyser GTTGATATGG ACTCTAGAAT AGGATTGCGC TGTTATCCCT AGGGTAACTT
A dekeyser GTTGATATGG ACTCTAGAAT AGGATTGCGC TGTTATCCCT AGGGTAACTT
T dinizi T TTCGATTAGA TCTCTATAAG TGTATAACGC TGTTATCCCT AAAGTAGCTT
T dinizi T TTCGATTAGA TCTCTATAAG TGTATAACGC TGTTATCCCT AAAGTAGCTT
T dinizi T TTCGATTAGA TCTCTATAAG TGTATAACGC TGTTATCCCT AAAGTAGCTT
T dinizi T TTCGATTAGA TCTCTATAAG TGTATAACGC TGTTATCCCT AAAGTAGCTT
T dinizi T TTCGATTAGA TCTCTATAAG TGTATAACGC TGTTATCCCT AAAGTAGCTT
T dinizi T TTCGATTAGA TCTCTATAAG TGTATAACGC TGTTATCCCT AAAGTAGCTT
T dinizi T TTCGATTAGA TCTCTATAAG TGTATAACGC TGTTATCCCT AAAGTAGCTT
T matthies GTCGATTAGG TCTCTGTAGG TGTATAACGC TGTTTTCCCT AAAGTAGCTT
T matthies GTCGATTAGG TCTCTGTAGG TGTATAACGC TGTTTTCCCT AAAGT.GCTT
T matthies GTCGATTAGG TCTCTGTGGA TGTATAACGC TGTTTTCCCT AAAGTAGCTT
T matthies GGCGATTAGG TCTCTGTAGA TGTATAACGC TGTTATCCCT AAAGTAGCTT
T matthies GGCGATTAGG TCTCTGTAGA TGTATAACGC TGTTATCCCT AAAGTAGCTT
T matthies GGCGATTAGG TCTCTGTAGA TGTATAACGC TGTTATCCCT AAAGTAGCTT
T matthies GGCGATTAGG TCTCTGTAGA TGTATAACGC TGTTATCCCT AAAGTAGCTT
T metuendu GTCGATTAGG TCTCTATAGG TGTATAACGC TGTTATCCCT AAAGTAGCTT
T metuendu GTCGATTAGG TCTCTATAGG TGTATAACGC TGTTATCCCT AAAGTAGCTT
T metuendu GTCGATTAGG TCTCTATGAG TTTATAACGC TGTTATCCCT AAAGTAGCTT
T metuendu GTCGATTAGG TCTCTATAGG TGTATAACGC TGTTATCCCT AAAGTAGCTT
T metuendu GTCGATTAGG TCTCTATAGG TGTATAACGC TGTTATCCCT AAAGTAGCTT
T metuendu GTCGATTAGA TCTCTATAAG TGTATAACGC TGTTATCCCT AAAGTAGCTT
T metuendu GTCGATTAGG TCTCTATAGG TGTATAACGC TGTTATCCCT AAAGTAGCTT
T metuendu GTCGATTAGA TCTCTATAAG TGTATAACGC TGTTATCCCT AAAGTAGCTT
T silvestr GTCAATAAGA TCTCTTTAGA AAGATTACGC TGTTATCCCT AAAGTATCTT
T silvestr GTCAATAAGA TCTCTTTAGA AAGATTACGC TGTTATCCCT AAAGTATCTT
T silvestr GTCAATAAGA TCTCTTTAGA AAGATTACGC TGTTATCCCT AAAGTATCTT
T strandi ATTAATTAGA TTTTTCAAAA TAGAAGGTGC TGTTATCCCT CCAGTATTTT
T strandi ATTAATTAGA TCTTTCAAAA TAGAAGGTGC TGTTATCCCT CCAGTATTTT
T strandi ATTAATTAGA TCTTTCAAAA TAGAAGGTGC TGTTATCCTT CCAGTATTTT
T strandi ATTAATTAGA TCTTTCAAAA TAGAAGGTGC TGTTATCCTT CCAGTATTTT
T strandi ATTAATTAGA TCTTTCAAAA TAGAAGGTGC TGTTATCCTT CCAGTATTTT
B amazonic GTTGATAAGA ACTCTTTAAA AAAATTATGC TGTTATCCCT ACAGTAACTT
B amazonic GTTGATAAGA ACTCTTTAAA AAAATTATGC TGTTATCCCT ACAGTAACTT
B amazonic GTTGATAAGA ACTCTTTAAA AAAATTATGC TGTTATCCCT ACAGTAACTT
B amazonic GTTGATAAGA ACTCTTTAAA AAAATTATGC TGTTATCCCT ACAGTAACTT
B amazonic GTTGATAAGA ACTCTTTAAA AAAATTATGC TGTTATCCCT ACAGTAACTT
B amazonic GTTGATAAGA ACTCTTTAAA AAAATTATGC TGTTATCCCT ACAGTAACTT
B amazonic GTTGATAAGA ACTCTTTAAA AAAATTATGC TGTTATCCCT ACAGTAACTT
B polisi P AAAAATAAGG ACTTAATAAA AAAATTATGC TGTTATCCCT AGGGTAATTT
B polisi M AAAAATAAGA ACTTAATAAA AAAATTATGC TGTTATCCCT AAGGTAATTT
B polisi P AAAAATAAGA ACTTAATAAA AAAATTATGC TGTTATCCCT AAGGTAATTT
B polisi M GAAAATAAGA ACTTAATAAA AAAATTATGC TGTTATCCCT AAGGTAAATA
B polisi M AAAAATAAGA ACTTAATAAA AAAATTATGC TGTTATCCCT AAGGTAATTT
C amazonic GATGATAAGA ACTCTTAAAA AAAATTATGC TGTTATCCCT ACAGTAACTT
C Amazonic GATGATAAGA ACTCTTAAAA AAAATTATGC TGTTATCCCT ACAGTAACTT
C amazonic GATGATAAGA ACTCTTAAAA AAAATTATGC TGTTATCCCT ACAGTAACTT

....|....| ....|....| ....|....| ....|....| ....|....|


110 120 130 140 150
A dekeyser GTTCCGTTGG TCAAGTTATT GGATCAATTG AGTATGGTAG TTCGCTTTGA
A dekeyser GTTCCGTTGG TCAAGTTATT GGATCAATTG AGTATGGTAG TTCGCTTTGA
A dekeyser GTTCCGTTGG TCAAGTTATT GGATCAATTG AGTATGGTAG TTCGCTTTGA
A dekeyser GTTCCGTTGG TCAAGTTATT GGATCAATTG AGTATGGTAG TTCGCTTTGA
A dekeyser GTTCCGTTGG TCAAGTTATT GGATCAATTG AGTATGGTAG TTCGCTTTGA

