Full Text

Title Immunomodulatory properties of probiotic bacteria
Author(s) Fong, Long-yan; 方朗茵
Fong, L. [方朗茵]. (2013). Immunomodulatory properties of

probiotic bacteria. (Thesis). University of Hong Kong, Pokfulam,
Citation Hong Kong SAR. Retrieved from
http://dx.doi.org/10.5353/th_b5185914
Issued Date 2013
URL http://hdl.handle.net/10722/208173
The author retains all proprietary rights, (such as patent rights)

Rights and the right to use in future works.
IMMUNOMODULATORY PROPERTIES
OF PROBIOTIC BACTERIA
by
Fiona Long Yan Fong
Doctor of Philosophy
at the University of Hong Kong
August 2013
1
Abstract of thesis
entitled
“Immunomodulatory properties of probiotic bacteria”
Submitted by
Fiona Long Yan Fong
for the degree of Doctor of Philosophy

in August 2013
Probiotics are living microorganisms, which when administered in adequate
amounts confer a health benefit on the host. They have been reported to relieve acute
diarrhoea, atopic dermatitis and irritable bowel syndrome in disease-specific animal
studies and in human intervention trials. However, probiotics are regularly consumed
by general healthy population with limited knowledge in the immunomodulation of
probiotics of local and systemic immune responses in healthy experimental models.
Serving as the first line of defense against microbial infections and the largest
immunological organ in animal host, the epithelium lining the small and large
intestine is supposed to be the first organ to encounter probiotics as probiotics are
always orally taken. It is believed that probiotics regulate the local immunities in the
gut, which acts as the pivot in modulating the systemic immune responses.
Accordingly, it was hypothesized that probiotic bacteria can modulate both local and
systemic immune responses in healthy population; and the immunomodulation of
ii
combination of probiotics is different from that of individual strains. Wildtype
healthy C57BL/6 mice were fed with different probiotic strains − Lactobacillus
rhamnosus GG (LGG), Lactobacillus rhamnosus LC705 (LC705), Bifidobacterium
breve Bb99 (Bb99), Propionibacterium freudenreichii ssp. shermanii JS (PJS) or
Escherichia coli Nissle 1917 (EcN), or mixture of probiotics − GGmix (LGG, LC705,
Bb99 and PJS) and ECPJSmix (PJS and EcN), for three weeks. After that, intestine,
liver, spleen and blood were investigated. Probiotics suppressed intestinal T helper
(Th)17 immune response but enhanced systemic (hepatic and splenic) Th17 immune
response, suggesting that immune homeostasis was maintained in healthy individuals.
Mechanism of action of LGG was further studied in this project as LGG is the
widely studied probiotics. It was hypothesized that LGG exerts immunomodulatory
effects by bacteria cells and/or its derived soluble factors such as lactic acid.
Immunomodulatory effects of LGG cells and their soluble factors on dendritic cells
(DCs), macrophages and monocytes from healthy blood donors were investigated as
antigen-presenting cells (APCs) are pivots of bridging innate and adaptive immunities.
Cytokine secretion profile, expressions of toll-like receptors (TLRs) and activation-
related receptors of the APCs were examined. Both LGG cells and their soluble
factors promoted type 1-responsiveness while soluble factors promoted type 17-
responsiveness as well. Yet, lactic acid seemed not to be the one which enhanced type
1 and type 17 immune responses in soluble factors. With better understanding on the
immunomodulation of probiotics in healthy models, prophylactic efficacy of
probiotics in preventing infections and diseases can be availed.
iii
IMMUNOMODULATORY
PROPERTIES OF PROBIOTIC
BACTERIA
by
Fiona Long Yan Fong
“Temporary Binding for Examination Purpose”
Doctor of Philosophy
August 2013
iv
Abstract of thesis
entitled
“Immunomodulatory properties of probiotic bacteria”
Submitted by
Fiona Long Yan Fong
for the degree of Doctor of Philosophy

in August 2013
amounts confer a health benefit on the host. They have been reported to relieve acute
diarrhoea, atopic dermatitis and irritable bowel syndrome in disease-specific animal
studies and in human intervention trials. However, probiotics are regularly consumed
by general healthy population with limited knowledge in the immunomodulation of
probiotics of local and systemic immune responses in healthy experimental models.
Serving as the first line of defense against microbial infections and the largest
immunological organ in animal host, the epithelium lining the small and large
intestine is supposed to be the first organ to encounter probiotics as probiotics are
always orally taken. It is believed that probiotics regulate the local immunities in the
gut, which acts as the pivot in modulating the systemic immune responses.
Accordingly, it was hypothesized that probiotic bacteria can modulate both local and
systemic immune responses in healthy population; and the immunomodulation of
v
combination of probiotics is different from that of individual strains. Wildtype
healthy C57BL/6 mice were fed with different probiotic strains − Lactobacillus
rhamnosus GG (LGG), Lactobacillus rhamnosus LC705 (LC705), Bifidobacterium
breve Bb99 (Bb99), Propionibacterium freudenreichii ssp. shermanii JS (PJS) or
Escherichia coli Nissle 1917 (EcN), or mixture of probiotics − GGmix (LGG, LC705,
Bb99 and PJS) and ECPJSmix (PJS and EcN), for three weeks. After that, intestine,
liver, spleen and blood were investigated. Probiotics suppressed intestinal T helper
(Th)17 immune response but enhanced systemic (hepatic and splenic) Th17 immune
response, suggesting that immune homeostasis was maintained in healthy individuals.
Mechanism of action of LGG was further studied in this project as LGG is the
widely studied probiotics. It was hypothesized that LGG exerts immunomodulatory
effects by bacteria cells and/or its derived soluble factors such as lactic acid.
Immunomodulatory effects of LGG cells and their soluble factors on dendritic cells
(DCs), macrophages and monocytes from healthy blood donors were investigated as
antigen-presenting cells (APCs) are pivots of bridging innate and adaptive immunities.
Cytokine secretion profile, expressions of toll-like receptors (TLRs) and activation-
related receptors of the APCs were examined. Both LGG cells and their soluble
factors promoted type 1-responsiveness while soluble factors promoted type 17-
responsiveness as well. Yet, lactic acid seemed not to be the one which enhanced type
1 and type 17 immune responses in soluble factors. With better understanding on the
immunomodulation of probiotics in healthy models, prophylactic efficacy of
probiotics in preventing infections and diseases can be availed.
vi
Declaration
I declare that this thesis represents my own work, except where acknowledgement is
made. It has not been previously included in a thesis or dissertation submitted to the
University of Hong Kong or other institutions for a degree, diploma or other
qualifications.
X
Fiona Long Yan Fong
vii
Acknowledgements
It is with immense gratitude that I acknowledge all those who have helped and
provided me the possibility to complete this project. This project would not happen to
be possible and accomplished if without their support.
I owe my deepest gratitude to my primary supervisor, Dr. Hani El-Nezami, whose
contribution in stimulating suggestions, advice and encouragement. I would like to
pay my every tribute to him for providing me opportunities for local and worldwide
exposure, which absolutely widened my horizon. I am indebted to Dr. Hani El-
Nezami for his excellent guidance, caring, patience and providing me with an
excellent atmosphere for doing research.
I could not find words to express my gratitude to my secondary supervisor, Dr. Pirkka
Kirjavainen, for his advice, continued support and patience. I am so sincerely
thankful to his help in developing and strengthening my background of immunology.
He is always a kind and gracious supervisor, who guides me to think precisely. I
would like to sincerely thank him for training me and giving me opportunities to
work with a clinical intervention project when I was an exchange student in Finland.
I would like to share the credits of my work with my laboratory mates in the Food
and Toxicology Laboratory in School of Biological Sciences of the University of
Hong Kong, including Victoria Ho Yee Wong, Dr. Carol Yee Kwan Chan, Murphy
Lam Yim Wan, Cecilia Ying Ju Sung, Shirley ZhiJian Chen, Dr. Jackson Chit Shing
Woo, Alec Eng Dar Kor, Dalal AlGhawas, Jonathan See Han Lau, Soda Ka Yiu Yip
viii
and Adrian Shu Cheng Yan. It is a great pleasure to thank for their help, teaching,
invaluable experience exchange and cordiality.
I would like to acknowledge the help of technicians in School of Biological Sciences,
including Yvonne Yuen Yue Chung, Dr. Wai Hung Sit, George Siu Kei, Helen Yuen
Man Leung, Eric Kai Yan Lee and Iris Mei Ying Tse, for giving me full technical
support for using the equipment and necessary materials to complete this project.
I consider it an honour to work with the laboratory colleagues in the Hong Kong
Baptist University, including Dr. William Chi Shing Tai, Dr. Wing Yan Wong and
Muk Lan Lee, for their advice and support. A special thank also goes to Dr. Yen
Chen for training and advising my experimental setup and procedures. I would also
like to thank the laboratory colleagues in the University of Eastern Finland.
I wish to take this chance to thank my supervisor – Dr. Pirkka Kirjavainen, Sanna
Piekkola, Dr. Jackson Chit Shing Woo and Otto Mykkänen for their geniality and
taking care of me when I was in Finland.
Last but not least, many thanks go to my beloved family and friends. Degree of
doctor of philosophy would have remained a dream had they not been for their
tolerance, kindness, love and understanding.
ix
Table of content
Abstract of thesis .......................................................................................................... ii

Abstract of thesis .......................................................................................................... v
Declaration........ ............................................................................................ ..............vii
Acknowledgements .................................................................................................... viii
Table of content ............................................................................................................ x
List of Figures ............................................................................................................ xiv
List of Tables ........................................................................................................... xviii
Abbreviations ............................................................................................................. xix
List of Symbols ......................................................................................................... xxii
General Background ..................................................................................................... 1
Immunity ............................................................................................................................... 1
Roles of TLRs in immunity .............................................................................................. 2
Antigen-presenting cells (APCs) and lymphocytes .......................................................... 7
Natural killer (NK) cells ................................................................................................. 13
T cells .............................................................................................................................. 15
NKT cells ........................................................................................................................ 21
Communication within the immune systems ...................................................................... 25
Cytokines ........................................................................................................................ 26
Chemokines..................................................................................................................... 28
Probiotic bacteria ................................................................................................................ 29
Beneficial effects of probiotics ....................................................................................... 30
Probiotic-derived soluble factors ........................................................................................ 40
Safety of probiotics ......................................................................................................... 41
Probiotics and intestinal immunity and epithelial barrier ................................................... 42
Probiotics and systemic immunity ...................................................................................... 44
Possible immunomodulatory mechanisms of action elicited by probiotics ........................ 46
x
Objectives............. ...................................................................................................... 50
Chapter 1 Evaluation of in vivo immunomodulatory effects of single and
mixture of probiotic strains on local immunity ..................................................... 51
1.1. Introduction .................................................................................................................. 51
1.2. Materials and Methods ................................................................................................. 52
1.2.1. Animals ................................................................................................................. 52
1.2.2. Probiotic strains and feeding procedure ................................................................ 52
1.2.3. Body and organ weights ........................................................................................ 53
1.2.4. Intestinal fluid ....................................................................................................... 53
1.2.5. Cytokine Profiling ................................................................................................. 54
1.2.6. Statistical Analysis ................................................................................................ 55
1.3. Results .......................................................................................................................... 56
1.3.1. Single probiotic strains .......................................................................................... 56
1.3.2. Mixed probiotic strains ......................................................................................... 61
1.4. Discussion .................................................................................................................... 65
1.5. Conclusion ................................................................................................................... 66
Chapter 2 Evaluation of in vivo immunomodulatory effects of single and
mixed probiotic strains on systemic immunity....................................................... 67
2.1. Introduction .................................................................................................................. 67
2.2. Materials and Methods ................................................................................................. 67
2.2.1. Animals ................................................................................................................. 67
2.2.2. Probiotic strains..................................................................................................... 68
2.2.3. Feeding procedures ............................................................................................... 68
2.2.4. Hepatocytes ........................................................................................................... 68
2.2.5. Splenocytes ........................................................................................................... 69
2.2.6. Immunophenotyping by flow cytometric analysis ................................................ 69
2.2.7. Cytokine profiling ................................................................................................. 70
2.2.8. Statistical analyses ................................................................................................ 72
2.3. Results .......................................................................................................................... 73
2.3.1. Single probiotic strains .......................................................................................... 73
2.3.2. Mixture of probiotic strains ................................................................................... 89
2.4. Discussion .................................................................................................................. 102
xi
2.5. Conclusion ................................................................................................................. 105
Chapter 3 Assessment of in vitro immunomodulatory effect of Lactobacillus
rhamnosus GG (LGG) bacteria on APCs ............................................................. 106
3.1. Introduction ................................................................................................................ 106
3.2. Materials and Methods ............................................................................................... 107
3.2.1 Bacterial Strain and culture conditions ................................................................ 107
3.2.2. Isolation of PBMCs ............................................................................................. 107
3.2.3. Derivation of DCs and macrophages from monocytes ....................................... 107
3.2.4. Co-cultured with LGG ........................................................................................ 108
3.2.5. Cytokine profiling ............................................................................................... 109
3.2.6. Quantification of TLR expression by real-time PCR .......................................... 110
3.2.7. Immunophenotyping of antigen presenting cells by flow cytometry .................. 114
3.2.8. Statistical Analysis .............................................................................................. 116
3.3. Results ........................................................................................................................ 117
3.3.1. Dendritic cells ..................................................................................................... 117
3.3.2. Macrophages ....................................................................................................... 125
3.3.3. Monocytes ........................................................................................................... 131
3.4. Discussion .................................................................................................................. 149
3.5. Conclusion ................................................................................................................. 154
Chapter 4 Assessment of in vitro immunomodulatory effect of soluble factors
derived by Lactobacillus rhamnosus GG (LGG) on APCs .................................. 155
4.1. Introduction ................................................................................................................ 155
4.2.1. Preparation of conditioned medium (CM) from LGG ........................................ 156
4.3. Results ........................................................................................................................ 157
4.3.1. Dendritic cells ..................................................................................................... 157
4.3.2. Macrophages ....................................................................................................... 170
4.3.3. Monocytes ........................................................................................................... 177
4.4. Discussion .................................................................................................................. 198
4.5 Conclusion .................................................................................................................. 204
Chapter 5 Assessment of in vitro immunomodulatory effect of hydrogen ions
and lactate on dendritic cells.................................................................................. 205
xii
5.1. Introduction ................................................................................................................ 205
5.2.1. Isolation of peripheral blood mononuclear cells (PBMCs) and differentiation of
dendritic cells (DCs) ..................................................................................................... 206
5.2.2. Stimulation of immature DCs with lactic acid or hydrochloric acid (HCl) ........ 206
5.2.3. Flow cytometric Analysis ................................................................................... 207
5.2.4. Statistical Analysis .............................................................................................. 207
5.3. Results ........................................................................................................................ 208
5.3.1. Immunophenotyping ........................................................................................... 208
5.4. Discussion .................................................................................................................. 215
5.5. Conclusion ................................................................................................................. 217
Summary of Studies and Future Work ..................................................................... 218
References............. .................................................................................................... 221
Original Publications ................................................................................................ 251
xiii
List of Figures
Figure 1. TLR recognition of bacterial components…………………………………5
Figure 2. Postulated mechanism of action of probiotics…………………………….49
Chapter One
Figure 1.1. Body weights of mice fed with single probiotic strains…………………56
Figure 1.2. Effect of single probiotic strains on cytokine secretions of small intestine
and colon………………………………………………………..........………………57
Figure 1.3. Body weights of mice fed with mixture of probiotic strains…………….61
Figure 1.4. Effect of mixture of probiotic strains on cytokine secretions of small
intestine and colon...…………………………………………………………………62
Chapter Two
Figure 2.1. Body weight changes of mice…………………………………………...73
Figure 2.2. Effect of probiotics on percentages and cytokine production of immune
cells in liver……………………………………………………………...…………..74
Figure 2.3. Effect of probiotics on helper T (Th) responses in liver…………..…….76
Figure 2.4. Effect of probiotics on Th cell regulation in liver……………………….77
Figure 2.5. Effects of probiotics on percentage and cytokine production of immune
cells in spleen………………………………………………………………………..79
Figure 2.6. Effects of probiotics on Th cell regulation in spleen……………………81
Figure 2.7. Cytokine profile of LGG-treated group…………………………………83
Figure 2.8. Cytokine profile of LC705-treated group………………………………..84
Figure 2.9. Cytokine profile of PJS-treated group…………………………...………85
Figure 2.10. Cytokine profile of Bb99-treated group………………………………..86
Figure 2.11. Cytokine profile of EcN-treated group…………………………………87
Figure 2.12. Body weight change of mice…………………………………………..89
Figure 2.13. Effects of mixture of probiotics on percentages and cytokine productions
of immune cells in liver…………………………………………………………….90
Figure 2.14. Effects of mixture of probiotics on Th responses in liver………….…92
xiv
Figure 2.15. Effect of mixture of probiotics on Th cells in liver………………...…93
Figure 2.16. Effects of mixture of probiotics on percentages and cytokine productions
of immune cells in spleen…………………………………………………………..94
Figure 2.17. Effects of mixture of probiotic bacteria on Th cells in spleen………..96
Figure 2.18. Cytokine profile of GGmix-treated group……………………………98
Figure 2.19. Cytokine profile of ECPJSmix-treated group………………………..99
Figure 2.20. Heat map of summary of serum cytokine and chemokine levels……101
Chapter Three
Figure 3.1. Cytokine and chemokine secretion profile of LGG-treated mononuclear
cells……………………………………………………………………………..…..117
Figure 3.2. TLR expression of DCs……………………………………………...…123
Figure 3.3. Activation-related receptor expression on macrophages………………125
Figure 3.4. Inflammatory marker expression on macrophages…………………….126
Figure 3.5. Cytokine production and transcription factor expression of
macrophages………………………………………………………………………..127
Figure 3.6. TLR expression of LGG-treated macrophages……………………...…129
Figure 3.7. Receptor expression on "classical" CD14hiCD16- monocytic
subset……………………………………………………………………………….131
Figure 3.8. Cytokine production of "classical" CD14hiCD16- monocytic
subset……………………………………………………………………………….132
Figure 3.9. Receptor expression on "intermediate" CD14hiCD16lo monocytic
subset……………………………………………………………………………… 134
Figure 3.10. Cytokine production of "intermediate" CD14hiCD16lo monocytic
subset…………………………………………………………………………….....135
Figure 3.11. Receptor expression on "non-classical" CD14loCD16lo monocytic
subset……………………………………………………………………………….137
Figure 3.12. Cytokine production of "non-classical" CD14loCD16lo monocytic
subset……………………………………………………………………………….138
Figure 3.13. Receptor expression on "non-classical" CD14loCD16hi monocytic
subset.………………………………………………………………………………140
Figure 3.14. Cytokine production of "Non-classical" CD14loCD16hi monocytic
subset……………………………………………………………………………….141
xv
Figure 3.15. Receptor expression on "Non-classical" CD14hiCD16hi monocytic
subset…………………………………………………………………………….....143
Figure 3.16. Cytokine production of "Non-classical" CD14hiCD16hi monocytic
subset…………………………………………………………………...…………..144
Figure 3.17. Percentages of different monocytic subsets………………………..…145
Figure 3.18. TLR expression of LGG-treated monocytes………………………….147
Chapter Four
Figure 4.1. Cytokine and chemokine secretion profiles of LGG CM-treated and LGG
CM+LGG-treated cells……………………………………………………………..157
Figure 4.2. Comparison of cytokine and chemokine secretions of LGG CM-treated
and LGG CM+LGG-treated cells………………………………………………..…161
Figure 4.3. Summary of cytokine and chemokine secretion levels of LGG CM-treated
and LGG CM+LGG-treated cells and their comparison……………………….…..165
Figure 4.4. TLR expression of LGG CM-treated and LGG CM+LGG-treated
DCs…………………………………………………………………………………167
Figure 4.5. Comparison of TLR expressions of LGG CM-treated and LGG
CM+LGG-treated DCs………………………………………………………..……168
Figure 4.6. TLR expression of LGG CM-treated and LGG+LGG CM-treated
macrophages.....…………………………………………………………………….170
Figure 4.7. Comparison of TLR expression of LGG CM-treated macrophages with
LGG+LGG CM-treated macrophages……………………………………………...171
Figure 4.8. Receptor expression and comparison of treated macrophages……..…173
Figure 4.9. Inflammatory marker expression and comparison of treated
macrophages………………………………………………………………….……174
Figure 4.10. Cytokine production and transcription factors of and comparison of
treated macrophages………………………………………………………………..175
monocytes……………………………………………………………………..……177
Figure 4.12. Comparison of TLR expression of LGG CM-treated and LGG+LGG
CM-treated monocytes……………………………………..………………………178
Figure 4.13. Receptor expression of "classical" CD14hiCD16- monocytic
subset ………………………………………………………………………………180
xvi
Figure 4.14. Cytokine production of "classical" CD14hiCD16- monocytic
subset……………………………………………………………………………….181
Figure 4.15. Receptor expression of "intermediate" CD14hiCD16lo monocytic
subset…………………………………………………………………………….....183
subset……………………………………………………………………...………..184
Figure 4.17. Receptor expression of "non-classical" CD14loCD16lo monocytic
subset……………………………………………………………………………….186
Figure 4.18. Cytokine production of "non-classical" CD14loCD16lo monocytic
subset……………………………………………………………………………….187
Figure 4.19. Receptor expression of "non-classical" CD14loCD16hi monocytic
subset……………………………………………………………………………….189
Figure 4.20. Cytokine production of "non-classical" CD14loCD16hi monocytic
subset…………………………………………………………………………….…190
Figure 4.21. Receptor expression of "non-classical" CD14hiCD16hi monocytic
subset……………………………………………………………………………….192
Figure 4.22. Cytokine production of "non-classical" CD14hiCD16hi monocytic
subset……………………………………………………………………………….193
Figure 4.23. Percentages of various monocytic subsets……………………………195
Figure 4.24. Summary of receptor expression and cytokine production of various
monocytic subsets…………………………………………………………………..197
Chapter Five
Figure 5.1. Effect of hydrogen ions on receptor expression and cytokine production of
DCs …………….....…………………………………………………….………….208
Figure 5.2. Effect of lactate on receptor expression and cytokine production of
DCs…………………………………………………………………………………210
Figure 5.3. Receptor expression and cytokine production of DCs in lactic acid with
various pH………………………………………………………………………..…212
Figure 5.4. Viability of DCs at different pH of lactic acid and hydrochloric acid....214
xvii
List of Tables
Table 1. Table of TLR recognition of bacterial components………………………...4