94
A dekeyser GTTCCGTTGG TCAAGTTATT GGATCAATTG AGTATGGTAG TTCGCTTTGA
A dekeyser GTTCCGTTGG TCAAGTTATT GGATCAATTG AGTATGGTAG TTCGCTTTGA
T dinizi T A--------T TTAATTTTTA GAATTTCTAG GT-ATGTTAA TA----ATGA
T dinizi T A--------T TTAATTTTTA GAATTTCTAG GT-ATGTTAA TA----ATGA
T dinizi T A--------T TTAATTTTTG GAATTTCTAG GT-ATGTTAA TA----ATGA
T dinizi T A--------T TTAATTTTTG GAATTTCTAG GT-ATGTTAA TA----ATGA
T dinizi T A--------T TTAATTTTTA GAATTTCTAG GT-ATGTTAA TA----ATGA
T dinizi T A--------T TTAATTTTTA GAATTTCTAG GT-ATGTTAA TA----ATGA
T dinizi T A--------T TTAATTTTTA GGATTTCTAG GT-ATGGTAA TA----ATGA
T matthies G--------T TTAATTTTTA GAATTTCTAG GT-ATTTAAA TT----ATGA
T matthies G--------T TTAATTTTTA GAATTTCTAG GT-ATTTAAA TT----GTGA
T matthies G--------T TTAATTTTTA GAATTTCTAG GT-ATTTAAA TT----ATGA
T matthies A--------T TTAATTTTTA GAATTTCTAG GT-ATTTAAA TT----ATGA
T matthies A--------T TTAATTTTTA GAATTTCTAG GT-ATTTAAA TT----ATGA
T matthies A--------T TTAATTTTTA GAATTTCTAG GT-ATTTAAA TT----ATGA
T matthies A--------T TTAATTTTTA GAATTTCTAG GT-ATTTAAA TT----ATGA
T metuendu A--------T TTAATTTTTA GAATTTCTAG GT-ATTTTAA TT----ATGA
T metuendu A--------T TTAATTTTTA GAATTTCTAG GT-ATTTTAA TT----ATGA
T metuendu G--------T TTAATTTTTA GAATTTCTAG GT-ATTTTAA TT----ATAA
T metuendu G--------T TTAATTTTTA GAATTTCTAG GT-ATTTTAA TT----ATGA
T metuendu A--------T TTAATTTTTA GAATTTCTAG GT-ATTTTAA TT----ATGA
T metuendu A--------T TTAATTTTTA GAATTTCTAG GT-ATGTTAA TA----ATGA
T metuendu G--------T TTAATTTTTA GAATTTCTAG GT-ATTTTAA TT----ATGA
T metuendu A--------T TTAATTTTTA GAATTTCTAG GT-ATGTTAA TA----ATGA
T silvestr T--------A TTAATTTTTA GAATTTCTAG GT-ATT---G TA----ATAT
T silvestr T--------A TTAATTTTTA GAATTTCTAG GT-ATT---G TA----ATAT
T silvestr T--------A TTAATTTTTA GAATTTCTAG GT-ATT---G TA----ATAT
T strandi A--------G TTAAATTTTA GAATTTCTAG GT-ATATTAA AT----ATAA
T strandi A--------G TTAAATTTTA GAATTTCTAG GT-ATATTAA AT----ATAA
T strandi A--------G TTAAATTTTA GAATTTCTAG GT-ATATTAA AT----ATAA
T strandi A--------G TTAAATTTTA GAATTTCTAG GT-ATATTAA AT----ATAA
T strandi A--------G TTAAATTTTA GAATTTCTAG GT-ATATTAA AT----ATAA
B amazonic A--------T TTCTATTTTA AAAATTTTAG ATTCTTCAAG AT----TAGT
B amazonic A--------T TTCTATTTTA AAAATTTTAG ATTCTTCAAG AT----TAGT
B amazonic A--------T TTCTATTTTA AAAATTTTAG ATTCTTCAAG AT----TAGT
B amazonic A--------T TTCTATTTTA AAAATTTTAG ATTCTTCAAG AT----TAGT
B amazonic A--------T TTCTATTTTA AAAATTTTAG ATTCTTCAAG AT----TAGT
B amazonic A--------T TTCTATTTTA AAAATTTTAG ATTTTTCAAG AT----TAGT
B amazonic A--------T TTCTATTTTA AAAATTTTAG ATTTTTCAAG AT----TAGT
B polisi P AA------AT TTTTAATCTA TAA-TAAAAG ATCAAATAAA CA----AAAA
B polisi M AA------AT TTTTAATCTA TAA-TAAAAG ATCAAATAAA CA----AAAA
B polisi P AA------AT TTTTAATCTA TAA-TAAAAG ATCAAATAAA CA----AAAA
B polisi M AA------AT TTTTAATCTA TAA-TAAAAG ATCAAATAAA CA----AAAA
B polisi M AA------AT TTTTAATCTA TAA-TAAAAG ATCAAATAAA CA----AAAA
C amazonic A--------T TTTTACTTAA GAATTTCTTG ATTTTACTAG AT----AAAT
C Amazonic A--------T TTTTACTTAA GAATTTCTTG ATTTTACTAG AT----AAAT
C amazonic A--------T TTTTACTTAA GAATTTCTTG ATTTTACTAG AT----AAAT

....|....| ....|....| ....|....| ....|....| ....|....|


160 170 180 190 200
A dekeyser CTGGTGAAGT CTTAGCATGT ACTGCTCGGA GGTTGGGTTC TGCTCCGAGG
A dekeyser CTGGTGAAGT CTTAGCATGT ACTGCTCGGA GGTTGGGTTC TGCTCCGAGG
A dekeyser CTGGTGAAGT CTTAGCATGT ACTGCTCGGA GGTTGGGTTC TGCTCCGAGG
A dekeyser CTGGTGAAGT CTTAGCATGT ACTGCTCGGA GGTTGGGTTC TGCTCCGAGG
A dekeyser CTGGTGAAGT CTTAGCATGT ACTGCTCGGA GGTTGGGTTC TGCTCCGAGG
A dekeyser CTGGTGAAGT CTTAGCATGT ACTGCTCGGA GGTTGGGTTC TGCTCCGAGG
A dekeyser CTGGTGAAGT CTTAGCATGT ACTGCTCGGA GGTTGGGTTC TGCTCCGAGG
T dinizi T TTA--AAATT ATTTAAT--- --------AG TGTT----AG TACTTT-TTG
T dinizi T TTA--AAATT ATTTAAT--- --------AG TGTT----AG TACTTT-TTG
T dinizi T TTA--AAATT ATTTAAT--- --------AG TGTT----AG TACTTT-TTG
T dinizi T TTA--AAATT ATTTAAT--- --------AG TGTT----AG TACTTT-TTG
T dinizi T TTA--AAATT ATTTAAT--- --------AG TGTT----AG TACTTT-TTG