Table 2. Table of major functions and characteristic cytokines of immune cells......23
Table 3. Table of Th-associated cytokines and chemokines......................................29
Table 4. Table of health benefits exerted by Lactobacilli……………………...……32
Table 5. Table of health benefits exerted by Bifidobacteria…………………………34
Table 6. Table of health benefits exerted by Propionibacterium freudenreichii ssp.
shermanii JS…………………………………………………………………………37
Table 7. Table of health benefits exerted by Escherichia coli Nissle 1917…………38
Chapter One
Table 1.1. List of probiotic strains used in the study…………………………...……53
Chapter Two
Table 2.1. List of cytokines and chemokines used in the study……………………70
Chapter Three
Table 3.1. List of cytokines tested in the study…………………………………….110
Table 3.2. Sequences of primers and probes of human TLRs and housekeeping for
real-time quantitative PCR…………………………………………………………112
Table 3.3. List of anti-human monoclonical antibodies (mABs) used in the
study……………………………………………………………………………...…115
xviii
Abbreviations
αGalCer: α-galactosylceramide
AD: atopic dermatitis
AAD: antibiotic associated diarrhea
AFB1: Aflatoxin B1
APC : allophococyanin
APCs: antigen-presenting cells
Bb12: Bifidobacterium animalis ssp. lactis Bb-12
CD: cluster for differentiation
CLR: C-type lectin receptor
CTL: cytotoxic T lymphocyte
DC 10: IL-10-differentiated monocyte-derived dendritic cells
DMSO: dimethyl sulfoxide
ds: double stranded
FDA: Food and Drug Administration
FITC: fluorescein isothiocyanate
FOXP: forkhead box P3
GAPDH : glyceraldehyde-3-phosphate dehydrogenase
GATA-3: GATA-binding protein-3
GCSF: granulocyte colony-stimulating factor
GI: gastrointestinal
GMCSF: granulocyte macrophage colony-stimulating factor
GRAS: Generally Recognized As Safe
HIV: human immunodeficiency virus
HLA-DR: human leukocyte antigen class II
IBD: inflammatory bowel disease
xix
IECs: intestinal epithelial cells
IFNγ: interferon-gamma
Ig: Immunoglobulin
IL: interleukin
iNKT: invariant NKT
IP-10: interferon gamma-induced protein-10
KC: keratinocyte-derived cytokine
LPS: lipopolysaccharide
La-5: Lactobacillus acidophilus La-5
LTA: lipoteichoic acid
MCP-1: monocyte chemotactic protein-1
MFI: mean fluorescence intensity
MHC: major histocompatibility complex
MIP-1: macrophage inflammatory protein-1
MLN: mesenteric lymph node
MRS: Man, Rogosa and Sharpes
MyD88: myeloid differentiation primary response gene 88
NF: nuclear factor
NK: natural killer
NKT: natural killer T
NLR: NOD-like receptor
PAMP: pathogen-associated molecular pattern
PBMCs: peripheral blood mononuclear cells
PD-L1: programmed death ligand-1
PE: phycoerythrin
PG: peptidoglycan
PHA: phytohaemaglutinin
xx
PPs: Peyer’s patches
PRR: pattern recognition receptors
RA: rheumatoid arthritis
RANTES: regulated on activation normal T cell expressed
RAR: retinoid acid receptors
RIG: retinoic acid-inducible gene
RORγt: retinoic acid-related orphan receptor t
ss: single stranded
T-bet: T-box expressed in T cells
TLR: toll-like receptor
TNF: tumor necrosis factor
Th: T helper
Treg: regulatory T
VCAM-1: vascular cell adhesion molecule 1
VDR: vitamin D receptor
xxi
List of Symbols
Symbol Meaning Symbol Meaning
°C degree Celsius M molar
g gram mol mole
k kilo n nano
l liter p pico
min minute SD standard deviation
µ micro SEM standard error of the mean
Study groups Probiotic strain(s)/ Conditioned medium
LGG Lactobacillus rhamnosus GG
LC705 Lactobacillus rhamnosus LC705
Bb99 Bifidobacterium breve Bb99
PJS Propionibacterium freudenreichii subsp. shermanii JS
EcN Escheriahia coli Nissle 1917
GGmix LGG+PJS+Bb99+PJS
ECPJSmix PJS+EcN
LGG CM Cell-free conditioned medium of LGG
LGG CM+LGG Conditioned medium of LGG and LGG cells
xxii
General Background
Immunity
Immunity, in the biological point of view, is the capability of a body to defend
the hosts from getting diseases, infection or other unwanted invasions. It involves
both non-specific and specific components, namely innate and adaptive immunities
respectively. Innate immunity includes physical, chemical and cellular approaches. It
is the first line of the host defense against pathogens and is mediated by phagocytes
such as dendritic cells (DCs) and macrophages (Akira, Uematsu et al. 2006). Innate
immunity was originally thought to be non-specific; but indeed it is not that non-
specific as it is able to discriminate between self and non-self like pathogens by
recognizing pathogen-associated molecular patterns (PAMPs) on the pathogens via
pattern-recognition receptors (PRRs) like toll-like receptors (TLRs) (Akira, Uematsu
et al. 2006), membrane-bound C-type lectin receptors (CLRs) (Osorio and Reis e
Sousa 2011), cytosolic proteins like NOD-like receptors (NLRs) (Elinav, Strowig et
al. 2011) and RIG-1 like receptors (RIRs) (Loo and Gale 2011). Adaptive immunity,
also known as acquired immunity, is specific immune responses consisting of cell-
mediated and humoral immune response elicited by various types of lymphocytes, for
example, B cells, T cells, natural killer (NK) cells and natural killer T (NKT) cells. B
cells are intimately involved in humoral immune responses that they generate
antibodies circulated in blood plasma and lymph. T cells, NK cells and NKT cells,
however, play large roles in cell-mediated immune response. One of the key features
of adaptive immunity is that adaptive immunity can develop immunological memory.
1
Roles of TLRs in immunity
At least ten mammalian TLRs have been identified (10 in human and 12 in
mice) (Beutler, Hoebe et al. 2004). TLRs 1, 2, 4, 5 and 6 primarily, although not
exclusively, express on cell surface that mainly recognize microbial membrane
components such as lipoproteins. TLRs 3, 7, 8 and 9 however are endosomal
receptors that express on intracellular vesicle membrane and commonly ligate nucleic
acids such as DNA and RNA (Akira, Uematsu et al. 2006). Apart from TLRs, there
are various types of RNA-sensing systems, including retinoic acid-inducible gene
(RIG) I, and RIG I-like receptors melanoma differentiation-associated protein 5 and
LGP2 (Kawai and Akira 2011, Kumar, Kawai et al. 2011).
TLRs express in various cell types such as epithelial cells of respiratory and
intestinal tracts (as they are continually exposed to bacteria), B cells, T cells and
above all antigen-presenting cells (APCs) like DCs, macrophages and monocytes
(Takeda, Kaisho et al. 2003). TLR 7 predominately express in plasmacytoid DCs and
to some extent in macrophages, monocytes and B cells while TLR 8 primarily
expresses in monocytes, macrophages and myeloid DCs (Hornung, Rothenfusser et al.
2002, Gantier, Tong et al. 2008, Alexopoulou, Desnues et al. 2012). Macrophages
and monocytes were found to express mRNA of almost all TLRs except TLR 3. TLR
3 has been found to be exclusively expressed by human DCs wherein maturation
induced by bacterial products of cytokines was associated with reduced expression
(Muzio, Bosisio et al. 2000).
Each of the TLRs is associated with the recognition of specific PAMPs. TLR
2 can form dimmers with TLRs 1 or 6 for sensing different PAMPs. Table 1 and
2
Figure 1 show the example of bacterial components that being recognized by specific
TLRs. Responses evoked upon recognition of PAMPs; and activation of TLRs
depends on cell types and pathogens involved (Akira, Uematsu et al. 2006).
3
Table 1. Table of TLR recognition of bacterial components (Takeda, Kaisho et
al. 2003, Akira, Uematsu et al. 2006)
TLRs Bacterial Components
TLR 1/TLR2 Triacyl lipopeptides
TLR 2/TLR 6 Diacyl lipopeptides
Lipoteichoic acid (LTA)
TLR 2 Peptidoglycan (PG)
Lipoproteins
Porins
Lipoarabinomannan
TLR 4 Lipopolysaccharides (LPS)
TLR 5 Flagellin
TLR 7 ss/ds RNA (Mancuso, Gambuzza et al.
2009, Blasius and Beutler 2010)
TLR 8 ss/ds RNA (Blasius and Beutler 2010,
Cervantes, Weinerman et al. 2012)
TLR 9 CpG-DNA
4
Figure 1. TLR recognition of bacterial components
After ligation with PAMPs, TLRs are activated and commonly stimulate
signaling pathway that is mediated by myeloid differentiation primary response gene
88 (MyD88) adaptor molecule (Takeda, Kaisho et al. 2003, Gray, Foy et al. 2004,
Guerrero, Cunha et al. 2012). MyD88 recruits a death domain-containing
serine/threonine kinase named interleukin (IL)-1R-associated kinase (IRAK), which
is activated by phosphorylation and associates with tumor necrosis factor receptor-
associated factor 6 (TRAF6) subsequently to stimulate two distinct signaling
pathways, namely c-Jun N-terminal kinase (JNK) and nuclear factor (NF)-κB
(Medzhitov, Preston-Hurlburt et al. 1998, Muzio, Natoli et al. 1998, Muzio, Ni et al.
2013). Activation of endosomal TLRs will usually lead to production of type 1 IFN
(i.e. IFNα and IFNβ) and various NF-κB-associated cytokines such as tumor necrosis
5
factor (TNF) (Kawai and Akira 2011). In addition to pro-inflammatory signaling,
PAMPs may also stimulate cellular secretion of anti-inflammatory cytokine IL-10
(Du, Kelly et al. 2006, Chau, McCully et al. 2009).
Apart from innate immunity, recognition of microbial components also
triggers adaptive immunity, which is usually via DCs. Maturation of DCs is induced
by ligating TLRs with PAMPs and antigen uptake. Expression of costimulatory
molecules, cluster for differentiation (CD)80 and CD86; and production of Th-1
associated cytokine IL-12 will be induced (Akira, Takeda et al. 2001). Matured DCs
will have relatively lower antigen-uptake capability but higher antigen-presenting
aptitude than immature DCs. Microbial antigens are expressed with human leukocyte
antigen class II (HLA-DR) (HLA-DR, human; major histocompatibility complex
(MHC) class II, mice) on DCs to naïve T cells to initiate antigen-specific adaptive
immune response (Reis e Sousa 2001, Lee and Iwasaki 2007). Type 1 immune
responsiveness is mediated by MyD88-dependent pathway as MyD88-deficient DCs
have been demonstrated to have defective production of IFNγ from CD4+ T cells and
antigen-specific immunoglobulin (Ig) G2a (Schnare, Barton et al. 2001) and to
promote Th2 cell differentiation (Kaisho, Hoshino et al. 2002).
Since TLRs are of chief superiority in innate and adaptive immunities, their
expressions and functionalities have been proved to be highly related to various
diseases and infections, for example, reduced expression and functional impairment
of TLR 2 on DCs show lesser ability to proliferate T cells against Hepatitis C virus
(HCV) infection than healthy population (Yakushijin, Kanto et al. 2006).
6
Antigen-presenting cells (APCs) and lymphocytes
Antigen-presenting cells (APCs) are immunocompetent cells that can capture,
process and present antigens associated with MHC class I or MHC class II molecules
on their surface during the maturation process (Sharon 1998). Costimulatory and
adhesion molecules will also be expressed on fully matured APCs to prime T cells
and induce them into polarizing effectors. They produce cytokines and/or chemokines
that required for T cell proliferation, differentiation and responsiveness (Maassen,
van Holten-Neelen et al. 2000, Pochard, Gosset et al. 2002, Chen, Tuttle et al. 2005,
Zhang, Wang et al. 2013), for example, IL-12 secreted by APCs will promote Th1
polarization (Sharon 1998). They play a decisive role in sensing potential dangers to
initiate antigen-specific immune responses or in induction of immunological
tolerance (Guermonprez, Valladeau et al. 2002). APCs include dendritic cells,
macrophages and at certain extent monocytes.
Dendritic cells (DCs)
Dendritic cells (DCs) are specialized cells in immune system that usually act
as a sentinel to activate adaptive immune responses against invasion (Rojo 2009).
They have been considered as one of the most vital professional APCs. They are sub-
classified into myeloid and plasmacytoid based on their phenotypes, functions and
origins. Differently differentiated DCs would have different characteristics. For
example, IL-10-differentiated monocyte-derived dendritic cells (DC10) have been
reported to express less CD40, CD80 and HLA-DR, inhibit production of
inflammatory (such as IL-6 and IL-12) and anti-inflammatory cytokines (such as IL-4,
7
IL-5 and IL-13) and suppress proliferation of Th2 cells by promoting development of
CD25+FOXP3+ regulatory T (Treg) cells (Li, Yang et al. 2010).
DCs are morphologically and functionally specialized APCs that locate at
surveillance interfaces of most human organs (Rupec, Boneberger et al. 2010) such as
intestine. They exist throughout the intestine where they extend their protrusions into
the intestinal lumen to actively capture antigens across the epithelium (Rescigno,
Urbano et al. 2001, Niess, Brand et al. 2005). Efficient antigen internalization is done
by receptor-mediated endocytosis, phagocytosis and micropinocytosis (Guermonprez,
Valladeau et al. 2002). Efficient antigen internalization is specifically attributed to
immature DCs. During maturation, capability of antigen uptake will be down-
regulated by reducing cell surface expressions of most antigen recognition receptors,
phagocytosis and micropinocytosis (Guermonprez, Valladeau et al. 2002). APCs
recognize non-self PAMPs in surrounding environment via TLRs and CLRs (Joffre,
Nolte et al. 2009, van Vliet, Steeghs et al. 2009) and internalize them to induce
maturation, in which antigens are degraded into peptides to be loaded onto MHC
intracellularly and expressed together with lymphocyte co-stimulatory molecules
(CD80 and CD86) on the cell surfaces (Banchereau and Steinman 1998). Mature
APCs may then migrate to lymphoid organs to secrete cytokines for activating
adaptive immune responses (Akira, Takeda et al. 2001, Schnare, Barton et al. 2001,
Ma, Pan et al. 2009) like T-cell immune responsiveness. Apart from activating T cells,
they can also tolerize T cells to antigens that are innate to the body (self-antigens),
thereby minimizing autoimmune reactions. In addition to the interaction between
DCs and lymphocytes, DCs and DCs have been shown to interact to form a novel
8
cross-dressed DC subsets, which drive memory CD8+ T cell activation after viral
infection by acquiring antigen-MHC I complexes (Wakim and Bevan 2011).
Macrophages
Macrophages are one of the main APCs that are pivots in innate and adaptive
immunities. They serve as sentinel that sense microbial products and aberrant self
antigens via TLRs to stimulate phagocytosis, cellular activation and release of
cytokines, chemokines, proteolytic enzymes and growth factors (Kawai and Akira
2011).
Macrophages can be divided into two populations – resident and recruited.
Resident macrophage population can be found in different organs such as liver
(Kupffer cells), lungs (alveolar macrophages) and central nervous system (microglia),
which have tissue-specific phenotypes and adapt to their corresponding local
microenvironment due to surface and secretory products of neighbouring cells, and
extracellular matrix (Gordon 2003, Murray and Wynn 2011). They are strategically
located throughout the body to elicit immune surveillance. Resident macrophages are
involved in maintaining tissue homeostasis as they bear remarkable aptitude of
phagocytosis and digesting cellular debris, dying and dead cells and toxic materials
(Murray and Wynn 2011). Moreover, macrophages are involved in wound healing
(Leibovich and Ross 1975).
During pathogen invasion, macrophages are always one of the first line of
defenses and one of the critical mediators of inflammation. But indeed, macrophages
9
can also display anti-inflammatory properties, presumably to avoid excessive tissue
damage during infection. This is reflected from a remarkable plasticity of monocyte-
macrophage lineage (Mantovani, Sica et al. 2004, Gordon and Taylor 2005,
Mantovani, Sica et al. 2007, Mosser and Edwards 2008, Mege, Mehraj et al. 2011,
Schneberger, Aharonson-Raz et al. 2011). This high plasticity allows the
macrophages to respond to the environmental signals and change their phenotype
effectively.
Macrophages are commonly divided into classically activated M1-type
macrophages that defense hosts from bacteria, virus and protozoa and play a role in
anti-tumor immunity; and alternatively activated M2-type macrophages that bear
anti-inflammatory functions and regulate wound healing (Mege, Mehraj et al. 2011,
Murray and Wynn 2011). M2-type macrophages are sometimes known as regulatory
macrophages (Mosser and Edwards 2008). M1-type macrophages are generated
during cell-mediated responses. They produce both IFNγ and TNF to support
tumoricidal and microbicidal activity; and are pro-inflammatory mediators that fortify
production of IL-12, TNFα, CC chemokines as well as NO synthase (Mosser and
Edwards 2008). IL-12 and TNFα are two major macrophage-derived mediators of
inflammatory responses in humans (Ma 2001). M2-type macrophages are potent
inhibitors of inflammation that produce high level of anti-inflammatory and
immunosuppressive cytokine IL-10 but low level of IL-12 (Gerber and Mosser 2001)
to inhibit the production and activity of various pro-inflammatory cytokines. M2-type
macrophages normally express high levels of co-stimulatory molecules, CD80 and
CD86, to present antigens to T cells (Edwards, Zhang et al. 2006). With IL-10, IL-4
10
or IL-13, M2-type macrophages may allow full differentiation into M2a, M2b and
M2c macrophages with different cell surface properties and capacity to secrete
immune mediators (Leidi, Gotti et al. 2009). M2-type macrophages express high
levels of scavenger receptors and factors for promoting angiogenesis (proangiogenic
factors) to facilitate tissue repairing and remodeling (Mantovani, Sica et al. 2004,
Gordon and Taylor 2005, Mantovani, Sica et al. 2007, Mege, Mehraj et al. 2011).
However, M2-type macrophages are tumor-associated macrophages that promoted
tumor progression (Sica, Schioppa et al. 2006). CD206 is a macrophage mannose-
receptor (Dasgupta, Bayry et al. 2007) that the increase in its expression can
distinguish alternative activation of macrophages from classical activation. Increase
in CD206 expression will stimulate production of CCL2 and IL-6, which change the
ratio of M1-to-M2 macrophages and induce M2-type macrophage polarization in
human peripheral blood (Roca, Varsos et al. 2009, Fridlender, Kapoor et al. 2011).
CD206 expression level of macrophages has recently been found to be related to
acute pancreatitis-associated acute lung injury (Akbarshahi, Menzel et al. 2012).
Monocytes
Monocytes, to a certain extent, are APCs. They sense non-self antigens via
TLRs, similar to DCs and macrophages. A recent study showed that human CD14lo
monocytes patrol and sense nucleic acids and viruses via TLRs 7 and 8 (Cros,
Cagnard et al. 2010).
11
Monocytes are circulating mononuclear phagocytes with a fundamental
capacity to differentiate into macrophages or DCs when entering tissues, depending
on the millieu (Randolph, Jakubzick et al. 2008). CD16+ monocytes have been
reported to spontaneously undergo apoptosis during differentiation into macrophages;
but CD16- monocytes differentiate into macrophages with minimal induction of cell
death (Castano, Garcia et al. 2011). Moreover, CD16+ monocytes are more prone to
produce TNFα than other monocyte subsets (Castano, Garcia et al. 2011). The
primary role of monocytes is to replenish the pool of tissue-resident macrophages and
DCs in steady state and in responses to inflammation (Murray and Wynn 2011).
Human monocyte heterogeneity is based on the expression of CD14 and
CD16. Different subsets have different phenotypes, characteristics and functions.
Monocytes are generally subdivided into three subsets − "classical", "intermediate"
and "non-classical". CD14hiCD16- monocytic subset is considered "classical";
CD14hiCD16lo monocytic subset is considered "intermediate"; and CD14loCD16lo,
CD14loCD16hi and CD14hiCD16hi monocytic subsets are considered "non-
classical" (Passlick, Flieger et al. 1989, Grage-Griebenow, Flad et al. 2001, Gordon
and Taylor 2005, Cros, Cagnard et al. 2010, Wong, Tai et al. 2011). CD14hiCD16-
subset is the major population of human monocytes (~90%) (Wong, Tai et al. 2011),
which represent the majority of circulating monocytes in human; while
CD14loCD16lo monocytic subset patrol the vasculature for maintaining tissue
integrity and repairing (Smeekens, van de Veerdonk et al. 2011).
CD14loCD16lo monocytic subset usually shows a relatively high expression
level of HLA-DR when compared with other monocytic subsets (Passlick, Flieger et
12
al. 1989), suggesting that CD14loCD16lo monocyte subset may bear relatively higher
antigen-presenting aptitude like CD14hi monocyte subsets (Thomas and Lipsky
1994). CD14hiCD16lo monocyte subset secretes significantly more TNFα but little
or even none of IL-10 (Stec, Weglarczyk et al. 2007). CD14hiCD16lo and
CD14loCD16lo monocytic subsets tend to release pro-inflammatory cytokines such
as IL-12 (Stec, Weglarczyk et al. 2007, Ziegler-Heitbrock 2007).
Both CD14hiCD16- and CD14loCD16lo subsets have been reported to be
capable to exert innate antifungal properties; but only the former is able to induce
potent type 17 immune response, which is important to antifungal host defense, to
fungal infection such as Candidiasis (Smeekens, van de Veerdonk et al. 2011).
CD14hiCD16lo monocytic subset has been reported to be independently associated
with cardiovascular events in non-dialysis chronic kidney disease patients (Rogacev,
Seiler et al. 2011). CD14loCD16lo monocytic subset has been documented to be
related to atherosclerosis, bacterial infections, rheumatoid arthritis (RA) and diabetes
(Ziegler-Heitbrock 2007). In addition, CD14loCD16lo monocytic subset has been
recently shown to perpetuate intrahepatic inflammation in patients with chronic liver
disease (CLD) (Zimmermann, Seidler et al. 2010).
Natural killer (NK) cells
Although natural killer (NK) cells have long been known as an effector cell in
innate immunity, they are able to cross-talk with APCs such as DCs to participate
directly in adaptive immune responses (Gerosa, Baldani-Guerra et al. 2002). NK cells
13
might acquire MHC class II from DCs by trogocytosis, a transfer of plasma
membrane fragment from APCs to lymphocytes that have been documented in T, B
and NK cells in vitro and in vivo (Joly and Hudrisier 2003), to generate MHC class
II-dressed NK cells to regulate CD4+ T cells (Nakayama, Takeda et al. 2011).
Tissue distribution of NK cell subsets in different non-lymphoid (e.g. liver)
and lymphoid (e.g. spleen) organs as well as peripheral blood of mice is diverse. Both
mature (Mac-1hiCD27hi and Mac-1hiCD27lo) (Hayakawa and Smyth 2006) and
immature NK cells could be found in the liver, spleen and peripheral blood of the
mice in different mature-to-immature-NK cell ratio with the highest in the blood but
similar in liver and spleen (Hayakawa, Huntington et al. 2006). Expression of
activating receptors was similar among NK cells subsets; but that of inhibitory
receptors was distinct. A higher proportion of CD27lo NK cells expressed self-
recognizing killer cell lectin-like receptor G1 (KLRG1) and particularly Ly49C/I
inhibitory receptors in C57BL/6 mice, resulting in a relatively stringent regulation on
cytotoxic activity when compared with CD27hi subset (Crowe, Coquet et al. 2005).
NK cells have been known to carry out cytotoxic activities and constitutively
produce various cytokines (e.g. IFNγ, TNFα and IL-10) before the adaptive effector
cells do. Among the mature NK cell subsets of mice, production of IFNγ by CD27hi
NK cells is considerably higher than that of CD27lo NK cells upon stimulation of IL-
12 and/or IL-18 or in response to DCs (Scharton and Scott 1993, Hayakawa and
Smyth 2006, Lee, Hong et al. 2009).
14
T cells
T cells are one of the lymphocytes, which have unique T cell receptors (TCRs)
that other lymphocytes do not have. Vast majority of them develop in thymus. They
are not one of the APCs like B cells since they do not have antigen-presenting
aptitude. T helper (Th) cells, regulatory T (Treg) cells, cytotoxic T lymphocytes
(CTLs) and natural killer T (NKT) cells are ones of the T lymphocytes.
T helper (Th) cells
T helper (Th) cells express CD4+ and TCR, which ligate MHC class II-
antigen complex on APCs to activate Th cells. Th cells can be subdivided into Th1,
Th2 and Th17 cells, which are derived from naïve T cells (also known as Th0 cells)
and have specific cytokine secretion profiles (Mosmann and Coffman 1989,
Mosmann and Coffman 1989).
Th1 and Th2 cells
Th1 and Th2 cells have long been known to mediate immune responses
against intracellular and extracellular pathogens respectively (Mosmann and Coffman
1989). Over-expression of Th1 may lead to autoimmune diseases such as sclerosis,
uveitis and encephalomyelitis; whereas that of Th2 may result in asthma and allergy
disorders. Th2-skewed diseases may be relieved by Th1 immune response promotion
(Pohjavuori, Viljanen et al. 2004) while Th1-induced autoimmune diseases may be
relieved by promoting Th2 immune responses (Saoudi, Kuhn et al. 1993). IFNγ
15
produced mainly by Th1 cells is potent to activate macrophages as a result of
increasing microbicidal activities (Suzuki, Orellana et al. 1988) whereas IL-4 from
Th2 chiefly regulates the IgE (immunity to parasitic worms) class switching in B
cells (Kopf, Le Gros et al. 1993). In addition to IL-4, IL-5, IL-9, IL-13 and IL-23 are
Th2 cytokines (Noelle and Snow 1992, Kopf, Le Gros et al. 1993). IL-5 recruits
eosinophils (Coffman, Seymour et al. 1989). IL-9 induces the production of mucin in
epithelial cells during allergic reactions (Longphre, Li et al. 1999). IL-13 is key
mediator in allergic asthma and in gastrointestinal nematode parasitic expulsion
(Urban, Noben-Trauth et al. 1998, Wynn 2003). IL-23 initiates and amplifies Th2
response and induce productions of chemokine like regulated on activation normal T
cell expressed (RANTES) and eotaxin for eosinophil recruitment (Zhu and Paul
2008). T-box expressed in T cells (T-bet) has been reported as a Th1 transcription
factor that initiates Th1 lineage development from naive Th0 cells and controls
expression of hallmark Th1 cytokine, IFNγ, in Th1 and NK cells (Szabo, Kim et al.
2000). Over-expressed T-bet in Th2 cells may lead to production of IFNγ instead of
IL-4; yet lack of T-bet might cause asthma, at least in mice (Finotto, Neurath et al.
2002). GATA-binding protein-3 (GATA-3) is, on the other hand, Th2 master
transcription factor that mutually antagonize with IL-12 signaling; thereof over-
expression of GATA in Th1 cells induces IL-4 production whereas absence of
GATA-3 abrogates optimal Th2 differentiation both in vitro and in vivo entirely
(Ouyang, Ranganath et al. 1998, Pai, Truitt et al. 2004, Zhu, Min et al. 2004).
Knockout of GATA-3 in Th2 cells that have already been differentiated from naïve
16
Th0 cells can curb IL-5 and IL-13 productions (Pai, Truitt et al. 2004, Tamauchi,
Terashima et al. 2004).
Th17 cells
Th17 cells are a CD4+ T cell subset that deviates from classical Th1 and Th2
cells (Harrington, Hatton et al. 2005, Park, Li et al. 2005). They are incapable to
produce but suppressed by IFNγ and IL-4, which are signature cytokines of Th1 and
Th2 immune responses respectively. The differentiation of Th17 cell lineage is
mastered by a transcription factor, RORγt (Ivanov, McKenzie et al. 2006). Over-
expression or lack of retinoic acid-related orphan receptor-gamma t (RORγt) seems
only influence the production of IL-17, in which RORγt-deficient cells produces very
little IL-17 (Zhu and Paul 2008). Th17 cells are important to the host mucosal anti-
microbial defense including activity against fungal infections such as candidiasis and
aspergillosis (Zelante, De Luca et al. 2009, Gladiator, Wangler et al. 2013); however
overactive Th17 responsiveness is associated with inflammatory autoimmune
diseases such as arthritis, multiple sclerosis, psoriasis, and lupus (Waite and Skokos
2012). Th17 cells have been shown to link to the development and function of Treg
cells through TGFβ (Weaver, Harrington et al. 2006). The cytokine profile of Th17 is
IL-17, IL-21, IL-22 and IL-23. IL-17 is a signature cytokine that induces other
chemokine (e.g. IL-8; also known as CXCL8) resulting in inflammatory response
(Yao, Fanslow et al. 1995); and recruit and activates neutrophils (Fujiwara, Hirose et
al. 2007, Liang, Long et al. 2007) to combat extracellular bacteria and fungi. IL-6, IL-
21 and IL-23 promote Th17 differentiation, (Korn, Bettelli et al. 2007, Zhou, Ivanov
17
et al. 2007). IL-21 can also depress forkhead box P3 (FOXP3) expression (Nurieva,
Yang et al. 2007) and work on other cells such as DCs, NK cells, CD8+ T cells and B
cells in a pleiotropic manner (Leonard and Spolski 2005). IL-22 is an effector
cytokine that mediates the crosstalk between the immune system and epithelial cells,
resulting in regulating IL-23-mediated dermal inflammation and acanthosis (Zheng,
Danilenko et al. 2007); and provides protection to hepatocytes from acute liver
inflammation by serving as a protective molecule to counteract the destructive nature
of the immune response to limit tissue damage (Zenewicz, Yancopoulos et al. 2007);
but is inhibited by TGFβ (McGeachy, Bak-Jensen et al. 2007, Rutz, Noubade et al.
2011). A recent study implicated that gastrointestinal tract is a site for the control of
Th17 cells. It showed that Th17 cells are controlled by two different mechanisms in
the small intestine. First, they are eliminated via the intestinal lumen; second, pro-
inflammatory Th17 cells simultaneously acquire a regulatory phenotype with
immune-suppressive properties (Esplugues, Huber et al. 2011).
Regulatory T cells (Treg)
Regulatory T (Treg) cells are characterized by constitutive expressions of
CD4 and CD25 on the cell surface. They also express transcription factor named
FOXP3, which is also known as Scurfin (Khattri, Cox et al. 2003). FOXP3 is a
transcription factor specifically for CD4+CD25+ Treg cells, which is a critical
regulator of the development of Treg cells (Fontenot, Gavin et al. 2003, Hori,
Nomura et al. 2003). Continual expression of FOXP3 can also maintain the functions
of Treg cells (Williams and Rudensky 2007). Treg cells are known for maintaining
18
immunological self-tolerance. Attenuating FOXP3 expression may subvert the
suppressive function of Treg cells and convert them to Th2-like effectors even in a
Th1-polarizing environment (Wan and Flavell 2007).
Treg cells compose nearly 10% of peripheral CD4+ T cells in normal adult
animal. Increase in proportion of CD4+CD25+ thymocytes (developing-Treg cells) is
not simply due to reduction in the number of CD4+CD25- thymocytes (von Boehmer
2005) but due to its de novo generation since generation of CD4+CD25+ thymocytes
and negative selection of CD4+CD25- thymocytes are not mutually exclusive (Jordan,
Boesteanu et al. 2001, Apostolou, Sarukhan et al. 2002, Walker, Chodos et al. 2003).
Treg cells can suppress Th1 immune response by inhibiting the function of
DCs at the early stage of Plasmodium yoelii infection (Zheng, Wang et al. 2009);
prevent various autoimmune diseases (Asano, Toda et al. 1996) by limiting both
induction and effector function of autoreactive T cells (Suri-Payer, Amar et al. 1998);
and induce transplantation tolerance (Sakaguchi, Sakaguchi et al. 1995). Depletion or
inhibition of Treg cells however may help immunity against tumor and chronic
infectious agents (Zhu and Paul 2008). Treg-mediated immunosuppression depends
on cell-to-cell contact (Takahashi, Kuniyasu et al. 1998), inhibition of IL-2 (Thornton
and Shevach 1998, Almeida, Legrand et al. 2002, Furtado, Curotto de Lafaille et al.
2002, Malek and Bayer 2004) and production of IL-10 (Asseman, Mauze et al. 1999,
Annacker, Pimenta-Araujo et al. 2001, Suri-Payer and Cantor 2001), TGFβ
(especially on CD8+ T cells) (von Boehmer 2005) and IL-35. However, function of
Treg cells may be limited by IL-6 (Pasare and Medzhitov 2003). Production of IL-10
from Treg cells may be independent of FOXP3 (Roncarolo, Gregori et al. 2006,
19
Gavin, Rasmussen et al. 2007). IL-10 can also be generated by other CD4+ T cells to
exerts a negative regulation on immune responses to diminish or preclude tissue
damage in the hosts. IL-10 is non-redundant in preventing Treg-mediated
inflammatory bowl disease (IBD) (Asseman, Mauze et al. 1999) but may not be
essential for inhibition of colitis (Asseman, Read et al. 2003). TGFβ contribute to the
generation and proliferation of Treg cells (Huber, Schramm et al. 2004). IL-35 may
be specifically produced by Treg cells and is required for maximum suppressive
activity (Collison, Workman et al. 2007). Treg cells do not only suppress the early
proliferation stage of other T cells, but also change their homing receptors continually
to restrain the effector function of activated T cells at the inflamed sites, for instance,
integrin αEβ7- on mouse Treg cells can become αEβ7+ for migrating to the inflamed
sites to suppress activated T cells (Huehn, Siegmund et al. 2004). This is very
important for Treg cells to deal with the activated T cells, which no longer recirculate,
in non-lymphoid tissues.
Cytotoxic T lymphocytes (CTLs)
Cytotoxic T lymphocytes (CTLs) are CD8+ T cell, which are chief effector
cells in adaptive immunity against intracellular pathogens through the recognition of
MHC class I-antigenic peptide complexes (and co-stimulatory ligands) on APCs by
TCRs (and co-stimulatory receptors). CTLs are famous for their cytotoxic activity.
However, apart from their cytotoxic activity, synthesis of IFNγ from CD8+ T cells is
also important to their immune response since IFNγ is antiviral and macrophage-
activating (Goldberg, Belkowski et al. 1989). Activation of CD8+ T cell is mediated
20
prevailingly by CD4+ T cells, namely Th1 cells (Cardin, Brooks et al. 1996, Riberdy,
Christensen et al. 2000) via IL-2 (Taniguchi and Minami 1993). CD4+ T cells also
help in the development of functional CD8 memory (Shedlock and Shen 2003). A
recent study showed that IL-4 may induce IFNγ expression in CD8+ T cells
depending on STAT6 but not T-bet and Eomesodermin (Oliver, Stolberg et al. 2012),
both of which are key transcription factors of cytotoxic lymphocyte lineages.
NKT cells
Most natural killer T (NKT) cells, commonly known as invariant NKT (iNKT)
cells, express semi-invariant TCR (Bordon 2011) composed of invariant α-
(Vα24Jα18 in humans and Vα14Jα18 in mice) and β-chains (Godfrey, MacDonald et
al. 2004) as well as some NK cell receptors. Semi-invariant TCRs bind to MHC class
I-related glycoprotein CD1d (Brigl and Brenner 2004, Bendelac, Savage et al. 2007)
presenting isoglobotrihexosylceramide, the first known natural glycosphingolipid
ligand for human and mouse iNKT cells (Zhou, Mattner et al. 2004, Chen, Xia et al.
2007), microbial α-glycuronylceramides (Kinjo, Wu et al. 2005, Bendelac, Savage et
al. 2007) and marine sponge-derived glycolipid α-galactosylceramide (αGalCer) – the
most potent activator of iNKT cells (Kawano, Cui et al. 1997). iNKT cells bridge
innate and adaptive immunities (Van Kaer, Parekh et al. 2011) as they can interact
with APCs and carry out helper-, effector- and adjuvant-like functions (Brigl and
Brenner 2004). For example, they can mature DCs and B cells into APCs and
antibody-secreting plasma cells respectively (Kitamura, Iwakabe et al. 1999, Galli,
21
Nuti et al. 2003, Fujii, Shimizu et al. 2007, Leadbetter, Brigl et al. 2008, Liu, Uemura
et al. 2008, Leavy 2012).
NKT cells are broadly divided into CD4+ and CD4-, which are sub-divided
into CD4+CD8- (sometimes known as CD4+ NKT), CD4-CD8- and CD4-CD8+
(sometimes known as CD8+ NKT) subsets (Godfrey, MacDonald et al. 2004) with
distinct (Gumperz, Miyake et al. 2002, Seino and Taniguchi 2005) and overlapping
functions. Activation of functionally distinct iNKT subsets may vary their activities
in tumor rejection, autoimmune disease and microbial infections, influencing various
effector functions (Gumperz, Miyake et al. 2002). Hepatic CD4-CD8- NKT cells can
reject tumor in vivo (Crowe, Coquet et al. 2005). Both CD4-CD8- and CD4+NKT
cells induce similar levels of B cell proliferation but the latter can comparatively
induce higher levels of immunoglobulin production (Galli, Nuti et al. 2003). In
human, all iNKT subsets release Th1-associated (IFNγ and TNFα) and Th2-
associated (IL-4, IL-5 and IL-13) cytokines (Exley, Garcia et al. 1997) with the
amount in an order of CD8+ NKT cells >CD4-CD8- NKT cells >CD4+ NKT cells
and CD4+ NKT cells >CD4-CD8- NKT cells >CD8+ NKT cells respectively
(O'Reilly, Zeng et al. 2011), revealing that CD4+ NKT cells may have higher
potential in dampening Th1-related autoimmune diseases than other NKT subsets.
NKT cells can even release IFNγ and IL-4 simultaneously (O'Reilly, Zeng et al.
2011). CD8+ NKT cells display the most potent cytotoxic activity among NKT
subsets (O'Reilly, Zeng et al. 2011). NKT cells can produce IL-17, which is a rapid
innate production that precedes the adaptive Th17 response in the presence of TGFβ,
IL-1β and IL-23 (Moreira-Teixeira, Resende et al. 2011). CD4+ NKT cells can
22
release IL-9 and IL-10 (O'Reilly, Zeng et al. 2011). NKT cells in mice have been
reported to produce IL-22, a Th17-assoicated cytokine (Goto, Murakawa et al. 2009).
Murine NKT cells moreover produce IL-10 for Treg immune response (Jiang, Kojo et
al. 2007). NKT cells produce IFNγ, IL-17, IL-4 and IL-10 at certain extent
(Yoshimoto and Paul 1994, Leite-De-Moraes, Moreau et al. 1998, Stein-Streilein,
Sonoda et al. 2000, Smyth, Crowe et al. 2002, Moreira-Teixeira, Resende et al. 2011).
Since NKT cells are prominent in modulating both innate and adaptive immune
responses, they may be target for pathogens during invasion, for instance, NKT cells
are potent targets for human immunodeficiency virus (HIV) infection (Fleuridor,
Wilson et al. 2003).
Table 2. Table of major functions and characteristic cytokines of immune cells
Cell Type(s) Immune Major function(s) Characteristic

Cell(s) cytokine(s)/chemo
kine(s)
APCs Dendritic  Activate adaptive immune IL-4, IL-5, IL-6,
Cells responses against invasion IL-10, IL-12, IL-13
APCs Macrophag  Sense microbial products and M1-type: IFNγ,
es aberrant self antigens via TLRs TNFα, IL-12, CC
to stimulate phagocytosis, chemokines
cellular activation and release M2-type: IL-4, IL-
of cytokines, chemokines, 6, IL-10, IL-13,
proteolytic enzymes and growth CCL2
factors
 M1-type macrophages protect
hosts from bacteria, virus and
protozoa and play a role in anti-
tumor immunity
 M2-type macrophages bear
anti-inflammatory functions and
regulate wound healing
APCs Monocytes  Sense non-self antigens via TNFα, IL-10, IL-12
TLRs
 Differentiate into macrophages
23
or DCs when entering tissues,
depending on the millieu
 CD14hiCD16- and
CD14loCD16lo subsets exert
innate antifungal properties
 CD14hiCD16- subset induce
potent type 17 immune
response, which is important to
antifungal host defense, to
fungal infection such as
Candidiasis
 CD14hiCD16lo monocytic
subset may be associated with
cardiovascular events in non-
dialysis chronic kidney disease
patients
 CD14loCD16lo monocytic
subset is related to
atherosclerosis, bacterial
infections, rheumatoid arthritis
(RA) and diabetes; and
perpetuate intrahepatic
inflammation in patients with
chronic liver disease (CLD)
Innate Natural  Cross-talk with DCs to IFNγ, TNFα, IL-10,
immune cells Killer (NK) participate directly in adaptive IL-12, IL-18
cells immune responses; and acquire
MHC class II from DCs by
trogocytosis
 Exert cytotoxic activities and
constitutively produce various
cytokines at early stage
Lymphocytes Th1  Mediate immune responses IFNγ, IL-12
against intracellular pathogens
 Activate macrophages as a
result of increasing microbicidal
activities
 Over-expression may lead to
autoimmune diseases such as
sclerosis, uveitis and
encephalomyelitis
Lymphocytes Th2  Mediate immune responses IL-4, IL-5, IL-9,
against extracellular pathogens IL-13, IL-23
 Regulate the IgE, which is the
immunity to parasitic worms,
24
class switching in B cells
 Over-expression may result in
asthma and allergy disorders
Lymphocytes Th17  Protect the host from fungal IL-6, IL-17, IL-21,
infections such as candidiasis IL-22, IL-23,
and aspergillosis TGFβ, CXCL8
 Associated with inflammatory
autoimmune diseases such as
arthritis, multiple sclerosis,
psoriasis, and lupus
 Link to the development and
function of Treg cells through
TGFβ
Lymphocytes Treg  Maintain immunological self- IL-10, TGFβ, IL-35
tolerance
 Suppress Th1, Th2 and Th17
cells
 Prevent various autoimmune
diseases by limiting induction
and effector function of
autoreactive T cells
Lymphocytes Cytotoxic  Chief effector cells in adaptive IFNγ, IL-4
T immunity against intracellular
Lymphocyt pathogens
es (CTLs)  Exert cytotoxic activity
Lymphocytes Natural  Bridge innate and adaptive IFNγ, TNFα,
Killer T immunities by interacting with TGFβ, IL-4, IL-5,
(NKT) APCs and carrying out helper-, IL-9, IL-10, IL-13,
Cells effector- and adjuvant-like IL-17, IL-22
functions
 Mature DCs and B cells into
APCs and antibody-secreting
plasma cells respectively
 CD8+ NKT cells exert
cytotoxic activity
Communication within the immune systems
Immune cells have to “communicate”, be recruited to or away from the
inflammation sites and become appropriately activated in order to work efficiently
25
and properly (Parkin and Cohen 2001). Apart from cell-to-cell interaction, this can
also be achieved by external factors – cytokines and chemokines.
Cytokines
Cytokines are mainly released by immune cells. Cytokines are proteins,
peptides or glycoprotiens that are responsible for stimulating downstream signaling
pathways of the cells (Sharon 1998). Cytokine secretion profiles are commonly used
for distinguishing Th immune responsiveness. For example, IL-1α, IL-2, IL-7, IL-
12p70, IFNγ, TNFα and IL-27 are Th1-associated cytokine; IL-1β, IL-15, IL-17, IL-
21, IL-33, IL-23, IL-6 and IL-22 are Th17-associated cytokines; IL-4, IL-13 and IL-
25 are Th2-associated cytokines; IL-10 and IL-16 are Treg-associated cytokines.
Cytokines can also be classified according to their proinflammatory, inflammatory
and anti-inflammatory properties. For example, IL-12 (Trinchieri 1995) and IL-17
(Tanabe, Kinuta et al. 2008) are pro-inflammatory cytokines; TNFα (Carlson,
Wieggel et al. 1999, Szlosarek, Charles et al. 2006), IFNγ (Luth, Schrader et al. 2011)
and IL-1α (Carlson, Wieggel et al. 1999) are inflammatory; IL-4 is anti-inflammatory
cytokine (Lee, Hong et al. 2002); IL-6 is inflammatory and anti-inflammatory
cytokine (Tilg, Trehu et al. 1994, Carlson, Wieggel et al. 1999); and IL-10 is anti-
inflammatory and immunosuppressive cytokine (Lee, Hong et al. 2002, Couper,
Blount et al. 2008, Yilma, Singh et al. 2012).
They regulate the immune cells in an autocrine or paracrine manner (Fadok,
Bratton et al. 1998, Majka, Janowska-Wieczorek et al. 2001). Autocrine means
26
cytokine binds to the receptors on the same cells while paracrine means cytokine
binds to the receptors of nearby cells. Different cytokines have different functions
and properties. Some of the examples of the functions and properties of cytokines are
mentioned in above sections. Some of the cytokines may have more than one
activities on various cell types, for example, IL-2 on the one hand promotes Th1
differentiation from naïve Th0 cells; it on the other hand induces the formation of
CD8 memory cells during priming phase (Williams, Tyznik et al. 2006). Others may
induce the generation of other cytokines, which act on the cells to exert effects, for
example, IL-12, which is a heterodimeric proinflammatory cytokine induced by TLRs
and produced by APCs in response to pathogens during infection, induces the
production of IFNγ from NK and T cells that favours Th1 and CTL differentiation,
enhances cytotoxic activity of NK cells, forms links between innate resistance and
adaptive immunity, induces T-cell-dependent and independent activation of
macrophages, suppresses IgG and IgE production and resists bacterial and parasitic
infections (Trinchieri 1995, Ma 2001, Trinchieri 2003). IL-12 also elicits the
production of TNFα, which together with IFNγ is important to IL-12-mediated anti-
tumor activity (Zitvogel, Couderc et al. 1996). Still others may suppress the
generation and/or function of other cytokines, for example IL-10 inhibits IL-12 and
TNFα generation (de Waal Malefyt, Abrams et al. 1991, Aste-Amezaga, Ma et al.
1998); and TNFα inhibits IL-12 production as TNFα signaling is able to selectively
inhibit IL-12 gene expression upon macrophage activation, as kind of cytokine
feedback and self-limiting modulation (Ma 2001). Production of appropriate amounts
of cytokines is of paramount importance as if the amount is inappropriate or in excess,
27
pathological or dangers may be caused, for example, appropriate amount of IL-23
may protect the hosts against fungal infection caused by Candida albicans (Kagami,
Rizzo et al. 2010); however, if it is in excess, autoimmune inflammation of the brain
may be resulted (Cua, Sherlock et al. 2003).
Chemokines
Chemokines are chemotactic cytokines with potential in inducing chemotaxis
in nearby responsive cells such as leukocyte migration (Ono, Nakamura et al. 2003).
They are classified into four main subfamilies, namely CXC, CC, CX3C and XC
(Borish and Steinke 2003). CCL21, I-309, MCP-2 and RANTES are Th1-associated
chemokines; BCA-1 and MIP3a are Th17-associated chemokines; and MCP-1 is Th2-
associated chemokine. All of them are pro-inflammatory or inflammatory
chemokines. I-309, MCP-1, MCP-2 and RANTES are CC chemokines and play roles
in recruiting monocytes to the injured and infected sites (Uguccioni, D'Apuzzo et al.
1995, Tiffany, Lautens et al. 1997, Ono, Nakamura et al. 2003). BCA-1, also known
as CSCL13, is a CXC chemokine and a B cell-attracting chemokine (Jenh, Cox et al.
2001). MIP3a is a CC chemokine and a macrophage proinflammatory chemokine
(Rossi, Vicari et al. 1997). CCR5 is a receptor for chemokines − RANTES, MIP-1α,
MIP-1β and MCP-2 (Cocchi, DeVico et al. 1995, Gong, Howard et al. 1998). It
expresses predominantly on T cells and APCs such as macrophages. CCR5 was
reported to stimulate the production of IL-12 (Aliberti, Reis e Sousa et al. 2000).
28
Table 3. Table of Th-associated cytokines and chemokines
Th1-associated Th2-associated Th17-associated Treg-associated

CCL21 IL-4 BCA-1 IL-10
G-CSF IL-5 GM-CSF IL-16
I-309 IL-9 IL-1β
IFNγ IL-10 IL-6
IL-1α IL-13 IL-15
IL-2 IL-25 IL-17A
IL-7 MCP-1 IL-17F
IL-12(p70) IL-21
IL-27 IL-22
KC IL-23
MCP-2 IL-33
MIP-1α MIP3a
RANTES
TNFα
Probiotic bacteria
amounts confer a health benefit on the host (Guarner and Schaafsma 1998,
FAO/WHO 2001, Jardine 2009). They have been documented to be one of the
“Generally Recognized As Safe (GRAS)” products by Food and Drug Administration
(FDA) in the United States. After entering our bodies, they may colonize
commensally the colons (Jardine 2009). A detectable colonic population should be
maintained as a move to exert their corresponding effects (Kopp-Hoolihan 2001).
They may interact with prebiotics, which are dietary substrates that support the
growth of probiotic bacteria in vivo (Jardine 2009), to form synbiotics (Bengmark
2003).
Probiotics are more than bacteria as they should fulfill certain criteria. In
order to be successful bacterial probiotics, they must be unharmful human origins;
29
tolerate gastric juice; attach to the internal surface of gastrointestinal (GI) tracts;
avoid adherence of noxious micro-organisms onto the guts; release antimicrobial
compounds; and most importantly regulate immune responses (Iannitti and Palmieri
2010). Majority of the strains of these health-enhancing probiotics are lactic acid
bacteria, belonging to either Lactobacilli or Bifidobacteria.
Beneficial effects of probiotics
Probiotics may carry out various functions such as eliminating pathogenic
micro-organisms; minimizing toxins, mutagens and carcinogens; provoking apoptosis
of infected cells; synthesizing various antioxidants, nutrients and growth factors; and
above all mediating innate and adaptive immunities (Bengmark 2003). Probiotics
elicit their effects in a strain-specific (Kirjavainen, El-Nezami et al. 1999,
Wakabayashi, Nariai et al. 2008) and dose-dependent manner (Marin, Tejada-Simon
et al. 1998, Pochard, Gosset et al. 2002, Latvala, Pietila et al. 2008).
Lactobacilli
Lactobacilli supplemented in the diets of mice may manipulate and prevent
atopic dermatitis (AD); however, the effect elicited by Lactobacillus paracasei
KW3110 is more prominent than those obtained with Lactobacillus rhamnosus GG
(LGG) (Wakabayashi, Nariai et al. 2008). LGG induces beneficial Th1
immunomodulatory effects in infants with cow’s milk allergy or with IgE-associated
dermatitis (Pohjavuori, Viljanen et al. 2004). LGG has been demnonstrated to
30
suppress allergic airway inflammation in mouse offspring when applied at a very
early stage of life (Blumer, Sel et al. 2007), decrease gastrointestinal symptoms in
children with atopic dermatitis (Rosenfeldt, Benfeldt et al. 2004) and alleviate
intestinal inflammation in patients with atopic dermatitis and food allergy (Majamaa
and Isolauri 1997). LGG can bind with potent hepatocarcinogenic Aflatoxin B1
(AFB1) and hence significantly reduce its swift absorption at intestine (Gratz, Wu et
al. 2007). LGG has been documented to relieve intestinal inflammation in atopic
children by promoting IL-10 generation (Pessi, Sutas et al. 2000). LGG has been
shown to down-regulate both intestinal and systemic proinflammatory changes
induced by a high-fat diet in ApoE*3Leiden mouse model (Oksaharju, Kooistra et al.
2012). Lactobacillus plantarum NCIMB8826 and LGG have been shown to be useful
in preventing allergic diseases as they inhibit Th2-associated cytokine IL-4 by
increasing secretion of IL-12 and IFNγ (Pochard, Gosset et al. 2002). Certain
Lactobacillus strains such as Lactobacillus paracasei W72, Lactobacillus plantarum
W59 and Lactobacillus salivarius W24 divert the immune systems of the hosts in a
regulatory or tolerant mode, which may help preventing or curing atopic diseases
(Niers, Timmerman et al. 2005). Lactobacillus acidophilus NCFM (La)-primed DCs
have been shown to attenuate Citrobacter rodentium colitis (Chen, Chiu et al. 2009).
However, a clinical study showed that LGG may not be able to prevent endoscopic
recurrence nor reduce the severity of recurrent lesions in patients with Crohn's
disease after curative resection (Prantera, Scribano et al. 2002). Moreover, LGG has
in vitro effects on enhancing IL-10 and IFNγ production of mononuclear cells; yet,
LGG supplementation during pregnancy appeared not to alter the proliferative
31
capacity or cytokine pattern of maternal and neonatal cord blood cells (Kopp,
Goldstein et al. 2008).
Table 4. Table of health benefits exerted by Lactobacilli
Probiotic strains Health benefits Reference
L. paracasei KW3110 May manipulate and (Wakabayashi, Nariai et

L. rhamnosus GG prevent atopic dermatitis al. 2008)
L. rhamnosus GG Induces beneficial Th1 (Pohjavuori, Viljanen et
immunomodulatory effects al. 2004)
in infants with cow’s milk
allergy or with IgE-
associated dermatitis
L. rhamnosus GG Suppresses allergic airway (Blumer, Sel et al. 2007)
inflammation in mouse
offspring when applied at a
very early stage of life
L. rhamnosus GG Decreases gastrointestinal (Rosenfeldt, Benfeldt et
symptoms in children with al. 2004)
atopic dermatitis
L. rhamnosus GG Alleviates intestinal (Majamaa and Isolauri
inflammation in patients 1997)
with atopic dermatitis and
food allergy
L. rhamnosus GG Binds with potent (Gratz, Wu et al. 2007)
hepatocarcinogenic
Aflatoxin B1 (AFB1) and
hence significantly reduce
its swift absorption at
intestine
L. rhamnosus GG Relieves intestinal (Pessi, Sutas et al. 2000)
32
inflammation in atopic
children by promoting IL-
10 generation
L. rhamnosus GG Down-regulates both (Oksaharju, Kooistra et al.
intestinal and systemic 2012)
proinflammatory changes
induced by a high-fat diet
in ApoE*3Leiden mouse
model
L. plantarum Prevent allergic diseases as (Pochard, Gosset et al.
NCIMB8826 they inhibit Th2-associated 2002)
L. rhamnosus GG cytokine IL-4 by increasing
secretion of IL-12 and IFNγ
L. paracasei W72 Enhance regulatory (Niers, Timmerman et al.
L. plantarum W59 response, which helps 2005)
L. salivarius W24 preventing or curing atopic
diseases
L. acidophilus NCFM Attenuates Citrobacter (Chen, Chiu et al. 2009)
rodentium colitis
L. rhamnosus GG May not be able to prevent (Prantera, Scribano et al.
endoscopic recurrence nor 2002)
reduce the severity of
recurrent lesions in patients
with Crohn's disease after
curative resection
Bifidobacteria
Similar to Lactobacilli, certain Bifidobacterium strains such as
Bifidobacterium infantis W52, Bifidobacterium longum W51 and Bifidobacterium
33
lactis W18 have been reported to be favourable to the prevention or treatment of
atopic disease as they enhance IL-10, which is important to regulatory immune
response or immunological tolerance, production (Niers, Timmerman et al. 2005).
With the use of influenza vaccination model, Bifidobacterium lactis Bb-12 (Bb-12)
may be an effective means to improve immune function by augmenting systemic and
mucosal immune responses to challenge (Rizzardini, Eskesen et al. 2012).
Bifidobacterium breve mediates anti-inflammatory and anti-allergic reactions by
modulating the expression of inflammatory molecules during the new born period
and by regulating the expression of co-stimulatory molecules during the weaning
period (Ohtsuka, Ikegami et al. 2012). Bifidobacterium breve appeared to relieve food
allergies as it suppresses the skewed Th2 response in allergic mice, increases the
number of Treg and IL-10-positive cells and improves the impaired intestinal
epithelial barrier function (Zhang, Chen et al. 2010). Intestinal Bifidobacterium
pseudocatenulatum JCM 7041 association in germ-free T cell receptor transgenic
mice down-regulates excessive immune responses to dietary antigens of the small
intestine but enhance those of the large intestine (Tsuda, Hosono et al. 2009).
However, no benefit is found from supplementation with Bifidobacterium lactis in the
treatment of eczema, when given as an adjunct to basic topical treatment, and no
effect on the progression of allergic disease in infant (Gore, Custovic et al. 2012).
Table 5. Table of health benefits exerted by Bifidobacteria

B. infantis W52 Prevent or cure atopic (Niers, Timmerman et al.
B. longum W51 disease as they enhance IL- 2005)
34
B. lactis W18 10 production
B. lactis Bb-12 Improves immune function (Rizzardini, Eskesen et
by augmenting systemic al. 2012)
and mucosal immune
responses to challenge
B. breve Mediates anti-inflammatory (Ohtsuka, Ikegami et al.
and anti-allergic reactions 2012)
by
 modulating the
expression of
inflammatory
molecules during the
new born period and
 by regulating the
expression of co-
stimulatory
molecules during the
weaning period
B. breve Relieves food allergies as (Zhang, Chen et al.
 it suppresses the 2010)
skewed Th2
response in allergic
mice
 increases the
number of Treg and
IL-10-positive cells
and
 improves the
impaired intestinal
epithelial barrier
35
function
Bi. pseudocatenulatum Down-regulates excessive (Tsuda, Hosono et al.
JCM 7041 immune responses to 2009)
dietary antigens of the small
intestine in germ-free T cell
receptor transgenic mice
B. lactis  No benefit is in the (Gore, Custovic et al.
treatment of eczema 2012)
when given as an
adjunct to basic
topical treatment
 No effect on the
progression of
allergic disease in
infant
Propionibacterium freudenreichii ssp. shermanii JS (PJS)
PJS, apart from LGG, has also been reported to down-regulate both intestinal
and systemic proinflammatory changes induced by a high-fat diet in ApoE*3Leiden
mice model as it reduces the plasma levels of markers of inflammation including
vascular cell adhesion molecule 1 (VCAM-1) and the amount of gonadal adipose
tissue (Oksaharju, Kooistra et al. 2012). PJS is commonly in use with Lactobacillus
LC705 (LC705), Bifidobacterium breve Bb99 (Bb99) and LGG to exert beneficial
effects to the hosts. For example, combination of PJS, LC705, Bb99 and LGG has
been shown to exert beneficial effects on gastric mucosa in Helicobacter pylori
infected patients (Myllyluoma, Kajander et al. 2007) and can be effective in
controlling oral Candida and hyposalivation in the elderly (Hatakka, Ahola et al.
36
2007). However, administration of combination of PJS and LC705 seemed not to
decrease serum lipids (Hatakka, Mutanen et al. 2008).
Table 6. Table of health benefits exerted by Propionibacterium freudenreichii ssp.