95
T dinizi T TTA--AAATT ATTTAAT--- --------AG TGTT----AG TACTTT-TTG
T dinizi T TTA--AAATT ATTTAAT--- --------AG TGTT----AG TACTTT-TTG
T matthies TTA--GGATT TTCTAAA--- --------AG TGTT----GG AATTCT-TTG
T matthies TTA--GGATT TTCTAAA--- --------AA TGTT----GG AATTCT-TTG
T matthies TTA--GAATT TTCTAAA--- --------AA TGTT----GA AATTCT-TTG
T matthies TTA--GGATT TTCTAAG--- --------AA TGTT----GG AATTCT-TTG
T matthies TTA--GGATT TTCTAAG--- --------AA TGTT----GG AATTCT-TTG
T matthies TTA--GGATT TTCTAAG--- --------AA TGTT----GG AATTCT-TTG
T matthies TTA--GGATT TTCTAAG--- --------AA TGTT----GG AATTCT-TTG
T metuendu TTA--GGATT TTCTAAG--- --------AA TGTT----AG GATTCT-TTG
T metuendu TTA--GGATT TTCTAAG--- --------AA TGTT----AG GATTCT-TTG
T metuendu TTA--GGATT TTTTAAG--- --------AA TGTT----GG AATTTT-TTG
T metuendu TTA--GGATT TTCTAAG--- --------AA TGTT----AG GATTCT-TTG
T metuendu TTA--GGATT TTTTAAG--- --------AA TGTT----AG GATTCT-TTG
T metuendu TTA--AAATT ATTTAAT--- --------AG TGTT----AG TACTTT-CTG
T metuendu TTA--GGATT TTCTAAG--- --------AA TGTT----AG GATTCT-TTG
T metuendu TTA--AAATT ATTTAAT--- --------AG TGTT----AG TACTTT-CTG
T silvestr TTA--TAATT ATTTGAA--- --------AG TGTT----TA T-TTTT-TTG
T silvestr TTA--TAATT ATTTGAA--- --------AG TGTT----TA T-TTTT-TTG
T silvestr TTA--TAATT ATTTGAA--- --------AG TGTT----TA T-TTTT-TTG
T strandi T---TAAAAT TTTTAGA--- --------AA CATT----T- TCTTTC-TAG
T strandi T---TAAAAT ATTTAAA--- --------AA CTTT----T- TCTTTC-TAG
T strandi TTGTTAAAAT TTTTAAA--- --------AA CCTT----T- TCTTTC-TAG
T strandi TAAATAAAAT GTTTAAA--- --------AA CGTT----T- TCTTTC-TAG
T strandi TTGTTAAAAT TTTTAAA--- --------AA CCTT----T- TCTTTC-TAG
B amazonic TTATCATATT ATACCAAT-- --------AA AATT----TT CTTTAT-TTA
B amazonic TTATCATATT ATACCAAT-- --------AA AATT----TT CTTTAT-TTA
B amazonic TTATCATATT ATACCAAT-- --------AA AATT----TT CTTTAT-TTA
B amazonic TTATCATATT ATACCAAT-- --------AA AATT----TT CTTTAT-TTA
B amazonic TTATCATATT ATACCAAT-- --------AA AATT----TT CTTTAT-TTA
B amazonic TTATCATATT ATACCAAT-- --------AA AATT----TT CTTTAT-TTA
B amazonic TTATCATATT ATACCAAT-- --------AA AATT----TT CTTTAT-TTA
B polisi P TTATTG-ATT AAATAATT-- --------AA AGTTTAAAAA ATTTAA-ATA
B polisi M TTATTG-ATT AAATAATT-- --------AA AGTTTAAAAA ATTTAA-ATA
B polisi P TTATTG-ATT AAATAATT-- --------AA AGTTTAAAAA ATTTAA-ATA
B polisi M TTATTG-ATT AAATAATT-- --------AA AGTTTAAAAA ATTTAA-ATA
B polisi M TTATTG-ATT AAATAATT-- --------AA AGTTTAAAAA ATTTAA-ATA
C amazonic TTACCACACT GTAAAAAT-- --------AA AATTAATTTA ATTTAT-TTA
C Amazonic TTACCACACT GTAAAAAT-- --------AA AATTAATTTA ATTTAT-TTA
C amazonic TTACCACACT GTAAAAAT-- --------AA AATTAATTTA ATTTAT-TTA

....|....| ....|....| ....|....| ....|....| ....|....|


210 220 230 240 250
A dekeyser TCGCCCCAAC CGAAATTTTT AATGCAGGTT TGGTAGT--T TAGGACCTGT
A dekeyser TCGCCCCAAC CGAAATTTTT AATGCAGGTT TGGTAGT--T TAGGACCTGT
A dekeyser TCGCCCCAAC CGAAATTTTT AATGCAGGTT TGGTAGT--T TAGGACCTGT
A dekeyser TCGCCCCAAC CGAAATTTTT AATGCAGGTT TGGTAGT--T TAGGACCTGT
A dekeyser TCGCCCCAAC CGAAATTTTT AATGCAGGTT TGGTAGT--T TAGGACCTGT
A dekeyser TCGCCCCAAC CGAAATTTTT AATGCAGGTT TGGTAGT--T TAGGACCTGT
A dekeyser TCGCCCCAAC CGAAATTTTT AATGCAGGTT TGGTAGT--T TAGGACCTGT
T dinizi T CCACCCCAGC CGAACATAA- ---------- ---------- ----------
T dinizi T CCACCCCAGC CGAACATAA- ---------- ---------- ----------
T dinizi T CCACCCCAGC CGAACATAA- ---------- ---------- ----------
T dinizi T CCACCCCGGC CGAACATAA- ---------- ---------- ----------
T dinizi T CCACCCCAGC CGAACATAA- ---------- ---------- ----------
T dinizi T CCACCCCAGC CGAACATAA- ---------- ---------- ----------
T dinizi T CCACCCCAGC CGAACATAA- ---------- ---------- ----------
T matthies CCGCCCCAGC TGAACACAA- ---------- ---------- ----------
T matthies CCGCCCCAGC TGAACACAA- ---------- ---------- ----------
T matthies CCGCCCCAGC TGAACACAA- ---------- ---------- ----------
T matthies CCGCCCCAGC TGAACACAA- ---------- ---------- ----------
T matthies CCGCCCCAGC TGAACACAA- ---------- ---------- ----------

96
T matthies CCGCCCCAGC TGAACACAA- ---------- ---------- ----------
T matthies CCGCCCCAGC TGAACACAA- ---------- ---------- ----------
T metuendu CCGCCCCAGC TGAACACAA- ---------- ---------- ----------
T metuendu CCGCCCCAGC TGAACACAA- ---------- ---------- ----------
T metuendu CCGCCCCAGC TGAACACAA- ---------- ---------- ----------
T metuendu CCGCCCCAGC TGAACACAA- ---------- ---------- ----------
T metuendu CCGCCCCAGC TGAACACAA- ---------- ---------- ----------
T metuendu CCACCCCAGC CGAACATAA- ---------- ---------- ----------
T metuendu CCGCCCCACC TGAACACAA- ---------- ---------- ----------
T metuendu CCACCCCAGC CGAACATAA- ---------- ---------- ----------
T silvestr CCGCCCCAGC TGAACATGA- ---------- ---------- ----------
T silvestr CCGCCCCAGC TGAACATGA- ---------- ---------- ----------
T silvestr CCGCCCCAGC TGAACATGA- ---------- ---------- ----------
T strandi CTGCCCCAGC AGAACATTA- ---------- ---------- ----------
T strandi GTGCCCCAGC AGAACATTA- ---------- ---------- ----------
T strandi GTGCCCCAGC AGAACATTA- ---------- ---------- ----------
T strandi GTGCCCCAGC AGAACATTA- ---------- ---------- ----------
T strandi GTGCCCCAGC AGAACATTA- ---------- ---------- ----------
B amazonic CTGCCCCAGT TAAATAATT- ---------- ---------T TTTAT----T
B amazonic CTGCCCCAGT TAAATAATT- ---------- ---------T TTTAT----T
B amazonic CTGCCCCAGT TAAATAATT- ---------- ---------T TTTAT----T
B amazonic CTGCCCCAGT TAAATAATT- ---------- ---------T TTTAT----T
B amazonic CTGCCCCAGT TAAATAATT- ---------- ---------T TTTAT----T
B amazonic CTGCCCCAGT TAAATAATT- ---------- ---------T TTTAT----T
B amazonic CTGCCCCAGT TAAATAATT- ---------- ---------T TTTAT----T
B polisi P TCTCCCCAAT AAAATAATTA TA-------- ---------T TTTAAAAAAT
B polisi M TCTCCCCAAT AAAATAATTA TA-------- ---------T TTTAAAAAAT
B polisi P TCTCCCCAAT AAAATAATTA TA-------- ---------T TTTAAAAAAT
B polisi M TCTCCCCAAT AAAATAATTA TA-------- ---------T TTTAAAAAAT
B polisi M TCTCCCCAAT AAAATAATTA TA-------- ---------T TTTAAAAAAT
C amazonic CTGCCCCAGT CAAATAATT- ---------- ---------T TTCAT----T
C Amazonic CTGCCCCAGT CAAATAATT- ---------- ---------T TTCAT----T
C amazonic CTGCCCCAGT CAAATAATT- ---------- ---------T TTCAT----T

....|....| ....|....| ....|....| ....|....| ....|....|


260 270 280 290 300
A dekeyser GGGTTTGTTA GGTATTGTTT GCATTAATAA AT--TAAAGC TCCATAGGGT
A dekeyser GGGTTTGTTA GGTATTGTTT GCATTAATAA AT--TAAAGC TCCATAGGGT
A dekeyser GGGTTTGTTA GGTATTGTTT GCATTAATAA AT--TAAAGC TCCATAGGGT
A dekeyser GGGTTTGTTA GGTATTGTTT GCATTAATAA AT--TAAAGC TCCATAGGGT
A dekeyser GGGTTTGTTA GGTATTGTTT GCATTAATAA AT--TAAAGC TCCATAGGGT
A dekeyser GGGTTTGTTA GGTATTGTTT GCATTAATAA AT--TAAAGC TCCATAGGGT
A dekeyser GGGTTTGTTA GGTATTGTTT GCATTAATAA AT--TAAAGC TCCATAGGGT
T dinizi T -TATTTATAG TTGACATATA GTTATGTAAA G--------T TTTATAGGGT
T dinizi T -TATTTATAG TTGACATATA GTTATGTAAA G--------T TTTATAGGGT
T dinizi T -TATTTATAG TTGACATATA GTTATGTAAA G--------T TTTATAGGGT
T dinizi T -TATTTATAG TTGACATATA GTTGTGTAAA G--------T TTTATAGGGT
T dinizi T -TATTTATAG TTGACATATA GTTATGTAAA G--------T TTTATAGGGT
T dinizi T -TATTTATAG TTGACATATA GTTATGTAAA G--------T TTTATAGGGT
T dinizi T -TATTTATAG TTGACATATA GTTATGTAAA G--------T TTTATAGGGT
T matthies -GGTTTATGT AGTGGATATG GTTGTGTAAA G--------T TTTATAGGGT
T matthies -GGTTTATGT AATGGATATG GTTGTGTAAA G--------T TTTATAGGGT
T matthies -GGTTTATAT AATGGATATG GTTGTGTAAG G--------T TTTATAGGGT
T matthies -GGTTTATAT AATAGATATG GTTGTGTAAA G--------T TTTATAGGGT
T matthies -GGTTTATAT AATAGATATG GTTGTGTAAA G--------T TTTATAGGGT
T matthies -GGTTTATGT AATAGATATG GTTGTGTAAA G--------T TTTATAGGGT
T matthies -GGTTTATAT AATAGATATG GTTGTGTAAA G--------T TTTATAGGGT
T metuendu -GGTTTATGT GGTGAATATA GTTGTGTAAA G--------T TTTATAGGGT
T metuendu -GGTTTATGT GGTGAATATA GTTGTGTAAA G--------T TTTATAGGGT
T metuendu -GGTTTATGT GGTAGATATA GTTGTGTGAA G--------T TTTATAGGGT
T metuendu -GGTTTATGT GGTAGATATA GTTGTGTAAA G--------T TTTATAGGGT
T metuendu -GGTTTATGT GGTGAATATA GTTGTGTAAA G--------T TTTATAGGGT

97
T metuendu -TATTTATAG TTGACATATA GTTATGTAAA G--------T TTTATAGGGT
T metuendu -GGTTTATGT GGTAGATATA GTTGTGTAAA G--------T TTTATAGGGT
T metuendu -TATTTATAG TTGACATATA GTTATGTAAA G--------T TTTATAGGGT
T silvestr GGGT-AGGTT ATAGACTA-A GGGATGTTAA G--------A TTTATAGGGT
T silvestr GGGT-AGGTT ATAGACTA-A GGGATGTTAA G--------A TTTATAGGGT
T silvestr GGGT-AGGTT ATAGACTA-A GGGATGTTAA G--------A TTTATAGGGT
T strandi -AAAAAATGA TTAATTTATA -TAATGTGAA G--------A TTAGGAGGGT
T strandi -AAAAAGTGA ATAATTTATA -TAATGTGGA G--------A TTAGGAGGGT
T strandi -AAAAAGTAA ATAATTTATA -TAATGGGGA A--------A TTAGGAGGGT
T strandi -AAAAAGTAA ATAATTTATA -TAATGTGGA A--------A TTAGGAGGGT
T strandi -AAAAAGTAA ATAATTTATA -TAATGGGGA A--------A TTAGGAGGGT
B amazonic TAAATTGAAA ATAAATTTTT ATTATAAAG- ---------C TTGATAGGGT
B amazonic TAAATTGAAA ATAAATTTTT ATTATAAAG- ---------C TTGATAGGGT
B amazonic TAAATTGAAA ATAAATTTTT ATTATAAAG- ---------C TTGATAGGGT
B amazonic TAAATTGAAA ATAAATTTTT ATTATAAAG- ---------C TTGATAGGGT
B amazonic TAAATTGAAA ATAAATTTTT ATTATAAAG- ---------C TTGATAGGGT
B amazonic TAAATTGAAA ATAAATTTTT ATTATAAAG- ---------C TTGATAGGGT
B amazonic TAAATTGAAA ATAAATTTTT ATTATAAAG- ---------C TTGATAGGGT
B polisi P AAAAATAATA ATAATTTATT AAAATAAAAA AATAAAA--T TCTATAGGGT
B polisi M AAAAATAATA ATAATTTATT AAAATAAAAA AATAAAA--T TCTATAGGGT
B polisi P AAAAATAATA ATAATTTATT AAAATAAAAA AATAAAA--T TCTATAGGGT
B polisi M AAAAATAATA ATAATTTATT AAAATAAAAA AATAAAA--T TCTATAGGGT
B polisi M AAAAATAATA ATAATTTATT AAAATAAAAA AATAAAA--T TCTATAGGGT
C amazonic TAATTTGATT TTAAATTTAA ATTATAAAG- ---------C TTGATAGGGT
C Amazonic TAATTTGATT TTAAATTTAA ATTATAAAG- ---------C TTGATAGGGT
C amazonic TAATTTGATT TTAAATTTAA ATTATAAAG- ---------C TTGATAGGGT