shermanii JS

Propionibacterium Down-regulate both (Oksaharju, Kooistra et
freudenreichii ssp. intestinal and systemic al. 2012)
shermanii JS proinflammatory changes
induced by a high-fat diet
in ApoE*3Leiden mice
model as it reduces the
plasma levels of markers
of inflammation including
vascular cell adhesion
molecule 1 (VCAM-1) and
the amount of gonadal
adipose tissue
Propionibacterium Exert beneficial effects on (Myllyluoma, Kajander et
freudenreichii ssp. gastric mucosa in H. pylori al. 2007)
shermanii JS, L. infected patients
rhamnosus LC705, B.
breve Bb99 and L.
rhamnosus GG
Propionibacterium Controls oral Candida and (Hatakka, Ahola et al.

freudenreichii ssp. hyposalivation in the 2007)
shermanii JS, L. elderly
rhamnosus LC705, B.
37
breve Bb99 and L.
rhamnosus GG
Propionibacterium Seemed not to decrease (Hatakka, Mutanen et al.
freudenreichii ssp. serum lipids 2008)
shermanii JS and L.
rhamnosus LC705
Escherichia coli Nissle 1917 (EcN)
EcN is a gram-negative probiotic bacterium. Its efficacy and safety in
maintaining remission in patients with ulcerative colitis has been shown to be
equivalent to the gold standard – mesalazine, which is an anti-inflammatory drug
used to treat IBD (Rembacken, Snelling et al. 1999, Kruis, Fric et al. 2004). EcN
shows effects in irritable bowel syndrome, especially in patients with altered enteric
microflora after gastroenterocolitis or administration of antibiotics (Kruis, Chrubasik
et al. 2012). Oral administration of EcN may be an effective strategy in prevention
and therapy of allergic inflammatory skin diseases (Weise, Zhu et al. 2011). EcN
supplementation to minocycline treatment improves the recovery of the intestinal
damage and prevents the reactivation of experimental colitis (Garrido-Mesa, Utrilla et
al. 2011).
Table 7. Table of health benefits exerted by Escherichia coli Nissle 1917

E. coli Nissle 1917  Cures and maintain (Kruis et al., 2004)
remission of (Rembacken et al. 1999)
ulcerative colitis
E. coli Nissle 1917 Shows effects in irritable (Kruis, Chrubasik et al.
38
bowel syndrome, especially 2012)
in patients with altered
enteric microflora after
gastroenterocolitis or
administration of antibiotics
E. coli Nissle 1917 Prevents allergic (Weise, Zhu et al. 2011)
inflammatory skin diseases
E. coli Nissle 1917 Improves recovery of (Garrido-Mesa, Utrilla et
intestinal damage and al. 2011)
prevents reactivation of
colitis
Mixture of probiotic strains
LGG has been shown to increase IFNγ production in stimulated peripheral
blood mononuclear cells (PBMCs) (Pohjavuori, Viljanen et al. 2004); however, when
LGG was mixed with LC705, Bb99 and PJS, IL-4 production in stimulated PBMCs
in infants with atopic eczema and cow's milk allergy increased (Pohjavuori, Viljanen
et al. 2004); and fermented milk supplemented with LGG, Bifidobacterium animalis
Bb-12 (Bb12) and Lactobacillus acidophilus La-5 (La-5) has been shown to prevent
antibiotic associated diarrhea (AAD) in adult patients (Wenus, Goll et al. 2008); and
reduce cumulative incidence of AD of infants but has no effect on atopic sensitization
(Dotterud, Storro et al. 2010). Mixture of Lactobacillus debruekkii bulgaricus,
Streptococcus thermophilus and Lactobacillus acidophilus appeared to improve or
prevent allergic recurrences in rhinopatic patients (Aldinucci, Bellussi et al. 2002).
Mixture of LGG, LC705, PJS and Bb99 has been shown to alleviate symptoms in
patients with irritable bowel syndrome (Kajander, Hatakka et al. 2005); and has been
39
indicated to be more useful and effective in inhibition of pathogen adhesion to human
intestinal mucus (Collado, Meriluoto et al. 2007) and modulate the gut microbiota of
infant for preventing atopic eczema (Kukkonen, Savilahti et al. 2007). Recommended
treatment for Helicobacter pylori infection induces long-term disturbances in the
intestinal microbiota; but intervention of mixture of LGG, LC705, PJS and Bb99
appeared to have only minor changes in the intestinal microbiota (Myllyluoma,
Ahlroos et al. 2007). Bifico capsules (combined Bifidobacterium, Lactobacillus and
enterococcus) increases Treg cells and reduce severity of experimental colitis in mice
(Zhao, Huang et al. 2013).
Interference, suppression or synergies might sometimes exist between
probiotics on mediating immunities (Lan, Cruickshank et al. 2005). Therefore, effects,
particularly those related to immunoregulations, of mixture of probiotics cannot be
simply extrapolated from their corresponding single probiotic individuals in the
mixture.
Probiotic-derived soluble factors
Probiotics are living micro-organisms which undergo metabolism. Most of the
probiotics are lactic acid bacteria. During fermentation, they will release soluble
factors such as metabolites, proteins, cell-wall constituents, lactic acid and DNA.
Taking LGG as an example. LGG produces p75 and p40 proteins (Yan, Cao et al.
2007), porcine serpine protease inhibitor, glyceraldehyde-3-phosphate dehydrogenase
(GAPDH), cell wall-associated hydrolase, transcriptional regulator and
40
phosphoglycerate kinase (Sanchez, Schmitter et al. 2009), which have been recently
identified.
These soluble factors play an important role in physiology of probiotics such as LGG
(Chatfield, Koo et al. 2005, Hathaway, Battig et al. 2007, Kinoshita, Uchida et al.
2008, Kinoshita, Wakahara et al. 2008, Sanchez, Schmitter et al. 2009) and were
postulated to exert benefits in the hosts. Beneficial effects of conditioned medium of
LGG (LGG CM) were investigated and most of them were found to be intestine-
related. LGG CM was reported to diminish radiation-induced apoptosis in a position-
dependent fashion; enhance intestinal crypt survival (Ciorba, Riehl et al. 2012);
fortify transepithelial resistance by increasing tight-junction protein synthesis (Seth,
Yan et al. 2008); and preserve cytoskeletal integrity to protect gut epithelial cells
from oxidant stress (Tao, Drabik et al. 2006). p75 and p40 proteins in LGG CM was
vital for gut homeostasis, promoting epithelial growth (Sanchez, Urdaci et al. 2010)
and minimizing hydrogen peroxide-induced epithelial barrier damage (Seth, Yan et al.
2008). p75 and p40 proteins may attenuate IL-1β-induced IL-8 production of
epithelial cells (Choi, Kim et al. 2008) and inhibit TNFα-induced apoptosis (Yan,
Cao et al. 2007).
Safety of probiotics
These beneficial effects of probiotics have been under mild dispute among
some researchers since the mechanisms of action of probiotics, especially those in
healthy experimental models, are not thoroughly comprehended and determined
41
(Ezendam and van Loveren 2006). Probiotics have been defined as non-pathogenic
micro-organisms with advantageous physiological influence and are safe to be used
in human; however, Ezendam (2006) contended that the use of probiotics cannot be
generalized in human population as the effects vary among strains (Ezendam and van
Loveren 2006). For instance, certain strains of probiotics that can positively regulate
allergy may trigger Th1 response and exacerbate autoimmune diseases negatively
(Ezendam and van Loveren 2006). Ezendam’s view was adopted by Besselink (2008)
that probiotics are not so suitable to be administered in patients with severe acute
pancreatitis (Besselink, van Santvoort et al. 2008). Therefore, it is of paramount
importance for us to comprehend thoroughly the immunomodulatory mechanisms of
each particular strain before using them in any treatment or prevention of diseases.
Probiotics and intestinal immunity and epithelial barrier
In ApoE*3Leiden mice fed with high fat diets, PJS has been proved to reduce
intestinal immunoreactivity of TNFα whereas LGG has been shown to increase
intestinal IL-10 (Oksaharju, Kooistra et al. 2012). LGG has been shown to stabilize
the intestinal barrier function and intestinal permeability of children with atopic
dermatitis (Rosenfeldt, Benfeldt et al. 2004); and reported to promote local antigen-
specific immune responses, particularly IgA class, prevent permeability defects and
confer controlled antigen absorption (Majamaa and Isolauri 1997). In addition, LGG
induces intestinal secretion of secretory IgA and TNFα in atopic children (Pessi,
Sutas et al. 2000). In healthy Bal/c male adult mice, Th1/Th2 balance is different
between small intestine and colon that IFNγ level is higher in the colon than in the
42
small intestine while IL-4 and IL-10 are predominant in small intestine; and IL-4
level in the small intestine is significantly higher than in the colon (Pavan,
Desreumaux et al. 2003). Lactobacillus lactis MG1363 has been shown to increase
IFNγ production of small intestine (Pavan, Desreumaux et al. 2003). Lactobacillus
acidophilus NCFM (La)-primed DCs have been shown to enhance mucosal IgA
production, reduce bacterial loads and increase mucosal IL-12, IL-10 and IFNγ
response (Chen, Chiu et al. 2009).
Bifidobacterium longum CECT 7347 increases NFκB expression and IL-10;
but reduced TNFα production at jejunal tissue sections of mice with enteropathy
(Laparra, Olivares et al. 2012). Bifidobacterium breve has been shown to improve the
impaired intestinal epithelial barrier function and increase intestinal IL-10 production
and number of Treg cells of mice with food allergy (Zhang, Chen et al. 2010).
Bifidobacterium pseudocatenulatum JCM 7041 (Bp) decreases IFNγ and IL-6
productions of intestinal Peyer's patches in Bb-associated germ-free OVA23-3 T cell
receptor transgenic mice (Tsuda, Hosono et al. 2009).
Specific probiotic strains exert differential immune modulation mediated by
the interaction between DCs and epithelial cells in the homeostasis of GI tract, for
example, Bifidobacterium lactis AD011 increased IL-10 production; Lactobacillus
acidophilus AD031 and Lactobacillus acidophilus AD031 increased TGFβ
production; and all of them decreased IL-6 production of DC-epithelial cell co-
culture (Kim, Park et al. 2012). Association of EcN and antibiotics – minocycline has
been reported to have additive beneficial effect in a DSS model or reactivated colitis
in mice as they reduce expression of TNFα, IL-1β, IL-2, MIP-2, MCP-1, ICAM-1,
43
iNOS and MMP-9 but increase that of MUC-3 and ZO-1 (Garrido-Mesa, Utrilla et al.
2011). Furthermore, a combination of Lactobacillus acidophilus NCC 2628,
Lactobacillus acidophilus NCC 2766 and Lactobacillus johnsonii NCC 2767 increase
intestinal IL-10 expression but decrease the ratios of TNFα/IL-10, IFNγ/IL-10 and
IL-12p40/IL-10, demonstrating that the combination of probiotics may reduce
intestinal inflammation in dogs with chronic enteropathies (Sauter, Allenspach et al.
2005).
Probiotics and systemic immunity
As far as systemic immunity is concerned, spleen, liver and peripheral blood
are generally taken into consideration. After Lactobacillus casei Shirota (LcS)
treatment, concavalin A-stimulated spleen cells of NOD mice produce less IFNγ but
more IL-2, IL-4, IL-6 and IL-10; and decrease the number of CD8+ T cells, which are
involved in destruction of β-cells (Matsuzaki, Nagata et al. 1997). As
abovementioned, Bifidobacterium breve has been shown to improve intestinal
epithelial barrier function and increase intestinal IL-10 production and number of
Treg cells in the spleens of mice with food allergy (Zhang, Chen et al. 2010). EcN
has been shown to reduce IL-4 and IFNγ along with elevated IL-10 production and a
tendency to increase TGFβ secretion in the spleens of mice with allergen-induced
dermatitis (Weise, Zhu et al. 2011). Lactobacilluus acidophilus increases concavalin
A-induced IFNγ production of lymphocytes of adults with atopic histories (Wheeler,
Bogle et al. 1997).
44
VSL#3, a cocktail of eight probiotic strains, seemed not to be able to reduce
TNFα expression in liver in ob/ob mice fed with high-fat diets (Li, Yang et al. 2003).
Lactobacillus plantarum DSM 15313 and Bifidobacterium infantis DSM 15159
significantly decrease hepatic TNFα when compared with liver injury control (Osman,
Adawi et al. 2007).
Myeloid DCs that exposed to Lactobacilli have been shown to up-regulate
HLA-DR, CD83, CD40, CD80 and CD86 expression and secrete high levels of IL-12
and IL-18, but not IL-10, indicating Th1 skewness and CTL promotion
(Mohamadzadeh, Olson et al. 2005). LGG increases secretion of Th1-associated IFNγ
of PBMCS in infants with cow’s milk allergy or with IgE-associated dermatitis
(Pohjavuori, Viljanen et al. 2004). Mixture of Lactobacillus debruekkii bulgaricus,
Streptococcus thermophilus and Lactobacillus acidophilus increased IFNγ production
in unstimulated PBMCs but decreased IL-4 production of phytohaemaglutinin
(PHA)-stimulated PBMCs of rhinopathic patients (Aldinucci, Bellussi et al. 2002).
LGG increase serum level of IL-10 in atopic children (Pessi, Sutas et al. 2000).
VSL#3 improves IL-6, IL-10 and TNFα levels in serum of patients with alcoholic
liver cirrhosis (Loguercio, Federico et al. 2005). Lactobacillus acidophilus
LAFTI®L10 significantly increases serum IFNγ level of fatigued athletes (Clancy,
Gleeson et al. 2006). The secretion of TNFα in in vitro DCs that isolated or derived
from human peripheral blood monocytes is enhanced by commensal Lactobacilli and
Bifidobacteria as well as by pathogenic Salmonella but that of those isolated from
human mesenteric lymph nodes would solely be promoted by the pathogenic ones
(O'Mahony, O'Callaghan et al. 2006).
45
Possible immunomodulatory mechanisms of action elicited by probiotics
Apart from the probiotic cells, soluble factors may also carry certain
immunomodulatory activities. One possible mechanism of action in which probiotics
elicit their immunomodulatory effects may be that the probiotic cells and/or soluble
factors mediate the local intestinal immune response, which is reflected on the
systemic levels.
Probiotic cells and their soluble factors may regulate their health effects
through the gut mucosal immune system and thereby modulate innate and adaptive
immune responses (Schiffrin and Blum 2002). They are recognized by TLRs of
intestinal epithelial cells (IECs) and/or APCs, which induce immunological cascades
subsequently (Vinderola, Matar et al. 2005, Kawai and Akira 2011). They may
modulate the responsiveness of T cells via regulation of APC function. Besides APCs,
epithelium is another critical player in the orchestration of immune responses.
Probiotic-stimulated IECs generate immune signals to immune cells in laminar
propria. Specialized epithelial M cells, a phenotype that occur in epithelium only over
organized lymphoid follicles, deliver probiotic cells and/or soluble factors by
transepithelial transport from lumen to organized lymphoid tissues within the mucosa
of small intestine and colon (Neutra 1998). Most of the M cells are located in Peyer’s
patches (PPs) and their apical surfaces are different from other epithelial cells that
they lack the highly organized brush border with uniform, closely packed microvilli
typical of enterocytes (Neutra 1998). Macrophages, DCs, T cells and B cells exist in
Peyer’s patch. It has been shown that macrophages in PPs can ingest probiotics like
46
Lactobacilli in a strain-dependent manner (Sun, Le et al. 2007). Antigens may then
stimulate APCs in the PPs and regulate the cytokine expression pattern of DCs and
macrophages (Miettinen, Lehtonen et al. 2000, Veckman, Miettinen et al. 2004).
Apart from the DCs in PPs, other DCs can extend their protrusions into the intestinal
lumen to actively capture probiotic cells and/or soluble factors across the epithelium
(Rescigno, Urbano et al. 2001, Niess, Brand et al. 2005). DCs will then become
mature and derive B cells into plasma cells, which may generate IgE and secretory
IgA. The latter is released into the gut lumen. Monocytes, which have been proved to
be differentiated by epithelial cells into intestine-like macrophage phenotype (Spottl,
Hausmann et al. 2001), will also uptake antigen for presentation.
Mast cells are important to mucosal surveillance at the sites of infection as
milk fermentation products of Lactobacillus helveticus R389 has been proved to
increase the number of mucosal mast cells and goblet cells (Vinderola, Matar et al.
2007). They are versatile tissue regulator cells, which control intestinal functions
such as epithelial secretion, integrity and function of the gastrointestinal barrier; and
can act as immunomodulatory cells by reacting to probiotic cells and soluble factors
through TLRs or through immunoglobulins bound on their cell surface (Bischoff and
Kramer 2007). Their functions can be enhanced by an intensive cross-talk of mast
cells with other cells of the innate or adaptive immune systems; and may act as
inflammatory cells when they are dysregulated by allergen, allergen-specific IgE and
cytokines, or invading microbes (Bischoff and Kramer 2007). Mast cells are involved
in the regulation of B-cell functions, such as production of IgE, by expressing IL-13
47
and CD40 ligand (Pawankar, Okuda et al. 1997, Lorentz, Schwengberg et al. 2000).
Cytokines produced by mast cells may be secreted into the intestinal lumen.
Antigen-primed mature DCs will then migrate to mesenteric lymph node
(MLN) (MartIn-Fontecha, Sebastiani et al. 2003) to mediate the differentiation of
naïve CD4+ Th0 cells into various Th subpopulations and proliferation of T cells
depending on cytokine secretion pattern. For example, IL-12 and IFNγ will promote
Th1 differentiation; IL-4 and IL-2 will promote Th2 differentiation; TGFβ and IL-6
will promote Th17 differentiation; and TGFβ and IL-12 will promote Treg
differentiation. CTLs will also be activated and promote cell-mediated immune
response and induce phagocytosis together with Th1 cells. Cytokines and T cells will
be drained into blood system and migrate to liver and spleen ultimately to regulate the
systemic immune responses there.
48
Figure 2. Postulated mechanism of action of probiotics
Probiotic cells and their soluble factors derived such as metabolites, proteins, cell-wall
constituents, lactic acid and DNA may mediate local intestinal immune response and hence
modulate systemic immunity. They are recognized by TLRs of IECs and/or APCs to induce
cytokine productions and T cell regulation. They are delivered by M cells by transepithelial
transport from lumen to macrophages, DCs, T cells and B cells or captured by protrusions of
DCs that extend into lumen. Antigen-primed mature DCs derive B cells into plasma cells
which generate IgE and IgA; and migrate to mesenteric lymph node to differentiate T cells.
Cytokines and T cells will be drained into blood system and migrate to liver and spleen
ultimately to regulate the systemic immunity. Monocytes are differentiated by epithelial cells
into macrophage-like monocytes while mast cells react with probiotic cells and soluble factors
through TLRs or immunoglobulins bound on their cell surface to produce cytokines.
49
Objectives
This project was composed of 5 independent but complementary studies with
following specific objectives:
1. Evaluate immunomodulatory effects of single and mixed probiotic strains on
local immunity in vivo;
2. Evaluate immunomodulatory effects of single and mixed probiotic strains on
systemic immunity in vivo.
3. Assess in vitro immunomodulatory effect of LGG bacteria on APCs;
4. Assess in vitro immunomodulatory effect of soluble factors derived by LGG
on APCs; and
5. Assess in vitro immunomodulatory effect of lactic acid on DCs preliminarily.
50
Chapter 1 Evaluation of in vivo
immunomodulatory effects of single and mixture of
probiotic strains on local immunity
1.1. Introduction
Epithelium lining the small and large intestines is supposed to be the first organ to
encounter probiotics as probiotics are always orally taken. It is believed that
probiotics regulates the local immunities in the gut, which acts as the pivot in
modulating the systemic immune responses (Hooper and Macpherson 2010, Salzman
2011, Blumberg and Powrie 2012, Hooper, Littman et al. 2012, Nicholson, Holmes et
al. 2012, Kamada, Seo et al. 2013). Probiotics have been widely used in foods, infant
formula and pills (Sanders 2003) and commercially marketed to healthy individuals
as boosters of the gut immune system. However, the knowledge of
immunomodulatory properties of probiotics on the gut of healthy individual is
lacking. This study was thus aimed at investigating the mechanism of probiotics in
regulating the local immune response in healthy C57BL/6 mice. Moreover, it was
aimed at studying how immunomodulatory properties of mixture of probiotics
(probiotic multispecies) deviated from the individual strains (probiotic monospecies).
51
1.2. Materials and Methods
1.2.1. Animals
6-week-old male C57BL/6 mice (n=4) were obtained from the Chinese University of
Hong Kong. They were kept in plastic cages in an air-conditioned room and given
free access to food and water. The study was performed under the approval of the
Animals (Control of Experiments) Ordinance (reference number 13-336).
1.2.2. Probiotic strains and feeding procedure
Lactobacillus rhamnosus GG (LGG), Propionibacterium freudenreichii subsp.
shermanii JS (PJS), Lactobacillus rhanmnosus LC705 (LC705) and Bifidobacterium
breve 99 (Bb99) were provided by Valio Ltd (Helsinki, Finland) while Escheriahia
coli Nissle 1917 (EcN) was provided by Ardeypharm GmbH, Germany. GGmix was
a mixture of LGG, PJS, LC705 and Bb99 while ECPJSmix was the mixture of EcN
and PJS. Suspensions of probiotics were freshly prepared from freeze-dried powders
in sterile saline (PBS). Mice were intragastrically administered with fixed dose of
probiotics (i.e. 107CFU) or mixtures of probiotics with the same total amount of
bacteria (i.e. 107CFU) by oral cavage needles daily for 3 weeks. Control mice were
treated in the similar manner but fed with sterile PBS only. During these three weeks,
standard rodent chow diet were provided ad libitum.
52
Table 1.1. List of probiotic strains used in the study
Single probiotic strains
Lactobacillus rhamnosus GG LGG
Propionibacterium freudenreichii subsp. PJS
shermanii JS
Lactobacillus rhanmnosus LC705 LC705
Bifidobacterium breve 99 Bb99
Escheriahia coli Nissle 1917 EcN 1917
Mixture of probiotic strains
LGG, PJS, LC705 and Bb99 GGmix
EcN1917 and PJS ECPJSmix
1.2.3. Body and organ weights
Body weights of the mice were measured every week. Mice were killed and organs
were isolated for experiments.
1.2.4. Intestinal fluid
Small intestines and colons of mice were divided into half and each of the segments
was flushed with 2.5ml ice-cold PBS. Rinse was centrifuged at 3000rpm for 5
minutes at 4°C. The rinse from small intestine was then centrifuged at 4000xg for 15
minutes at 4°C. The rinse was stored as aliquots at -80°C for later experiments.
53
1.2.5. Cytokine Profiling
Levels of cytokines, including IL-6, IL-10, IL-12(p40), IL-17A/F, IL-22 and IL-23,
were detected by enzyme-linked immunosorbent assay (ELISA) (Biolegend, San
Diego, CA, USA) and the assay procedure was as following. One day prior to
running the ELISA, 100µl of appropriate 1X capture antibodies was added to 96-well
ELISA plates. The plate was sealed and incubated in 4°C fridge overnight (16-18
hours). Reagents were brought to room temperature before use on the next day. The
plates that coated with capture antibodies were washed with wash buffer (PBS +
0.05% Tween-20) with 300µl per well four times. Residual buffer was blotted by
firmly tapping the plates upside down on absorbent paper. 200µl 1X assay diluent
was added to each well to block non-specific binding and reduce background. The
plate were sealed and incubated for 1 hour at room temperature with shaking at
200rpm on plate shaker. While the plates were blocking, standards were prepared.
After one-hour incubation, the plates were washed with wash buffer four times. 100µl
of standards or samples was added to appropriate wells. The plates were sealed and
incubated at room temperature for 2 hours with shaking. The plates were then washed.
100µl of appropriate detection antibodies were added to appropriate wells, sealed and
incubated at room temperature for 1 hour with shaking. The plates were washed four
times and added with 100µl Avidin-HRP solution per well; sealed and incubated for
30 minutes at room temperature with shaking. The plates were then washed five times.
For this final wash, wells were soaked in wash buffer for 1 minute for each wash to
minimize background. 100µl of freshly mixed TMB substrate solution was added to
the wells. The plates were incubated in the dark at room temperature for appropriate
54
length of time (i.e. IL-6, IL-10 and IL-22: 20 minutes; IL-12(p40): 15 minutes; IL-
17A/F and Il-23: 30 minutes). 100µl of stop solution (2N H2SO4) was added to each
well. Dual absorbance (absorbance at 570nm was subtracted from absorbance at
450nm) was read on microplate reader (Bio-Rad IMark).
1.2.6. Statistical Analysis
Data shown in the bar charts were presented as mean ± SEM. Kruskal-Wallis, one-
way ANOVA, Tukey HSD, LSD, two-tailed Student’s t and Mann-Whitney tests
were used to evaluate the significant differences between groups (p<0.100*,
p<0.05**, p<0.01*** and p<0.001****). Statistical calculations were performed
using SPSS 19 for Windows (Chicago, IL, USA) and GraphPad Software Prism 6.04
(San Diego, CA, USA).
55
1.3. Results
1.3.1. Single probiotic strains
1.3.1.1. Body weights
Figure 1.1. Body weights of mice fed with single probiotic strains
Body weights of mice of different experimental groups were measured weekly.

indicated the untreated group; indicated LGG-treated group; indicated
LC705-treated group; indicated PJS-treated group; indicated Bb99-treated
group; and indicated EcN-treated group. Data were presented as mean. *p<0.1,
**p<0.05, ***p<0.01, ****p<0.001 were considered significant.
Healthy wild type C57BL/6 mice were used in the study. Body weights of mice were
measured every week, which were served as an indicator of the healthy status of the
mice (Laaksonen, Sarlio-Lahteenkorva et al. 2005). As observed from Figure 1.1, no
significant difference could be found between and within groups. This implied that
the mice were healthy throughout the experimental period.
56
1.3.1.2. Cytokine profiling
57
Figure 1.2. Effect of single probiotic strains on cytokine secretions of small intestine and colon
Levels of (A and B) IL-17A/F, (C and D) IL-6, (E and F) IL-22, (G and H) IL-23, (I and J) IL-12(p40) and (K and L) IL-10 of small
intestine and colon of LGG-treated, LC705-treated, PJS-treated, Bb99-treated and EcN-treated groups are shown. Data are presented
as mean ± SEM. *p<0.10, **p<0.05, ***p<0.01, ****p<0.001 were considered significant.
58
Effects of single probiotic strains on cytokine secretion in small intestine and
colon
In small intestine, IL-17A/F (Fig. 1.2A) levels of LC705-treated, Bb99-treated and
EcN-treated groups were significantly lower than that of the untreated group and the
levels were almost half of that of the untreated group. Similarly, IL-6 (Fig. 1.2C)
levels of LC705-treated, Bb99-treated and EcN-treated groups were significantly
lower than that of the untreated group. IL-22 (Fig. 1.2E) levels of LC705-treated,
PJS-treated, Bb99-treated and EcN-treated groups were significantly lower than that
of the untreated group. However, IL-23 (Fig. 1.2G) levels of all treated group were
not significantly different from the untreated group although IL-23 level of LGG-
treated group was higher than that of the untreated while others were lower than that
of the untreated. IL-12(p40) (Fig. 1.2I) levels of LGG-treated and LC705-treated
groups were significantly lower than that of the untreated group and the levels were
about half of that of the untreated group. Although IL-12(p40) levels of PJS-treated
group were higher than that of the untreated group, it was not significantly different
from the untreated. IL-10 (Fig. 1.2K) levels of LC705-treated, Bb99-treated and EcN-
treated groups were significantly lower than that of the untreated group.
In colon, IL-17A/F (Fig. 1.2B) levels of LGG-treated, PJS-treated, Bb99-treated and
EcN-treated groups were significantly lower than that of the untreated group and the
levels were less than half of the untreated group. IL-17A/F level of LC705-treated
group was apparently lower than that of the untreated group; yet not significantly
different from the untreated. IL-6 (Fig. 1.2D) levels of LGG-treated, Bb99-treated
and EcN-treated groups were significantly lower than that of the untreated group.
59
Similar to IL-17A/F, IL-22 (Fig. 1.2E) levels of LGG-treated, PJS-treated, Bb99-
treated and EcN-treated groups were significantly lower than that of the untreated
group and the levels were almost four times lower than that of the untreated group.
IL-22 level of LC705-treated group was lower but not significantly different from the
untreated group. IL-23 (Fig. 1.2H) levels of LGG-treated, LC705-treated, Bb99-
treated and EcN-treated groups were significantly lower than that of the untreated
group. IL-23 levels of LC705-treated and Bb99-treated groups were about four times
lower than that of the untreated group. IL-12(p40) (Fig. 1.2J) levels of Bb99-treated
and EcN-treated groups were significantly lower than that of the untreated group. IL-
12(p40) level of Bb99-treated group was about three times lower than that of the
untreated group. IL-10 (Fig. 1.2L) level of LGG-treated group was significantly
lower than that of the untreated group.
60
1.3.2. Mixed probiotic strains
1.3.2.1. Body weights
Figure 1.3. Body weights of mice fed with mixture of probiotic strains
Body weights of mice of different experimental groups were measured weekly.

indicated the untreated group; indicated GGmix-treated group; and
indicated ECPJSmix-treated group. Data were presented as mean only. *p<0.1,
Mice that were fed with mixture of probiotic strains were healthy as well throughout
the experiment as no significant difference was shown on the weekly-measured body
weights (Fig. 1.3) between and within groups (Laaksonen, Sarlio-Lahteenkorva et al.
2005).
61
62
Figure 1.4. Effect of mixture of probiotic strains on cytokine secretions of small intestine and colon
Levels of (A and B) IL-17A/F, (C and D) IL-6, (E and F) IL-22, (G and H) IL-23, (I and J) IL-12(p40) and (K and L) IL-10 of small
intestine and colon of GGmix-treated and ECPJSmix-treated groups are shown. Data are presented as mean ± SEM. *p<0.10,
63
Effects of mixture of probiotic strains on cytokine secretion of small intestine
and colon
In small intestine, IL-17A/F (Fig. 1.4A) levels of GGmix-treated and ECPJSmix-
treated groups were significantly lower than that of the untreated group and the levels
were about half of the untreated group. IL-6 (Fig. 1.4C) levels of GGmix-treated and
ECPJSmix-treated groups were slightly but significantly lower than that of the
untreated group. Similar to IL-17A/F and IL-6, IL-22 (Fig. 1.4E) levels of GGmix-
treated and ECPJSmix-treated groups were significantly lower than that of the
untreated group. However, IL-23 (Fig. 1.4G) and IL-12(p40) (Fig. 1.4I) levels of
treated groups were not significantly different from the untreated group. IL-10 (Fig.
1.4K) levels of GGmix-treated and ECPJSmix-treated groups were significantly
lower than that of the untreated group.
In colon, IL-17A/F (Fig. 1.4B) levels of GGmix-treated and ECPJSmix-treated
groups were significantly lower than that of the untreated group. Similarly, IL-6 (Fig.
1.4D) levels of GGmix-treated and ECPJSmix-treated groups were significantly
lower than that of the untreated group. IL-22 (Fig. 1.4F) level of ECPJSmix-treated
group was significantly lower than that of the untreated group and the level was about
four times lower than that of the untreated. IL-23 (Fig. 1.4H) levels of GGmix-treated
and ECPJSmix-treated groups were significantly lower than that of the untreated
group and the levels were about four times lower than that of the untreated group. IL-
12(p40) (Fig. 1.4J) levels of GGmix-treated and ECPJSmix-treated groups were
significantly lower than that of the untreated group. IL-10 (Fig. 1.4L) level of
ECPJSmix-treated group was significantly lower than that of the untreated group.
64
1.4. Discussion
To the best of our knowledge, this is the first study to elucidate cytokine
secretions in small intestine and colon of healthy C57BL/6 mice. Our results showed
that LC705, Bb99. EcN, GGmix and ECPJSmix seemed to inhibit Th17 immune
response in small intestine of healthy mice as secretions of Th17-associated cytokines
(IL-17, IL-6 and IL-22) were suppressed. However, LC705 appeared not to suppress
Th17 immune response in colon; but LGG, PJS, Bb99, EcN, GGmix and ECPJSmix.
Previous studies have shown that IBD is induced by Th17-assoicated cytokines such
as IL-23 (Abraham and Cho 2009, De Nitto, Sarra et al. 2010, Monteleone, Pallone et
al. 2011, Weaver, Elson et al. 2013), suggesting that all of the single and mixture of
probiotic strains, particularly Bb99, EcN, GGmix and ECPJSmix, in this study may
have potential in preventing healthy individuals from IBD especially Crohn's diseases
(CD) and ulcerative colitis (UC) (Monteleone, Pallone et al. 2011).
Moreover, LGG in the study inhibited Th1 immune response in small intestine
while Bb99, EcN, GGmix and ECPJSmix inhibited Th1 immune response in colon as
they reduced IL-12 secretion. Suppression of Th1 immune responses in colon by
Bb99, EcN, GGmix and ECPJSmix further verified their potential in protecting
individuals from developing CD and UC (Kamada, Hisamatsu et al. 2005, Fuss,
Becker et al. 2006). A previous study showed that Th1/Th2 balance is different
between murine small intestine and colon. IFNγ is found to be predominant in colon
while IL-4 and IL-10 are found to be predominant in small intestine; and IL-4 level in
small intestine is significantly higher than that in colon (Pavan, Desreumaux et al.
2003). Inhibition of Th1 immune response by LGG, Bb99, EcN, GGmix and
65
ECPJSmix may be beneficial to prevent IBD; but the risk of being infected by
Helicobacter pylori, which is a spiral-shaped bacterium that commonly found in
gastrointestinal tract, may increase as IL-12 and Th1 immune response have been
reported to be crucial for H. pylori-specific protective immunity (Akhiani, Pappo et al.
2002).
LGG, LC705, Bb99, EcN, GGmix and ECPJSmix may enhance response to
luminal antigens (Denning, Campbell et al. 2000) as they decreased IL-10 secretions.
IL-10 is an immunosuppressive cytokine secreted by regulatory T (Treg) cells and
Th17/Treg balance in the lamina propria that influence intestinal immunity and
tolerance (Ivanov, Frutos Rde et al. 2008).
1.5. Conclusion
In conclusion, probiotics regulated the immune response differently at different
intestinal sections. In addition, intestinal immune response elicited by the mixture of
probiotics was different from their corresponding individual strains, indicating that
immunological effects of mixed probiotics cannot be simply extrapolated from the
individual strains. Overall, Bb99, EcN, GGmix and ECPJSmix may protect the
healthy population from having IBD as intestinal Th17 and Th1 immune responses
were suppressed. Knowing the effects of probiotics on intestinal cytokine secretions
of healthy mice will help to draw evidence-based outlines for the immunomodulatory
potential and novel clinical application of these strains, particularly for intestinal
diseases and infections.
66
Chapter 2 Evaluation of in vivo
immunomodulatory effects of single and mixed
probiotic strains on systemic immunity
2.1. Introduction
Immunomodulation elicited by probiotics in the gut of healthy mice has been
preliminarily studied in chapter one. This chapter was aimed at addressing the
immunomodulation of different probiotic strains and their mixtures on systemic and
liver immune profile in healthy C57BL/6 mice on normal diet. The correlation
between systemic immunity and intestinal immunity was also studied.
2.2.1. Animals
6-week-old male C57BL/6 mice (n=4-11) were obtained from the University of
Eastern Finland. They were kept in plastic cages in an air-conditioned room and
given free access to food and water. The study was performed under the approval of
Agriculture and Forestry Regulation on Animal Experimentation (36/2006) with
reference number 1360/1990.
67
2.2.2. Probiotic strains
Probiotic strains used in this chapter were the same as chapter one, namely LGG,
LC705, PJS, Bb99 and EcN; and two mixtures – GGmix (LGG, LC705, PJS and
Bb99) and ECPJSmix (PJS and EcN).
2.2.3. Feeding procedures
Refer to “Materials and Methods” section of chapter one.
2.2.4. Hepatocytes
Mice were killed by cervical dislocation. Livers were isolated and weighed. Gall
bladders were removed and the livers were cut into segments, which were
homogenized in a 70µm cell strainer and centrifuged (200xg for 5 min at 4°C). The
pellet was resuspended in complete RPMI-1640 medium and centrifuged (300xg for
3 min at 4°C). The pellet was discarded and the step was repeated twice. The
supernatant was centrifuged (300xg for 10 min at 4°C) and the pellet was
resuspended in RPMI-1640 medium. OptiPrepTM working Solution (OPWS)-40%
iodixanol (Sigma Chemical, St. Louis, Mo., USA) was added and then layered with
Hank's Balanced Salt Solution (Sigma). The cell suspension was centrifuged (1500xg
for 20 min at 4°C; without brake) to harvest mononuclear cells, which were then
washed with RPMI-1640 medium (300xg for 10 min at 4°C) twice and resuspended
in FACS buffer to 1x106cells/ml for flow cytometry analysis. Erythrosin B exclusion
was used for cell counting and determining the viability of cells.
68
2.2.5. Splenocytes
Mice were killed and spleens were isolated and weighted. Spleens were placed in
RPMI-1640 medium (ICN Biomedicals, Aurora, Ohio, USA) containing 5% heat
inactivated fetal bovine serum (FBS), 2mM L-glutamine, 50µM 2-mercaptoethanol,
100U/ml penicilin and 100µg/ml streptomycin sulfate (Sigma). They were teased
apart by injecting with complete RPMI-1640 medium to obtain splenocytes. The
splenic cell suspension was filtered through a 70µm cell strainer. The cells were
pelleted by centrifugation (200xg for 5 min at 4°C), incubated in Red Blood Cell
lysing buffer (Sigma R7757) for 1 minute and washed with complete RMPI-1640
medium thrice (300xg for 7 min at 4°C). The cells were resuspended in PBS
containing FBS (FACS buffer) to 1x106cells/ml for flow cytometry analysis.
Erythrosin B exclusion was used for cell counting and determining the viability of
cells.
2.2.6. Immunophenotyping by flow cytometric analysis
Prior to staining, cells (1x106) were pre-incubated with purified anti-mouse
CD16/CD32 (eBioscience) for 20 minutes on ice to block Fc receptors. For surface
staining, the cells were stained with the following mAbs (all from eBioscience) for 30
min at 4°C in the dark: Alexa 700-conjugated anti-mouse CD3, APC-Cy7-conjugated
anti-mouse CD4, PE-Cy7-conjugated anti-mouse CD8, PerCP-Cy5.5-conjugated anti-
mouse NK1.1, FITC-conjugated anti-mouse CD4 and PE-conjugated anti-mouse
69
CD25. Cells were then washed with FACS buffer twice (300xg for 5 min at 4°C) and
acquired data on BD FACSCanto II flow cytometer (Beckton Dickinson, San Jose,
CA). For intracellular staining, Alexa Fluor 488-conjugated anti-mouse Interferon-
gamma (IFNg), PE-conjugated anti-mouse IL4, Alexa Fluor 647-conjugated anti-
mouse IL17 and APC-conjugated anti-mouse FOXP3 (for Treg response) mAbs (all
from eBioscience) were used. After staining surface antigens, the cells were fixed
with IC Fixation Buffer (eBioscience) for 20 min at room temperature and washed
with 1X Permeabilization Buffer (eBioscience) twice (300xg for 5 min at room
temperature). The cells were stained with mAbs for 20 min at room temperature,
washed with 1X Permeabilization Buffer followed by FACS buffer (300xg for 5 min
at room temperature) and analyzed by flow cytometer.
2.2.7. Cytokine profiling
Bloods were taken from the mice to evaluate the serum levels of 22 mouse cytokines
and chemokines by the kit listed in the table below.
Table 2.1. List of cytokines and chemokines used in the study
Multiplex kit Cytokines and chemokines
Mouse Cytokine/Chemokine Premixed IL1-α, IL-1-β, IL-2, IL-4, IL-5, IL-6, IL-
Lincoplex kit 7, IL-9, IL-10, IL-12(p70), IL-13, IL-15,
(Merck Millipore, MA, USA) IL-18, IP-10, G-CSF, IFNγ, GMC-SF,
TNFα, KC, MCP-1, MIP-1 and
RANTES
70
200µl of Assay Buffer was added to each well of the plate. The plate was sealed and
mixed on a plate shaker for 10 minutes at room temperature (20-25°C). Assay Buffer
was then decanted by tapping the plate on an absorbent towels several times. 25µl of
standard or control and 25µl of appropriate matrix solution were added to appropriate
wells. Assay Buffer was used for background. 25µl of Assay Buffer and 25µl of
samples (diluting one part of serum with one part of Assay Buffer) were added to the
sample wells. 25µl of the Mixed Beads was added to each well. The plate was sealed
and incubated with agitation on plate shaker overnight (16-18 hours) at 4°C. After
overnight incubation, the plate was placed on a hand-held magnet for 1 minute to
allow complete settling of magnetic beads. Well contents were removed by gently
decanting the plate on an absorbent pad. The plate was washed twice. 25µl of
Detection Antibodies was added to each well. The plate was sealed and incubated
with agitation on a plate shaker for 1 hour at room temperature. 25µl of Streptavidin-
Phycoerythrin was added to each well containing the 25µl of Detection Antibodies.
The plate was sealed and incubated with agitation for 30 minutes at room temperature.
The plate was then washed twice. 150µl of Sheath Fluid was added to the wells to
resuspend the beads on the plate shaker for 5 minutes. The plate was run on
Luminex® 200TM (Luminex Corporation, Texas, USA) with xPONENT 3.1 software
(Luminex Corporation, Texas, USA). Duplicate was done and analysis was
performed by using MILLIPLEX Analyst Version 3.5.5.0 (Vigene Tech Inc., Carlisle,
MA, USA).
71
2.2.8. Statistical analyses
Data shown in the bar charts were presented as mean ± SEM. Kruskal-Wallis, one-
way ANOVA, Tukey HSD, LSD, two-tailed Student t and Mann-Whitney tests were
used to evaluate the significant differences between groups (p<0.100*, p<0.05**,
p<0.01*** and p<0.001****). Statistical calculations were performed using SPSS 19
for Windows (Chicago, IL, USA) and GraphPad Software Prism 6.04 (San Diego,
CA, USA).
72
2.3. Results
2.3.1. Single probiotic strains
2.3.1.1 Body weight change
Figure 2.1. Body weight changes of mice
Body weights of mice of different experimental groups were measured. indicated

the untreated group (CTL); indicated LGG-treated group; indicated LC705-
treated group; indicated PJS-treated group; indicated Bb99-treated group; and
indicated EcN-treated group. Data were presented as mean. *p<0.1, **p<0.05,
***p<0.01, ****p<0.001 were considered significant.
Mice that were fed with probiotic bacteria remained healthy in the experiment as no
significant difference was shown on (Fig. 2.1) their changes of body weights
(Laaksonen, Sarlio-Lahteenkorva et al. 2005).
73
2.3.1.2. Hepatic immunophenotyping
Figure 2.2. Effect of probiotics on percentages and cytokine production of

immune cells in liver
Percentages of hepatic (a) NK, (c) CD3+NK1.1+NKT and (e) CD8+ cells in
lymphocyte-population and mean fluorescence intensity (MFI) of IFNγ of (b) NK, (d)
CD3+NK1.1+NKT and (f) CD8+ cells. Data were presented as mean ± SEM. *p<0.1,
74
Effects of probiotics on hepatic NK, NKT and CD8+ T cells
Percentages of NK cells of LC705-treated, Bb99-treated and EcN-treated groups
were significantly higher than that of the untreated group in hepatic lymphocyte-
population with Bb99-treated group showing the most prominent effect (Fig. 2.2a).
However, the percentage of NK cells of LGG-treated group was comparable to the
control group. IFNγ production, as indicated by mean fluorescence intensity (MFI),
of hepatic NK cells of all treated groups with single probiotic strains was not
significantly different from that of the untreated group (Fig. 2.2b). Similarly,
percentage of CD3+NK1.1+NKT cells of all treated groups with single probiotic
strains was not significantly different from that of the untreated group in hepatic
lymphocyte-population (Fig. 2.2c); so was IFNγ MFI of hepatic CD3+NK1.1+NKT
cells (Fig. 2.2d). Moreover, percentages of CD8+ T cells (Fig. 2.2e) of all probiotic-
treated groups were not significantly different from those of the untreated group in
hepatic lymphocyte-population. None of the IFNγ MFI of hepatic CD8+ cells of
probiotic treatment groups was significantly different from that of the untreated group
(Fig. 2.2f).
75
Figure 2.3. Effect of probiotics on helper T (Th) responses in liver
Percentage of Th1 cells in CD4+ T cell-population and corresponding IFNγ MFI

were shown in left panel. Percentage of Th2 cells in CD4+ T cell-population and
corresponding IL-4 MFI were shown in right panel. Dot plots and histograms were
one of the representatives from each group and the numbers shown on the diagrams
were the mean percentage and MFI respectively. *p<0.100, **p<0.05 and ***p<0.01,
****p<0.001 were considered significant. CTL represented control; LC represented
LC705; and Bb represented Bb99. M shown in the histograms indicated an
exponential x-scale while M shown in the dot plots indicated bi-exponential scales.
76
Effects of probiotics on hepatic Th1 and Th2 immune responses
Percentages of hepatic Th1 and Th2 and their corresponding signature cytokines,
namely IFNγ and IL-4 respectively, of all treatment groups were not significantly
different from the untreated group.
Figure 2.4. Effect of probiotics on Th cell regulation in liver
(a) Ratio of %Th1/%Th2 cells; percentages of (b) Th17 and (c) regulatory T (Treg)
cells in CD4+ T cell-population; and (d) the ratio of %Treg cells/%Th17 cells in liver
were shown. Data were presented as mean ± SEM. *p<0.1, **p<0.05, ***p<0.01,
****p<0.001 were considered significant.
77
Effects of probiotic on Th cells
It seemed that none of the probiotic treatments influenced Th1/Th2 balance in liver
(Fig. 2.4a). Contrastingly, all treatment groups, except LC705, showed an increase in
percentage of hepatic Th17 cells when compared with the untreated group (Fig. 2.4b).
However, percentages of hepatic regulatory T (Treg) cells (Fig. 2.4c) of all treatment
groups were not significantly different from the untreated group; so were hepatic
Treg/Th17 ratio (Fig. 2.4d).
78
2.3.1.3. Splenic Immunophenotyping
Figure 2.5. Effects of probiotics on percentage and cytokine production of

immune cells in spleen
Percentages of splenic (a) NK, (c) CD3+NK1.1+NKT and (e) CD8+ cells in
lymphocyte-population and MFI of IFNγ of (b) NK, (d) CD3+NK1.1+NKT and (f)
CD8+ cells. Data were presented as mean ± SEM. *p<0.1, **p<0.05, ***p<0.01,
79
Effects of probiotics on splenic NK, NKT and CD8+ T cells
As shown in Figure 2.5a, percentage of splenic NK cells in lymphocyte-population of
PJS-treated group decreased when compared with the untreated group. IFNγ MFI of
splenic NK cells of PJS-treated group increased (Fig. 2.5b). Percentage of splenic
CD3+NK1.1+NKT cells in lymphocyte-population of LC705-treated group was
higher than that of the untreated group (Fig. 2.5c). IFNγ MFI of splenic
CD3+NK1.1+NKT cells of PJS-treated and Bb99-treated groups were decreased in
comparison with the untreated (Fig. 2.5d). Percentage of splenic CD8+ T cells in
lymphocyte-population of EcN-treated group was significantly higher than that of the
untreated group (Fig. 2.5e). IFNγ MFI of splenic CD8+ T cells of LC705-treated
group increased (Fig. 2.5f).
80
Figure 2.6. Effects of probiotics on Th cell regulation in spleen
(a) The ratio of %Th1/%Th2 cells; percentages of (b) Th17 and (c) Treg cells in
CD4+ T cell-population; and (d) the ratio of %Treg cells/%Th17 cells in spleens were
shown. Data were presented as mean ± SEM. Percentage of Th17 (lower left panel)
and Treg (lower right panel) cells in CD4+ T cell-population were shown as dot plots
and histograms. One of the representatives from each group was shown. CTL
represented control; LC represented LC705; and Bb represented Bb99. M shown in
the histograms indicated an exponential x-scale while M shown in the dot plots
indicated bi-exponential scales. *p<0.1, **p<0.05, ***p<0.01, ****p<0.001 were
considered significant.
81
Effect of probiotics on splenic Th cells
None of the probiotic treatments influenced Th1/Th2 balance in spleen (Figure 2.6a).
Contrastingly, all treatment groups, except LC705, showed an increase in percentage
of Th17 cells in spleen when compared with the untreated groups (Fig. 2.6b).
Moreover, percentages of splenic Treg cells of LGG-treated and EcN-treated groups
were higher than that of the untreated group (Fig. 2.6c). Nonetheless, splenic
Treg/Th17 ratio of LGG-treated and Bb99-treated groups was significantly lower
than that of the untreated group (Fig. 2.6d).
82
Figure 2.7. Cytokine profile of LGG-treated group
83
Figure 2.8. Cytokine profile of LC705-treated group
84
Figure 2.9. Cytokine profile of PJS-treated group
85
Figure 2.10. Cytokine profile of Bb99-treated group
86
Figure 2.11. Cytokine profile of EcN-treated group
Cytokine profiles of (Fig. 2.7) LGG-treated, (Fig. 2.8) LC705-treated, (Fig. 2.9) PJS-treated, (Fig. 2.10) Bb99-treateed and
(Fig. 2.11) EcN-treated groups were shown above. Data were shown as mean ± SEM. *p<0.100, **p<0.05, ***p<0.01 and
87
Effects of probiotics on serum cytokine and chemokine levels
As shown in Figure 2.7, Th17-associated cytokines (IL-17 and IL-6) and Th1-
associated cytokines and chemokines (KC, IFNγ and IL-2) of LGG-treated group
were significantly lower than those of the untreated group. All studied cytokine and
chemokine levels of LC705-trated group were not significantly different from the
untreated group (Fig. 2.8). Solely Th1-assocaited cytokine IL-2 of PJS-treated group
was significantly lower than that of the untreated group (Fig. 2.9). Th1-associated
cytokine and chemokine – IL-2 and KC respectively, of Bb99-treated group were
significantly lower than those of the untreated group (Fig. 2.10). Th2-associated
cytokine IL-10 of Bb99-treated group was significantly lower than that of the
untreated group as well. Th1-associated KC level of EcN-treated group was
significantly lower than that of the untreated group (Fig. 2.11).
88
2.3.2. Mixture of probiotic strains
2.3.2.1. Body weight change
Figure 2.12. Body weight change of mice
Body weights of mice of different experimental groups were measured. indicated

the untreated group (CTL); indicated GGmix-treated group; and indicated
ECPJSmix-treated group. Data were presented as mean only. *p<0.1, **p<0.05,
Mice that were fed with mixture of probiotic strains remained healthy in the
experiment as no significant difference was shown on (Fig. 2.12) their changes of
body weights (Laaksonen, Sarlio-Lahteenkorva et al. 2005).
89
2.3.2.2. Hepatic immunophenotyping
Figure 2.13. Effects of mixture of probiotics on percentages and cytokine

productions of immune cells in liver
90
Effects of mixture of probiotic strains on hepatic NK, NKT and CD8+ T cells
As shown in Figure 2.13a, percentage of hepatic NK cells in lymphocyte-population
of GGmix-treated group was significantly higher than that of the untreated group.
IFNγ MFI of hepatic NK cells of ECPJSmix-treated group decreased (Fig. 2.13b).
Percentage of hepatic CD3+NK1.1+NKT cells in lymphocyte-population of
ECPJSmix-treated group was significantly lower than that of the untreated group (Fig.
2.13c). IFNγ MFI of splenic CD3+NK1.1+NKT cells of both treatment groups was
not significantly different from the untreated group (Fig. 2.13d). Percentages of
hepatic CD8+ cells in lymphocyte-population of all treatment groups were not
significantly different from that of the untreated group (Fig. 2.13e). Similarly, none of
the IFNγ MFI of hepatic CD8+ cells of probiotic treatment groups was significantly
different from that of the untreated group. (Fig. 2.13f).
91
Figure 2.14. Effects of mixture of probiotics on Th responses in liver
Percentage of Th1 cells in CD4+ T cell-population and corresponding IFNγ MFI
were shown as dot plot and histogram respectively in left panel. Percentage of Th2
cells in CD4+ T cell-population and corresponding IL-4 MFI were shown as dot plot
and histogram respectively in right panel. Dot plots and histograms were one of the
representatives from each group and the numbers shown on the diagrams were the
mean percentage and MFI respectively. *p<0.100, **p<0.05 and ***p<0.01,
****p<0.001 were considered significant. CTL represented control; LC represented
LC705; and Bb represented Bb99. M shown in the dot plots indicated bi-exponential
scales while M shown in the histograms indicated an exponential x-scale.
Effects of mixture of probiotics on Th1 and Th2 immune responses in liver
Percentages of Th1 and Th2 and their corresponding cytokines IFNγ and IL-4 levels
of all treatment groups were not significantly different from the untreated group.
92
Figure 2.15. Effect of mixture of probiotics on Th cells in liver
(a) The ratio of %Th1 cells/%Th2 cells; percentages of (b) Th17 and (c) regulatory T
(Treg) cells in CD4+ T cell-population; and (d) the ratio of %Treg cells/%Th17 cells
in liver were shown. Data were presented as mean ± SEM. *p<0.1, **p<0.05,
Effects of mixture of probiotics on Th cells
None of the probiotic treatments influenced Th1/Th2 balance in liver (Fig. 2.15a).
Contrastingly, percentage of Th17 cells of GGmix group was significantly higher
than that of the untreated group (Fig. 2.15b) in liver. Moreover, percentages of
hepatic Treg (Fig. 2.15c) and Treg/Th17 balance (Fig. 2.15d) of all both treated
groups were comparable to the untreated group.
93
2.3.2.3. Splenic Immunophenotyping
Figure 2.16. Effects of mixture of probiotics on percentages and cytokine

productions of immune cells in spleen
94
Effects of mixture of probiotics on splenic NK, NKT and CD8+ T cells
Percentages of splenic NK cells in lymphocyte-population of GGmix-treated and
ECPJSmix-treated groups were significantly higher than that of the untreated group
(Fig. 2.16a). IFNγ MFIs of both GGmix-treated and ECPJSmix-treated groups were
lower but not significantly different from those of the untreated group (Fig. 2.16b).
Percentage of splenic CD3+NK1.1+NKT cells in lymphocyte-population of GGmix-
treated group was significantly higher than that of the untreated group (Fig. 2.16c)
whereas IFNγ MFI of splenic CD3+NK1.1+NKTcells of ECPJSmix-treated group
was significantly lower than that of the untreated group (Fig. 2.16d). Percentages of
splenic CD8+ cells in lymphocyte-population of both treatment groups were not
significantly different from that of the untreated group (Fig. 2.16e). However, IFNγ
MFI of splenic CD8+ cells of GGmix-treated group decreased in comparison with the
untreated group (Fig. 2.16f).
95
Figure 2.17. Effects of mixture of probiotic bacteria on Th cells in spleen
(a) The ratio of %Th1cells/%Th2 cells; percentages of (b) Th17 and (c) Treg cells in
CD4+ T cell-population; and (d) the ratio of %Treg cells/%Th17 cells in spleens were
shown. Data were presented as mean ± SEM. Percentage of Th17 cells in CD4+ T
cell-population and their corresponding IL-17 MFIs were shown as dot plots and
histograms respectively in the middle panel. Percentage of Treg cells in CD4+ T cell-
population were shown as dot plots in the bottom panel. One of the representatives
from each group was shown. CTL represented control; GGm represented GGmix; and
ECPJS represented ECPJSmix. M shown in the dot plots indicated bi-exponential
scales while M shown in the histograms indicated an exponential x-scale. *p<0.1,
96
Effects of mixture of probiotics on splenic Th cells
Both probiotic mixtures did not influence Th1/Th2 balance in spleen (Fig. 2.17a).
Contrastingly, percentage of splenic Th17 cells of ECPJSmix-treated group was
significantly higher than that of the untreated group (Fig. 2.17b). Percentages of
splenic Treg cells of GGmix-treated and ECPJSmix-treated groups were not
significantly different from the untreated group (Fig. 2.17c); but splenic Treg
cells/Th17 cells ratio of ECPJSmix-treated groups was lower than that of untreated
group (Fig. 2.17d).
97
2.3.2.4. Cytokine Profiling
Figure 2.18. Cytokine profile of GGmix-treated group
98
Figure 2.19. Cytokine profile of ECPJSmix-treated group
Cytokine profiles of (Fig. 2.19) GGmix-treated and (Fig. 2.20) ECPJSmix-treated groups were shown. Data were shown as
mean ± SEM. *p<0.100, **p<0.05, ***p<0.01 and ****p<0.001 were considered significant.
99
Effects of mixture of probiotics on serum cytokine and chemokine levels
Th17 cell-differentiation promoting cytokine – IL-6, of GGmix-treated group was
increased when compared with the untreated group (Fig. 2.18). Th17-associated
cytokine IL-17, Th1-assocated cytokines and chemokines (KC, IFNγ, RANTES and
TNFα) and Th2-assocated cytokines (IL-10 and IL-13) of ECPJSmix-treated group
were significantly lower than those of the untreated group (Fig. 2.19).
100
LGG LC705 PJS Bb99 EcN GGmix ECPJSmix
IL-17 ** ** IL-17
IL-6 ** * * IL-6
GM-CSF GM-CSF Th17
IL-1β IL-1β
IL-15 IL-15
MIP-1α MIP-1α
KC * ** * ** KC
IFNγ * * IFNγ
IP-10 IP-10
IL-1α IL-1α
IL-2 ** * * ** IL-2 Th1
RANTES RANTES
IL-7 IL-7
IL- IL-
12(p70) 12(p70)
TNFα ** TNFα
G-CSF G-CSF
IL-4 IL-4
IL-5 IL-5
IL-10 ** ** IL-10
Th2
MCP-1 MCP-1
IL-9 IL-9
IL-13 ** IL-13
Figure 2.20. Heat map of summary of serum cytokine and chemokine levels
Cytokine levels are presented as percentage change of control in a heat map
indicating positive (green) to negative (red) difference. *p<0.1, **p<0.05, ***p<0.01,
101
2.4. Discussion
To the best of our knowledge, this is the first study to demonstrate that the
probiotic treatments appeared to have the most notable effects on NK and Th17 cells
in livers and spleens of healthy mice. LC705, PJS, Bb99, EcN and GGmix increased
the percentage of NK cells in liver with Bb99 showing the most prominent effect. It
has been suggested that LGG increased NK cell activity in peripheral blood of human
adults (Dong, Rowland et al. 2012). Other probiotic strains such as Lactobacillus
casei Shirota (LcS) have been shown to increase NK cell activity in peripheral blood
of smokers and patients with biliary caner surgery (Sugawara, Nagino et al. 2006,
Seifert, Bub et al. 2011, Reale, Boscolo et al. 2012) and NK cytotoxicity in mice
spleens (Soltan Dallal, Yazdi et al. 2012). However, LcS depressed NK cells lytic
activity in health human (Seifert, Bub et al. 2011). B. adolescentis BBMN23 and B.
longum BBMN68 increased murine NK cell activities (Yang, Liu et al. 2009). B.
longum SP 07/3 enhanced the activation and activity of NK cells in ex vivo models by
using human peripheral blood mononuclear cells (PBMCs) (Genel, Atlihan et al.
2012). Other strains of Bifidobacterium breve increased the percentage and activity of
NK cells of human PBMCs (Cui, Pazdziorko et al. 2005) like the Bifidobacterium
breve strain that was used in our study. NK cells have been known as anti-tumor and
anti-viral effector cells with immune surveillance of various cancers and diseases
(Forsberg, Abrahamsson et al. 2013), such as colon cancer (Bae, Kim et al. 2012) and
acquired immunodeficiency syndrome (AIDS) (Adiloglu, Gonulates et al. 2013).
Since Bb99 appeared to have the most prominent effect on NK cells, this implied that
102
Bb99 might have potential in preventing infections or to be used as an adjuvant to
certain cancer treatments.
Previous studies have showed that some probiotic strains such as
Enterococcus faecalis FK-23 and Bifidobacterium infantis regulated Th17 immune
response (Tanabe, Kinuta et al. 2008, Zhang, An et al. 2012). Donkor, Reavikumar et
al. reported that LGG increased the percentage of Th17 cells when co-cultured with
human PBMCs (Donkor, Ravikumar et al. 2012). But to our knowledge, the universal
activation of Th17 in liver and spleen by the probiotic treatments in our study seemed
not been previously studied. In our study, LGG, Bb99, EcN and PJS increased the
percentage of Th17 cells in liver while the former three increased that of Th17 cells
in spleen as well. Th17 cells play an important in defense against extracellular
pathogens or even allergic diseases (Ishigame, Kakuta et al. 2009). It suggested that
these probiotic treatments might have potential in host defense against fungal
infection by perverting the immune response towards Th17; however, the chronic
effects should be further investigated in clinical trials as inappropriate or uncontrolled
activation of Th17 immune response is linked to several autoimmune diseases such as
encephalomyelitis (EAE), uveoretinitis (EAU), arthritis, multiple sclerosis, lupus and
inflammatory skin diseases like psoriasis (Veldhoen, Hocking et al. 2006, Ghoreschi,
Laurence et al. 2010, Waite and Skokos 2012, Raveney, Oki et al. 2013).
Furthermore, LGG and EcN increased the percentage of Treg cells in spleen.
This was similar to the results of some of the previous studies, for example, LGG
enhanced the number of forkhead box P3 (FOXP3)+Treg cells in murine model with
asthma (Feleszko, Jaworska et al. 2007) and ovalbumin-immunized rats (Finamore,
103
Roselli et al. 2012) while EcN increased dermal FOXP3+Treg cells (Weise, Zhu et al.
2011). Zhang and Chen et al. claimed that Bifidobacteria decreased the amount of
Treg cells in spleen (Zhang, Chen et al. 2010). However, in our study, the percentage
of Treg cells of Bb99 group was not significantly different from that of the control
group in spleen. Increase in percentage of Treg cells by LGG and EcN in healthy
models suggested that both of them might have potential in preventing allergic airway
disease, autoimmune disease like psoriasis and infectious disease like Human
Immunodeficiency Virus (HIV) (Sugiyama, Gyulai et al. 2005, Taams, Palmer et al.
2006, Martin, Reuter et al. 2012).
Probiotic treatments showed variable effects in liver and spleen on other cell
types such as CD3+NK1.1+NKT and CD8+ cells in our study as well. Ma, Hua et al.
demonstrated that increase in hepatic NKT cells by probiotics might improve high fat
diet-induced hepatic steatosis and insulin resistance (Ma, Hua et al. 2008) while
Kolbus, Ljungcrantz et al. recently reported that CD8+ T-cell subset might be
associated with cardiovascular disease (Kolbus, Ljungcrantz et al. 2013). These
implied that probiotics might be able to protect hosts from having certain diseases
like hepatic and cardiovascular diseases through regulation on NKT and CD8+ cells.
In this chapter, cytokine profiles of healthy C57BL/6 mice after probiotic
treatments were also investigated. LGG and Bb99 seemed to have tendency to reduce
inflammatory cytokine levels, which was coincident with the study of Blümer, Sel et
al. (Blümer, Sel et al. 2007); but in contrast with others (Pohjavuori, Viljanen et al.
2004, Helwig, Lammers et al. 2006, Imaoka, Shima et al. 2008, Zhang, Chen et al.
2010). The differences between our results and those of previous studies might be due
104
to different probiotic strains and experimental models used. ECPJSmix, which was
the novel combination of probiotics to the best of our knowledge, gave the most
prominent effect on suppressing inflammatory cytokines in our study. This intimated
that probiotics might interact and subsequently deviate their immunomodulatory
properties. This was also seen in regulating the cell-mediated immune response − NK,
NKT, CD8+, Th17 and Treg cells.
Immunomodulation effects of probiotics on intestines and system immunities,
including liver, spleen and peripheral blood, were correlated in the study. It seemed
that probiotic treatments in our studies suppressed intestinal Th17 immune responses
but enhanced Th17 immune response in liver and spleen. This suggested that
probiotics may prevent healthy individuals from organ-specific infections and
diseases while maintaining the overall immunological hemostasis.
2.5. Conclusion
In conclusion, immunological effects of mixtures of probiotics were significantly
different from those of their individual components; and thus the effects of mixture of
probiotics could not be extrapolated from those of the individual strains. Probiotics
seemed to promote systemic NK, Th17 and Treg cells in healthy models, implying
that they might prevent the hosts from certain kinds of diseases and infections,
especially those related to liver. Characterization of probiotic immunomodulation on
systemic immune response of healthy models will enhance our understanding of
prophylactic efficacy of probiotics and advance the development of new therapeutic
strategy for various diseases. Further clinical studies are needed.
105
Chapter 3 Assessment of in vitro
immunomodulatory effect of Lactobacillus rhamnosus
GG (LGG) bacteria on APCs
3.1. Introduction
Immunomodulatory effects of probiotics on local and systemic immunities have been
investigated in mice and reported in the previous two chapters. Their mechanism of
action was further studied in the following chapters. Lactobacillus rhamnosus GG
(LGG) is perhaps the most widely studied probiotic strain and its potential in
treatment and prevention of various diseases is clinically well documented, including
diarrhea, childhood infections, allergies and atopic eczema (Arvola, Laiho et al. 1999,
Isolauri, Arvola et al. 2000, Pohjavuori, Viljanen et al. 2004, Viljanen, Pohjavuori et
al. 2005, Basu, Chatterjee et al. 2007, Basu, Paul et al. 2009, Szajewska, Albrecht et
al. 2009, Szajewska, Wanke et al. 2011). It has been commercially marketed to
healthy individuals as boosters of the immune system. However, the claim is
scientifically vague and the knowledge of the immunomodulatory properties, which
are known to be strain-specific (Kirjavainen, El-Nezami et al. 1999), has been poorly
characterized in healthy individuals. Since antigen-presenting cells (APCs) play a
decisive role in sensing potential dangers to initiate antigen-specific immune
responses or in induction of immunological tolerance (Guermonprez, Valladeau et al.
2002), this chapter was aimed to elucidate the immunomodulatory effects of LGG on
APCs from healthy donors.

106
3.2.1 Bacterial Strain and culture conditions
LGG (Gefilus) was grown anaerobically in De Man, Rogosa, Sharpe (MRS) medium
(LAB M Limited, Lancashire, UK) at 37°C for 15-16 hours. Log-phase bacteria were
used in the experiment. The number of colony forming units (CFU) was determined
by measuring optical density at 600nm wavelength (OD600) with spectrophotometer
(Shimadzu Corporation). Bacteria were washed with phosphate buffered saline (PBS)
(Invitrogen Co., San Diego, CA, USA) twice and then co-cultured with DCs,
macrophages or monocytes.
3.2.2. Isolation of PBMCs
Human PBMCs were isolated from healthy blood donors (Hong Kong Red Cross
Blood Transfusion Service, Hong Kong, China) by density gradient centrifugation
over Ficoll-PlaqueTM Plus (GE Healthcare Life Sciences, Piscataway, NJ, USA).
3.2.3. Derivation of DCs and macrophages from monocytes
PBMCs were suspended in complete RPMI-1640 medium (LONZA, Basel,
Switzerland) containing 4% heat-inactivated fetal bovine serum (FBS) (Gibco®,
Billings, MT, USA), 1% L-glutamine (Gibco®), 1% penicillin/streptomycin
(Gibco®), 1% sodium pyruvate (Gibco®) and 1% nonessential amino acids (Gibco®)
and seeded in six-well plate (Corning, NY, USA) with 20x106 cells/well for 2 hours
at 37°C. Remaining PBMCs were frozen in RPMI-1640 with 20% heat-inactivated
AB serum and 10% dimethyl sulfoxide (DMSO) HYBRI-MAX® (Sigma Life Science,
107
St. Louis, MO. USA) for later experiments. To differentiate into immature DCs,
adherent monocytes were cultured in complete medium with heat-inactivated human
AB serum (plasma derived) (Valley Biomedical Products and Services, Inc.,
Winchester, VA, USA) replacing heat-inactivated FBS and supplemented with
40ng/ml recombinant human (rh) GM-CSF and 40ng/ml rh IL-4 (both from
PeproTech EC. Ltd, London, UK) for 7 days. To differentiate into immature
macrophages, adherent monocytes were cultured in complete medium with heat-
inactivated human AB serum (plasma derived) (Valley Biomedical Products and
Services, Inc., Winchester, VA, USA) replacing heat-inactivated FBS and
supplemented with 40ng/ml rh GM-CSF (PeproTech EC. Ltd, London, UK) for 7
days. Fresh supplemented medium was added for every 2 days. Immature cells were
washed with PBS. Protocol was modified from the studies of Lacey (2012) and
Mohamadzadeh (2005) (Mohamadzadeh, Olson et al. 2005, Lacey, Achuthan et al.
2012).
3.2.4. Co-cultured with LGG
DCs, macrophages or monocytes were co-cultured with LGG in a bacteria-to-cell
ratio of 10:1 for 24 hours in 5% CO2 incubator (Sanyo North America Corporation,
CA, USA) at 37°C. Cells with addition of 1000U/ml rh IFNγ (Life Technologies,
California, USA), 100ng/ml lipopolysaccharides (LPS) from Escherichia Coli
0111:B4 (Sigma Aldrich, St. Louis, Mo, USA) and 1µg/ml R848 (InvivoGen, San
Diego, California, USA) were used as positive control (POS) (Paustian, Caspell et al.
108
2011) while immature cells without addition of any stimulants or bacteria were used
as negative control.
3.2.5. Cytokine profiling
After 24-hour incubation of DCs with LGG, cells were washed with PBS and
incubated with autologous PBMCs in 96-well plates at 37°C for 3 days in a ratio of
1:20. Supernatant was collected and stored at -20°C for cytokine detection. Samples
were undergone less than 2 freeze/thaw cycles. Procedures were stated in “Material
and Methods” section of chapter 2.
109
Cytokines and chemokines that were tested in the study were shown in the following
table.
Table 3.1. List of cytokines tested in the study
MILLIPLEX® MAP kits Cytokines and Chemokines
Human Th17 Magnetic Bead IL-17F (ng/ml), GM-CSF (ng/ml), IFNγ (pg/ml),
Panel IL-10 (pg/ml), CCL20/MIP3a (pg/ml), IL-12p70
96-Well Plate Assay (pg/ml), IL-13 (pg/ml), IL-15 (pg/ml), IL-17A
(Cat. # HTH17MAG-14K) (pg/ml), IL-22 (ng/ml), IL-1β (pg/ml), IL-33
(pg/ml), IL-2 (pg/ml), IL-21 (pg/ml), IL-4 (ng/ml),
IL-23 (ng/ml), IL-6 (pg/ml), IL-25 (ng/ml), IL-27
(ng/ml), TNFα (pg/ml)
Human Cytokine/Chemokine IL-1α (pg/ml), IL-7 (pg/ml), MCP-1 (pg/ml),
Magnetic Bead Panel I RANTES (pg/ml)
96-Well Plate Assay
(Cat. # HCYTOMAG-60K)
Human Cytokine/Chemokine MCP-2 (pg/ml), BCA-1 (pg/ml), I-309 (pg/ml),
Panel II IL-16 (pg/ml), CCL21 (pg/ml)
96-Well Plate Assay
(Cat. # HCYP2MAG-62K)
3.2.6. Quantification of TLR expression by real-time PCR
After incubation with LGG for 24 hours, constitutive expression of TLRs 1, 2, 4, 5, 6,
7, 8 and 9 of DCs, macrophages and monocytes were determined by quantitative
110
polymerase chain reactions (qPCR). Cells were lyzed and homogenized with 1ml
RNAiso Plus (Takara Holdings Inc., Shiga, Japan) and 0.4ml chloroform (BDH
Laboratory Supplies, Poole, England) and then centrifuged at 10000xg for 15 minutes
at 4°C. 0.5ml isopropyl alcohol (Merck KGaA, Darmstadt, Germany) was added to
precipitate RNA. 1μg of total RNA of each sample was reverse-transcribed for 15min
at 37°C using PrimeScript® RT Master Mix (Perfect Real Time) (Takara Holdings
Inc., Shiga, Japan) composing of PrimeScript® RTase, RNase inhibitor, Oligo dT
primer, random 6 mers, dNTP mixture and Mg2+ buffer. The reverse transcription
was performed on C1000TM Thermal Cycler (BIO-RAD, CA, USA). Resulting cDNA
were stored at -20°C. qPCR was performed using Premix Ex TaqTM (Probe qPCR)
(Takara Holdings Inc., Shiga, Japan). cDNA was mixed with appropriate amount of
Premix Ex Taq (Probe qPCR), forward and reverse primers, TaqMan® probe, ROX
reference dye and sterile distilled water. Reactions were performed in duplicate and
using a modified manufacturer’s fast protocol:
Holding Stage:
Number of cycles: 1 (95°C, 30 sec)
Cycling Stage:
Number of cycles: 45 (95°C, 1 sec; 60°C, 20 sec)
Gene expression levels of TLRs were normalized to housekeeping gene 18S. Data
were acquired on ABI StepOne Plus Real-Time PCR System (Life Technologies, NY,
USA). Sequences of primers and probes were cited from Flacher, Bouschbacher et el.
(Flacher, Bouschbacher et al. 2006).
111
Table 3.2. Sequences of primers and probes of human TLRs and housekeeping for real-time quantitative PCR
(Flacher, Bouschbacher et al. 2006)
Gene(s) Forward Primer (5'→3') Reverse Primer (5'→3') TaqMan Probe
18S TGGCTCATTAAATCAGTTATG CGGCATGTATTAGCTCTA [5FAM]
CGCTCGCTCCTCTCCTACTTG
[Eclipse]-3’
TLR 1 CCCATTCCGCAGTACTCCAT TTTTCCTTGGGCCATTCCA [5FAM]
AGCTCAAAAGTCTCATGGCCAGGA
GGA [3TAMRA]
TLR 2 CCCATTGCTCTTTCACTGCT CTTCCTTGGAGAGGCTGATG [5FAM]
GTAGTTGTGGGTTGAAGCACTGGA
CAAT [3TAMRA]
TLR 4 CTGCAATGGATCAAGGACCA TTATCTGAAGGTGTTGCACA [5FAM]
TTCC AGGCAGCTCTTGGTGGAAGTTGAA
CG [3TAMRA]
TLR 5 TGCCTTGAAGCCTTCAGTTATG CCACCACCATGATGAGAGCA [5FAM]
112
CCAGGGCAGGTGCTTATCTGACCTT
AACA [3TAMRA]
TLR 6 CCCTCAACCACATAGAAACG GAGATATTCCACAGGTTTGG [5FAM]
ACCGACTTGGAAATGCCTGGTCAG
[3TAMRA]
TLR 7 TTACCTGGATGGAAACCAGCTAC TCAAGGCTGAGAAGCTGTAA [5FAM]
T GCTA AGATACCGCAGGGCCTCCCGC
[3TAMRA]
TLR 8 AACTTTCTATGATGCTTACATTTC GGTGGTAGCGCAGCTCATTT [5FAM]
TTATGAC CCAAAGATGCCTCTGTTACTGACTG
GGTG [3TAMRA]
TLR 9 TGAAGACTTCAGGCCCAACTG TGCACGGTCACCAGGTTGT [5FAM]
AGCACCCTCAACTTCACCTTGGATC
TGTC [3TAMRA]
113
3.2.7. Immunophenotyping of antigen presenting cells by flow cytometry
After 24-hour incubation, macrophages and monocytes were harvested for flow
cytometry analysis. 10µg/ml Brefeldin A solution (eBioscience, San Diego, CA, USA)
was added around 15 hours before the cells were harvested. Anti-human
monoclonical antibodies (mABs) that were used in the study were shown in the
following table.
114
Table 3.3. List of anti-human monoclonical antibodies (mABs) used in the study
Antibodies Fluorochromes Companies
CD14 FITC eBioscience, CA, USA
CD11b PE/CyTM7 BD PharmingenTM, New Jersey, USA
CD80 PerCP-eFluor 710 eBioscience, CA, USA
CD86 PE eBioscience, CA, USA
CD16 BD Horizon PE- BD Biosciences, New Jersey, USA
CF594
HLA-DR APC/Cy7 BioLegend, San Diego, CA, USA
CCR5 (CD195) APC/CyTM7 BD PharmingenTM, New Jersey, USA
CD206 APC/Cy7 or APC BioLegend, San Diego, CA, USA/ BD
PharmingenTM, New Jersey, USA
CD209 PE/Cy7 eBioscience, CA, USA
CD64 PE BioLegend, San Diego, CA, USA
PD-L1 APC eBioscience, CA, USA
CD69 PE/Cy7 BD PharmingenTM, New Jersey, USA
IL-12/IL-23(p40) PE eBioscience, CA, USA
IL-10 Alexa Fluor 647 eBioscience, CA, USA
T-bet PerCP-Cy5.5 eBioscience, CA, USA
TNFa PerCP-Cy5.5 BD PharmingenTM, New Jersey, USA
115
Cells were incubated with appropriate amount of appropriate antibodies (for staining
cell surface antigens) for 30 min in the dark at 4°C and washed with 2ml PBS
containing 3% heat-inactivated FBS (FACS buffer) twice (300xg for 5 min at 4°C).
Cells were fixed and permeabilized with freshly prepared Foxp3
Fixation/Permeabilization working solution (eBioscience, CA, USA) if intracellular
antigens are going to be stained. Cells were incubated at room temperature for 45
minutes. 2ml of 1xPermeabilization Buffer was added to the tubes and centrifuged at
300xg at room temperature for 5 minutes. Cells were resuspended in FACS buffer
and incubated with appropriate amount of appropriate antibodies for at least 30 min
in the dark at room temperature. Cells were washed twice and acquired data on
FACSAria III flow cytometer using BD FACSDivaTM Software Version 6.1.3
(Becton Dickinson, BD Biosciences, San Diego, CA, USA). The analyses were based
on the counting of 20,000 cells and were performed using FlowJo Version 7.6
(Ashland, OR, USA).
Results were presented as mean ± standard deviation (SD) and analyzed by one way
ANOVA, Tukey HSD, LSD, two-tailed Student’s t, Kruskal-Wallis and Mann-
Whitney tests to reveal the significant differences between experimental groups.
*p<0.100, **p<0.05, ***p<0.01 and ****p<0.001 were considered significant.
Statistical calculations were performed using GraphPad Software Prism Version 6.04
(San Diego, CA, USA) and IBM SPSS Statistics 20 (Chicago, IL, USA).
116
3.3. Results
3.3.1. Dendritic cells
117
118
119
120
LGG
alone
IL-1α **** IL-1α
IL-2 *** IL-2
IL-7 *** IL-7
IL-12p70 *** IL-12p70
IFNγ **** IFNγ
CCL21 * CCL21 Th1
I-309 **** I-309
MCP-2 **** MCP-2
RANTES **** RANTES
TNFα **** TNFα
IL-27 **** IL-27
IL-1β **** IL-1β
IL-15 *** IL-15
IL-17A **** IL-17A
IL-17F **** IL-17F
IL-21 *** IL-21
IL-33 IL-33
Th17
IL-23 IL-23
GMCSF **** GMCSF
BCA-1 **** BCA-1
MIP3a **** MIP3a
IL-6 **** IL-6
IL-22 ** IL-22
IL-4 *** IL-4
IL-13 **** IL-13
Th2
IL-25 * IL-25
MCP-1 **** MCP-1
IL-10 **** IL-10
Treg
IL-16 * IL-16
Figure 3.1. Cytokine and chemokine secretion profile of LGG-treated

mononuclear cells
Cytokine and chemokine levels of (a) IL-1α, (b) IL-2, (c) IL-7, (d) IL-12(p70), (e) IFNγ,
(f) CCL21, (g) I-309, (h) MCP-2, (i) RANTES, (j) TNFα, (k) IL-27, (l) IL-1β, (m) IL-15,
(n) IL-17A, (o) IL-17F, (p) IL-21, (q) IL-33, (r) IL-23, (s) GMCSF, (t) BCA-1, (u) MIP-
3a, (v) IL-6, (w) IL-22, (x) IL-4, (y) IL-13, (z) IL-25, (aa) MCP-1, (ab) IL-10 and (ac) IL-
16 were shown. Heat map was the summary of figures (a) - (ac). Red colour indicated
max negative percentage change (Max -ve %change) while green colour indicated max
positive percentage change (Max +ve %change). Cytokine levels were compared with
corresponding negative controls. Data were shown as mean ± SD from more than four
donors. *p<0.100, **p<0.05, ***p<0.01 and ****p<0.001 were considered significant.
121
Effects of LGG on cytokine and chemokine production
DCs were incubated with LGG for 24 hours and PBMCs were added subsequently.
Cytokine and chemokine production levels were determined and shown in Figure 3.1.
Levels of all studied Th1-associated cytokines and chemokines − (Fig. 3.1a) IL-1α,
(Fig. 3.1c) IL-7, (Fig. 3.1d) IL-12, (Fig. 3.1e) IFNγ, (Fig. 3.1f) CCL21, (Fig. 3.1g) I-
309, (Fig. 3.1h) MCP-2, (Fig. 3.1i) RANTES, (Fig. 3.1j) TNFα and (Fig. 3.1k) IL-27
of LGG-treated cells were significantly higher than those of the untreated cells and
the levels were as high as two to three logarithms of those of the corresponding
cytokines of the control groups, except (Fig. 3.1b) IL-2. Level of IL-2 of LGG-treated
cells was significantly lower than that of the untreated cells instead.
In addition, levels of Th17-associated cytokines and chemokines − (Fig. 3.1l) IL-1β
and (Fig. 3.1m) IL-15, (Fig. 3.1n) IL-17A, (Fig. 3.1o) IL-17F, (Fig. 3.1p) IL-21, (Fig.
3.1s) GMCSF, (Fig. 3.1t) BCA-1, (Fig. 3.1u) MIP-3a, (Fig. 3.1v) IL-6 and (Fig. 3.1w)
IL-16 increased in LGG-treated cells when compared with the untreated cells.
Moreover, levels of Th2-associated cytokine (Fig. 3.1x) IL-4 and (Fig. 3.1z) IL-25 of
LGG-treated cells were significantly lower than that of the untreated cells. However,
levels of other studied Th2-associated cytokine (Fig. 3.1y) IL-13 and chemokine (Fig.
3.1aa) MCP-1 of LGG-treated cells were higher than those of the untreated cells.
Last but not the least, levels of regulatory T (Treg) cell-related cytokines (Fig. 3.1ab)
IL-10 and (Fig. 3.1ac) IL-16 of LGG-treated cells were significantly higher than
those of the untreated cells. IL-10 level of LGG-treated cells was almost two
logarithms higher than that of the untreated cells.
122
3.3.1.2. Quantification of TLR expression
Figure 3.2. TLR expression of DCs

mRNA levels of (a) TLR 1, (b) TLR 2 (c) TLR 4, (d) TLR 5, (e) TLR 6, (f) TLR 7, (g)
TLR 8 and (h) TLR 9 of DCs were shown. Data were shown as mean ± SD. *p<0.100,
**p<0.05, ***p<0.01 and ****p<0.001 were considered significant.
123
Effect of LGG on TLR expression of LGG-treated DCs
DCs were incubated with LGG for 24 hours. DCs were then harvested for
investigating the constitutive expression of TLRs by qPCR. According to Figure 3.2,
only mRNA level of (Fig. 3.2a) TLR 2 of LGG-treated DCs was significantly lower
than that of the untreated DCs. mRNA levels of other TLRs, including TLRs 1, 4, 5,
6, 7 and 9 were not significantly different from those of the untreated DCs.
124
3.3.2. Macrophages
3.3.2.1. Immunophenotyping
Figure 3.3. Activation-related receptor expression on macrophages
Mean fluorescence intensity (MFIs) of (a) CD16, (b) HLA-DR, (c) CD80 and (d)
CD86 of LGG-treated macrophages were shown. Data were shown as mean ± SD.
125
Figure 3.4. Inflammatory marker expression on macrophages
MFIs of (a) CD206, (b) CD209, (c) CD163 and (d) CD64 of LGG-treated
macrophages were shown. Data were shown as mean ± SD. *p<0.100, **p<0.05,
***p<0.01 and ****p<0.001 were considered significant.
126
Figure 3.5. Cytokine production and transcription factor expression of
macrophages
MFIs of (a) IL-12, (b) TNFα, (c) T-bet and (d) IL-10 of LGG-treated macrophages
were shown. Data were shown as mean ± SD. *p<0.100, **p<0.05, ***p<0.01 and
127
Effect of LGG on receptor expression and cytokine production of macrophages
and their correlations
After 24-hour incubation with LGG, mean fluorescence intensity (MFI) of surface
markers and intracellular cytokines of macrophages were determined by flow
cytometry. MFI of (Fig. 3.3a) CD16 of LGG-treated macrophages was significantly
lower than that of the untreated macrophages whereas that of (Fig. 3.3c) CD80 was
significantly higher than that of the untreated macrophages. The MFI of CD16 of
LGG-treated macrophages was only half of that of the untreated. Another two studied
markers − MHC class II antigen presentation receptor (Fig. 3.3b) HLA-DR and (Fig.
3.3d) CD86 MFIs were not significantly different from the untreated macrophages.
MFIs of all studied inflammatory markers of macrophages, including (Fig. 3.4a)
CD206, (Fig. 3.4b) CD209, (Fig. 3.4c) CD163 and (Fig. 3.4d) CD64 (van Vuuren,
van Roon et al. 2006, Liu, Phan et al. 2008, Fuentes-Duculan, Suarez-Farinas et al.
2010, Wentworth, Naselli et al. 2010, Biondo, Malara et al. 2012) of LGG-treated
macrophages were not significantly different from those of untreated macrophages.
MFI of CD64 of macrophages from LGG-treated group was lower than but not
significantly different from the untreated macrophages.
MFIs of (Fig. 3.5a) IL-12, (Fig. 3.5b) TNFα and (Fig. 3.5d) IL-10 of LGG-treated
macrophages were significantly higher than those of the untreated macrophages. MFI
of IL-12 was double of that of the untreated macrophages while that of TNFα was
almost one logarithm higher than that of the untreated macrophages. IL-10 MFI of
macrophages from LGG-treated macrophages was double of that of the untreated
macrophages.
128
Figure 3.6. TLR expression of LGG-treated macrophages