....|....| ....|....| ....|....| ....|....| ....|....|


310 320 330 340 350
A dekeyser CTTCTCGTCT TGCTGTGTCA TGCCCGCCTC TTCACGGGCA GGTCAATTTC
A dekeyser CTTCTCGTCT TGCTGTGTCA TGCCCGCCTC TTCACGGGCA GGTCAATTTC
A dekeyser CTTCTCGTCT TGCTGTGTCA TGCCCGCCTC TTCACGGGCA GGTCAATTTC
A dekeyser CTTCTCGTCT TGCTGTGTCA TGCCCGCCTC TTCACGGGCA GGTCAATTTC
A dekeyser CTTCTCGTCT TGCTGTGTCA TGCCCGCCTC TTCACGGGCA GGTCAATTTC
A dekeyser CTTCTCGTCT TGCTGTGTCA TGCCCGCCTC TTCACGGGCA GGTCAATTTC
A dekeyser CTTCTCGTCT TGCTGTGTCA TGCCCGCCTC TTCACGGGCA GGTCAATTTC
T dinizi T CTTCTTGTCT ATAAGATAAA TTCTAGCCTT CTTACTAGAA AGTAAAATTA
T dinizi T CTTCTTGTCT ATAAGATAAA TTCTAGCCTT CTTACTAGAA AGTAAAATTA
T dinizi T CTTCTTGTCT ATAAGATAAA TTCTAGCCTT CTTACTAGAA AGTAAAATTA
T dinizi T CTTCTTGTCT ATAAGATAAA TTCTAGCCTT CTTACTAGAA AGTAAAATTA
T dinizi T CTTCTTGTCT ATAAGATAAA TTCTAGCCTT CTTACTAGAA AGTAAAATTA
T dinizi T CTTCTTGTCT ATAAGATAAA TTCTAGCCTT CTTACTAGAA AGTAAAATTA
T dinizi T CTTCTTGTCT ATAAGATAAA TTCTAGCCTT CTTACTGGAA AATAAAATTA
T matthies CTTCTTGTCT TTAAGTTATA TTTTAGCCTT TTTACTAAAA AGTAAGGTTA
T matthies CTTCTTGTCT TTAAGTTATA TTTTAGCCTT TTTACTAAAA AGTAAGGTTA
T matthies CTTCTTGTCT TTAAGTTATA TTTTAGCCTT TTTACTRAAA GGTAAGGTTA
T matthies CTTCTTGTCT TTAAGTTATA TTTTAGCCTT TTTACTAAAA AGTAAAGTTA
T matthies CTTCTTGTCT TTAAGTTATA TTTTAGCCTT TTTACTAAAA AGTAAAGTTA
T matthies CTTCTTGTCT TTAAGTTATA TTTTAGCCTT TTTACTAAAA AGTAAAGTTA
T matthies CTTCTTGTCT TTAAGTTATA TTTTAGCCTT TTTACTAAAA AGTAAAGTTA
T metuendu CTTCTTGTCT TTAAGACTTA TTTTAGCCTT TTTACTAAAA AGTAAAGTTT
T metuendu CTTCTTGTCT TTAAGACTTA TTTTAGCCTT TTTACTAAAA AGTAAAGTTT
T metuendu CTTCTTGTCT TTAAGATTTA TTTTAGCCTT TTTACTAAAA AGTAAAGTTT
T metuendu CTTCTTGTCT TTAAGACTTA TTTTAGCCTT TTTACTAAAA AGTAAAGTTT
T metuendu CTTCTTGTCT TTAAGACTTA TTTTAGCCTT TTTACTAAAA AGTAAAGTTT
T metuendu CTTCTTGTCT ATAAGATAGA TTCTAGCCTT CTTACTAGAA AGTAAAATTA
T metuendu CTTCTTGTCT TTAAGACTTA TTTTAGCCTT TTTACTAAAA AGTAAAGTTT
T metuendu CTTCTTGTCT ATAAGATAGA TTCTAGCCTT CTTACTAAAA AGTAAAATTA
T silvestr CTTCTTGTCT TTGATAAAAA TCTAAGCCTT TTTACTTAGA GGTTAGATTT
T silvestr CTTCTTGTCC TTGATAAAAA TCTAAGCCTT TTTACTTAGA GGTTAGATTT
T silvestr CTTCTTGTCC TTGATAAAAA TCTAAGCCTT TTTACTTAGA GGTTAGATTT
T strandi CTTCTTGTCT ATATAGGAAA TTTTAAATTT TTAACTAAAA GGTAAAATTT

98
T strandi CTTCTTGTCT ATATAGGAAA TTTTAAATTT TTAACTAAAA GGTAAAATTT
T strandi CTTCTTGTCT ATATAAAAAA TTTTAAATTT TTAACTAAAA AGTAAAATTT
T strandi CTTCTTGGCT ATATAAAAAA TTTTAAATTT TTAGCTAAAA AGTAAAATTT
T strandi CTTCTTGTCT ATATAAAAAA TTTTAAATTT TTAACTAAAA AGTAAAATTT
B amazonic CTTCTTGTCC CAAAATTCTA TTTTAGCTTT TTTACTAAAA TATAAAATTC
B amazonic CTTCTTGTCC CAAAATTCTA TTTTAGCTTT TTTACTAAAA TATAAAATTC
B amazonic CTTCTTGTCC CAAAATTCTA TTTTAGCTTT TTTACTAAAA TATAAAATTC
B amazonic CTTCTTGTCC CAAAATTCTA TTTTAGCTTT TTTACTAAAA TATAAAATTC
B amazonic CTTCTTGTCC CAAAATTCTA TTTTAGCTTT TTTACTAAAA TATAAAATTC
B amazonic CTTCTTGTCC CAAAATTCTA TTTTAGCTTT TTTACTAAAA TATAAAATTC
B amazonic CTTCTTGTCC CAAAATTCTA TTTTAGCTTT TTTACTAAAA TATAAAATTC
B polisi P CTTCTCGTCC CATTATTTTA TTTTAGCTTT TTCACTAAAA AATAAAATTC
B polisi M CTTCTCGTCC CATTATTTTA TTTTAGCTTT TTAACTAAAA AATAAAATTC
B polisi P CTTCTCGTCC CATTATTTTA TTTTAGCTTT TTAACTAAAA AATAAAATTC
B polisi M CTTCTCGTCC CATTATTTTA TTTTAGCTTT TTCACTAAAA AATAAAATTC
B polisi M CTTCTCGTCC CATTATTTTA TTTTAGCTTT TTAACTAAAA AATAAAATTC
C amazonic CTTCTTGTCT TAAATAACTA TATTAGCTTT TTTACTAATA TATAAAGTTA
C Amazonic CTTCTTGTCT TAAATAACTA TATTAGCTTT TTTACTAATA TATAAAGTTA
C amazonic CTTCTTGTCT TAAATAACTA TATTAGCTTT TTTACTAATA TATAAAGTTA

....|....| ....|....| ..
360 370
A dekeyser ACTGG---TT AAAAGTAAGA GA
A dekeyser ACTGG---TT AAAAGTAAGA GA
A dekeyser ACTGG---TT AAAAGTAAGA GA
A dekeyser ACTGG---TT AAAAGTAAGA GA
A dekeyser ACTGG---TT AAAAGTAAGA GA
A dekeyser ACTGG---TT AAAAGTAAGA GA
A dekeyser ACTGG---TT AAAAGTAAGA GA
T dinizi T AATG-----A AAATATAAGA AA
T dinizi T AATG-----A AAATATAAGA AA
T dinizi T AATG-----A AAATATAAGA AA
T dinizi T AATG-----A AAATATAAGA AA
T dinizi T AATG-----A AAATATAAGA AA
T dinizi T AATG-----A AAATATAAGA AA
T dinizi T AATG-----A AAATATAAGA AA
T matthies GATA-----T TAATATAAGA AA
T matthies GATT-----T TAATATAAGA AA
T matthies GATT-----T TAATATAAGA AA
T matthies GATG-----T TAATATAAGA AA
T matthies GATG-----T TAATATAAGA AA
T matthies GATG-----T TAATATAAGA AA
T matthies GATG-----T TAATATAAGA AA
T metuendu AATG-----A AAATATAAGA AA
T metuendu AATG-----A AAATATAAGA AA
T metuendu AATG-----T AAATATAAGA AA
T metuendu AATG-----T AAATATAAGA AA
T metuendu AATG-----A AAATATAAGA AA
T metuendu AATG-----A AAATATAAGA AA
T metuendu AATG-----T AAATATAAGA AA
T metuendu AATG-----A AAATATAAGA AA
T silvestr GAGA-----T TTATTCTAGA AA
T silvestr GAGA-----T TTATTCTAGA AA
T silvestr GAGA-----T TTATTCTAGA AA
T strandi AAAA-----A -AAAAATATA AA
T strandi AAAA-----A -AAAAATATA AA
T strandi ATTT-----T TATTAATATA AA
T strandi ATTT-----T TATTGATATA AA
T strandi ATTT-----T TATTAATATA AA
B amazonic AAAA-----T -ATTATGATA AG
B amazonic AAAA-----T -ATTATGATA AG
B amazonic AAAA-----T -ATTATGATA AG