TLR 8 and (h) TLR 9 of macrophages were shown. Data were shown as mean ± SD.
129
Effect of LGG on TLR expression of DCs
Macrophages were incubated with LGG and then harvested for investigating the
constitutive expression of TLRs by qPCR. mRNA levels of (Fig. 3.6b) TLR 2 and
(Figure 3.6g) TLR 8 of LGG-treated macrophages were significantly decreased when
compared with the corresponding untreated macrophages. mRNA levels of other
studied TLRs such as TLRs 1, 4, 5, 6, 7 and 9 were not significantly different from
those of the untreated macrophages.
130
3.3.3. Monocytes
3.3.3.1.1. "Classical" CD14hiCD16- monocytic subset
Figure 3.7. Receptor expression on "classical" CD14hiCD16- monocytic subset
MFIs of (a) HLA-DR, (b) CD86, (c) CD69, (d) PD-L1, (e) CD11b and (f) CCR5 of
"classical" CD14hiCD16- monocytic subset were shown. Data were shown as mean ±
SD. *p<0.100, **p<0.05, ***p<0.01 and ****p<0.001 were considered significant.
131
Figure 3.8. Cytokine production of "classical" CD14hiCD16- monocytic subset
MFIs of (a) IL-12, (b) TNFα and (c) IL-10 of "Classical" CD14hiCD16- monocytic
subset were shown. Data were shown as mean ± SD. *p<0.100, **p<0.05, ***p<0.01
and ****p<0.001 were considered significant.
132
Effect of LGG on receptor expression and cytokine production of "classical"
CD14hiCD16- monocytic subset
MFIs of (Fig. 3.7b) CD86, (Fig. 3.7c) CD69 and (Fig. 3.7e) CD11b of LGG-treated
monocytes were significantly lower than those of the untreated monocytes. MFI of
CD11b of LGG-treated CD14hiCD16- monocytes was almost four times lower than
that of the untreated monocytes. But MFI of (Fig. 3.7d) PD-L1 of LGG-treated
monocytes was significantly higher than that of the untreated monocytes. MFI of PD-
L1 of LGG-treated monocytes was almost double of that of the untreated monocytes.
MFIs of (Fig. 3.7a) HLA-DR and (Fig. 3.7f) CCR5 were not significantly different
from the untreated monocytes.
MFIs of (Fig. 3.8a) IL-12 and (Fig. 3.8b) TNFα of LGG-treated monocytes were
significantly higher than that of the untreated. MFIs of IL-12 and TNFα of LGG-
treated monocytes were about two to three logarithms higher than the untreated.
However, MFI of (Fig. 3.8c) IL-10 of LGG-treated monocytes was not significantly
different from the untreated monocytes.
133
3.3.3.1.2. "Intermediate" CD14hiCD16lo monocytic subset
Figure 3.9. Receptor expression on "intermediate" CD14hiCD16lo monocytic subset

"intermediate" CD14hiCD16lo monocytic subset were shown. Data were shown as mean ±
SD. *p<0.100, **p<0.05, ***p<0.01 and ****p<0.001 were considered significant.
134
Figure 3.10. Cytokine production of "intermediate" CD14hiCD16lo monocytic subset
MFIs of (a) IL-12, (b) TNFα and (c) IL-10 of "intermediate" CD14hiCD16lo
monocytic subset were shown. Data were shown as mean ± SD. *p<0.100, **p<0.05,
135
Effect of LGG on receptor expression and cytokine production of
"intermediate" CD14hiCD16lo monocytic subset
MFIs of (Fig. 3.9a) HLA-DR, (Fig. 3.9e) CD11b of LGG-treated monocytes were
significantly lower than that of the untreated monocytes whereas MIFs of (Fig. 3.9d)
PD-L1 and (Fig. 3.9f) CCR5 of LGG-treated monocytes were significantly higher
than that of the untreated. MFI of PD-L1 of LGG-treated monocytes was about
double of that of the untreated. MFIs o f (Fig. 3.9b) CD86 and (Fig. 3.9c) CD69 of
LGG-treated monocytes were lower but not significantly different from the untreated
monocytes. MFIs of (Fig. 3.10a) IL-12, (Fig. 3.10b) TNFα and (Fig. 3.10c) IL-10 of
LGG-treated monocytes were significantly higher than that of the untreated
monocytes. MFI of IL-10 of LGG-treated CD14hiCD16lo monocytes was about
double of that of the untreated.
136
3.3.3.1.3. "Non-classical" CD14loCD16lo monocytic subset
Figure 3.11. Receptor expression on "non-classical" CD14loCD16lo monocytic subset

"non-classical" CD14loCD16lo monocytic subset were shown. Data were shown as
mean ± SD. *p<0.100, **p<0.05, ***p<0.01 and ****p<0.001 were considered
significant.
137
Figure 3.12. Cytokine production of "non-classical" CD14loCD16lo monocytic subset
MFIs of (a) IL-12, (b) TNFα and (c) IL-10 of "non-classical" CD14loCD16lo
138
Effect of LGG on receptor expression and cytokine production of "non-
classical" CD14loCD16lo monocytic subset
MFIs of (Fig. 3.11a) HLA-DR, (Fig. 3.11b) CD86, (Fig. 3.11e) CD11b and (Fig.
3.11f) CCR5 of LGG-treated monocytes were significantly lower than those of the
untreated monocytes. However, (Fig. 3.11c) CD69 and (Fig. 3.11d) PD-L1 of LGG-
treated monocytes were not significantly different from the untreated monocytes.
MFIs o f (Fig. 3.12a) IL-12 and (Fig. 3.12b) TNFα were significantly higher than
those of the untreated monocytes; but that of (Fig. 3.12c) IL-10 of LGG-treated
monocytes was not significantly different from the untreated monocytes.
139
3.3.3.1.4. "Non-classical" CD14loCD16hi monocytic subset
Figure 3.13. Receptor expression on "non-classical" CD14loCD16hi monocytic subset

MFIs of (a) HLA-DR, (b) CD86, (c) CD69, (d) PD-L1, (e) CD11b and (f) CCR5 of "non-
classical" CD14loCD16hi monocytic subset were shown. Data were shown as mean ± SD.
140
Figure 3.14. Cytokine production of "non-classical" CD14loCD16hi monocytic subset
MFIs of (a) IL-12, (b) TNFα and (c) IL-10 of "non-classical" CD14loCD16hi
141
classical" CD14loCD16hi monocytic subset
MFI of (Fig. 3.13c) CD69 of LGG-treated monocytes was significantly higher than
that of the untreated but that of (Fig. 3.13e) CD11b of LGG-treated monocytes was
significantly lower than that of the untreated monocytes. Others, including (Fig. 3.13a)
HLA-DR, (Fig. 3.13b) CD86, (Fig. 3.13d) PD-L1 and (Fig. 3.13f) CCR5 MFIs of
LGG-treated monocytes were not significantly different from the untreated
monocytes. MFIs of (Fig. 3.14a) IL-12, (Fig. 3.14b) TNFα and (Fig. 3.14c) IL-10 of
LGG-treated monocytes were significantly higher than that of the untreated.
142
3.3.3.1.5. "Non-classical" CD14hiCD16hi monocytic subset
Figure 3.15. Receptor expression on "non-classical" CD14hiCD16hi monocytic subset
MFIs of (a) HLA-DR, (b) CD86, (c) CD69, (d) PD-L1, (e) CD11b and (f) CCR5 of "non-
classical" CD14hiCD16hi monocytic subset were shown. Data were shown as mean ± SD.
143
Figure 3.16. Cytokine production of "non-classical" CD14hiCD16hi monocytic subset
MFIs of (a) IL-12, (b) TNFα and (c) IL-10 of "non-classical" CD14hiCD16hi monocytic
subset were shown. Data were shown as mean ± SD. *p<0.100, **p<0.05, ***p<0.01 and
classical" CD14hiCD16hi monocytic subset
MFIs of (Fig. 3.15a) HLA-DR, (Fig. 3.15d) PD-L1 and (Fig. 3.15f) CCR5 of LGG-
treated monocytes were significantly higher than that of the untreated. MFIs of (Fig.
3.15b) CD86, (Fig. 3.15c) CD69 and (Fig. 3.15e) CD11b of LGG-treated monocytes
were not significantly different from the untreated monocytes. MFIs of (Fig. 3.16a)
IL-12, (Fig. 3.16b) TNFα and (Fig. 3.16c) IL-10 of LGG-treated monocytes were
significantly higher than that of the untreated monocytes.
144
Figure 3.17. Percentages of different monocytic subsets
Percentages of (a) "classical" CD14hiCD116-, (b) "intermediate" CD14hiCD16lo, "non-

classical" (c) CD14loCD16lo, (d) CD14loCD16hi and (e) CD14hiCD16hi monocytic
subsets were shown. Data were shown as mean ± SD. *p<0.100, **p<0.05, ***p<0.01 and
145
Effect of LGG on percentages of monocytic subsets
Percentages of LGG-treated (Fig. 3.17a) "classical" CD14hiCD16-, (Fig. 3.17d)
"non-classical" CD14loCD16hi and (Fig. 3.17e) "non-classical" CD14hiCD16hi
monocytic subsets were significantly lower than that of the untreated monocytes.
Percentages of (Fig. 3.17b) "intermediate" CD14hiCD16lo and (Fig. 3.17c) "non-
classical" CD14loCD16lo monocytic subsets were not significantly different from the
untreated monocytes.
146
Figure 3.18. TLR expression of LGG-treated monocytes

TLR 8 and (h) TLR 9 of monocytes were shown. Data were shown as mean ± SD.
147
Effect of LGG on TLR expression of monocytes
mRNA level of (Fig. 3.27b) TLR 2 LGG-treated monocytes was significantly
decreased when compared with the untreated. mRNA levels of other TLRs such as
TLRs 1, 4, 5, 6, 7 and 9 of LGG-treated monocytes were not significantly different
from those of the untreated.
148
3.4. Discussion
This is the first study to thoroughly demonstrate the immunomodulatory
effects of LGG on antigen-presenting cells of healthy individuals. Our results were
strikingly consistent in demonstrating type 1-immunity-promoting effects of LGG. It
increased the production of Th1-associated cytokines, for example, signature
cytokine IFNγ and IL-12 — the hallmark cytokine of Th1 differentiation and
promotion. It also increased acute inflammation and chiefly M1-associated cytokines
such as TNFα, IL-1α and GM-CSF. Accordingly, the production of Th2-associated
cytokine — IL-4 and Th2-polarizing cytokine — IL-25 were decreased. To our
knowledge, regulation of LGG on IL-25 production in any experimental models
seemed to be barely studied previously.
In addition, our results showed that LGG might enhance Th17 immune
response as observed from the higher release of Th17-associated cytokines – IL-17A
and IL-17F; and potentially Th17 differentiation-promoting cytokine – IL-6. LGG
also increased the production of other Th17-related cytokines such as IL-15, IL-21
and IL-22. Th17 cells, on the one hand, are important to the host mucosal anti-
microbial defense including activity against fungal infections such as candidiasis and
aspergillosis (Zelante, De Luca et al. 2009, Gladiator, Wangler et al. 2013). On the
other hand, overactive Th17 immune responses are associated with autoimmunity
conditions such as sclerosis and arthritis (Hedegaard, Krakauer et al. 2008,
Marijnissen, Koenders et al. 2012, Waite and Skokos 2012). Interestingly, LGG
administration has been shown to significantly reduce enteric Candida colonization in
149
the early stage of life in preterm neonates and its systemic dissemination in mouse
model (Manzoni 2007).
LGG also greatly increased IL-10 production in different co-culture models in
this study. IL-10 can promote antibody-mediated responses of non-inflammatory
isotypes (IgA and IgG4) and suppress production of allergic response-mediating IgE
antibodies. Therefore, the increase in IL-10 is in line with the ability of LGG to
promote IgA responses together with the effects on Th1/Th2 profile and the potential
of LGG in preventing the development of atopic diseases (Majamaa, Isolauri et al.
1995, Kalliomaki, Salminen et al. 2001, Blutt, Miller et al. 2012).
LGG appeared to activate both M1-type and M2-type macrophages as the
signature cytokines of both M1 (TNFα and IL-12) and M2 (IL-10) were seen to
increase in macrophages. In addition, co-culture with LGG reduced CD16 and CD64
expressions on macrophages. CD16 and CD64 expressed on the cell surface of
macrophages are bound to FcγRIIIA and FcγRI of IgG receptively to initiate
antibody-mediated phagocytosis (Kant, De et al. 2002, Swanson and Hoppe 2004,
Huang, Barreda et al. 2006) and antibody-dependent cell-mediated cytotoxicity
(ADCC) (Van Vugt, Van den Herik-Oudijk et al. 1998, Lazar, Dang et al. 2006,
Oganesyan, Damschroder et al. 2008, Horton, Bernett et al. 2010, Lu, Vernes et al.
2011); and indicates phenotypic change associated with maturation. This implied that
LGG might suppress the potential of antibody-mediated phagocytosis and ADCC of
macrophages. Moreover, CD64 can serve as a valuable tool to discriminate between
IBD, infectious enterocolitis, and functional intestinal disorders (Tillinger, Jilch et al.
2009). Decrease in CD64 expression of LGG-treated macrophages revealed that LGG
150
might have potential in preventing hosts from suffering from IBD as patients with
active IBD seemed to have higher tendency to express CD64 than healthy people.
Similar to macrophages, LGG increased IL-12 and TNFα production of all
studied monocytic subsets as well as IL-10 production in "intermediate"
CD14hiCD16lo monocytic subset and "non-classical" CD14loCD16hi and
CD14hiCD16hi monocytic subsets. Notably, LGG also increased the expression of
critical T-cell function-inhibiting receptor PD-L1 expression on proinflammatory
"classical" CD14hiCD16-, "intermediate" CD14hiCD16lo and "non-classical"
CD14hiCD16hi monocytic subsets. This might be induced by peptidoglycan (PGN), a
ubiquitous product on the membrane of LGG. This PGN effect was reported to be
specific to CD14+ monocytic cells fraction (Hewitt, Pele et al. 2012). In addition to
PGN on LGG, increase in PD-L1 expression of monocytes might be due to increase
in secretion of TNFα by monocytes that stimulated by LGG as deficient PD-L1
expression can be restored in vitro by TNFα − a factor to induce expression of PD-
LA on healthy monocytes (Palazon, Aragones et al. 2012). PD-L1 is
immunosuppressive as it ligates PD-1 on T cells to suppress proliferation of CD4+
and CD8+ T cells in antigen specific manner (Carter, Fouser et al. 2002). This has
special importance in limiting peripheral T cell responses to self antigens and its
increase will be sought in preventing and controlling autoimmune diseases such as
Type 1 diabetes (Ansari, Salama et al. 2003, Watanabe and Nakajima 2012).
Moreover, LGG decreased CCR5 expression in "non-classical"
CD14loCD16lo monocytic subset but increased that in "intermediate"
CD14hiCD16lo and "non-classical" CD14hiCD16hi monocytic subsets. CCR5 is
151
known to be a crucial receptor involved in the development of atherosclerotic lesions
by directing monocyte and T cell recruitment. Its deficiency has been proved to
reduce the development of diet-induced atherosclerosis (Braunersreuther, Zernecke et
al. 2007). In this study, it seemed that LGG may influence the pathogenesis of
atherosclerosis diseases as observed from CCR5 expression but whether LGG
promote or suppress the atherosclerosis is needed to be further investigated. However,
potential anti-inflammatory effect was observed from the reduction of CD11b
expression on "classical" CD14hiCD16-, "intermediate" CD14hiCD16lo, "non-
classical" CD14loCD16lo and CD14loCD16hi monocytic subsets. CD11b is a marker
expressed on inflammatory monocytes for migrating the cells to the inflammation
sites (Dunay, Fuchs et al. 2010), implying that LGG might alter the migration of
monocytes. Monocytes are primary drivers of atherogenetic vascular inflammation
and thus enhancement of their anti-inflammatory properties will be of particular
interest in preventing cardiovascular diseases (Moore and Tabas 2011). In here the
most notable influence was noted on the "intermediate" CD14hiCD16lo monocytes,
which is interesting as this subset has recently been shown to be an independent
predictive marker of cardiovascular events (Rogacev, Cremers et al. 2012).
Furthermore, this is in line with our unpublished data on the antiatherogenic
properties of LGG in mouse model of high fat diet-induced atherosclerosis.
LGG seemed to reduce the antigen-presenting aptitude of "intermediate"
CD14hiCD16lo and "non-classical" CD14loCD16lo and CD14hiCD16hi monocytic
subsets as observed from the decrease in HLA-DR expression (Pinet, Vergelli et al.
1995). In addition, LGG might have potential in preventing healthy people from
152
developing Crohn's disease as CD86 expression of monocytes was reported to be
increased in patients with Crohn's disease (Liu, Hiwatashi et al. 1997) but CD86
expression of "classical" CD14hiCD16- and "non-classical" CD14loCD16lo
monocytic subsets was decreased by LGG.
As gram-positive bacterium, LGG would be expected to act via TLR 2
(Mohamadzadeh, Olson et al. 2005, Ciorba, Riehl et al. 2012) as they express
lipoproteins and lipoteichoic acid (LTA) on their cells surfaces (Navarre and
Schneewind 1999). Herein, it was interesting to see whether LGG might also affect
the expression of other TLRs, which could implicate its immunomodulatory
capacities. TLRs 1, 2, 4, 5, 6, 7, 8, and 9 mRNA levels of LGG-treated DCs,
macrophages and monocytes were examined. LGG was shown to reduce the
expression of TLR 2 and TLR 8 mRNA levels of APCs. According to a recent study,
down-regulation of TLR mRNA levels indicates the ligation of that particular
receptor (Peroval, Boyd et al. 2013). Previous studies have shown that immunological
effects of LGG and other Lactobacillus species are related to TLR activation
(Miettinen, Veckman et al. 2008, Wang, Xie et al. 2013). Notably, LGG DNA has
been shown to act via TLR 9 (Ghadimi, Vrese et al. 2010). However, the indirect
indication of TLR 8 ligation seen in this study has not been previously documented
with LGG. If true, it may suggest that the immunomodulatory influence of LGG may
be partly due to APCs reacting to its RNA (Cervantes, Weinerman et al. 2012).
153
3.5. Conclusion
In conclusion, our results consistently demonstrated that LGG promoted Th1, cell-
mediated immunity as Th1-associated cytokine production was increased and
inflammatory M1-type phenotype of macrophages was supported. The results are in
line with many of the clinical effects associated with LGG consumption; and warrant
further investigations on its clinical immunomodulatory potential, especially against
the development of Th2 skewness-associated diseases as well as different infectious
diseases and monocyte-driven proinflammatory conditions such as atherosclerosis.
154
immunomodulatory effect of soluble factors derived
by Lactobacillus rhamnosus GG (LGG) on APCs
4.1. Introduction
Conditioned medium (CM) of Lactobacilli is cell-free supernatant (CFS) containing
soluble factors such as metabolites, proteins, cell-wall constituents and DNA (Rojas,
Ascencio et al. 2002, Mirnejad, Vahdati et al. 2013). Lactobacillus rhamnosus GG
(LGG) is perhaps the most researched Lactobacilli in the world; but some of its
soluble factors have only been recently identified, for example, p75 and p40 proteins
(Yan, Cao et al. 2007), porcine serpine protease inhibitor, glyceraldehyde-3-
phosphate dehydrogenase (GAPDH), cell wall-associated hydrolase, transcriptional
regulator and phosphoglycerate kinase (Sanchez, Schmitter et al. 2009). These factors
played an important role in physiology of LGG (Chatfield, Koo et al. 2005, Hathaway,
Battig et al. 2007, Kinoshita, Uchida et al. 2008, Kinoshita, Wakahara et al. 2008,
Sanchez, Schmitter et al. 2009) and were found to be beneficial to the gut (Tao,
Drabik et al. 2006, Yan, Cao et al. 2007, Seth, Yan et al. 2008, Sanchez, Urdaci et al.
2010, Ciorba, Riehl et al. 2012). Chapter three shows that LGG cells appeared to
consistently activate antigen-presenting cells (APCs) of healthy blood donors to
promote type-1 immune responsiveness, this chapter was thus aimed at studying if
soluble factors that derived by LGG promote the same immune responsiveness as the
155
cells; and if LGG cells interact with soluble factors to alter the immunomodulatory
properties of soluble factors. To the best of our knowledge, this is a novel study to
elucidate the immunomodulatory effects of LGG soluble factors on dendritic cells
(DCs), macrophages and monocytes of healthy donors.
4.2.1. Preparation of conditioned medium (CM) from LGG
Log-phase growing LGG were spinned down at 3000rpm for 15 minutes at 4°C twice
and filtered through 0.22μm filter cap (Corning, NY, USA) thrice. Contioned MRS
medium (CM) were looked under microscope to ensure the absence of LGG cells and
then co-cultured with APCs.
Referred to "Materials and Methods" section of chapter three for other sections.
156
4.3. Results
4.3.1. Dendritic cells
157
158
159
Figure 4.1. Cytokine and chemokine secretion profiles of LGG CM-treated and
LGG CM+LGG-treated cells
Cytokine and chemokine levels of (a) IL-1α, (b) IL-2, (c) IL-7, (d) IL-12(p70), (e)
IFNγ, (f) CCL21, (g) I-309, (h) MCP-2, (i) RANTES, (j) TNFα, (k) IL-27, (l) IL-1β,
(m) IL-15, (n) IL-17A, (o) IL-17F, (p) IL-21, (q) IL-33, (r) IL-23, (s) GMCSF, (t)
BCA-1, (u) MIP-3a, (v) IL-6, (w) IL-22, (x) IL-4, (y) IL-13, (z) IL-25, (aa) MCP-1,
(ab) IL-10 and (ac) IL-16 of LGG CM-treated and LGG CM+LGG-treated were
shown. Data were shown as mean ± SD from more than four donors. *p<0.100,
160
161
162
163
Figure 4.2. Comparison of cytokine and chemokine secretions of LGG CM-
treated and LGG CM+LGG-treated cells
Comparison of cytokine and chemokine levels of (a) IL-1α, (b) IL-2, (c) IL-7, (d) IL-
12(p70), (e) IFNγ, (f) CCL21, (g) I-309, (h) MCP-2, (i) RANTES, (j) TNFα, (k) IL-
27, (l) IL-1β, (m) IL-15, (n) IL-17A, (o) IL-17F, (p) IL-21, (q) IL-33, (r) IL-23, (s)
GMCSF, (t) BCA-1, (u) MIP-3a, (v) IL-6, (w) IL-22, (x) IL-4, (y) IL-13, (z) IL-25,
(aa) MCP-1, (ab) IL-10 and (ac) IL-16 of LGG CM-treated and LGG CM+LGG-
treated cells were shown. Data were shown as mean ± SD. *p<0.100, **p<0.05,
164
LGG alone (from
Chapter 3) LGG CM alone LGG+LGG CM
IL-1α **** *** **** #### IL-1α
IL-2 *** * IL-2
IL-7 *** ** **** ## IL-7
IL-12p70 *** ## IL-12p70
IFNγ **** *** **** #### IFNγ
CCL21 * *** **** CCL21 Th1
I-309 **** ** ** I-309
MCP-2 **** **** #### MCP-2
RANTES **** ## RANTES
TNFα **** ** **** #### TNFα
IL-27 **** *** **** #### IL-27
IL-1β **** ** **** #### IL-1β
IL-15 *** ** ## IL-15
IL-17A **** **** ### IL-17A
IL-17F **** * **** ## IL-17F
IL-21 *** * IL-21
IL-33 IL-33
Th17
IL-23 *** ** ## IL-23
GMCSF **** ** **** #### GMCSF
BCA-1 **** **** #### BCA-1
MIP3a **** * **** # MIP3a
IL-6 **** ** **** IL-6
IL-22 ** IL-22
IL-4 *** *** ** IL-4
IL-13 **** ** ## IL-13
Th2
IL-25 * ** ** IL-25
MCP-1 **** ** ## MCP-1
IL-10 **** * **** #### IL-10
Treg
IL-16 * ## IL-16
Figure 4.3. Summary of cytokine and chemokine secretion levels of LGG CM-
treated and LGG CM+LGG-treated cells and their comparison.
Summary of Figures 4.1 and 4.2. Red colour indicated max negative percentage change
(Max -ve %change) while green colour indicated max positive percentage change (Max
+ve %change). Cytokine levels were compared with corresponding negative controls.
Data were shown as mean ± SD. *p<0.100; **p<0.05; ***p<0.01; ****p<0.001 when
compared treated cells with negative control. #p<0.100, ##p<0.05, ###p<0.01 and
####
p<0.001 when compared LGG CM-treated cells (LGG CM alone) with LGG
CM+LGG-treated cells (LGG CM+LGG).
165
Effect of LGG CM and LGG CM+LGG on cytokine and chemokine production
Levels of Th1-asscociated cytokines and chemokines (IL-1α, IL-2, IL-7, IFNγ,
CCL21, I-309, TNFα and IL-27) of LGG CM-treated cells were significantly higher
than that of the untreated cells. IL-1α level of LGG CM-treated cells was more than
one logarithm of the untreated cells. In addition, LGG CM significantly increased
Th17-associated cytokines and chemokines (IL-1β, IL-17F, GMCSF, MIP3a and IL-6)
but decreased IL-15 and IL-23. GMCSF and IL-6 production of LGG CM-treated
cells was more than 100 times and 80 times of the untreated cells respectively.
Moreover, LGG CM decreased Th2-associated cytokine (IL-4) but increased IL-25.
LGG CM also increased regulatory T (Treg) cell-related cytokine (IL-10).
LGG CM+LGG significantly increased the production of Th1-associated (IL-1α, IL-7,
IFNγ, CCL21, I-309, MCP-2, TNFα and IL-27) and Th17-associated cytokines and
chemokines (IL-1β, IL-17A, IL-17F, IL-21, GMCSF, BCA-1, MIP3a and IL-6). IL-
1α and IL-1β levels of LGG CM+LGG-treated cells were more than two logarithms
of those of the untreated cells. However, LGG CM+LGG significantly decreased IL-
23 secretion. LGG CM+LGG significantly decreased Th2-associated cytokine (IL-4)
but increased IL-13, IL-25 and MCP-1 and Treg-related cytokine (IL-10). When
compared LGG CM-treated with LGG CM+LGG-treated cells, IL-1α, IL-7, IL-
12(p70), IFNγ, MCP-2, RANTES, TNFα, IL-27, IL-1β, IL-15, IL-17A, IL-17F, IL-23,
GMCSF, BCA-1, MIP3a, IL-13, MCP-1, IL-10 and IL-16 productions of LGG
CM+LGG cells were significantly higher than that of the LGG CM-treated.
166
Figure 4.4. TLR expression of LGG CM-treated and LGG CM+LGG-treated

DCs
TLR 8 and (h) TLR 9 of DCs were shown. Data were shown as mean ± SD. *p<0.100,
167
Figure 4.5. Comparison of TLR expressions of LGG CM-treated and LGG
CM+LGG-treated DCs
Comparison of mRNA levels of (a) TLR 1, (b) TLR 2 (c) TLR 4, (d) TLR 5, (e) TLR
6, (f) TLR 7, (g) TLR 8 and (h) TLR 9 of LGG CM-treated and LGG CM+LGG-
treated DCs were shown. Data were shown as mean ± SD. *p<0.100, **p<0.05,
168
Effect of LGG CM and LGG CM+LGG on TLR expressions of DCs
mRNA levels of TLRs 1, 4, 5, 6, 7, 8 and 9 of LGG CM-treated or LGG CM+LGG-treated
DCs were shown in Figure 4.5. LGG CM and LGG CM+LGG significantly increased
TLRs 1, 4, 5, 6, 7, 8, and 9 mRNA levels of DCs. As shown in Figure 4.6, when compared
LGG CM-treated with LGG CM+LGG-treated DCs, mRNA levels of all studied TLRs of
LGG CM-treated DCs were not significantly different from those of LGG CM+LGG-
treated DCs.
169
4.3.2. Macrophages

macrophages
TLR 8 and (h) TLR 9 of macrophages were shown. Data were shown as mean ± SD.
170
Figure 4.7. Comparison of TLR expression of LGG CM-treated macrophages
with LGG+LGG CM-treated macrophages
Comparison of mRNA levels of (a) TLR 1, (b) TLR 2, (c) TLR 4, (d) TLR 5, (e) TLR
6, (f) TLR 7, (g) TLR 8 and (h) TLR 9 of macrophages were shown. Data were
shown as mean ± SD. *p<0.100, **p<0.05, ***p<0.01 and ****p<0.001 were
considered.
171
Effect of LGG CM and LGG CM+LGG on TLR expression of macrophages
Similar to DCs, LGG CM and LGG CM+LGG significantly increased TLR 1, 4, 5, 6,
7, 8 and 9 mRNA levels of macrophages. As shown in Figure 4.9, when compared
LGG CM-treated with LGG CM+LGG-treated macrophages, mRNA levels of all
studied TLRs of LGG CM-treated DCs were not significantly different from those of
LGG CM+LGG-treated macrophages.
172
Figure 4.8. Receptor expression and comparison of treated macrophages

Mean fluorescence intensities (MFIs) and comparison of (a and b) CD16, (c and d)
HLA-DR, (e and f) CD80 and (g and h) CD86 of LGG CM-treated and LGG
CM+LGG-treated macrophages. Data were shown as mean ± SD. *p<0.100,
173
Figure 4.9. Inflammatory marker expression and comparison of treated macrophages
MFIs and comparison of (a and b) CD206, (c and d) CD209, (e and f) CD163 and (g and h)
CD64 of LGG CM-treated and LGG CM+LGG-treated macrophages. Data were shown as
mean ± SD. *p<0.100, **p<0.05, ***p<0.01 and ****p<0.001 were considered significant.
174
Figure 4.10. Cytokine production and transcription factors of and comparison of
treated macrophages
MFIs and comparison of (a and b) IL-12, (c and d) TNFα, (e and f) T-bet and (g and
h) IL-10 of LGG CM-treated and LGG CM+LGG-treated macrophages. Data were
shown as mean ± SD. *p<0.100, **p<0.05, ***p<0.01 and ****p<0.001 were
175
Effects of LGG CM and LGG CM+LGG on receptor expression, cytokine
production and transcription factor expression of macrophages
LGG CM and LGG CM+LGG significantly decreased (Fig. 4.8a) CD16 MFI but
increased (Fig. 4.8c) HLA-DR MFI of macrophages. However, LGG CM and LGG
CM+LGG significantly decreased (Fig. 4.8d) CD80 and (Fig. 4.8g) CD86 MFIs of
macrophages. When compared LGG CM-treated with LGG CM+LGG-treated
macrophages, CD80 MFI of LGG CM+LGG-treated macrophages was significantly
higher than that of LGG CM+LGG-treated (Fig. 4.10f).
LGG CM and LGG CM+LGG decreased MFI of inflammatory receptors on
macrophages such as (Fig. 4.9a) CD206, (Fig. 4.9c) CD209, (Fig. 4.9e) CD163 and
(Fig. 4.9g) CD64. MFI of these receptors were reduced by more than half when
compared with the untreated macrophages. When compared LGG CM-treated with
LGG CM+LGG-treated macrophages, MFIs of all studied inflammatory receptors of
LGG CM+LGG-treated macrophages were not significantly different from those of
LGG CM+LGG-treated (Fig. 4.9b, d, f and h).
Furthermore, LGG CM and LGG CM+LGG reduced MFIs of (Fig. 4.120a) IL-12,
(Fig. 4.10c) TNF and (Fig. 4.10e) T-bet. LGG CM and LGG CM+LGG decreased
(Fig. 4.10g) IL-10 MFI of macrophages as well. When compared LGG CM-treated
with LGG CM+LGG-treated macrophages, MFIs of all studied cytokines and
transcription factor of LGG CM+LGG-treated macrophages was comparable to those
of LGG CM+LGG-treated (Fig. 4.10b, d and h).
176
4.3.3. Monocytes

monocytes
mRNA levels of (a) TLR 1, (b) TLR 2 (c) TLR 4, (d) TLR 5, (e) TLR 6, (f) TLR 7, (g) TLR
8 and (h) TLR 9 of monocytes were shown. Data were shown as mean ± SD. *p<0.100,
177
Figure 4.12. Comparison of TLR expression of LGG CM-treated and
LGG+LGG CM-treated monocytes
Comparison of mRNA levels of (a) TLR 1, (b) TLR 2 (c) TLR 4, (d) TLR 5, (e) TLR
6, (f) TLR 7, (g) TLR 8 and (h) TLR 9 of monocytes were shown. Data were shown
as mean ± SD. *p<0.100, **p<0.05, ***p<0.01 and ****p<0.001 were considered
significant.
178
Effects of LGG CM and LGG CM+LGG on TLR expression of monocytes
mRNA levels of TLR 1, 2, 4, 5, 6, 7, 8 and 9 of LGG CM-treated or LGG CM+LGG-
treated monocytes were shown in Figure 4.14. LGG CM significantly increased TLR
1, 5, 7 and 9 mRNA levels of monocytes when compared with the untreated
monocytes. However, LGG CM+LGG significantly decreased mRNA levels of TLRs
1 and 5 of monocytes. When compared LGG CM-treated with LGG CM+LGG-
treated cells, TLR 1, 4, 5, 6, and 7 mRNA levels of LGG CM+LGG-treated
monocytes were significantly lower than those of LGG CM-treated monocytes (Fig.
4.15).
179
4.3.3.2.1. "Classical" CD14hiCD16- Monocytic subset
Figure 4.13. Receptor expression of "classical" CD14hiCD16- monocytic subset