99
B amazonic AAAA-----T -ATTATGATA AG
B amazonic AAAA-----T -ATTATGATA AG
B amazonic AAAA-----T -ATTATGATA AG
B amazonic AAAA-----T -ATTATGATA AG
B polisi P ACTT-----A -TTTAAAATT AA
B polisi M ACTT-----T -TTTAAAATT AA
B polisi P ACTT-----A -ATTAAAATT AA
B polisi M ACTT-----T -GTTAAAATT AA
B polisi M ACTT-----A -ATTAAAATT AA
C amazonic AAAA-----T -ATAATAATA AG
C Amazonic AAAA-----T -ATAATAATA AG
C amazonic AAAA-----T -ATAATAATA AG

100
APÊNDICE III: Tabela 3 - Estimativa de divergência nucleotídica entre as sequências dos escorpiões estudados.
Qt Espécie 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
1 A. dekeyseri Humaitá/CA 103
2 A. dekeyseri Humaitá/CA 79 0.00
3 A. dekeyseri Manaus/CA 77 0.00 0.00
4 A. dekeyseri Manaus/CA 106 0.00 0.00 0.00
5 A. dekeyseri Manaus/CC 112 0.01 0.01 0.01 0.01
6 A. dekeyseri Manaus/CC 113 0.01 0.01 0.01 0.01 0.01
7 A. dekeyseri Manaus/CC 95 0.01 0.01 0.01 0.01 0.01 0.02
8 T dinizi_Tabatinga/CA 112 0.58 0.58 0.58 0.58 0.57 0.58 0.58
9 T dinizi_Tabatinga/CA 245 0.58 0.58 0.58 0.58 0.57 0.58 0.58 0.00
10 T dinizi_Tabatinga/CA 247 0.58 0.58 0.58 0.58 0.58 0.58 0.59 0.01 0.01
11 T dinizi_Tabatinga/CC 46 0.58 0.58 0.58 0.58 0.58 0.58 0.59 0.02 0.02 0.01
12 T dinizi_Tabatinga/CC 105 0.58 0.58 0.58 0.58 0.57 0.58 0.58 0.00 0.00 0.01 0.02
13 T dinizi_Tabatinga/CC 106 0.58 0.58 0.58 0.58 0.57 0.58 0.58 0.00 0.00 0.01 0.02 0.00
14 T dinizi_Tabatinga/CC 246 0.58 0.58 0.58 0.58 0.58 0.58 0.59 0.03 0.03 0.03 0.04 0.03 0.03
15 T matthieseni Apui/CA 110 0.58 0.58 0.58 0.58 0.57 0.58 0.58 0.16 0.16 0.17 0.17 0.16 0.16 0.19
16 T matthieseni_Apui/CA 260 0.59 0.59 0.59 0.59 0.59 0.59 0.60 0.19 0.19 0.19 0.20 0.19 0.19 0.21 0.03
17 T matthieseni_Apui/CA 261 0.59 0.59 0.59 0.59 0.59 0.59 0.60 0.19 0.19 0.19 0.20 0.19 0.19 0.21 0.04 0.05
18 T matthieseni_CVarzea/CC 103 0.59 0.59 0.59 0.59 0.58 0.59 0.59 0.16 0.16 0.16 0.17 0.16 0.16 0.18 0.04 0.05 0.05
19 T matthieseni_CVarzea/CC 104 0.59 0.59 0.59 0.59 0.58 0.59 0.59 0.16 0.16 0.16 0.17 0.16 0.16 0.18 0.04 0.05 0.05 0.00
20 T matthieseni_CVarzea/CC 108 0.59 0.59 0.59 0.59 0.58 0.59 0.59 0.16 0.16 0.17 0.17 0.16 0.16 0.18 0.04 0.05 0.06 0.00 0.00
21 T matthieseni_CVarz/CC2 40ª 0.59 0.59 0.59 0.59 0.58 0.59 0.59 0.16 0.16 0.16 0.17 0.16 0.16 0.18 0.04 0.05 0.05 0.00 0.00 0.00
22 T metuendus_Manaus/CA 17 0.58 0.58 0.58 0.58 0.58 0.58 0.59 0.15 0.15 0.15 0.16 0.15 0.15 0.17 0.08 0.10 0.12 0.08 0.08 0.08 0.08
23 T metuendus_Manaus/CA 18 0.58 0.58 0.58 0.58 0.58 0.58 0.59 0.15 0.15 0.15 0.16 0.15 0.15 0.17 0.08 0.10 0.12 0.08 0.08 0.08 0.08 0.00
24 T metuendus_R P Eva/CA 66 0.59 0.59 0.59 0.59 0.59 0.59 0.60 0.16 0.16 0.17 0.17 0.16 0.16 0.18 0.09 0.11 0.12 0.09 0.09 0.09 0.09 0.06 0.06
25 T metuendus_Manaus/CA 91 0.58 0.58 0.58 0.58 0.58 0.58 0.59 0.15 0.15 0.15 0.16 0.15 0.15 0.17 0.07 0.09 0.10 0.07 0.07 0.06 0.07 0.02 0.02 0.04
26 T metuendus_Manaus/CC 65 0.58 0.58 0.58 0.58 0.58 0.58 0.59 0.14 0.14 0.15 0.15 0.14 0.14 0.17 0.08 0.10 0.12 0.08 0.08 0.08 0.08 0.01 0.01 0.06 0.02
27 T metuendus_Tab/CC 107 0.57 0.57 0.57 0.57 0.57 0.57 0.58 0.01 0.01 0.02 0.03 0.01 0.01 0.04 0.16 0.19 0.19 0.16 0.16 0.16 0.16 0.15 0.15 0.16 0.15
28 T metuendus_Manaus/CC 130 0.58 0.58 0.58 0.58 0.58 0.58 0.59 0.15 0.15 0.16 0.16 0.15 0.15 0.17 0.07 0.09 0.11 0.07 0.07 0.07 0.07 0.02 0.02 0.05 0.00
29 T metuendusTabatinga/CC252 0.57 0.57 0.57 0.57 0.57 0.57 0.58 0.01 0.01 0.02 0.03 0.01 0.01 0.04 0.16 0.18 0.18 0.15 0.15 0.16 0.15 0.14 0.14 0.16 0.14
30 T silvestris Manaus/CA 19 0.54 0.54 0.54 0.54 0.54 0.53 0.55 0.48 0.48 0.48 0.49 0.48 0.48 0.47 0.49 0.50 0.48 0.48 0.48 0.48 0.48 0.48 0.48 0.50 0.48
31 T silvestris Manaus/CA 67 0.54 0.54 0.54 0.54 0.54 0.53 0.55 0.48 0.48 0.48 0.49 0.48 0.48 0.47 0.49 0.50 0.48 0.48 0.48 0.48 0.48 0.48 0.48 0.50 0.48
32 T silvestris B. Constant/CC 139 0.54 0.54 0.54 0.54 0.54 0.53 0.55 0.48 0.48 0.48 0.49 0.48 0.48 0.47 0.49 0.50 0.48 0.48 0.48 0.48 0.48 0.48 0.48 0.50 0.48
33 Tityus strandi Barcelos/CA 68 0.63 0.63 0.63 0.63 0.63 0.63 0.63 0.50 0.50 0.50 0.51 0.50 0.50 0.51 0.52 0.53 0.52 0.51 0.51 0.51 0.51 0.51 0.51 0.50 0.51
34 Tityus strandi Barcelos/CA 109 0.67 0.67 0.67 0.67 0.67 0.68 0.67 0.62 0.62 0.62 0.62 0.62 0.62 0.63 0.66 0.66 0.67 0.67 0.67 0.67 0.67 0.65 0.65 0.66 0.66
35 Tityus strandi Coari/CA 66 0.64 0.64 0.64 0.64 0.63 0.64 0.64 0.41 0.41 0.42 0.42 0.41 0.41 0.43 0.45 0.45 0.45 0.43 0.43 0.43 0.43 0.44 0.44 0.43 0.44
36 Tityus strandi Coari/CA 75 0.74 0.74 0.74 0.74 0.74 0.74 0.74 0.62 0.62 0.61 0.61 0.62 0.62 0.62 0.63 0.62 0.63 0.63 0.63 0.63 0.63 0.64 0.64 0.62 0.63
37 Tityus strandi Coari/CC 86 0.64 0.64 0.64 0.64 0.63 0.64 0.64 0.41 0.41 0.42 0.42 0.41 0.41 0.43 0.45 0.45 0.45 0.43 0.43 0.43 0.43 0.44 0.44 0.43 0.44
38 B amazonicus Silves/CC48 0.52 0.52 0.52 0.52 0.52 0.52 0.52 0.49 0.49 0.50 0.50 0.49 0.49 0.50 0.53 0.53 0.52 0.51 0.51 0.51 0.51 0.50 0.50 0.52 0.51
39 B amazonicus_Silves/CC 50 0.52 0.52 0.52 0.52 0.52 0.52 0.52 0.49 0.49 0.50 0.50 0.49 0.49 0.50 0.53 0.53 0.52 0.51 0.51 0.51 0.51 0.50 0.50 0.52 0.51
40 B amazonicus_Silves/CA 51 0.52 0.52 0.52 0.52 0.52 0.52 0.52 0.49 0.49 0.50 0.50 0.49 0.49 0.50 0.53 0.53 0.52 0.51 0.51 0.51 0.51 0.50 0.50 0.52 0.51
41 B amazonicus_Silves/CA 98 0.52 0.52 0.52 0.52 0.52 0.52 0.52 0.49 0.49 0.50 0.50 0.49 0.49 0.50 0.53 0.53 0.52 0.51 0.51 0.51 0.51 0.50 0.50 0.52 0.51
42 B amazonicus_Silves/CA 99 0.52 0.52 0.52 0.52 0.52 0.52 0.52 0.49 0.49 0.50 0.50 0.49 0.49 0.50 0.53 0.53 0.52 0.51 0.51 0.51 0.51 0.50 0.50 0.52 0.51
43 B amazonicus_Manac/CC 20 0.52 0.52 0.52 0.52 0.52 0.52 0.52 0.49 0.49 0.49 0.50 0.49 0.49 0.50 0.52 0.53 0.52 0.51 0.51 0.51 0.51 0.50 0.50 0.51 0.50
44 B amazonicus_Manacap/CC 21 0.52 0.52 0.52 0.52 0.52 0.52 0.52 0.49 0.49 0.49 0.50 0.49 0.49 0.50 0.52 0.53 0.52 0.51 0.51 0.51 0.51 0.50 0.50 0.51 0.50
45 B polisi P Figueiredo/CA 148 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.69 0.69 0.69 0.70 0.69 0.69 0.71 0.72 0.73 0.73 0.71 0.71 0.71 0.71 0.71 0.71 0.71 0.72
46 B polisi Manaus/CA 128 0.76 0.76 0.76 0.76 0.75 0.75 0.75 0.69 0.69 0.69 0.70 0.69 0.69 0.70 0.72 0.73 0.73 0.71 0.71 0.71 0.71 0.71 0.71 0.71 0.71
47 B polisi P Figueiredo/CA 87 0.76 0.76 0.76 0.76 0.76 0.76 0.76 0.69 0.69 0.69 0.69 0.69 0.69 0.70 0.71 0.73 0.72 0.71 0.71 0.71 0.71 0.71 0.71 0.70 0.71
48 B polisi Manaus/CC 90 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.69 0.69 0.69 0.69 0.69 0.69 0.70 0.71 0.73 0.72 0.71 0.71 0.71 0.71 0.71 0.71 0.70 0.71
49 B polisi Manaus/CC 91 0.76 0.76 0.76 0.76 0.76 0.76 0.76 0.69 0.69 0.69 0.69 0.69 0.69 0.70 0.71 0.73 0.72 0.71 0.71 0.71 0.71 0.71 0.71 0.70 0.71
50 C amazonicus P Figue/CA 3 0.60 0.60 0.60 0.60 0.60 0.59 0.60 0.51 0.51 0.51 0.52 0.51 0.51 0.51 0.54 0.56 0.55 0.53 0.53 0.53 0.53 0.53 0.53 0.53 0.53
51 C amazonicus Manaus/CC 94 0.60 0.60 0.60 0.60 0.60 0.59 0.60 0.51 0.51 0.51 0.52 0.51 0.51 0.51 0.54 0.56 0.55 0.53 0.53 0.53 0.53 0.53 0.53 0.53 0.53
52 C amazonicus Manaus/CC 95 0.60 0.60 0.60 0.60 0.60 0.59 0.60 0.51 0.51 0.51 0.52 0.51 0.51 0.51 0.54 0.56 0.55 0.53 0.53 0.53 0.53 0.53 0.53 0.53 0.53

101
Continuação
Qt Espécie 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51
27 T metuendus_Tab/CC 107 0.14
28 T metuendus_Mao/CC 130 0.02 0.15
29 T metuendus_Tab/CC 252 0.14 0.00 0.15
30 T silvestris Mao/CA 19 0.48 0.47 0.48 0.47
31 T silvestris Mao/CA 67 0.48 0.47 0.48 0.47 0.00
32 T silvestris B. Const/CC 139 0.48 0.47 0.48 0.47 0.00 0.00
33 T strandi Barcelos/CA 68 0.50 0.50 0.51 0.50 0.53 0.53 0.53
34 T strandi Barcelos/CA 109 0.65 0.63 0.66 0.63 0.61 0.61 0.61 0.57
35 T strandi Coari/CA 66 0.44 0.41 0.44 0.41 0.51 0.51 0.51 0.38 0.67
36 T strandi Coari/CA 75 0.63 0.63 0.63 0.62 0.72 0.72 0.72 0.63 0.39 0.58
37 T strandi Coari/CC 86 0.44 0.41 0.44 0.41 0.51 0.51 0.51 0.38 0.67 0.00 0.58
38 B amazonicus_Silv/CC 48 0.50 0.49 0.50 0.49 0.50 0.50 0.50 0.48 0.64 0.51 0.69 0.51
39 B amazonicus_Silv/CC 50 0.50 0.49 0.50 0.49 0.50 0.50 0.50 0.48 0.64 0.51 0.69 0.51 0.00
40 B amazonicus_Silves/CA 51 0.50 0.49 0.50 0.49 0.50 0.50 0.50 0.48 0.64 0.51 0.69 0.51 0.00 0.00
41 B amazonicus_Silves/CA 98 0.50 0.49 0.50 0.49 0.50 0.50 0.50 0.48 0.64 0.51 0.69 0.51 0.00 0.00 0.00
42 B amazonicus_Silves/CA 99 0.50 0.49 0.50 0.49 0.50 0.50 0.50 0.48 0.64 0.51 0.69 0.51 0.00 0.00 0.00 0.00
43 B amazonicus Mao/CC 20 0.50 0.49 0.50 0.49 0.49 0.49 0.49 0.48 0.64 0.51 0.69 0.51 0.00 0.00 0.00 0.00 0.00
44 B amazonicus_Mao/CC 21 0.50 0.49 0.50 0.49 0.49 0.49 0.49 0.48 0.64 0.51 0.69 0.51 0.00 0.00 0.00 0.00 0.00 0.00
45 B polisi P Figue/CA 148 0.71 0.69 0.72 0.69 0.71 0.71 0.71 0.64 0.61 0.66 0.66 0.66 0.66 0.66 0.66 0.66 0.66 0.66 0.66
46 B polisi Manaus/CA 128 0.71 0.69 0.71 0.69 0.70 0.70 0.70 0.64 0.61 0.65 0.66 0.65 0.66 0.66 0.66 0.66 0.66 0.66 0.66 0.02
47 B polisi P Figueiredo/CA 87 0.71 0.69 0.71 0.69 0.70 0.70 0.70 0.64 0.61 0.65 0.66 0.65 0.66 0.66 0.66 0.66 0.66 0.66 0.66 0.02 0.01
48 B polisi Manaus/CC 90 0.71 0.69 0.71 0.69 0.70 0.70 0.70 0.64 0.61 0.66 0.66 0.66 0.65 0.65 0.65 0.65 0.65 0.65 0.65 0.04 0.03 0.03
49 B polisi Manaus/CC 91 0.71 0.69 0.71 0.69 0.70 0.70 0.70 0.64 0.61 0.65 0.66 0.65 0.66 0.66 0.66 0.66 0.66 0.66 0.66 0.02 0.01 0.00 0.03
50 C amazonicusPFigue/CA 37 0.53 0.51 0.52 0.51 0.54 0.54 0.54 0.52 0.68 0.52 0.66 0.52 0.40 0.40 0.40 0.40 0.40 0.40 0.40 0.65 0.65 0.65 0.64 0.65
51 C amazonicus Maos/CC 94 0.53 0.51 0.52 0.51 0.54 0.54 0.54 0.52 0.68 0.52 0.66 0.52 0.40 0.40 0.40 0.40 0.40 0.40 0.40 0.65 0.65 0.65 0.64 0.65 0.00
52 C amazonicus Mao/CC 95 0.53 0.51 0.52 0.51 0.54 0.54 0.54 0.52 0.68 0.52 0.66 0.52 0.40 0.40 0.40 0.40 0.40 0.40 0.40 0.65 0.65 0.65 0.64 0.65 0.00 0.00
Fonte: (TAMURA et al., 2013)