MFIs and comparison of (a and b) HLA-DR, (c and d) CD86, (e and f) CD69, (g and h) PD-L1, (i and j) CD11b and (k and
l) CCR5 of LGG CM-treated and LGG CM+LGG-treated "classical" CD14hiCD16- monocytes. Data were shown as mean
± SD. *p<0.100, **p<0.05, ***p<0.01 and ****p<0.001 were considered significant.
180
Figure 4.14. Cytokine production of "classical" CD14hiCD16- monocytic subset
MFIs and comparison of (a and b) IL-12, (c and d) TNFα and (e and f) IL-10 of LGG
CM-treated and LGG CM+LGG-treated "classical" CD14hiCD16- monocytes. Data
were shown as mean ± SD. *p<0.100, **p<0.05, ***p<0.01 and ****p<0.001 were
181
Effects of LGG CM and LGG CM+LGG on receptor expression and cytokine
production of "classical" CD14hiCD16- monocytic subset
Figures 4.13 and 4.14 showed the receptor expressions and cytokine productions of
'classical" CD14hiCD16- subset. LGG CM decreased CD86, CD11b, HLA-DR and
IL-12 MFIs and percentage but increased IL-10 MFI while LGG CM+LGG
decreased CD86 and CD11b MFIs and percentage but increased CCR5, TNFα and
IL-10 MFIs. When compared LGG CM-treated with LGG CM+LGG-treated
monocytes, IL-12 and TNFα MFIs of LGG CM+LGG-treated monocytes were higher
but percentage of LGG CM+LGG-treated monocytes was lower than that of LGG
CM-treated.
182
4.3.3.2.2. "Intermediate" CD14hiCD16lo Monocytic subset
Figure 4.15. Receptor expression of "intermediate" CD14hiCD16lo monocytic subset

l) CCR5 of LGG CM-treated and LGG CM+LGG-treated "intermediate" CD14hiCD16lo monocytes. Data were shown as
183
subset
CM-treated and LGG CM+LGG-treated "intermediate" CD14hiCD16lo monocytes.
Data were shown as mean ± SD. *p<0.100, **p<0.05, ***p<0.01 and ****p<0.001
were considered significant.
184
production of "intermediate" CD14hiCD16lo monocytic subset
'intermediate" CD14hiCD16lo monocytic subset. LGG CM decreased CD86, CD11b
and PD-L1 MFIs but increased HLA-DR MFI while LGG CM+LGG decreased
CD11b MFI but increased HLA-DR, TNFα and IL-10 MFIs. When compared LGG
CM-treated with LGG CM+LGG-treated monocytes, CD11b, PD-L1, CCR5, IL-12,
TNFα and IL-10 MFIs of LGG CM+LGG-treated monocytes were significantly
higher than those of the LGG CM-treated.
185
4.3.3.2.3. "Non-classical" CD14loCD16lo Monocytic subset
Figure 4.17. Receptor expression of "non-classical" CD14loCD16lo monocytic subset