102
APÊNDICE IV
T matthieseni C da Varzea/CC 104
T matthieseni C da Varzea/CC 240A
T matthieseni C da Varzea/CC 103
T matthieseni C da Varzea/CC 108
T matthieseni Apu/CA 261
T matthieseni Apui/CA 110
T matthieseni Apui/CA 260
T metuendus R P da Eva/CA 66
T metuendus Manaus/CA 91
T metuendus Manaus/CC 130
T metuendus Manaus/CC 65
T metuendus Manaus/CA 17
T metuendus Manaus/CA 18
T metuendus Tabatinga/CC 107
T metuendus Tabatinga/CC 252
T dinizi Tabatinga/CC 246
T dinizi Tabatinga/CA 247
T dinizi Tabatinga/CC 46
T dinizi Tabatinga/CA 112
T dinizi Tabatinga/CA 245
T dinizi Tabatinga/CC 105
T dinizi Tabatinga/CC 106
T silvestris Manaus/CA 19
T silvestris Manaus/CA 67
T silvestris B Constant/CC
T strandi Barcelos/CA 68
T strandi Barcelos/CA 109
T strandi Coari/CA 75
T strandi Coari/CA 66
T strandi Coari/CC
B polisi P Figueiredo/CA 87
B polisi Manaus/CC 91
B polisi Manaus/CA 128
B polisi P Figueiredo/CA 148
B polisi Manaus/CC 90
C Amazonicus Manaus/CC 94
C amazonicus Manaus/CC
C amazonicus P Figueiredo/CA
B amazonicus Manacapuru/CC 202 A
B amazonicus Manacapuru/CC 202 B
B amazonicus Silves/CC 48
B amazonicus Silves/CC 50
B amazonicus Silves/CA 51
B amazonicus Silves/CA 98
B amazonicus Silves/CA 99
A dekeyseri Manaus/CC 113
A dekeyseri Manaus/CC 112
A dekeyseri Manaus/CC 95
______
A dekeyseri Humaita/CA 103
0.05 A dekeyseri Humaita/CA 79
A dekeyseri Manaus/CA 77
A dekeyseri Manaus/CA 106

Figura 6 - Árvore filogenética gerada pelo método evolutivo Neighbor-Joining


Fonte: (FELSENSTEIN, 1985; NEI & KUMAR, 2000; SAITOU & NEI, 1987;TAMURA et
al., 2013).

103
T matthieseni C da Varzea/CC 104
T matthieseni C da Varzea/CC 240A
T matthieseni C da Varzea/CC 103
T matthieseni C da Varzea/CC 108
T matthieseni Apui/CA 110
T matthieseni Apui/CA 260
T matthieseni Apu/CA 261
T metuendus Manaus/CA 91
T metuendus Manaus/CC 130
T metuendus Manaus/CC 65
T metuendus Manaus/CA 17
T metuendus Manaus/CA 18
T metuendus R P da Eva/CA 66
T metuendus Tabatinga/CC 107
T metuendus Tabatinga/CC 252
T dinizi Tabatinga/CC 106
T dinizi Tabatinga/CA 247
T dinizi Tabatinga/CC 46
T dinizi Tabatinga/CC 246
T dinizi Tabatinga/CA 112
T dinizi Tabatinga/CA 245
T dinizi Tabatinga/CC 105
T silvestris Manaus/CA 67
T silvestris Manaus/CA 19
T silvestris B Constant/CC
T strandi Barcelos/CA 68
T strandi Barcelos/CA 109
T strandi Coari/CA 75
T strandi Coari/CA 66
T strandi Coari/CC
C amazonicus P Figueiredo/CA
C amazonicus Manaus/CC
C Amazonicus Manaus/CC 94
B amazonicus Manacapuru/CC 202 A
B amazonicus Manacapuru/CC 202 B
B amazonicus Silves/CC 48
B amazonicus Silves/CA 99
B amazonicus Silves/CC 50
B amazonicus Silves/CA 51
B amazonicus Silves/CA 98
A dekeyseri Manaus/CC 112
A dekeyseri Manaus/CC 113
A dekeyseri Humaita/CA 103
A dekeyseri Manaus/CA 77
A dekeyseri Manaus/CC 95
A dekeyseri Humaita/CA 79
A dekeyseri Manaus/CA 106
B polisi Manaus/CC 90
B polisi P Figueiredo/CA 148

______ B polisi Manaus/CA 128


B polisi P Figueiredo/CA 87
0.05
B polisi Manaus/CC 91

Figura 7 - Árvore filogenética gerada pelo método evolutivo Máxima Parcimônia


Fonte: (FELSENSTEIN, 1985; NEI & KUMAR, 2000; TAMURA et al., 2013).

104