l) CCR5 of LGG CM-treated and LGG CM+LGG-treated "non-classical" CD14loCD16lo monocytes. Data were shown as
186
Figure 4.18. Cytokine production of "non-classical" CD14loCD16lo monocytic subset
CM-treated and LGG CM+LGG-treated "non-classical" CD14loCD16lo monocytes.
187
production of "non-classical" CD14loCD16lo monocytic subset
"non-classical" CD14loCD16lo monocytic subset. LGG CM and LGG CM+LGG
reduced CD86, CD11b and CCR5 MFIs while the former decreased PD-L1 MFI.
When compared LGG CM-treated with LGG CM+LGG-treated monocytes, PD-L1
MFI of LGG CM+LGG-treated monocytes was significantly higher than that of the
LGG CM-treated.
188
4.3.3.2.4. "Non-classical" CD14loCD16hi Monocytic subset
Figure 4.19. Receptor expression of "non-classical" CD14loCD16hi monocytic subset
l) CCR5 of LGG CM-treated and LGG CM+LGG-treated "non-classical" CD14hiCD16lo monocytes. Data were shown as
189
Figure 4.20. Cytokine production of "non-classical" CD14loCD16hi monocytic subset
CM-treated and LGG CM+LGG-treated "non-classical" CD14hiCD16lo monocytes.
190
production of "non-classical" CD14loCD16hi monocytic subset
"non-classical" CD14loCD16hi subset. LGG CM and LGG CM+LGG reduced
CD11b and PD-L1 MFIs while the latter reduced CD86 MFI but increased the
percentage. When compared LGG CM-treated with LGG CM+LGG-treated
monocytes, percentage of LGG CM+LGG-treated monocytes was significantly
higher than that of the LGG CM-treated.
191
4.3.3.2.5. "Non-classical" CD14hiCD16hi Monocytic subset
Figure 4.21. Receptor expression of "non-classical" CD14hiCD16hi monocytic subset
l) CCR5 of LGG CM-treated and LGG CM+LGG-treated "non-classical" CD14hiCD16hi monocytes. Data were shown as
192
Figure 4.22. Cytokine production of "non-classical" CD14hiCD16hi monocytic subset
CM-treated and LGG CM+LGG-treated "non-classical" CD14hiCD16hi monocytes.
193
production of "non-classical" CD14hiCD16hi monocytic subset
"non-classical" CD14hiCD16hi subset. LGG CM and LGG CM+LGG decreased
CD86, CD11b, CD69, CCR5, IL-12, TNF and IL-10 MFIs and the percentage of
‘non-classical” CD14hiCD16hi monocytic subsets while the latter decreased HLA-
DR MFI. When compared LGG CM-treated with LGG CM+LGG-treated monocytes,
CCR5, IL-12, TNF and IL-10 MFIs and percentage of LGG CM+LGG-treated
monocytes were significantly higher than that of LGG CM-treated monocytes.
194
Figure 4.23. Percentages of various monocytic subsets
Percentages of (a) "classical" CD14hiCD16-, (b) 'intermediate" CD14hiCD16lo, (c)
"non-classical" CD14loCD16lo, (d) "non-classical" CD14loCD16hi and (e) "non-
classical" CD14hiCD16hi monocytic subsets were shown. Data were shown as mean
± SD. *p<0.100, **p<0.05, ***p<0.01 and ****p<0.001 were considered significant.
195
Effects of LGG CM and LGG CM+LGG on the percentages of monocytic
subsets
Both LGG CM and LGG CM+LGG significantly decreased the percentages of
"classical" CD14hiCD16- monocytic subsets (Fig. 4.23a) and "non-classical"
CD14hiCD16hi (Fig. 4.23e) monocytic subset; but significantly increased that of
"non-classical" CD14loCD16lo monocytic subset. Moreover, LGG CM+LGG
significantly increased the percentage of "non-classical" CD14loCD16hi monocytic
subset.
196
Figure 4.24. Summary of receptor expression and cytokine production of various monocytic
subsets
MFI of receptor and cytokines and percentages of (A) "classical" CD14hiCD16-, (B)
"intermediate" CD14hiCD16lo, "non-classical" (C) CD14loCD16lo, (D) CD14loCD16hi and (E)
CD14hiCD16hi monocytic subsets were measured by flow cytometer. Results were presented as
mean. *p<0.100, **p<0.05, ***p<0.01 and ****p<0.001 when compared LGG CM-treated
monocytes with negative control. #p<0.100, ##p<0.05, ###p<0.01 and ####p<0.001 when compared
LGG CM+LGG-treated monocytes with negative control. ^p<0.100, ^^p<0.05, ^^^p<0.01 and
^^^^
p<0.001 when compared LGG CM-treated monocytes with LGG CM+LGG-treated
monocytes. indicated negative control; indicated LGG CM-treated monocytes; indicated
LGG CM+LGG treated monocytes.
197
4.4. Discussion
To the best of our knowledge, this is the first study to demonstrate the
immunomodulatory effects of LGG soluble factors on APCs of human blood donors.
In chapter three, TLR 2 expression of LGG-treated DCs, macrophages and
monocytes and TLR 8 expression of LGG-treated macrophages of healthy blood
donors decreased. However, TLR 1, 4, 5, 6, 7, 8, and 9 expressions of LGG CM-
treated DCs and macrophages as well as TLR 1, 5, 7 and 9 expressions of LGG CM-
treated monocytes were increased. According to a recent study, down-regulation of
TLR mRNA levels indicates the ligation of that particular receptor (Peroval, Boyd et
al. 2013), suggesting that soluble factor in LGG CM might not have ligated these
TLRs. TLR 2 expression of LGG CM-treated and LGG CM+LGG-treated DCs,
macrophages and monocytes could not be measured by qPRC in this study. The
reasons might be that soluble factors ligated TLR 2 and greatly down-regulated TLR
2 expression to the level well below detection; or LGG CM might have suppressed
TLR 2 expression of APCs. Further investigations were needed. A previous study
showed that LGG CM exerted a TLR 2-dependent radioprotection to murine intestine
(Ciorba, Riehl et al. 2012), suggesting that LGG CM might not be able to elicit a
radioprotective effect in human intestine if the second reason is true. Moreover,
results of this study were similar to the CM of another Lactobacillius strain –
Lactobacillus reuteri 6475 that it does not change cell surface quantities of human
TLR 4 on LPS-activated THP-1 monocytes (Lin, Thibodeaux et al. 2008).
Addition of LGG cells appeared not to influence TLR expressions of LGG
CM-treated DCs and macrophages but monocytes. TLR 1, 4, 5, 6, and 7 expressions
198
of LGG CM+LGG-treated monocytes were significantly different from those of LGG
CM-treated monocytes. TLR 1 and 5 mRNA levels of LGG CM+LGG-treated
monocytes were significantly lower than those of the untreated monocytes, indicating
the ligation of these particular receptors (Peroval, Boyd et al. 2013).
Cytokine production and receptor expressions of monocytes were then studied
as they are closely related to TLR expressions (Gray, Foy et al. 2004, Du, Kelly et al.
2006, Chau, McCully et al. 2009, Guerrero, Cunha et al. 2012). "Classical"
CD14hiCD16-, "intermediate" CD14hiCD16lo, "non-classical" CD14loCD16lo,
"non-classical" CD14loCD16hi and "non-classical" CD14hiCD16hi monocytic
subsets were examined in this study. "Non-classical" CD14hiCD16hi monocytic
subset was reported to be highly pro-inflammatory (Unthank 2012). But its
inflammatory aptitude seemed to be inhibited by LGG CM in this study as its Th1-
associated cytokine IL-12 and TNFα productions decreased. This was similar to the
CM of Lactobacillus TH14 and Lactobacillus reuteri CF48-3A (Lin, Thibodeaux et
al. 2008, Taweechotipatr, Iyer et al. 2009) but different from the CM of Lactobacillus
reuteri 6475 (Lin, Thibodeaux et al. 2008). Such LGG CM effect seemed to be
suppressed by LGG as IL-12 and TNFα MFIs of LGG CM+LGG-treated “non-
classical” CD14hiCD16hi monocytic subset was significantly higher than those of the
LGG CM-treated. LGG also seemed to suppress IL-10 production of CD14hiCD16hi
subset as IL-10 MFI of LGG CM+LGG-treated “non-classical” CD14hiCD16hi
subset was significantly higher than that of the LGG CM-treated. Moreover, LGG
CM and LGG CM+LGG reduced CD86 expression of almost all studied monocytic
subsets. CD86 expression of monocytes was reported to be increased in patients with
199
Crohn's disease (Liu, Hiwatashi et al. 1997), implying that LGG CM and LGG
CM+LGG might have potential in preventing healthy people from developing
Crohn's disease. LGG CM and LGG CM+LGG also significantly reduced CD11b
expression of all studied monocytic subsets, inferring that they might prevent health
people from developing atherosclerosis as CD11b expression was reported to be
increased on circulating monocytes after myocardial infarction and reflect the activity
level of the disease (Meisel, Shapiro et al. 1998). Furthermore, LGG CM might
prevent people from being infected by human immunodeficiency virus (HIV) (Yang,
Zheng et al. 2004, Boasso, Hardy et al. 2008) as PD-L1 and CCR5 (as well as CD86)
expressions of specific monocytic subsets were significantly reduced by LGG CM in
this study. But decrease in PD-L1 expression imply that LGG CM might not be able
to protect people from autoimmune diseases such as type 1 diabetes (Ansari, Salama
et al. 2003, Watanabe and Nakajima 2012) as PD-L1 is a critical T-cell function-
inhibiting receptor and immunosuppressive that it ligates PD-1 on T cells to suppress
proliferation of T cells in antigen-specific manner (Carter, Fouser et al. 2002) and
limit peripheral T cell responding to self-antigens. However, LGG cells might
suppress LGG CM on PD-L1 expression as PD-L1 expression of LGG CM+LGG-
treated “intermediate” CD14hiCD16lo and “non-classical” CD14loCD16lo
monocytes were significantly higher than that of the LGG CM-treated. Moreover,
CCR5 expression of LGG CM+LGG-treated “intermediate” CD14hiCD16lo and
“non-classical” CD14hiCD16hi monocytes were significantly higher than that of the
LGG CM-treated. LGG CM and LGG CM+LGG seemed to have potential in
preventing healthy people from developing sarcoidosis (Heron, Grutters et al. 2008)
200
as it significantly decreased CD69 expression of “intermediate” CD14hiCD16lo and
“non-classical” CD14hiCD16hi monocytes. CD14hi monocytes were known to have
high antigen-presenting aptitude (Thomas and Lipsky 1994); however such aptitude
was diminished by LGG CM in this study as HLA-DR expression of LGG CM-
treated CD14hiCD16- monocytes decreased. Apart from receptor expressions and
cytokine productions, LGG CM might also alter the proportions of monocytic subsets.
It increased the amount of CD14loCD16lo subset while decreased that of
CD14hiCD16-, CD14loCD16hi and CD14hiCD16hi subsets.
Receptor expression and cytokine production of macrophages were also
investigated at cellular level in this study. In contrast to monocytes, LGG CM
increased the antigen-presenting ability (Bontrop, Ottenhoff et al. 1986) of
macrophages as it doubled the HLA-DR expression of macrophages. LGG CM
reduced co-stimulatory molecules, including CD80 and CD86, on macrophages in
this study. Although reduction of CD80 expression by LGG CM was significantly
limited by LGG, CD80 expression of LGG CM+LGG-treated macrophages was still
significantly lower than that of the untreated macrophages. Decrease in CD80 and
CD86 expressions implied that the abilities of macrophages to activate primary
antiviral CD8+ T-cell response and to induce neutralizing antibodies might be
impaired (Fuse, Obar et al. 2006) and so immune surveillance of the hosts might be
weakened. In addition, LGG CM significantly decreased expressions of inflammatory
receptors, including CD163, CD206, CD64 and CD209 (van Vuuren, van Roon et al.
2006, Liu, Phan et al. 2008, Fuentes-Duculan, Suarez-Farinas et al. 2010, Wentworth,
Naselli et al. 2010, Biondo, Malara et al. 2012); and production of M1-type cytokines
201
(IL-12 and TNFα) of macrophages. It also decreased Th1-associated transcription
factor (T-bet) expression. These results were similar to the CM of other Lactobacillus
species (Chan Remillard SKW 2006) that they decrease TNFα production of
macrophages (Pena and Versalovic 2003). CD163+ macrophages were reported to
express CD206, CD209 and CD86 and to produce inflammatory cytokines such as
IL-12 and TNFα (Fuentes-Duculan, Suarez-Farinas et al. 2010). This intimated that
decrease in CD206, CD209 and CD86 expression and IL-12 and TNFα production of
macrophages in this study might be due to the decrease in CD163 expression.
Furthermore, CD64 (like CD16) was Fcgamma receptor (FcγR), which bound to
FcγRIIIA (and FcγRI) of immunoglobin G (IgG), to initiate phagocytosis and
antibody-dependent cell-mediated cytotoxicity (ADCC) (Van Vugt, Van den Herik-
Oudijk et al. 1998, Kant, De et al. 2002, Huang, Barreda et al. 2006). Decrease in
CD64 expression indicated that LGG CM might suppress the potential of antibody-
mediated phagocytosis and ADCC of macrophages.
Regulation of LGG CM or LGG CM+LGG on Th immune responses were
then investigated. Since DCs were an important pivot bridging innate and adaptive
immunities via cytokines, we incubated LGG CM-treated or LGG CM+LGG-treated
DCs with PBMCs and subsequently examined the cytokine and chemokine secretion
profiles of the co-culture. To our knowledge, this was the first study to demonstrate
such complete cytokine and chemokine secretion profiles of LGG CM-treated and
LGG CM+LGG-treated cells. Similar to the CM of Lactobacillus NCFM (Sanchez,
Urdaci et al. 2010), LGG CM tended to promote Th17 immune response as it
increased Th17-associated cytokines and chemokines (IL-1β, IL-17F and GMCSF)
202
and Th17 differentiation-promoting IL-6. Th17 cells, on the one hand, are important
to the host mucosal anti-microbial defense including activity against fungal infections
such as candidiasis and aspergillosis (Zelante, De Luca et al. 2009, Gladiator,
Wangler et al. 2013). On the other hand, overactive Th17 responses are associated
with autoimmunity conditions such as sclerosis and arthritis (Hedegaard, Krakauer et
al. 2008, Marijnissen, Koenders et al. 2012, Waite and Skokos 2012). IL-10
production was also increased by LGG CM like the CM of Bifidobacterium breve
(Menard, Candalh et al. 2004). IL-10 promotes antibody-mediated responses of non-
inflammatory isotypes (IgA and IgG4) and suppresses generation of allergic
response-mediating IgE antibodies. Therefore, the increase in IL-10 production in this
study is in line with the ability of LGG soluble factors to promote IgA responses and
together with the effects on Th1/Th2 profile and potential of LGG in preventing the
development of atopic diseases (Majamaa, Isolauri et al. 1995, Kalliomaki, Salminen
et al. 2001, Blutt, Miller et al. 2012). Enhancement of Th17 immune response and
increase in IL-10 production in this study might be due to TLR 2 deficiency on APCs
as a previous study stated that TLR 2 deficiency led to an increase in Th17 immunity
associated with expression of regulatory T cells (Zemann, Schwaerzler et al. 2003).
In addition, LGG CM might promote Th1 immune response as it increased
production of some Th1-associated cytokines such as IL-1α, IFNγ and TNFα but
decreased that of Th2 cytokine IL-4 sharply. LGG seemed to synergistically boost up
type-1 and type-17 immune responsiveness that promoted by LGG CM as levels of
Th1-associated and Th17-associated cytokines and chemokines of LGG CM+LGG-
203
treated mononuclear cells were significantly higher than those of LGG CM-treated
mononuclear cells.
Throughout the study, cytokine and chemokine production, TLR, receptor and
transcription factor expressions of LGG CM-treated or LGG CM-treated DCs,
macrophages and different monocytic subsets were correlated at various extents.
Above all, addition of LGG cells to LGG CM gave different results, particularly TLR
expression of monocytes and cytokine and chemokine secretions of mononuclear
cells. The possible reason might be that a complex interplay existed between LGG
cells and their soluble factors, which led to synergies, antagonism, suppression or
enhancement. Further investigations are needed.
4.5 Conclusion
In conclusion, LGG CM seemed to modulate TLR expressions of monocytes, DCs
and macrophages differently. It decreased IL-12, TNFα and IL-10 productions of
specific monocytic subsets and macrophages; and reduced Th1-associated
transcription factor (T-bet) expression in macrophages. Its effect on TLR and receptor
expressions as well as cytokine production of monocytes appeared to be suppressed
by LGG cells. Moreover, LGG CM seemed to promote type-1 and type-17 immune
responses of mononuclear cells, which were further enhanced by LGG cells. With a
thorough understanding in immunomodulatory mechanism of LGG CM in this study,
LGG soluble factors may be able to be utilized as an alternative to develop vaccines
and adjuvant for treatments; and boost up the immune systems.
204
immunomodulatory effect of hydrogen ions and
lactate on dendritic cells
5.1. Introduction
LGG is a lactic acid bacterium, which produces lactic acid when undergoing
homofermentation (Andrew R. Berry, Christopher M.M. Franco et al. 1999, Yu, Su et
al. 2011). Lactic acid secreted by LGG has been proved to elicit strong antimicrobial
effect on pathogens like Salmonella typhimurium (De Keersmaecker, Verhoeven et al.
2006).; and its immunomodulatory properties on immune cells in tumor environment
have been investigated in a recent decade (Dietl, Renner et al. 2010, Yabu, Shime et
al. 2011). However, knowledge of immunomodulatory effect of lactic acid on
antigen-presenting cells (APCs) of healthy blood donors has not been elucidated.
Tumor-derived lactic acid regulates DC phenotype in tumor milieu, which critically
contributes to tumor escape mechanisms (Gottfried, Kunz-Schughart et al. 2006); and
dendritic cells (DCs) are the most vital professional APCs to determine the initiation
of immune responses or induction of immunological tolerance (Guermonprez,
Valladeau et al. 2002) and express various acid-sensing receptors (Kim 2003,
Wemmie, Price et al. 2006, Tong, Wu et al. 2011, Taleb, Maammar et al. 2012, Wen,
Ostman et al. 2012). Chapter four shows that Lactobacillus rhamnosus GG (LGG)-
derived soluble factors may promote Th1 inflammatory response in healthy
population; this chapter was thus hypothesized that Th1 immune response was
205
attributed to lactic acid secreted by LGG, with the use of DCs. Immunomodulatory
effect of lactic acid was preliminarily studied in this chapter.
5.2.1. Isolation of peripheral blood mononuclear cells (PBMCs) and
differentiation of dendritic cells (DCs)
Referred to "Materials and Methods" section of chapter three.
5.2.2. Stimulation of immature DCs with lactic acid or hydrochloric acid (HCl)
Immature DCs were cultured in freshly prepared complete media with pH ranging
from 4 to 6 adjusted by lactic acid or hydrochloric acid (HCl) and from 8 to 10
adjusted by sodium hydroxide (NaOH) for 24 hours. Positive control (POS) was
prepared with 1000U/ml rh interferon-γ (IFNγ) (Life Technologies, California, USA),
100ng/ml lipopolysaccharides (LPS) from Escherichia Coli 0111:B4 (Sigma Aldrich,
St. Louis, Mo, USA) and 1µg/ml TLR 7/8 ligands (InvivoGen, San Diego, California,
USA) modified from the study of Paustian (2011) (Paustian, Caspell et al. 2011).
Brefeldin A solution (10µg/ml) (eBioscience, San Diego, CA, USA) was added to
DCs 15 hours before cell harvest.
206
5.2.3. Flow cytometric Analysis
Anti-human CD14-FITC, CD11c-PE/Cy7, HLA-DR-APC/Cy7, CD80-PerCP-eFluor
710, CD86-PE, PD-L1-APC, IL-12/IL-23(p40)-PE, IL-10-Alexa Fluor 647 and T-
bet-PerCP-Cy5.5 (all from eBioscience except HLADR-APC/Cy7 from Biolegend)
monoclonal antibodies (mAbs) were used this study. Referred to "Materials and
Methods" section of chapter three for staining protocol and analysis methods.
Data shown in the bar charts were presented as mean ± SD. Kruskal-Wallis, one-way
ANOVA, Tukey HSD, LSD, two-tailed Student t and Mann-Whitney tests were used
to evaluate the significant differences between groups (p<0.100*, p<0.05**,
p<0.01*** and p<0.001****). Statistical calculations were performed using SPSS 19
for Windows (Chicago, IL, USA) and GraphPad Software Prism 6.04 (San Diego,
CA, USA).
207
5.3. Results
5.3.1. Immunophenotyping
Figure 5.1. Effect of hydrogen ions on receptor expression and cytokine
production of DCs
Mean fluorescence intensities (MFIs) of (A) HLA-DR, (B) CD80, (C) CD86, (D) PD-
L1, (E) IL-10, (F) IL-12 and (G) T-bet of DCs at different concentrations of hydrogen
ions were shown. *p<0.10, **p<0.05, ***p<0.01, ****p<0.001 were considered
significant. POS, positive control; Neg, negative control.
208
Effect of hydrogen ions on receptor expression and cytokine production of DCs
Mean fluorescence intensities (MFIs) of activation-related receptors and cytokines of
DCs at different concentrations of hydrogen ions are shown in Figure 5.1. (Fig. 5.1A)
HLA-DR MFI of DCs at pH4 was significantly lower than that of the untreated but
HLA-DR MFI of DCs at pH5 was significantly higher than that of the untreated. (Fig.
5.1B) CD80 MFIs of DCs at pH4 and pH5 were higher than that of the untreated
whereas (Fig. 5.1C) CD86 MFIs of DCs at the same pH were lower than that of the
untreated. Both CD80 and CD86 MFIs of DCs at pH9 and pH10 were lower than that
of the untreated. (Fig. 5.1D) PD-L1 MFI of DCs at pH5 was higher than the untreated.
No significant changes were observed from (Fig. 5.1E) IL-10 and (Fig. 5.1F) IL-12
MFIs of DCs. (Fig. 5.1G) T-bet MFIs of DCs at pH4 tended to be higher than that of
the untreated cells.
209
Figure 5.2. Effect of lactate on receptor expression and cytokine production of DCs
MFIs of receptors and cytokines of DCs in (A) 35mM, (B) 10mM and (C) 5mM lactate
were shown. Middle line in the box showed the mean. *p<0.10, **p<0.05, ***p<0.01,
****p<0.001 were considered significant. indicated DCs with lactate; indicated
DCs without lactate.
210
Receptor expression and cytokine production of DCs at various lactate
concentrations
MFIs of receptors and cytokines of DCs at different lactate concentrations, including
35mM, 10mM and 5mM, are shown in Figure 5.2. PD-L1 and IL-10 MFIs of (Fig.
5.2A) 35mM lactate-treated DCs were significantly lower than those of the untreated.
HLA-DR and CD80 MFIs of (Fig. 5.2B) 10mM lactate-treated DCs were
significantly lower than those of the untreated. MFIs of HLA-DR, PD-L1, IL-10, IL-
12 and T-bet of (Fig. 5.2C) 5mM lactate-treated DCs were lower than those of the
untreated DCs.
211
Figure 5.3. Receptor expression and cytokine production of DCs in lactic acid
with various pH
MFIs of (A) HLA-DR, (B) CD80, (C) CD86, (D) PD-L1, (E) IL-10, (F) IL-12 and (G)
T-bet of DCs in lactic acid with pH ranging from 4 to 6 were shown. Data were
presented as mean ± SD. *p<0.10, **p<0.05, ***p<0.01, ****p<0.001 were
considered significant. LA, lactic acid; POS, positive control; Neg, negative control.
212
Receptor expression and cytokine production of DCs at various lactic acid
concentrations at corresponding pH
MFIs of receptors and cytokines of DCs in lactic acid with various pH are shown in
Figure 5.3. (Fig. 5.3A) HLA-DR MFIs of DCs in lactic acid with pH4 and 6 were
significantly lower than that of the untreated. (Fig. 5.3B) CD80 MFIs of DCs in lactic
acid with pH4 and 5 were significantly higher than those of the untreated; however
(Fig. 5.3C) CD86 MFIs of DCs in lactic acid with the same pH were significantly
lower than that of the untreated. (Fig. 5.3D) PD-L1 and (Fig. 5.3E) IL-10 MFIs of
DCs in lactic acid with pH6 were significantly lower than those of the untreated. IL-
10 MFIs of DCs in lactic acid with pH4 was also significantly lower than that of the
untreated. (Fig. 5.3F) IL-12 MFIs of DCs in lactic acid with all studied pH were
similar to those of the untreated; but (Fig. 5.3G) T-bet MFI of DCs in lactic acid with
pH5 was slightly higher than that of the untreated.
213
Figure 5.4. Viability of DCs at different pH of lactic acid and HCl.
Acid-treated DCs were stained with 7-AAD for viability test. Numbers shown on x-
axis indicated the pH values. Data were presented as mean ± SD. *p<0.10, **p<0.05,
***p<0.01, ****p<0.001 were considered significant. LA, lactic acid; HCl,
hydrochloric acid; POS, positive control; Neg, negative control.
Viability of DCs at different pH of lactic acid and HCl
Viability of lactic acid (LA)-treated and HCl-treated DCs at pH 4 to 6 were tested.
Percentages of viability of DCs at all tested pH were above 50%; but that of LA-
treated at pH4 and pH5 and HCl-treated at pH4, pH5 and pH6 were significantly
lower than that of the untreated DCs.
214
5.4. Discussion
Chapter four shows that LGG-derived soluble factors seemed to promote Th1
inflammatory responses in healthy people. It was postulated in this study that Th1
immune response might be promoted by lactic acid secreted by LGG. To the best of
our knowledge, this is the first study to demonstrate the effect of lactic acid on
immunophenotype and cytokine production of DCs of healthy blood donors.
DC phenotype and cytokine production at different concentrations of
hydrogen ions were investigated. In this study, when it was strongly acidic (e.g. pH4),
antigen-presenting capability of DCs reduced as HLA-DR expression reduced (Pinet,
Vergelli et al. 1995). Decrease in HLA-DR expression minimizes interaction of DCs
with CD4+ T cells and hence diminish T-cell activation (Gay, Maddon et al. 1987).
Moreover, acidosis (at pH4 and 5) affected MFIs of costimulatory molecules of DCs
(CD80 and CD86) differently. It increased CD80 but decreased CD86 MFIs of DCs.
Decrease in CD86 MFI of DCs might weaken intercellular interactions and dampen
T-cell activation (Banchereau and Steinman 1998, Lim, Goh et al. 2012). A recent
study showed that acidosis (at pH~6) induces maturation and increases antigen-
presenting ability of murine DCs via ASICs as observed from the upregulation of
MHC, CD80 and CD86 (Tong, Wu et al. 2011), which were different from the results
in this study. Acidosis (pH5) increased PD-L1 expression on DCs. PD-L1 is a vital T
cell-inhibiting receptor which ligates PD-1 on T cells to suppress proliferation of T
cells in antigen-specific manner (Carter, Fouser et al. 2002). This is important to limit
peripheral T cell responses to self antigens. Therefore, acidosis might prevent and
215
control autoimmune diseases such as Type 1 diabetes (Ansari, Salama et al. 2003,
Watanabe and Nakajima 2012).
Activity of hydrogen ions and lactate altered DCs differently in this study.
Low lactate concentration (5mM) seemed to suppress both activation and cytokine
production of DCs while high lactate concentrations (35mM and 10mM) tended to
suppress DC activation only. MFIs of HLA-DR, PD-L1, IL-10, IL-12 and T-bet of
5mM lactate-treated DCs significantly lower than those of the untreated; however,
only PD-L1 and IL-10 MFIs of 35mM lactate-treated DCs; and HLA-DR and CD80
MFIs of 10mM lactate-treated DCs were significantly lower than those of the
untreated. A study stated that high lactate concentration may inhibit the initiation of
immune responses (Puig-Kroger, Pello et al. 2003), which might be partially
coincident to our results. Taken together, it was suggested that low lactate
concentration (5mM) might have potential to suppress Th1 differentiation and
promotion as Th1-associated IL-12 production and T-bet expression of DCs
decreased.
It was then interesting to study how the immunomodulation on DCs would be
different if they were treated with lactic acid at various pH. A previous study reported
that effect of lactic acid is only partially counteracted by adjusting H+ at low pH as
other MCT-1 transporter-independent mechanisms may be involved (Gottfried,
Kunz-Schughart et al. 2006). CD80, CD86, IL-12 and T-bet MFIs of DCs in lactic
acid with pH6 were similar to those of the untreated cells. This might be that the pH
is near to physiological pH. At physiological pH, lactic acid almost entirely
dissociates to lactate anions, which cannot diffuse cross the plasma membrane of DCs
216
freely but are transported through monocarboxylate transporter MCT-1 in a pH-
dependent manner (Halestrap and Price 1999). Effect of lactate depends on its
transport into the cells as inhibitory effect of lactic acid can be reverted by adjusting
acidic pH to 7.4 (Gottfried, Kunz-Schughart et al. 2006).
5.5. Conclusion
In conclusion, lactic acid elicited immunomodulatory effects on DCs via hydrogen
ions or lactate or both. Lactate at low concentration tended to suppress Th1
differentiation and promotion as observed from the decrease in IL-12 production and
T-bet expression of DCs, suggesting that lactic acid might prevent healthy people
from Th1-assocated diseases such as atherosclerosis and rheumatoid arthritis.
Moreover, results of this study showed that lactic acid might not play a role in
promoting Th1 immune response. Induction of Th1 response might be due to other
soluble factors derived by LGG. Further investigations are required.
217
Summary of Studies and Future Work
In the preliminary study (chapter one), immunomodulatory effects of
probiotics and mixture of probiotics were investigated by examining various cytokine
levels in intestinal fluid. Bb99, EcN, GGmix and ECPJSmix were demonstrated to
suppress Th17 immune response in both small intestine and colon of healthy wildtype
mice. LC705 was also manifested to inhibit Th17 responsiveness in small intestine
while LGG and PJS were shown to curb Th17 immune responses in colon of healthy
mice. Inhibition of Th17 immune responses in the intestine may prevent local
inflammatory diseases such as IBD and Crohn’s disease. Suppression of local Th17
immune response in the gut seemed to be in line with a promotion of systemic Th17
immune responses in liver and spleen (chapter two) as a bid to maintain a immune
homeostasis in healthy individuals. Probiotics, particularly LGG, Bb99 and EcN,
enhanced systemic Th17 immune responses in healthy mice as they increased
percentages of Th17 in liver and spleen. Bb99, in addition, showed a prominent effect
on hepatic NK cells.
Mechanism of action of probiotic bacteria on immune responses was further
investigated and LGG was used in the studies as it is a widely studied probiotic
bacterium. APCs from healthy blood donors, including DCs, macrophages and
monocytes, that are of paramount importance in bridging innate and adaptive
immunities, were co-cultured with LGG cells. Cytokine secretion profile of
mononuclear cells, cytokine production and activation-related receptor expression of
APCs showed that LGG cells may have a consistent tendency in promoting type 1
218
responsiveness (chapter three). Soluble factors of LGG may also have potential in
enhancing Th1 immune response in healthy individuals (chapter four). They may
induce Th17 immune responses as well. Yet, Th1 immune responses promoted by
soluble factors were unlikely to be attributed to lactic acid secreted by LGG on a
preliminary study (chapter five).
A thorough comprehension of the immunomodulatory mechanism of probiotic
bacteria will avail the prophylactic efficacy and immunotherapeutic potential of
probiotic bacteria, making them a preventive measure for infections to healthy
populations or an alternative treatment for diseases to patients.
A hierarchy introduced in this thesis provides a natural guide for future
research. However, experiments on immunomodulatory mechanism of LGG-derived
soluble factors (Chapters four and five) were only done in in vitro manner. Further in
vivo and clinical investigations can be done. Moreover, lactic acid is one of the
soluble factors only. There are many other soluble factors, for example, metabolites,
proteins, cell-wall constituents and DNA (Rojas, Ascencio et al. 2002, Mirnejad,
Vahdati et al. 2013) that have not been identified but may contribute to the type 1
responsiveness in the hosts. They may be a potential alternative for treatments or a
potential preventive measure like vaccine for diseases. Isolation, identification and
investigation on how they regulate the immune responses by in vitro, in vivo and
clinical trials can be done.
Furthermore, this project mainly focused on the modulation of probiotics on
cell-mediated immune responses. Further investigation can be done on the
219
modulation of probiotics on humoral immunity such as antibody-mediated
responsiveness as it is another important part of adaptive immunities and linked to
many diseases like Parkinson’s disease (Orr, Rowe et al. 2005). As from previous
study and this project, immunomodulatory properties of probiotic bacteria are strain-
specific (Kirjavainen, El-Nezami et al. 1999), immunomodulatory mechanism of
action of other probiotic strains, species and genera, for example Bifidobacteria and
recently discovered gram-negative EcN, can be studied.
Last but not the least, apart from cytokine production and activation-related
receptors, other receptors such as vitamin D receptors (VDRs) and retinoid acid
receptors (RARs) can also be studied as they have been recently shown to play
crucial and unexpected roles in regulating immune response (Mora, Iwata et al. 2008);
but the immunomodulatory effects of probiotic bacteria on VDRs and RARs have
less been elucidated. If their effects on VDRs and RARs are demonstrated, a more
complete picture on the prophylactic efficacy of probiotic bacteria in prevention of
diseases and infections can be obtained.
220
References
Abraham, C. and J. Cho (2009). "Interleukin-23/Th17 pathways and inflammatory
bowel disease." Inflamm Bowel Dis 15(7): 1090-1100.
Adiloglu, A. K., N. Gonulates, M. Isler and A. Senol (2013). "[The effect of kefir
consumption on human immune system: a cytokine study]." Mikrobiyol Bul 47(2):
273-281.
Akbarshahi, H., M. Menzel, M. Posaric Bauden, A. Rosendahl and R. Andersson
(2012). "Enrichment of murine CD68+ CCR2+ and CD68+ CD206+ lung
macrophages in acute pancreatitis-associated acute lung injury." PLoS One 7(10):
e42654.
Akhiani, A. A., J. Pappo, Z. Kabok, K. Schon, W. Gao, L. E. Franzen and N. Lycke
(2002). "Protection against Helicobacter pylori infection following immunization is
IL-12-dependent and mediated by Th1 cells." J Immunol 169(12): 6977-6984.
Akira, S., K. Takeda and T. Kaisho (2001). "Toll-like receptors: critical proteins
linking innate and acquired immunity." Nat Immunol 2(8): 675-680.
Akira, S., S. Uematsu and O. Takeuchi (2006). "Pathogen recognition and innate
immunity." Cell 124(4): 783-801.
Aldinucci, C., L. Bellussi, G. Monciatti, G. C. Passali, L. Salerni, D. Passali and V.
Bocci (2002). "Effects of dietary yoghurt on immunological and clinical parameters
of rhinopathic patients." Eur J Clin Nutr 56(12): 1155-1161.
Alexopoulou, L., B. Desnues and O. Demaria (2012). "[Toll-like receptor 8: the
awkward TLR]." Med Sci (Paris) 28(1): 96-102.
Aliberti, J., C. Reis e Sousa, M. Schito, S. Hieny, T. Wells, G. B. Huffnagle and A.
Sher (2000). "CCR5 provides a signal for microbial induced production of IL-12 by
CD8 alpha+ dendritic cells." Nat Immunol 1(1): 83-87.
Almeida, A. R., N. Legrand, M. Papiernik and A. A. Freitas (2002). "Homeostasis of
peripheral CD4+ T cells: IL-2R alpha and IL-2 shape a population of regulatory cells
that controls CD4+ T cell numbers." J Immunol 169(9): 4850-4860.
Andrew R. Berry, Christopher M.M. Franco, Wei Zhang and A. P. J. Middelberg
(1999). "Growth and lactic acid production in batch culture of Lactobacillus
rhamnosus in a defined medium." Biotechnology Letters 21(2): 163-167.
Annacker, O., R. Pimenta-Araujo, O. Burlen-Defranoux, T. C. Barbosa, A. Cumano
and A. Bandeira (2001). "CD25+ CD4+ T cells regulate the expansion of peripheral
CD4 T cells through the production of IL-10." J Immunol 166(5): 3008-3018.
Ansari, M. J., A. D. Salama, T. Chitnis, R. N. Smith, H. Yagita, H. Akiba, T.
Yamazaki, M. Azuma, H. Iwai, S. J. Khoury, H. Auchincloss, Jr. and M. H. Sayegh
(2003). "The programmed death-1 (PD-1) pathway regulates autoimmune diabetes in
nonobese diabetic (NOD) mice." J Exp Med 198(1): 63-69.
Apostolou, I., A. Sarukhan, L. Klein and H. von Boehmer (2002). "Origin of
regulatory T cells with known specificity for antigen." Nat Immunol 3(8): 756-763.
Arvola, T., K. Laiho, S. Torkkeli, H. Mykkanen, S. Salminen, L. Maunula and E.
Isolauri (1999). "Prophylactic Lactobacillus GG reduces antibiotic-associated
221
diarrhea in children with respiratory infections: a randomized study." Pediatrics
104(5): e64.
Asano, M., M. Toda, N. Sakaguchi and S. Sakaguchi (1996). "Autoimmune disease
as a consequence of developmental abnormality of a T cell subpopulation." J Exp
Med 184(2): 387-396.
Asseman, C., S. Mauze, M. W. Leach, R. L. Coffman and F. Powrie (1999). "An
essential role for interleukin 10 in the function of regulatory T cells that inhibit
intestinal inflammation." J Exp Med 190(7): 995-1004.
Asseman, C., S. Read and F. Powrie (2003). "Colitogenic Th1 cells are present in the
antigen-experienced T cell pool in normal mice: control by CD4+ regulatory T cells
and IL-10." J Immunol 171(2): 971-978.
Aste-Amezaga, M., X. Ma, A. Sartori and G. Trinchieri (1998). "Molecular
mechanisms of the induction of IL-12 and its inhibition by IL-10." J Immunol
160(12): 5936-5944.
Bae, J. H., S. J. Kim, M. J. Kim, S. O. Oh, J. S. Chung, S. H. Kim and C. D. Kang
(2012). "Susceptibility to natural killer cell-mediated lysis of colon cancer cells is
enhanced by treatment with epidermal growth factor receptor inhibitors through
UL16-binding protein-1 induction." Cancer Sci 103(1): 7-16.
Banchereau, J. and R. M. Steinman (1998). "Dendritic cells and the control of
immunity." Nature 392(6673): 245-252.
Basu, S., M. Chatterjee, S. Ganguly and P. K. Chandra (2007). "Effect of
Lactobacillus rhamnosus GG in persistent diarrhea in Indian children: a randomized
controlled trial." J Clin Gastroenterol 41(8): 756-760.
Basu, S., D. K. Paul, S. Ganguly, M. Chatterjee and P. K. Chandra (2009). "Efficacy
of high-dose Lactobacillus rhamnosus GG in controlling acute watery diarrhea in
Indian children: a randomized controlled trial." J Clin Gastroenterol 43(3): 208-213.
Bendelac, A., P. B. Savage and L. Teyton (2007). "The biology of NKT cells." Annu
Rev Immunol 25: 297-336.
Bengmark, S. (2003). "Use of some pre-, pro- and synbiotics in critically ill patients."
Best Pract Res Clin Gastroenterol 17(5): 833-848.
Besselink, M. G., H. C. van Santvoort, E. Buskens, M. A. Boermeester, H. van Goor,
H. M. Timmerman, V. B. Nieuwenhuijs, T. L. Bollen, B. van Ramshorst, B. J.
Witteman, C. Rosman, R. J. Ploeg, M. A. Brink, A. F. Schaapherder, C. H. Dejong, P.
J. Wahab, C. J. van Laarhoven, E. van der Harst, C. H. van Eijck, M. A. Cuesta, L. M.
Akkermans, H. G. Gooszen and G. Dutch Acute Pancreatitis Study (2008). "Probiotic
prophylaxis in predicted severe acute pancreatitis: a randomised, double-blind,
placebo-controlled trial." Lancet 371(9613): 651-659.
Beutler, B., K. Hoebe and L. Shamel (2004). "Forward genetic dissection of afferent
immunity: the role of TIR adapter proteins in innate and adaptive immune responses."
C R Biol 327(6): 571-580.
Biondo, C., A. Malara, A. Costa, G. Signorino, F. Cardile, A. Midiri, R. Galbo, S.
Papasergi, M. Domina, M. Pugliese, G. Teti, G. Mancuso and C. Beninati (2012).
"Recognition of fungal RNA by TLR7 has a nonredundant role in host defense
against experimental candidiasis." Eur J Immunol 42(10): 2632-2643.
Bischoff, S. C. and S. Kramer (2007). "Human mast cells, bacteria, and intestinal
immunity." Immunol Rev 217: 329-337.
222
Blasius, A. L. and B. Beutler (2010). "Intracellular toll-like receptors." Immunity
32(3): 305-315.
Blumberg, R. and F. Powrie (2012). "Microbiota, disease, and back to health: a
metastable journey." Sci Transl Med 4(137): 137rv137.
Blumer, N., S. Sel, S. Virna, C. C. Patrascan, S. Zimmermann, U. Herz, H. Renz and
H. Garn (2007). "Perinatal maternal application of Lactobacillus rhamnosus GG
suppresses allergic airway inflammation in mouse offspring." Clin Exp Allergy 37(3):
348-357.
Blümer, N., S. Sel, S. Virna, C. C. Patrascan, S. Zimmermann, U. Herz, H. Renz and
H. Garn (2007). "Perinatal maternal application of Lactobacillus rhamnosus GG
suppresses allergic airway inflammation in mouse offspring." Clinical &
Experimental Allergy 37(3): 348-357.
Blutt, S. E., A. D. Miller, S. L. Salmon, D. W. Metzger and M. E. Conner (2012).
"IgA is important for clearance and critical for protection from rotavirus infection."
Mucosal Immunol 5(6): 712-719.
Boasso, A., A. W. Hardy, A. L. Landay, J. L. Martinson, S. A. Anderson, M. J. Dolan,
M. Clerici and G. M. Shearer (2008). "PDL-1 upregulation on monocytes and T cells
by HIV via type I interferon: restricted expression of type I interferon receptor by
CCR5-expressing leukocytes." Clin Immunol 129(1): 132-144.
Bontrop, R., T. Ottenhoff, R. Van Miltenburg, D. Elferink, R. De Vries and M.
Giphart (1986). "Quantitative and qualitative differences in HLA-DR molecules
correlated with antigen-presentation capacity." Eur J Immunol 16(2): 133-138.
Bordon, Y. (2011). "Natural killer T cells: Worth holding on to." Nat Rev Immunol
11(10): 642.
Borish, L. C. and J. W. Steinke (2003). "2. Cytokines and chemokines." J Allergy
Clin Immunol 111(2 Suppl): S460-475.
Braunersreuther, V., A. Zernecke, C. Arnaud, E. A. Liehn, S. Steffens, E.
Shagdarsuren, K. Bidzhekov, F. Burger, G. Pelli, B. Luckow, F. Mach and C. Weber
(2007). "Ccr5 but not Ccr1 deficiency reduces development of diet-induced
atherosclerosis in mice." Arterioscler Thromb Vasc Biol 27(2): 373-379.
Brigl, M. and M. B. Brenner (2004). "CD1: antigen presentation and T cell function."
Annu Rev Immunol 22: 817-890.
Cardin, R. D., J. W. Brooks, S. R. Sarawar and P. C. Doherty (1996). "Progressive
loss of CD8+ T cell-mediated control of a gamma-herpesvirus in the absence of
CD4+ T cells." J Exp Med 184(3): 863-871.
Carlson, N. G., W. A. Wieggel, J. Chen, A. Bacchi, S. W. Rogers and L. C. Gahring
(1999). "Inflammatory cytokines IL-1 alpha, IL-1 beta, IL-6, and TNF-alpha impart
neuroprotection to an excitotoxin through distinct pathways." J Immunol 163(7):
3963-3968.
Carter, L., L. A. Fouser, J. Jussif, L. Fitz, B. Deng, C. R. Wood, M. Collins, T. Honjo,
G. J. Freeman and B. M. Carreno (2002). "PD-1:PD-L inhibitory pathway affects
both CD4(+) and CD8(+) T cells and is overcome by IL-2." Eur J Immunol 32(3):
634-643.
Castano, D., L. F. Garcia and M. Rojas (2011). "Increased frequency and cell death of
CD16+ monocytes with Mycobacterium tuberculosis infection." Tuberculosis (Edinb)
91(5): 348-360.
223
Cervantes, J. L., B. Weinerman, C. Basole and J. C. Salazar (2012). "TLR8: the
forgotten relative revindicated." Cell Mol Immunol 9(6): 434-438.
Chan Remillard SKW, O. L. (2006). "Inhibition of tumour necrosis factor by lactic
acid bacteria in mouse macrophages." DRTC Dairy Day: 45-46.
Chatfield, C. H., H. Koo and R. G. Quivey, Jr. (2005). "The putative autolysin
regulator LytR in Streptococcus mutans plays a role in cell division and is growth-
phase regulated." Microbiology 151(Pt 2): 625-631.
Chau, T. A., M. L. McCully, W. Brintnell, G. An, K. J. Kasper, E. D. Vines, P. Kubes,
S. M. Haeryfar, J. K. McCormick, E. Cairns, D. E. Heinrichs and J. Madrenas (2009).
"Toll-like receptor 2 ligands on the staphylococcal cell wall downregulate
superantigen-induced T cell activation and prevent toxic shock syndrome." Nat Med
15(6): 641-648.
Chen, C. C., C. H. Chiu, T. Y. Lin, H. N. Shi and W. A. Walker (2009). "Effect of
probiotics Lactobacillus acidophilus on Citrobacter rodentium colitis: the role of
dendritic cells." Pediatr Res 65(2): 169-175.
Chen, S., D. L. Tuttle, J. T. Oshier, H. J. Knot, W. J. Streit, M. M. Goodenow and J.
K. Harrison (2005). "Transforming growth factor-beta1 increases CXCR4 expression,
stromal-derived factor-1alpha-stimulated signalling and human immunodeficiency
virus-1 entry in human monocyte-derived macrophages." Immunology 114(4): 565-
574.
Chen, W., C. Xia, J. Wang, P. Thapa, Y. Li, A. Talukdar, J. Nadas, W. Zhang, D.
Zhou and P. G. Wang (2007). "Synthesis and structure-activity relationship study of
isoglobotrihexosylceramide analogues." J Org Chem 72(26): 9914-9923.
Choi, C. H., T. I. Kim, S. K. Lee, K. M. Yang and W. H. Kim (2008). "Effect of
Lactobacillus GG and conditioned media on IL-1beta-induced IL-8 production in
Caco-2 cells." Scand J Gastroenterol 43(8): 938-947.
Ciorba, M. A., T. E. Riehl, M. S. Rao, C. Moon, X. Ee, G. M. Nava, M. R. Walker, J.
M. Marinshaw, T. S. Stappenbeck and W. F. Stenson (2012). "Lactobacillus probiotic
protects intestinal epithelium from radiation injury in a TLR-2/cyclo-oxygenase-2-
dependent manner." Gut 61(6): 829-838.
Clancy, R. L., M. Gleeson, A. Cox, R. Callister, M. Dorrington, C. D'Este, G. Pang,
D. Pyne, P. Fricker and A. Henriksson (2006). "Reversal in fatigued athletes of a
defect in interferon gamma secretion after administration of Lactobacillus
acidophilus." Br J Sports Med 40(4): 351-354.
Cocchi, F., A. L. DeVico, A. Garzino-Demo, S. K. Arya, R. C. Gallo and P. Lusso
(1995). "Identification of RANTES, MIP-1 alpha, and MIP-1 beta as the major HIV-
suppressive factors produced by CD8+ T cells." Science 270(5243): 1811-1815.
Coffman, R. L., B. W. Seymour, S. Hudak, J. Jackson and D. Rennick (1989).
"Antibody to interleukin-5 inhibits helminth-induced eosinophilia in mice." Science
245(4915): 308-310.
Collado, M. C., J. Meriluoto and S. Salminen (2007). "In vitro analysis of probiotic
strain combinations to inhibit pathogen adhesion to human intestinal mucus." Food
Research International 40(5): 629-636.
Collison, L. W., C. J. Workman, T. T. Kuo, K. Boyd, Y. Wang, K. M. Vignali, R.
Cross, D. Sehy, R. S. Blumberg and D. A. Vignali (2007). "The inhibitory cytokine
IL-35 contributes to regulatory T-cell function." Nature 450(7169): 566-569.
224
Couper, K. N., D. G. Blount and E. M. Riley (2008). "IL-10: the master regulator of
immunity to infection." J Immunol 180(9): 5771-5777.
Cros, J., N. Cagnard, K. Woollard, N. Patey, S. Y. Zhang, B. Senechal, A. Puel, S. K.
Biswas, D. Moshous, C. Picard, J. P. Jais, D. D'Cruz, J. L. Casanova, C. Trouillet and
F. Geissmann (2010). "Human CD14dim monocytes patrol and sense nucleic acids
and viruses via TLR7 and TLR8 receptors." Immunity 33(3): 375-386.
Crowe, N. Y., J. M. Coquet, S. P. Berzins, K. Kyparissoudis, R. Keating, D. G.
Pellicci, Y. Hayakawa, D. I. Godfrey and M. J. Smyth (2005). "Differential antitumor
immunity mediated by NKT cell subsets in vivo." J Exp Med 202(9): 1279-1288.
Cua, D. J., J. Sherlock, Y. Chen, C. A. Murphy, B. Joyce, B. Seymour, L. Lucian, W.
To, S. Kwan, T. Churakova, S. Zurawski, M. Wiekowski, S. A. Lira, D. Gorman, R.
A. Kastelein and J. D. Sedgwick (2003). "Interleukin-23 rather than interleukin-12 is
the critical cytokine for autoimmune inflammation of the brain." Nature 421(6924):
744-748.
Cui, J., S. Pazdziorko, J. S. Miyashiro, P. Thakker, J. W. Pelker, C. Declercq, A. Jiao,
J. Gunn, L. Mason, J. P. Leonard, C. M. Williams and S. Marusic (2005). "TH1-
mediated airway hyperresponsiveness independent of neutrophilic inflammation." J
Allergy Clin Immunol 115(2): 309-315.
Dasgupta, S., J. Bayry, S. Lacroix-Desmazes and S. V. Kaveri (2007). "Human
mannose receptor (CD206) in immune response: novel insights into vaccination
strategies using a humanized mouse model." Expert Rev Clin Immunol 3(5): 677-681.
De Keersmaecker, S. C., T. L. Verhoeven, J. Desair, K. Marchal, J. Vanderleyden
and I. Nagy (2006). "Strong antimicrobial activity of Lactobacillus rhamnosus GG
against Salmonella typhimurium is due to accumulation of lactic acid." FEMS
Microbiol Lett 259(1): 89-96.
De Nitto, D., M. Sarra, M. L. Cupi, F. Pallone and G. Monteleone (2010). "Targeting
IL-23 and Th17-cytokines in inflammatory bowel diseases." Curr Pharm Des 16(33):
3656-3660.
de Waal Malefyt, R., J. Abrams, B. Bennett, C. G. Figdor and J. E. de Vries (1991).
"Interleukin 10(IL-10) inhibits cytokine synthesis by human monocytes: an
autoregulatory role of IL-10 produced by monocytes." J Exp Med 174(5): 1209-1220.
Denning, T. L., N. A. Campbell, F. Song, R. P. Garofalo, G. R. Klimpel, V. E. Reyes
and P. B. Ernst (2000). "Expression of IL-10 receptors on epithelial cells from the
murine small and large intestine." Int Immunol 12(2): 133-139.
Dietl, K., K. Renner, K. Dettmer, B. Timischl, K. Eberhart, C. Dorn, C. Hellerbrand,
M. Kastenberger, L. A. Kunz-Schughart, P. J. Oefner, R. Andreesen, E. Gottfried and
M. P. Kreutz (2010). "Lactic acid and acidification inhibit TNF secretion and
glycolysis of human monocytes." J Immunol 184(3): 1200-1209.
Dong, H., I. Rowland and P. Yaqoob (2012). "Comparative effects of six probiotic
strains on immune function in vitro." Br J Nutr 108(3): 459-470.
Donkor, O. N., M. Ravikumar, O. Proudfoot, S. L. Day, V. Apostolopoulos, G.
Paukovics, T. Vasiljevic, S. L. Nutt and H. Gill (2012). "Cytokine profile and
induction of T helper type 17 and regulatory T cells by human peripheral
mononuclear cells after microbial exposure." Clin Exp Immunol 167(2): 282-295.
Dotterud, C. K., O. Storro, R. Johnsen and T. Oien (2010). "Probiotics in pregnant
women to prevent allergic disease: a randomized, double-blind trial." Br J Dermatol.
225
Du, Z., E. Kelly, I. Mecklenbrauker, L. Agle, C. Herrero, P. Paik and L. B. Ivashkiv
(2006). "Selective regulation of IL-10 signaling and function by zymosan." J
Immunol 176(8): 4785-4792.
Dunay, I. R., A. Fuchs and L. D. Sibley (2010). "Inflammatory monocytes but not
neutrophils are necessary to control infection with Toxoplasma gondii in mice."
Infect Immun 78(4): 1564-1570.
Edwards, J. P., X. Zhang, K. A. Frauwirth and D. M. Mosser (2006). "Biochemical
and functional characterization of three activated macrophage populations." J Leukoc
Biol 80(6): 1298-1307.
Elinav, E., T. Strowig, J. Henao-Mejia and R. A. Flavell (2011). "Regulation of the
antimicrobial response by NLR proteins." Immunity 34(5): 665-679.
Esplugues, E., S. Huber, N. Gagliani, A. E. Hauser, T. Town, Y. Y. Wan, W.
O'Connor, Jr., A. Rongvaux, N. Van Rooijen, A. M. Haberman, Y. Iwakura, V. K.
Kuchroo, J. K. Kolls, J. A. Bluestone, K. C. Herold and R. A. Flavell (2011).
"Control of TH17 cells occurs in the small intestine." Nature 475(7357): 514-518.
Exley, M., J. Garcia, S. P. Balk and S. Porcelli (1997). "Requirements for CD1d
recognition by human invariant Valpha24+ CD4-CD8- T cells." J Exp Med 186(1):
109-120.
Ezendam, J. and H. van Loveren (2006). "Probiotics: immunomodulation and
evaluation of safety and efficacy." Nutr Rev 64(1): 1-14.
Fadok, V. A., D. L. Bratton, A. Konowal, P. W. Freed, J. Y. Westcott and P. M.
Henson (1998). "Macrophages that have ingested apoptotic cells in vitro inhibit
proinflammatory cytokine production through autocrine/paracrine mechanisms
involving TGF-beta, PGE2, and PAF." J Clin Invest 101(4): 890-898.
FAO/WHO (2001). Joint FAO/WHO Expert Consultation on Evaluation of Health
and Nutritional Properties of Probiotics in Food Including Powder Milk with Live
Lactic Acid Bacteria. Cordoba, Argentina.
Feleszko, W., J. Jaworska, R. D. Rha, S. Steinhausen, A. Avagyan, A. Jaudszus, B.
Ahrens, D. A. Groneberg, U. Wahn and E. Hamelmann (2007). "Probiotic-induced
suppression of allergic sensitization and airway inflammation is associated with an
increase of T regulatory-dependent mechanisms in a murine model of asthma."
Clinical & Experimental Allergy 37(4): 498-505.
Finamore, A., M. Roselli, M. S. Britti, N. Merendino and E. Mengheri (2012).
"Lactobacillus rhamnosus GG and Bifidobacterium animalis MB5 induce intestinal
but not systemic antigen-specific hyporesponsiveness in ovalbumin-immunized rats."
J Nutr 142(2): 375-381.
Finotto, S., M. F. Neurath, J. N. Glickman, S. Qin, H. A. Lehr, F. H. Green, K.
Ackerman, K. Haley, P. R. Galle, S. J. Szabo, J. M. Drazen, G. T. De Sanctis and L.
H. Glimcher (2002). "Development of spontaneous airway changes consistent with
human asthma in mice lacking T-bet." Science 295(5553): 336-338.
Flacher, V., M. Bouschbacher, E. Verronese, C. Massacrier, V. Sisirak, O. Berthier-
Vergnes, B. de Saint-Vis, C. Caux, C. Dezutter-Dambuyant, S. Lebecque and J.
Valladeau (2006). "Human Langerhans cells express a specific TLR profile and
differentially respond to viruses and Gram-positive bacteria." J Immunol 177(11):
7959-7967.
226
Fleuridor, R., B. Wilson, R. Hou, A. Landay, H. Kessler and L. Al-Harthi (2003).
"CD1d-restricted natural killer T cells are potent targets for human
immunodeficiency virus infection." Immunology 108(1): 3-9.
Fontenot, J. D., M. A. Gavin and A. Y. Rudensky (2003). "Foxp3 programs the
development and function of CD4+CD25+ regulatory T cells." Nat Immunol 4(4):
330-336.
Forsberg, A., T. R. Abrahamsson, B. Bjorksten and M. C. Jenmalm (2013). "Pre- and
post-natal Lactobacillus reuteri supplementation decreases allergen responsiveness in
infancy." Clin Exp Allergy 43(4): 434-442.
Fridlender, Z. G., V. Kapoor, G. Buchlis, G. Cheng, J. Sun, L. C. Wang, S. Singhal, L.
A. Snyder and S. M. Albelda (2011). "Monocyte chemoattractant protein-1 blockade
inhibits lung cancer tumor growth by altering macrophage phenotype and activating
CD8+ cells." Am J Respir Cell Mol Biol 44(2): 230-237.
Fuentes-Duculan, J., M. Suarez-Farinas, L. C. Zaba, K. E. Nograles, K. C. Pierson, H.
Mitsui, C. A. Pensabene, J. Kzhyshkowska, J. G. Krueger and M. A. Lowes (2010).
"A subpopulation of CD163-positive macrophages is classically activated in
psoriasis." J Invest Dermatol 130(10): 2412-2422.
Fujii, S., K. Shimizu, H. Hemmi and R. M. Steinman (2007). "Innate Valpha14(+)
natural killer T cells mature dendritic cells, leading to strong adaptive immunity."
Immunol Rev 220: 183-198.
Fujiwara, M., K. Hirose, S. Kagami, H. Takatori, H. Wakashin, T. Tamachi, N.
Watanabe, Y. Saito, I. Iwamoto and H. Nakajima (2007). "T-bet inhibits both TH2
cell-mediated eosinophil recruitment and TH17 cell-mediated neutrophil recruitment
into the airways." J Allergy Clin Immunol 119(3): 662-670.
Furtado, G. C., M. A. Curotto de Lafaille, N. Kutchukhidze and J. J. Lafaille (2002).
"Interleukin 2 signaling is required for CD4(+) regulatory T cell function." J Exp
Med 196(6): 851-857.
Fuse, S., J. J. Obar, S. Bellfy, E. K. Leung, W. Zhang and E. J. Usherwood (2006).
"CD80 and CD86 control antiviral CD8+ T-cell function and immune surveillance of
murine gammaherpesvirus 68." J Virol 80(18): 9159-9170.
Fuss, I. J., C. Becker, Z. Yang, C. Groden, R. L. Hornung, F. Heller, M. F. Neurath,
W. Strober and P. J. Mannon (2006). "Both IL-12p70 and IL-23 are synthesized
during active Crohn's disease and are down-regulated by treatment with anti-IL-12
p40 monoclonal antibody." Inflamm Bowel Dis 12(1): 9-15.
Galli, G., S. Nuti, S. Tavarini, L. Galli-Stampino, C. De Lalla, G. Casorati, P.
Dellabona and S. Abrignani (2003). "CD1d-restricted help to B cells by human
invariant natural killer T lymphocytes." J Exp Med 197(8): 1051-1057.
Gantier, M. P., S. Tong, M. A. Behlke, D. Xu, S. Phipps, P. S. Foster and B. R.
Williams (2008). "TLR7 is involved in sequence-specific sensing of single-stranded
RNAs in human macrophages." J Immunol 180(4): 2117-2124.
Garrido-Mesa, N., P. Utrilla, M. Comalada, P. Zorrilla, J. Garrido-Mesa, A. Zarzuelo,
M. E. Rodríguez-Cabezas and J. Gálvez (2011). "The association of minocycline and
the probiotic Escherichia coli Nissle 1917 results in an additive beneficial effect in a
DSS model of reactivated colitis in mice." Biochemical Pharmacology 82(12): 1891-
1900.
227
Gavin, M. A., J. P. Rasmussen, J. D. Fontenot, V. Vasta, V. C. Manganiello, J. A.
Beavo and A. Y. Rudensky (2007). "Foxp3-dependent programme of regulatory T-
cell differentiation." Nature 445(7129): 771-775.
Gay, D., P. Maddon, R. Sekaly, M. A. Talle, M. Godfrey, E. Long, G. Goldstein, L.
Chess, R. Axel, J. Kappler and et al. (1987). "Functional interaction between human
T-cell protein CD4 and the major histocompatibility complex HLA-DR antigen."
Nature 328(6131): 626-629.
Genel, F., F. Atlihan, N. Gulez, E. Kazanci, C. Vergin, D. T. Terek and O. C. Yurdun
(2012). "Evaluation of adhesion molecules CD64, CD11b and CD62L in neutrophils
and monocytes of peripheral blood for early diagnosis of neonatal infection." World J
Pediatr 8(1): 72-75.
Gerber, J. S. and D. M. Mosser (2001). "Reversing lipopolysaccharide toxicity by
ligating the macrophage Fc gamma receptors." J Immunol 166(11): 6861-6868.
Gerosa, F., B. Baldani-Guerra, C. Nisii, V. Marchesini, G. Carra and G. Trinchieri
(2002). "Reciprocal activating interaction between natural killer cells and dendritic
cells." J Exp Med 195(3): 327-333.
Ghadimi, D., M. Vrese, K. J. Heller and J. Schrezenmeir (2010). "Effect of natural
commensal-origin DNA on toll-like receptor 9 (TLR9) signaling cascade, chemokine
IL-8 expression, and barrier integritiy of polarized intestinal epithelial cells."
Inflamm Bowel Dis 16(3): 410-427.
Ghoreschi, K., A. Laurence, X. P. Yang, C. M. Tato, M. J. McGeachy, J. E. Konkel,
H. L. Ramos, L. Wei, T. S. Davidson, N. Bouladoux, J. R. Grainger, Q. Chen, Y.
Kanno, W. T. Watford, H. W. Sun, G. Eberl, E. M. Shevach, Y. Belkaid, D. J. Cua,
W. Chen and J. J. O'Shea (2010). "Generation of pathogenic T(H)17 cells in the
absence of TGF-beta signalling." Nature 467(7318): 967-971.
Gladiator, A., N. Wangler, K. Trautwein-Weidner and S. LeibundGut-Landmann
(2013). "Cutting edge: IL-17-secreting innate lymphoid cells are essential for host
defense against fungal infection." J Immunol 190(2): 521-525.
Godfrey, D. I., H. R. MacDonald, M. Kronenberg, M. J. Smyth and L. Van Kaer
(2004). "NKT cells: what's in a name?" Nat Rev Immunol 4(3): 231-237.
Goldberg, M., L. S. Belkowski and B. R. Bloom (1989). "Regulation of macrophage
growth and antiviral activity by interferon-gamma." J Cell Biol 109(3): 1331-1340.
Gong, W., O. M. Howard, J. A. Turpin, M. C. Grimm, H. Ueda, P. W. Gray, C. J.
Raport, J. J. Oppenheim and J. M. Wang (1998). "Monocyte chemotactic protein-2
activates CCR5 and blocks CD4/CCR5-mediated HIV-1 entry/replication." J Biol
Chem 273(8): 4289-4292.
Gordon, S. (2003). "Alternative activation of macrophages." Nat Rev Immunol 3(1):
23-35.
Gordon, S. and P. R. Taylor (2005). "Monocyte and macrophage heterogeneity." Nat
Rev Immunol 5(12): 953-964.
Gore, C., A. Custovic, G. W. Tannock, K. Munro, G. Kerry, K. Johnson, C. Peterson,
J. Morris, C. Chaloner, C. S. Murray and A. Woodcock (2012). "Treatment and
secondary prevention effects of the probiotics Lactobacillus paracasei or
Bifidobacterium lactis on early infant eczema: randomized controlled trial with
follow-up until age 3 years." Clin Exp Allergy 42(1): 112-122.
228
Goto, M., M. Murakawa, K. Kadoshima-Yamaoka, Y. Tanaka, K. Nagahira, Y.
Fukuda and T. Nishimura (2009). "Murine NKT cells produce Th17 cytokine
interleukin-22." Cell Immunol 254(2): 81-84.
Gottfried, E., L. A. Kunz-Schughart, S. Ebner, W. Mueller-Klieser, S. Hoves, R.
Andreesen, A. Mackensen and M. Kreutz (2006). "Tumor-derived lactic acid
modulates dendritic cell activation and antigen expression." Blood 107(5): 2013-2021.
Grage-Griebenow, E., H. D. Flad and M. Ernst (2001). "Heterogeneity of human
peripheral blood monocyte subsets." J Leukoc Biol 69(1): 11-20.
Gratz, S., Q. K. Wu, H. El-Nezami, R. O. Juvonen, H. Mykkanen and P. C. Turner
(2007). "Lactobacillus rhamnosus strain GG reduces aflatoxin B1 transport,
metabolism, and toxicity in Caco-2 Cells." Appl Environ Microbiol 73(12): 3958-
3964.
Gray, H. C., T. M. Foy, B. A. Becker and A. P. Knutsen (2004). "Rice-induced
enterocolitis in an infant: TH1/TH2 cellular hypersensitivity and absent IgE
reactivity." Ann Allergy Asthma Immunol 93(6): 601-605.
Guarner, F. and G. J. Schaafsma (1998). "Probiotics." Int J Food Microbiol 39(3):
237-238.
Guermonprez, P., J. Valladeau, L. Zitvogel, C. Thery and S. Amigorena (2002).
"Antigen presentation and T cell stimulation by dendritic cells." Annu Rev Immunol
20: 621-667.
Guerrero, A. T., T. M. Cunha, W. A. Verri, Jr., R. T. Gazzinelli, M. M. Teixeira, F. Q.
Cunha and S. H. Ferreira (2012). "Toll-like receptor 2/MyD88 signaling mediates
zymosan-induced joint hypernociception in mice: participation of TNF-alpha, IL-
1beta and CXCL1/KC." Eur J Pharmacol 674(1): 51-57.
Gumperz, J. E., S. Miyake, T. Yamamura and M. B. Brenner (2002). "Functionally
distinct subsets of CD1d-restricted natural killer T cells revealed by CD1d tetramer
staining." J Exp Med 195(5): 625-636.
Halestrap, A. P. and N. T. Price (1999). "The proton-linked monocarboxylate
transporter (MCT) family: structure, function and regulation." Biochem J 343 Pt 2:
281-299.
Harrington, L. E., R. D. Hatton, P. R. Mangan, H. Turner, T. L. Murphy, K. M.
Murphy and C. T. Weaver (2005). "Interleukin 17-producing CD4+ effector T cells
develop via a lineage distinct from the T helper type 1 and 2 lineages." Nat Immunol
6(11): 1123-1132.
Hatakka, K., A. J. Ahola, H. Yli-Knuuttila, M. Richardson, T. Poussa, J. H. Meurman
and R. Korpela (2007). "Probiotics reduce the prevalence of oral candida in the
elderly--a randomized controlled trial." J Dent Res 86(2): 125-130.
Hatakka, K., M. Mutanen, R. Holma, M. Saxelin and R. Korpela (2008).
"Lactobacillus rhamnosus LC705 together with Propionibacterium freudenreichii ssp
shermanii JS administered in capsules is ineffective in lowering serum lipids." J Am
Coll Nutr 27(4): 441-447.
Hathaway, L. J., P. Battig and K. Muhlemann (2007). "In vitro expression of the first
capsule gene of Streptococcus pneumoniae, cpsA, is associated with serotype-specific
colonization prevalence and invasiveness." Microbiology 153(Pt 8): 2465-2471.
Hayakawa, Y., N. D. Huntington, S. L. Nutt and M. J. Smyth (2006). "Functional
subsets of mouse natural killer cells." Immunol Rev 214: 47-55.
229
Hayakawa, Y. and M. J. Smyth (2006). "CD27 dissects mature NK cells into two
subsets with distinct responsiveness and migratory capacity." J Immunol 176(3):
1517-1524.
Hedegaard, C. J., M. Krakauer, K. Bendtzen, H. Lund, F. Sellebjerg and C. H.
Nielsen (2008). "T helper cell type 1 (Th1), Th2 and Th17 responses to myelin basic
protein and disease activity in multiple sclerosis." Immunology 125(2): 161-169.
Helwig, U., K. M. Lammers, F. Rizzello, P. Brigidi, V. Rohleder, E. Caramelli, P.
Gionchetti, J. Schrezenmeir, U. R. Foelsch, S. Schreiber and M. Campieri (2006).
"Lactobacilli, bifidobacteria and E. coli nissle induce pro- and anti-inflammatory
cytokines in peripheral blood mononuclear cells." World J Gastroenterol 12(37):
5978-5986.
Heron, M., J. C. Grutters, H. van Velzen-Blad, M. Veltkamp, A. M. Claessen and J.
M. van den Bosch (2008). "Increased expression of CD16, CD69, and very late
antigen-1 on blood monocytes in active sarcoidosis." Chest 134(5): 1001-1008.
Hewitt, R. E., L. C. Pele, M. Tremelling, A. Metz, M. Parkes and J. J. Powell (2012).
"Immuno-inhibitory PD-L1 can be induced by a peptidoglycan/NOD2 mediated
pathway in primary monocytic cells and is deficient in Crohn's patients with
homozygous NOD2 mutations." Clin Immunol 143(2): 162-169.
Hooper, L. V., D. R. Littman and A. J. Macpherson (2012). "Interactions between the
microbiota and the immune system." Science 336(6086): 1268-1273.
Hooper, L. V. and A. J. Macpherson (2010). "Immune adaptations that maintain
homeostasis with the intestinal microbiota." Nat Rev Immunol 10(3): 159-169.
Hori, S., T. Nomura and S. Sakaguchi (2003). "Control of regulatory T cell
development by the transcription factor Foxp3." Science 299(5609): 1057-1061.
Hornung, V., S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdorfer, T. Giese, S.
Endres and G. Hartmann (2002). "Quantitative expression of toll-like receptor 1-10
mRNA in cellular subsets of human peripheral blood mononuclear cells and
sensitivity to CpG oligodeoxynucleotides." J Immunol 168(9): 4531-4537.
Horton, H. M., M. J. Bernett, M. Peipp, E. Pong, S. Karki, S. Y. Chu, J. O. Richards,
H. Chen, R. Repp, J. R. Desjarlais and E. A. Zhukovsky (2010). "Fc-engineered anti-
CD40 antibody enhances multiple effector functions and exhibits potent in vitro and
in vivo antitumor activity against hematologic malignancies." Blood 116(16): 3004-
3012.
Huang, Z. Y., D. R. Barreda, R. G. Worth, Z. K. Indik, M. K. Kim, P. Chien and A. D.
Schreiber (2006). "Differential kinase requirements in human and mouse Fc-gamma
receptor phagocytosis and endocytosis." J Leukoc Biol 80(6): 1553-1562.
Huber, S., C. Schramm, H. A. Lehr, A. Mann, S. Schmitt, C. Becker, M. Protschka, P.
R. Galle, M. F. Neurath and M. Blessing (2004). "Cutting edge: TGF-beta signaling
is required for the in vivo expansion and immunosuppressive capacity of regulatory
CD4+CD25+ T cells." J Immunol 173(11): 6526-6531.
Huehn, J., K. Siegmund, J. C. Lehmann, C. Siewert, U. Haubold, M. Feuerer, G. F.
Debes, J. Lauber, O. Frey, G. K. Przybylski, U. Niesner, M. de la Rosa, C. A.
Schmidt, R. Brauer, J. Buer, A. Scheffold and A. Hamann (2004). "Developmental
stage, phenotype, and migration distinguish naive- and effector/memory-like CD4+
regulatory T cells." J Exp Med 199(3): 303-313.
230
Iannitti, T. and B. Palmieri (2010). "Therapeutical use of probiotic formulations in
clinical practice." Clinical Nutrition 29(6): 701-725.
Imaoka, A., T. Shima, K. Kato, S. Mizuno, T. Uehara, S. Matsumoto, H. Setoyama, T.
Hara and Y. Umesaki (2008). "Anti-inflammatory activity of probiotic
Bifidobacterium: enhancement of IL-10 production in peripheral blood mononuclear
cells from ulcerative colitis patients and inhibition of IL-8 secretion in HT-29 cells."
World J Gastroenterol 14(16): 2511-2516.
Ishigame, H., S. Kakuta, T. Nagai, M. Kadoki, A. Nambu, Y. Komiyama, N.
Fujikado, Y. Tanahashi, A. Akitsu, H. Kotaki, K. Sudo, S. Nakae, C. Sasakawa and Y.
Iwakura (2009). "Differential roles of interleukin-17A and -17F in host defense
against mucoepithelial bacterial infection and allergic responses." Immunity 30(1):
108-119.
Isolauri, E., T. Arvola, Y. Sutas, E. Moilanen and S. Salminen (2000). "Probiotics in
the management of atopic eczema." Clin Exp Allergy 30(11): 1604-1610.
Ivanov, II, L. Frutos Rde, N. Manel, K. Yoshinaga, D. B. Rifkin, R. B. Sartor, B. B.
Finlay and D. R. Littman (2008). "Specific microbiota direct the differentiation of IL-
17-producing T-helper cells in the mucosa of the small intestine." Cell Host Microbe
4(4): 337-349.
Ivanov, II, B. S. McKenzie, L. Zhou, C. E. Tadokoro, A. Lepelley, J. J. Lafaille, D. J.
Cua and D. R. Littman (2006). "The orphan nuclear receptor RORgammat directs the
differentiation program of proinflammatory IL-17+ T helper cells." Cell 126(6):
1121-1133.
Jardine, S. (2009). Prebiotics and probiotics. Leatherhead, UK
Chichester, U.K., Leatherhead Publishing ;
Wiley-Blackwell.
Jenh, C. H., M. A. Cox, W. Hipkin, T. Lu, C. Pugliese-Sivo, W. Gonsiorek, C. C.
Chou, S. K. Narula and P. J. Zavodny (2001). "Human B cell-attracting chemokine 1
(BCA-1; CXCL13) is an agonist for the human CXCR3 receptor." Cytokine 15(3):
113-121.
Jiang, X., S. Kojo, M. Harada, N. Ohkohchi, M. Taniguchi and K. I. Seino (2007).
"Mechanism of NKT cell-mediated transplant tolerance." Am J Transplant 7(6):
1482-1490.
Joffre, O., M. A. Nolte, R. Sporri and C. Reis e Sousa (2009). "Inflammatory signals
in dendritic cell activation and the induction of adaptive immunity." Immunol Rev
227(1): 234-247.
Joly, E. and D. Hudrisier (2003). "What is trogocytosis and what is its purpose?" Nat
Immunol 4(9): 815.
Jordan, M. S., A. Boesteanu, A. J. Reed, A. L. Petrone, A. E. Holenbeck, M. A.
Lerman, A. Naji and A. J. Caton (2001). "Thymic selection of CD4+CD25+
regulatory T cells induced by an agonist self-peptide." Nat Immunol 2(4): 301-306.
Kagami, S., H. L. Rizzo, S. E. Kurtz, L. S. Miller and A. Blauvelt (2010). "IL-23 and
IL-17A, but not IL-12 and IL-22, are required for optimal skin host defense against
Candida albicans." J Immunol 185(9): 5453-5462.
231
Kaisho, T., K. Hoshino, T. Iwabe, O. Takeuchi, T. Yasui and S. Akira (2002).
"Endotoxin can induce MyD88-deficient dendritic cells to support T(h)2 cell
differentiation." Int Immunol 14(7): 695-700.
Kajander, K., K. Hatakka, T. Poussa, M. Farkkila and R. Korpela (2005). "A
probiotic mixture alleviates symptoms in irritable bowel syndrome patients: a
controlled 6-month intervention." Aliment Pharmacol Ther 22(5): 387-394.
Kalliomaki, M., S. Salminen, H. Arvilommi, P. Kero, P. Koskinen and E. Isolauri
(2001). "Probiotics in primary prevention of atopic disease: a randomised placebo-
controlled trial." Lancet 357(9262): 1076-1079.
Kamada, N., T. Hisamatsu, S. Okamoto, T. Sato, K. Matsuoka, K. Arai, T. Nakai, A.
Hasegawa, N. Inoue, N. Watanabe, K. S. Akagawa and T. Hibi (2005). "Abnormally
differentiated subsets of intestinal macrophage play a key role in Th1-dominant
chronic colitis through excess production of IL-12 and IL-23 in response to bacteria."
J Immunol 175(10): 6900-6908.
Kamada, N., S. U. Seo, G. Y. Chen and G. Nunez (2013). "Role of the gut microbiota
in immunity and inflammatory disease." Nat Rev Immunol 13(5): 321-335.
Kant, A. M., P. De, X. Peng, T. Yi, D. J. Rawlings, J. S. Kim and D. L. Durden
(2002). "SHP-1 regulates Fcgamma receptor-mediated phagocytosis and the
activation of RAC." Blood 100(5): 1852-1859.
Kawai, T. and S. Akira (2011). "Toll-like receptors and their crosstalk with other
innate receptors in infection and immunity." Immunity 34(5): 637-650.
Kawano, T., J. Cui, Y. Koezuka, I. Toura, Y. Kaneko, K. Motoki, H. Ueno, R.
Nakagawa, H. Sato, E. Kondo, H. Koseki and M. Taniguchi (1997). "CD1d-restricted
and TCR-mediated activation of valpha14 NKT cells by glycosylceramides." Science
278(5343): 1626-1629.
Khattri, R., T. Cox, S. A. Yasayko and F. Ramsdell (2003). "An essential role for
Scurfin in CD4+CD25+ T regulatory cells." Nat Immunol 4(4): 337-342.
Kim, D. (2003). "Fatty acid-sensitive two-pore domain K+ channels." Trends
Pharmacol Sci 24(12): 648-654.
Kim, J. Y., M. S. Park and G. E. Ji (2012). "Probiotic modulation of dendritic cells
co-cultured with intestinal epithelial cells." World J Gastroenterol 18(12): 1308-1318.
Kinjo, Y., D. Wu, G. Kim, G. W. Xing, M. A. Poles, D. D. Ho, M. Tsuji, K.
Kawahara, C. H. Wong and M. Kronenberg (2005). "Recognition of bacterial
glycosphingolipids by natural killer T cells." Nature 434(7032): 520-525.
Kinoshita, H., H. Uchida, Y. Kawai, T. Kawasaki, N. Wakahara, H. Matsuo, M.
Watanabe, H. Kitazawa, S. Ohnuma, K. Miura, A. Horii and T. Saito (2008). "Cell
surface Lactobacillus plantarum LA 318 glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) adheres to human colonic mucin." J Appl Microbiol 104(6): 1667-1674.
Kinoshita, H., N. Wakahara, M. Watanabe, T. Kawasaki, H. Matsuo, Y. Kawai, H.
Kitazawa, S. Ohnuma, K. Miura, A. Horii and T. Saito (2008). "Cell surface
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) of Lactobacillus plantarum
LA 318 recognizes human A and B blood group antigens." Res Microbiol 159(9-10):
685-691.
Kirjavainen, P. V., H. S. El-Nezami, S. J. Salminen, J. T. Ahokas and P. F. Wright
(1999). "The effect of orally administered viable probiotic and dairy lactobacilli on
mouse lymphocyte proliferation." FEMS Immunol Med Microbiol 26(2): 131-135.
232
Kitamura, H., K. Iwakabe, T. Yahata, S. Nishimura, A. Ohta, Y. Ohmi, M. Sato, K.
Takeda, K. Okumura, L. Van Kaer, T. Kawano, M. Taniguchi and T. Nishimura
(1999). "The natural killer T (NKT) cell ligand alpha-galactosylceramide
demonstrates its immunopotentiating effect by inducing interleukin (IL)-12
production by dendritic cells and IL-12 receptor expression on NKT cells." J Exp
Med 189(7): 1121-1128.
Kolbus, D., I. Ljungcrantz, L. Andersson, B. Hedblad, G. N. Fredrikson, H.
Bjorkbacka and J. Nilsson (2013). "Association between CD8(+) T-cell subsets and
cardiovascular disease." J Intern Med.
Kopf, M., G. Le Gros, M. Bachmann, M. C. Lamers, H. Bluethmann and G. Kohler
(1993). "Disruption of the murine IL-4 gene blocks Th2 cytokine responses." Nature
362(6417): 245-248.
Kopp-Hoolihan, L. (2001). "Prophylactic and therapeutic uses of probiotics: a
review." J Am Diet Assoc 101(2): 229-238; quiz 239-241.
Kopp, M. V., M. Goldstein, A. Dietschek, J. Sofke, A. Heinzmann and R. Urbanek
(2008). "Lactobacillus GG has in vitro effects on enhanced interleukin-10 and
interferon-gamma release of mononuclear cells but no in vivo effects in
supplemented mothers and their neonates." Clin Exp Allergy 38(4): 602-610.
Korn, T., E. Bettelli, W. Gao, A. Awasthi, A. Jager, T. B. Strom, M. Oukka and V. K.
Kuchroo (2007). "IL-21 initiates an alternative pathway to induce proinflammatory
T(H)17 cells." Nature 448(7152): 484-487.
Kruis, W., S. Chrubasik, S. Boehm, C. Stange and J. Schulze (2012). "A double-blind
placebo-controlled trial to study therapeutic effects of probiotic Escherichia coli
Nissle 1917 in subgroups of patients with irritable bowel syndrome." Int J Colorectal
Dis 27(4): 467-474.
Kruis, W., P. Fric, J. Pokrotnieks, M. Lukas, B. Fixa, M. Kascak, M. A. Kamm, J.
Weismueller, C. Beglinger, M. Stolte, C. Wolff and J. Schulze (2004). "Maintaining
remission of ulcerative colitis with the probiotic Escherichia coli Nissle 1917 is as
effective as with standard mesalazine." Gut 53(11): 1617-1623.
Kukkonen, K., E. Savilahti, T. Haahtela, K. Juntunen-Backman, R. Korpela, T.
Poussa, T. Tuure and M. Kuitunen (2007). "Probiotics and prebiotic galacto-
oligosaccharides in the prevention of allergic diseases: a randomized, double-blind,
placebo-controlled trial." J Allergy Clin Immunol 119(1): 192-198.
Kumar, H., T. Kawai and S. Akira (2011). "Pathogen recognition by the innate
immune system." Int Rev Immunol 30(1): 16-34.
Laaksonen, M., S. Sarlio-Lahteenkorva, P. Leino-Arjas, P. Martikainen and E.
Lahelma (2005). "Body weight and health status: importance of socioeconomic
position and working conditions." Obes Res 13(12): 2169-2177.
Lacey, D. C., A. Achuthan, A. J. Fleetwood, H. Dinh, J. Roiniotis, G. M. Scholz, M.
W. Chang, S. K. Beckman, A. D. Cook and J. A. Hamilton (2012). "Defining GM-
CSF- and macrophage-CSF-dependent macrophage responses by in vitro models." J
Immunol 188(11): 5752-5765.
Lan, J. G., S. M. Cruickshank, J. C. Singh, M. Farrar, J. P. Lodge, P. J. Felsburg and
S. R. Carding (2005). "Different cytokine response of primary colonic epithelial cells
to commensal bacteria." World J Gastroenterol 11(22): 3375-3384.
233
Laparra, J. M., M. Olivares, O. Gallina and Y. Sanz (2012). "Bifidobacterium longum
CECT 7347 modulates immune responses in a gliadin-induced enteropathy animal
model." PLoS One 7(2): e30744.
Latvala, S., T. E. Pietila, V. Veckman, R. A. Kekkonen, S. Tynkkynen, R. Korpela
and I. Julkunen (2008). "Potentially probiotic bacteria induce efficient maturation but
differential cytokine production in human monocyte-derived dendritic cells." World J
Gastroenterol 14(36): 5570-5583; discussion 5581-5572.
Lazar, G. A., W. Dang, S. Karki, O. Vafa, J. S. Peng, L. Hyun, C. Chan, H. S. Chung,
A. Eivazi, S. C. Yoder, J. Vielmetter, D. F. Carmichael, R. J. Hayes and B. I. Dahiyat
(2006). "Engineered antibody Fc variants with enhanced effector function." Proc Natl
Acad Sci U S A 103(11): 4005-4010.
Leadbetter, E. A., M. Brigl, P. Illarionov, N. Cohen, M. C. Luteran, S. Pillai, G. S.
Besra and M. B. Brenner (2008). "NK T cells provide lipid antigen-specific cognate
help for B cells." Proc Natl Acad Sci U S A 105(24): 8339-8344.
Leavy, O. (2012). "Natural killer T cells: More help for B cells." Nat Rev Immunol
12(1): 5.
Lee, H., C. Hong, J. Shin, S. Oh, S. Jung, Y. K. Park, S. Hong, G. R. Lee and S. H.
Park (2009). "The presence of CD8+ invariant NKT cells in mice." Exp Mol Med
41(12): 866-872.
Lee, H. K. and A. Iwasaki (2007). "Innate control of adaptive immunity: dendritic
cells and beyond." Semin Immunol 19(1): 48-55.
Lee, S. W., Y. S. Hong, C. M. Chun, J. D. Moon, S. J. Kim, I. C. Jung, Y. H. Yoon, B.
A. Lee, S. W. Moon, S. H. Choi and C. K. Moon (2002). "Anti-inflammatory effects
of IL-4 and IL-10 on human polymorphonuclear leukocytes." J Korean Med Sci 17(1):
7-14.
Leibovich, S. J. and R. Ross (1975). "The role of the macrophage in wound repair. A
study with hydrocortisone and antimacrophage serum." Am J Pathol 78(1): 71-100.
Leidi, M., E. Gotti, L. Bologna, E. Miranda, M. Rimoldi, A. Sica, M. Roncalli, G. A.
Palumbo, M. Introna and J. Golay (2009). "M2 macrophages phagocytose rituximab-
opsonized leukemic targets more efficiently than m1 cells in vitro." J Immunol 182(7):
4415-4422.
Leite-De-Moraes, M. C., G. Moreau, A. Arnould, F. Machavoine, C. Garcia, M.
Papiernik and M. Dy (1998). "IL-4-producing NK T cells are biased towards IFN-
gamma production by IL-12. Influence of the microenvironment on the functional
capacities of NK T cells." Eur J Immunol 28(5): 1507-1515.
Leonard, W. J. and R. Spolski (2005). "Interleukin-21: a modulator of lymphoid
proliferation, apoptosis and differentiation." Nat Rev Immunol 5(9): 688-698.
Li, X., A. Yang, H. Huang, X. Zhang, J. Town, B. Davis, D. W. Cockcroft and J. R.
Gordon (2010). "Induction of type 2 T helper cell allergen tolerance by IL-10-
differentiated regulatory dendritic cells." Am J Respir Cell Mol Biol 42(2): 190-199.
Li, Z., S. Yang, H. Lin, J. Huang, P. A. Watkins, A. B. Moser, C. Desimone, X. Y.
Song and A. M. Diehl (2003). "Probiotics and antibodies to TNF inhibit
inflammatory activity and improve nonalcoholic fatty liver disease." Hepatology
37(2): 343-350.
Liang, S. C., A. J. Long, F. Bennett, M. J. Whitters, R. Karim, M. Collins, S. J.
Goldman, K. Dunussi-Joannopoulos, C. M. Williams, J. F. Wright and L. A. Fouser
234
(2007). "An IL-17F/A heterodimer protein is produced by mouse Th17 cells and
induces airway neutrophil recruitment." J Immunol 179(11): 7791-7799.
Lim, T. S., J. K. Goh, A. Mortellaro, C. T. Lim, G. J. Hammerling and P. Ricciardi-
Castagnoli (2012). "CD80 and CD86 differentially regulate mechanical interactions
of T-cells with antigen-presenting dendritic cells and B-cells." PLoS One 7(9):
e45185.
Lin, Y. P., C. H. Thibodeaux, J. A. Pena, G. D. Ferry and J. Versalovic (2008).
"Probiotic Lactobacillus reuteri suppress proinflammatory cytokines via c-Jun."
Inflamm Bowel Dis 14(8): 1068-1083.
Liu, P. T., J. Phan, D. Tang, M. Kanchanapoomi, B. Hall, S. R. Krutzik and J. Kim
(2008). "CD209(+) macrophages mediate host defense against Propionibacterium
acnes." J Immunol 180(7): 4919-4923.
Liu, T. Y., Y. Uemura, M. Suzuki, Y. Narita, S. Hirata, H. Ohyama, O. Ishihara and S.
Matsushita (2008). "Distinct subsets of human invariant NKT cells differentially
regulate T helper responses via dendritic cells." Eur J Immunol 38(4): 1012-1023.
Liu, Z. X., N. Hiwatashi, M. Noguchi and T. Toyota (1997). "Increased expression of
costimulatory molecules on peripheral blood monocytes in patients with Crohn's
disease." Scand J Gastroenterol 32(12): 1241-1246.
Loguercio, C., A. Federico, C. Tuccillo, F. Terracciano, M. V. D'Auria, C. De
Simone and C. Del Vecchio Blanco (2005). "Beneficial effects of a probiotic VSL#3
on parameters of liver dysfunction in chronic liver diseases." J Clin Gastroenterol
39(6): 540-543.
Longphre, M., D. Li, M. Gallup, E. Drori, C. L. Ordonez, T. Redman, S. Wenzel, D.
E. Bice, J. V. Fahy and C. Basbaum (1999). "Allergen-induced IL-9 directly
stimulates mucin transcription in respiratory epithelial cells." J Clin Invest 104(10):
1375-1382.
Loo, Y. M. and M. Gale, Jr. (2011). "Immune signaling by RIG-I-like receptors."
Immunity 34(5): 680-692.
Lorentz, A., S. Schwengberg, G. Sellge, M. P. Manns and S. C. Bischoff (2000).
"Human intestinal mast cells are capable of producing different cytokine profiles: role
of IgE receptor cross-linking and IL-4." J Immunol 164(1): 43-48.
Lu, Y., J. M. Vernes, N. Chiang, Q. Ou, J. Ding, C. Adams, K. Hong, B. T. Truong,
D. Ng, A. Shen, G. Nakamura, Q. Gong, L. G. Presta, M. Beresini, B. Kelley, H.
Lowman, W. L. Wong and Y. G. Meng (2011). "Identification of IgG(1) variants
with increased affinity to FcgammaRIIIa and unaltered affinity to FcgammaRI and
FcRn: comparison of soluble receptor-based and cell-based binding assays." J
Immunol Methods 365(1-2): 132-141.
Luth, S., J. Schrader, S. Zander, A. Carambia, J. Buchkremer, S. Huber, K.
Reifenberg, K. Yamamura, P. Schirmacher, A. W. Lohse and J. Herkel (2011).
"Chronic inflammatory IFN-gamma signaling suppresses hepatocarcinogenesis in
mice by sensitizing hepatocytes for apoptosis." Cancer Res 71(11): 3763-3771.
Ma, X. (2001). "TNF-alpha and IL-12: a balancing act in macrophage functioning."
Microbes Infect 3(2): 121-129.
Ma, X., J. Hua and Z. Li (2008). "Probiotics improve high fat diet-induced hepatic
steatosis and insulin resistance by increasing hepatic NKT cells." Journal of
Hepatology 49(5): 821-830.
235
Ma, X. J., X. L. Pan, Z. H. Lv, F. L. Xu, Y. Liu da, P. Lei da, M. Xia and X. Y. Luan
(2009). "Therapeutic influence on circulating and monocyte-derived dendritic cells in
laryngeal squamous cell carcinoma patients." Acta Otolaryngol 129(1): 84-91.
Maassen, C. B., C. van Holten-Neelen, F. Balk, M. J. den Bak-Glashouwer, R. J. Leer,
J. D. Laman, W. J. Boersma and E. Claassen (2000). "Strain-dependent induction of
cytokine profiles in the gut by orally administered Lactobacillus strains." Vaccine
18(23): 2613-2623.
Majamaa, H. and E. Isolauri (1997). "Probiotics: a novel approach in the management
of food allergy." J Allergy Clin Immunol 99(2): 179-185.
Majamaa, H., E. Isolauri, M. Saxelin and T. Vesikari (1995). "Lactic acid bacteria in
the treatment of acute rotavirus gastroenteritis." J Pediatr Gastroenterol Nutr 20(3):
333-338.
Majka, M., A. Janowska-Wieczorek, J. Ratajczak, K. Ehrenman, Z. Pietrzkowski, M.
A. Kowalska, A. M. Gewirtz, S. G. Emerson and M. Z. Ratajczak (2001). "Numerous
growth factors, cytokines, and chemokines are secreted by human CD34(+) cells,
myeloblasts, erythroblasts, and megakaryoblasts and regulate normal hematopoiesis
in an autocrine/paracrine manner." Blood 97(10): 3075-3085.
Malek, T. R. and A. L. Bayer (2004). "Tolerance, not immunity, crucially depends on
IL-2." Nat Rev Immunol 4(9): 665-674.
Mancuso, G., M. Gambuzza, A. Midiri, C. Biondo, S. Papasergi, S. Akira, G. Teti
and C. Beninati (2009). "Bacterial recognition by TLR7 in the lysosomes of
conventional dendritic cells." Nat Immunol 10(6): 587-594.
Mantovani, A., A. Sica and M. Locati (2007). "New vistas on macrophage
differentiation and activation." Eur J Immunol 37(1): 14-16.
Mantovani, A., A. Sica, S. Sozzani, P. Allavena, A. Vecchi and M. Locati (2004).
"The chemokine system in diverse forms of macrophage activation and polarization."
Trends Immunol 25(12): 677-686.
Manzoni, P. (2007). "Use of Lactobacillus casei subspecies Rhamnosus GG and
gastrointestinal colonization by Candida species in preterm neonates." J Pediatr
Gastroenterol Nutr 45 Suppl 3: S190-194.
Marijnissen, R. J., M. I. Koenders, F. L. van de Veerdonk, J. Dulos, M. G. Netea, A.
M. Boots, L. A. Joosten and W. B. van den Berg (2012). "Exposure to Candida
albicans polarizes a T-cell driven arthritis model towards Th17 responses, resulting in
a more destructive arthritis." PLoS One 7(6): e38889.
Marin, M. L., M. V. Tejada-Simon, J. H. Lee, J. Murtha, Z. Ustunol and J. J. Pestka
(1998). "Stimulation of cytokine production in clonal macrophage and T-cell models
by Streptococcus thermophilus: comparison with Bifidobacterium sp. and
Lactobacillus bulgaricus." J Food Prot 61(7): 859-864.
MartIn-Fontecha, A., S. Sebastiani, U. E. Hopken, M. Uguccioni, M. Lipp, A.
Lanzavecchia and F. Sallusto (2003). "Regulation of dendritic cell migration to the
draining lymph node: impact on T lymphocyte traffic and priming." J Exp Med
198(4): 615-621.
Martin, H., S. Reuter, N. Dehzad, A. Heinz, I. Bellinghausen, J. Saloga, I. Haasler, S.
Korn, H. Jonuleit, R. Buhl, C. Becker and C. Taube (2012). "CD4-mediated
regulatory T-cell activation inhibits the development of disease in a humanized
236
mouse model of allergic airway disease." J Allergy Clin Immunol 129(2): 521-528,
528 e521-527.
Matsuzaki, T., Y. Nagata, S. Kado, K. Uchida, I. Kato, S. Hashimoto and T.
Yokokura (1997). "Prevention of onset in an insulin-dependent diabetes mellitus
model, NOD mice, by oral feeding of Lactobacillus casei." APMIS 105(8): 643-649.
McGeachy, M. J., K. S. Bak-Jensen, Y. Chen, C. M. Tato, W. Blumenschein, T.
McClanahan and D. J. Cua (2007). "TGF-beta and IL-6 drive the production of IL-17
and IL-10 by T cells and restrain T(H)-17 cell-mediated pathology." Nat Immunol
8(12): 1390-1397.
Medzhitov, R., P. Preston-Hurlburt, E. Kopp, A. Stadlen, C. Chen, S. Ghosh and C. A.
Janeway, Jr. (1998). "MyD88 is an adaptor protein in the hToll/IL-1 receptor family
signaling pathways." Mol Cell 2(2): 253-258.
Mege, J. L., V. Mehraj and C. Capo (2011). "Macrophage polarization and bacterial
infections." Curr Opin Infect Dis 24(3): 230-234.
Meisel, S. R., H. Shapiro, J. Radnay, Y. Neuman, A. R. Khaskia, N. Gruener, H.
Pauzner and D. David (1998). "Increased expression of neutrophil and monocyte
adhesion molecules LFA-1 and Mac-1 and their ligand ICAM-1 and VLA-4
throughout the acute phase of myocardial infarction: possible implications for
leukocyte aggregation and microvascular plugging." J Am Coll Cardiol 31(1): 120-
125.
Menard, S., C. Candalh, J. C. Bambou, K. Terpend, N. Cerf-Bensussan and M.
Heyman (2004). "Lactic acid bacteria secrete metabolites retaining anti-inflammatory
properties after intestinal transport." Gut 53(6): 821-828.
Miettinen, M., A. Lehtonen, I. Julkunen and S. Matikainen (2000). "Lactobacilli and
Streptococci activate NF-kappa B and STAT signaling pathways in human
macrophages." J Immunol 164(7): 3733-3740.
Miettinen, M., V. Veckman, S. Latvala, T. Sareneva, S. Matikainen and I. Julkunen
(2008). "Live Lactobacillus rhamnosus and Streptococcus pyogenes differentially
regulate Toll-like receptor (TLR) gene expression in human primary macrophages." J
Leukoc Biol 84(4): 1092-1100.
Mirnejad, R., A. R. Vahdati, J. Rashidiani, M. Erfani and V. Piranfar (2013). "The
antimicrobial effect of lactobacillus casei culture supernatant against multiple drug
resistant clinical isolates of Shigella sonnei and Shigella flexneri in vitro." Iran Red
Crescent Med J 15(2): 122-126.
Mohamadzadeh, M., S. Olson, W. V. Kalina, G. Ruthel, G. L. Demmin, K. L.
Warfield, S. Bavari and T. R. Klaenhammer (2005). "Lactobacilli activate human
dendritic cells that skew T cells toward T helper 1 polarization." Proc Natl Acad Sci
U S A 102(8): 2880-2885.
Monteleone, I., F. Pallone and G. Monteleone (2011). "Th17-related cytokines: new
players in the control of chronic intestinal inflammation." BMC Med 9: 122.
Moore, K. J. and I. Tabas (2011). "Macrophages in the pathogenesis of
atherosclerosis." Cell 145(3): 341-355.
Mora, J. R., M. Iwata and U. H. von Andrian (2008). "Vitamin effects on the immune
system: vitamins A and D take centre stage." Nat Rev Immunol 8(9): 685-698.
Moreira-Teixeira, L., M. Resende, M. Coffre, O. Devergne, J. P. Herbeuval, O.
Hermine, E. Schneider, L. Rogge, F. M. Ruemmele, M. Dy, A. Cordeiro-da-Silva and
237
M. C. Leite-de-Moraes (2011). "Proinflammatory environment dictates the IL-17-
producing capacity of human invariant NKT cells." J Immunol 186(10): 5758-5765.
Mosmann, T. R. and R. L. Coffman (1989). "Heterogeneity of cytokine secretion
patterns and functions of helper T cells." Adv Immunol 46: 111-147.
Mosmann, T. R. and R. L. Coffman (1989). "TH1 and TH2 cells: different patterns of
lymphokine secretion lead to different functional properties." Annu Rev Immunol 7:
145-173.
Mosser, D. M. and J. P. Edwards (2008). "Exploring the full spectrum of macrophage
activation." Nat Rev Immunol 8(12): 958-969.
Murray, P. J. and T. A. Wynn (2011). "Protective and pathogenic functions of
macrophage subsets." Nat Rev Immunol 11(11): 723-737.
Muzio, M., D. Bosisio, N. Polentarutti, G. D'Amico, A. Stoppacciaro, R. Mancinelli,
C. van't Veer, G. Penton-Rol, L. P. Ruco, P. Allavena and A. Mantovani (2000).
"Differential expression and regulation of toll-like receptors (TLR) in human
leukocytes: selective expression of TLR3 in dendritic cells." J Immunol 164(11):
5998-6004.
Muzio, M., G. Natoli, S. Saccani, M. Levrero and A. Mantovani (1998). "The human
toll signaling pathway: divergence of nuclear factor kappaB and JNK/SAPK
activation upstream of tumor necrosis factor receptor-associated factor 6 (TRAF6)." J
Exp Med 187(12): 2097-2101.
Muzio, M., J. Ni, P. Feng and V. M. Dixit (2013). "Pillars article: IRAK (Pelle)
family member IRAK-2 and MyD88 as proximal mediators of IL-1 signaling.
Science. 1997. 278: 1612-1615." J Immunol 190(1): 16-19.
Myllyluoma, E., T. Ahlroos, L. Veijola, H. Rautelin, S. Tynkkynen and R. Korpela
(2007). "Effects of anti-Helicobacter pylori treatment and probiotic supplementation
on intestinal microbiota." Int J Antimicrob Agents 29(1): 66-72.
Myllyluoma, E., K. Kajander, H. Mikkola, S. Kyronpalo, M. Rasmussen, E. Kankuri,
P. Sipponen, H. Vapaatalo and R. Korpela (2007). "Probiotic intervention decreases
serum gastrin-17 in Helicobacter pylori infection." Dig Liver Dis 39(6): 516-523.
Nakayama, M., K. Takeda, M. Kawano, T. Takai, N. Ishii and K. Ogasawara (2011).
"Natural killer (NK)-dendritic cell interactions generate MHC class II-dressed NK
cells that regulate CD4+ T cells." Proc Natl Acad Sci U S A 108(45): 18360-18365.
Navarre, W. W. and O. Schneewind (1999). "Surface proteins of gram-positive
bacteria and mechanisms of their targeting to the cell wall envelope." Microbiol Mol
Biol Rev 63(1): 174-229.
Neutra, M. R. (1998). "Current concepts in mucosal immunity. V Role of M cells in
transepithelial transport of antigens and pathogens to the mucosal immune system."
Am J Physiol 274(5 Pt 1): G785-791.
Nicholson, J. K., E. Holmes, J. Kinross, R. Burcelin, G. Gibson, W. Jia and S.
Pettersson (2012). "Host-gut microbiota metabolic interactions." Science 336(6086):
1262-1267.
Niers, L. E., H. M. Timmerman, G. T. Rijkers, G. M. van Bleek, N. O. van Uden, E.
F. Knol, M. L. Kapsenberg, J. L. Kimpen and M. O. Hoekstra (2005). "Identification
of strong interleukin-10 inducing lactic acid bacteria which down-regulate T helper
type 2 cytokines." Clin Exp Allergy 35(11): 1481-1489.
238
Niess, J. H., S. Brand, X. Gu, L. Landsman, S. Jung, B. A. McCormick, J. M. Vyas,
M. Boes, H. L. Ploegh, J. G. Fox, D. R. Littman and H. C. Reinecker (2005).
"CX3CR1-mediated dendritic cell access to the intestinal lumen and bacterial
clearance." Science 307(5707): 254-258.
Noelle, R. and E. C. Snow (1992). "T helper cells." Curr Opin Immunol 4(3): 333-
337.
Nurieva, R., X. O. Yang, G. Martinez, Y. Zhang, A. D. Panopoulos, L. Ma, K.
Schluns, Q. Tian, S. S. Watowich, A. M. Jetten and C. Dong (2007). "Essential
autocrine regulation by IL-21 in the generation of inflammatory T cells." Nature
448(7152): 480-483.
O'Mahony, L., L. O'Callaghan, J. McCarthy, D. Shilling, P. Scully, S. Sibartie, E.
Kavanagh, W. O. Kirwan, H. P. Redmond, J. K. Collins and F. Shanahan (2006).
"Differential cytokine response from dendritic cells to commensal and pathogenic
bacteria in different lymphoid compartments in humans." Am J Physiol Gastrointest
Liver Physiol 290(4): G839-845.
O'Reilly, V., S. G. Zeng, G. Bricard, A. Atzberger, A. E. Hogan, J. Jackson, C.
Feighery, S. A. Porcelli and D. G. Doherty (2011). "Distinct and overlapping effector
functions of expanded human CD4+, CD8alpha+ and CD4-CD8alpha- invariant
natural killer T cells." PLoS One 6(12): e28648.
Oganesyan, V., M. M. Damschroder, W. Leach, H. Wu and W. F. Dall'Acqua (2008).
"Structural characterization of a mutated, ADCC-enhanced human Fc fragment." Mol
Immunol 45(7): 1872-1882.
Ohtsuka, Y., T. Ikegami, H. Izumi, M. Namura, T. Ikeda, T. Ikuse, Y. Baba, T. Kudo,
R. Suzuki and T. Shimizu (2012). "Effects of Bifidobacterium breve on inflammatory
gene expression in neonatal and weaning rat intestine." Pediatr Res 71(1): 46-53.
Oksaharju, A., T. Kooistra, R. Kleemann, W. van Duyvenvoorde, M. Miettinen, J.
Lappalainen, K. A. Lindstedt, P. T. Kovanen, R. Korpela and R. A. Kekkonen (2012).
"Effects of probiotic Lactobacillus rhamnosus GG and Propionibacterium
freudenreichii ssp. shermanii JS supplementation on intestinal and systemic markers
of inflammation in ApoE*3Leiden mice consuming a high-fat diet." Br J Nutr: 1-9.
Oliver, J. A., V. R. Stolberg, S. W. Chensue and P. D. King (2012). "IL-4 acts as a
potent stimulator of IFN-gamma expression in CD8+ T cells through STAT6-
dependent and independent induction of Eomesodermin and T-bet." Cytokine 57(1):
191-199.
Ono, S. J., T. Nakamura, D. Miyazaki, M. Ohbayashi, M. Dawson and M. Toda
(2003). "Chemokines: roles in leukocyte development, trafficking, and effector
function." J Allergy Clin Immunol 111(6): 1185-1199; quiz 1200.
Orr, C. F., D. B. Rowe, Y. Mizuno, H. Mori and G. M. Halliday (2005). "A possible
role for humoral immunity in the pathogenesis of Parkinson's disease." Brain 128(Pt
11): 2665-2674.
Osman, N., D. Adawi, S. Ahrne, B. Jeppsson and G. Molin (2007). "Endotoxin- and
D-galactosamine-induced liver injury improved by the administration of
Lactobacillus, Bifidobacterium and blueberry." Dig Liver Dis 39(9): 849-856.
Osorio, F. and C. Reis e Sousa (2011). "Myeloid C-type lectin receptors in pathogen
recognition and host defense." Immunity 34(5): 651-664.
239
Ouyang, W., S. H. Ranganath, K. Weindel, D. Bhattacharya, T. L. Murphy, W. C.
Sha and K. M. Murphy (1998). "Inhibition of Th1 development mediated by GATA-3
through an IL-4-independent mechanism." Immunity 9(5): 745-755.
Pai, S. Y., M. L. Truitt and I. C. Ho (2004). "GATA-3 deficiency abrogates the
development and maintenance of T helper type 2 cells." Proc Natl Acad Sci U S A
101(7): 1993-1998.
Palazon, A., J. Aragones, A. Morales-Kastresana, M. O. de Landazuri and I. Melero
(2012). "Molecular pathways: hypoxia response in immune cells fighting or
promoting cancer." Clin Cancer Res 18(5): 1207-1213.
Park, H., Z. Li, X. O. Yang, S. H. Chang, R. Nurieva, Y. H. Wang, Y. Wang, L.
Hood, Z. Zhu, Q. Tian and C. Dong (2005). "A distinct lineage of CD4 T cells
regulates tissue inflammation by producing interleukin 17." Nat Immunol 6(11):
1133-1141.
Parkin, J. and B. Cohen (2001). "An overview of the immune system." Lancet
357(9270): 1777-1789.
Pasare, C. and R. Medzhitov (2003). "Toll pathway-dependent blockade of
CD4+CD25+ T cell-mediated suppression by dendritic cells." Science 299(5609):
1033-1036.
Passlick, B., D. Flieger and H. W. Ziegler-Heitbrock (1989). "Identification and
characterization of a novel monocyte subpopulation in human peripheral blood."
Blood 74(7): 2527-2534.
Paustian, C., R. Caspell, T. Johnson, P. A. Cohen, S. Shu, S. Xu, B. J. Czerniecki and
G. K. Koski (2011). "Effect of multiple activation stimuli on the generation of Th1-
polarizing dendritic cells." Hum Immunol 72(1): 24-31.
Pavan, S., P. Desreumaux and A. Mercenier (2003). "Use of mouse models to
evaluate the persistence, safety, and immune modulation capacities of lactic acid
bacteria." Clin Diagn Lab Immunol 10(4): 696-701.
Pawankar, R., M. Okuda, H. Yssel, K. Okumura and C. Ra (1997). "Nasal mast cells
in perennial allergic rhinitics exhibit increased expression of the Fc epsilonRI,
CD40L, IL-4, and IL-13, and can induce IgE synthesis in B cells." J Clin Invest 99(7):
1492-1499.
Pena, J. A. and J. Versalovic (2003). "Lactobacillus rhamnosus GG decreases TNF-
alpha production in lipopolysaccharide-activated murine macrophages by a contact-
independent mechanism." Cell Microbiol 5(4): 277-285.
Peroval, M. Y., A. C. Boyd, J. R. Young and A. L. Smith (2013). "A critical role for
MAPK signalling pathways in the transcriptional regulation of toll like receptors."
PLoS One 8(2): e51243.
Pessi, T., Y. Sutas, M. Hurme and E. Isolauri (2000). "Interleukin-10 generation in
atopic children following oral Lactobacillus rhamnosus GG." Clin Exp Allergy
30(12): 1804-1808.
Pinet, V., M. Vergelli, R. Martin, O. Bakke and E. O. Long (1995). "Antigen
presentation mediated by recycling of surface HLA-DR molecules." Nature
375(6532): 603-606.
Pochard, P., P. Gosset, C. Grangette, C. Andre, A. B. Tonnel, J. Pestel and A.
Mercenier (2002). "Lactic acid bacteria inhibit TH2 cytokine production by
mononuclear cells from allergic patients." J Allergy Clin Immunol 110(4): 617-623.
240
Pohjavuori, E., M. Viljanen, R. Korpela, M. Kuitunen, M. Tiittanen, O. Vaarala and
E. Savilahti (2004). "Lactobacillus GG effect in increasing IFN-gamma production in
infants with cow's milk allergy." J Allergy Clin Immunol 114(1): 131-136.
Prantera, C., M. L. Scribano, G. Falasco, A. Andreoli and C. Luzi (2002).
"Ineffectiveness of probiotics in preventing recurrence after curative resection for
Crohn's disease: a randomised controlled trial with Lactobacillus GG." Gut 51(3):
405-409.
Puig-Kroger, A., O. M. Pello, R. Selgas, G. Criado, M. A. Bajo, J. A. Sanchez-
Tomero, V. Alvarez, G. del Peso, P. Sanchez-Mateos, C. Holmes, D. Faict, M.
Lopez-Cabrera, J. Madrenas and A. L. Corbi (2003). "Peritoneal dialysis solutions
inhibit the differentiation and maturation of human monocyte-derived dendritic cells:
effect of lactate and glucose-degradation products." J Leukoc Biol 73(4): 482-492.
Randolph, G. J., C. Jakubzick and C. Qu (2008). "Antigen presentation by monocytes
and monocyte-derived cells." Curr Opin Immunol 20(1): 52-60.
Raveney, B. J., S. Oki and T. Yamamura (2013). "Nuclear Receptor NR4A2
Orchestrates Th17 Cell-Mediated Autoimmune Inflammation via IL-21 Signalling."
PLoS One 8(2): e56595.
Reale, M., P. Boscolo, V. Bellante, C. Tarantelli, M. Di Nicola, L. Forcella, Q. Li, K.
Morimoto and R. Muraro (2012). "Daily intake of Lactobacillus casei Shirota
increases natural killer cell activity in smokers." Br J Nutr 108(2): 308-314.
Reis e Sousa, C. (2001). "Dendritic cells as sensors of infection." Immunity 14(5):
495-498.
Rembacken, B. J., A. M. Snelling, P. M. Hawkey, D. M. Chalmers and A. T. Axon
(1999). "Non-pathogenic Escherichia coli versus mesalazine for the treatment of
ulcerative colitis: a randomised trial." Lancet 354(9179): 635-639.
Rescigno, M., M. Urbano, B. Valzasina, M. Francolini, G. Rotta, R. Bonasio, F.
Granucci, J. P. Kraehenbuhl and P. Ricciardi-Castagnoli (2001). "Dendritic cells
express tight junction proteins and penetrate gut epithelial monolayers to sample
bacteria." Nat Immunol 2(4): 361-367.
Riberdy, J. M., J. P. Christensen, K. Branum and P. C. Doherty (2000). "Diminished
primary and secondary influenza virus-specific CD8(+) T-cell responses in CD4-
depleted Ig(-/-) mice." J Virol 74(20): 9762-9765.
Rizzardini, G., D. Eskesen, P. C. Calder, A. Capetti, L. Jespersen and M. Clerici
(2012). "Evaluation of the immune benefits of two probiotic strains Bifidobacterium
animalis ssp. lactis, BB-12 and Lactobacillus paracasei ssp. paracasei, L. casei 431 in
an influenza vaccination model: a randomised, double-blind, placebo-controlled
study." Br J Nutr 107(6): 876-884.
Roca, H., Z. S. Varsos, S. Sud, M. J. Craig, C. Ying and K. J. Pienta (2009). "CCL2
and interleukin-6 promote survival of human CD11b+ peripheral blood mononuclear
cells and induce M2-type macrophage polarization." J Biol Chem 284(49): 34342-
34354.
Rogacev, K. S., B. Cremers, A. M. Zawada, S. Seiler, N. Binder, P. Ege, G. Grosse-
Dunker, I. Heisel, F. Hornof, J. Jeken, N. M. Rebling, C. Ulrich, B. Scheller, M.
Bohm, D. Fliser and G. H. Heine (2012). "CD14++CD16+ monocytes independently
predict cardiovascular events: a cohort study of 951 patients referred for elective
coronary angiography." J Am Coll Cardiol 60(16): 1512-1520.
241
Rogacev, K. S., S. Seiler, A. M. Zawada, B. Reichart, E. Herath, D. Roth, C. Ulrich,
D. Fliser and G. H. Heine (2011). "CD14++CD16+ monocytes and cardiovascular
outcome in patients with chronic kidney disease." Eur Heart J 32(1): 84-92.
Rojas, M., F. Ascencio and P. L. Conway (2002). "Purification and characterization
of a surface protein from Lactobacillus fermentum 104R that binds to porcine small
intestinal mucus and gastric mucin." Appl Environ Microbiol 68(5): 2330-2336.
Rojo, J. (2009). "Dendritic Compounds as Immune Response Modulators. New
Approaches for Vaccine Development." Anti-Infective Agents in Medicinal
Chemistry 8(1): 50-72.
Roncarolo, M. G., S. Gregori, M. Battaglia, R. Bacchetta, K. Fleischhauer and M. K.
Levings (2006). "Interleukin-10-secreting type 1 regulatory T cells in rodents and
humans." Immunol Rev 212: 28-50.
Rosenfeldt, V., E. Benfeldt, N. H. Valerius, A. Paerregaard and K. F. Michaelsen
(2004). "Effect of probiotics on gastrointestinal symptoms and small intestinal
permeability in children with atopic dermatitis." J Pediatr 145(5): 612-616.
Rossi, D. L., A. P. Vicari, K. Franz-Bacon, T. K. McClanahan and A. Zlotnik (1997).
"Identification through bioinformatics of two new macrophage proinflammatory
human chemokines: MIP-3alpha and MIP-3beta." J Immunol 158(3): 1033-1036.
Rupec, R. A., S. Boneberger and T. Ruzicka (2010). "What is really in control of skin
immunity: lymphocytes, dendritic cells, or keratinocytes? facts and controversies."
Clin Dermatol 28(1): 62-66.
Rutz, S., R. Noubade, C. Eidenschenk, N. Ota, W. Zeng, Y. Zheng, J. Hackney, J.
Ding, H. Singh and W. Ouyang (2011). "Transcription factor c-Maf mediates the
TGF-beta-dependent suppression of IL-22 production in T(H)17 cells." Nat Immunol
12(12): 1238-1245.
Sakaguchi, S., N. Sakaguchi, M. Asano, M. Itoh and M. Toda (1995). "Immunologic
self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains
(CD25). Breakdown of a single mechanism of self-tolerance causes various
autoimmune diseases." J Immunol 155(3): 1151-1164.
Salzman, N. H. (2011). "Microbiota-immune system interaction: an uneasy alliance."
Curr Opin Microbiol 14(1): 99-105.
Sanchez, B., J. M. Schmitter and M. C. Urdaci (2009). "Identification of novel
proteins secreted by Lactobacillus rhamnosus GG grown in de Mann-Rogosa-Sharpe
broth." Lett Appl Microbiol 48(5): 618-622.
Sanchez, B., M. C. Urdaci and A. Margolles (2010). "Extracellular proteins secreted
by probiotic bacteria as mediators of effects that promote mucosa-bacteria
interactions." Microbiology 156(Pt 11): 3232-3242.
Sanders, M. E. (2003). "Probiotics: considerations for human health." Nutr Rev 61(3):
91-99.
Saoudi, A., J. Kuhn, K. Huygen, Y. de Kozak, T. Velu, M. Goldman, P. Druet and B.
Bellon (1993). "TH2 activated cells prevent experimental autoimmune uveoretinitis, a
TH1-dependent autoimmune disease." Eur J Immunol 23(12): 3096-3103.
Sauter, S. N., K. Allenspach, F. Gaschen, A. Grone, E. Ontsouka and J. W. Blum
(2005). "Cytokine expression in an ex vivo culture system of duodenal samples from
dogs with chronic enteropathies: modulation by probiotic bacteria." Domest Anim
Endocrinol 29(4): 605-622.
242
Scharton, T. M. and P. Scott (1993). "Natural killer cells are a source of interferon
gamma that drives differentiation of CD4+ T cell subsets and induces early resistance
to Leishmania major in mice." J Exp Med 178(2): 567-577.
Schiffrin, E. J. and S. Blum (2002). "Interactions between the microbiota and the
intestinal mucosa." Eur J Clin Nutr 56 Suppl 3: S60-64.
Schnare, M., G. M. Barton, A. C. Holt, K. Takeda, S. Akira and R. Medzhitov (2001).
"Toll-like receptors control activation of adaptive immune responses." Nat Immunol
2(10): 947-950.
Schneberger, D., K. Aharonson-Raz and B. Singh (2011). "Monocyte and
macrophage heterogeneity and Toll-like receptors in the lung." Cell Tissue Res
343(1): 97-106.
Seifert, S., A. Bub, C. M. Franz and B. Watzl (2011). "Probiotic Lactobacillus casei
Shirota supplementation does not modulate immunity in healthy men with reduced
natural killer cell activity." J Nutr 141(5): 978-984.
Seino, K. and M. Taniguchi (2005). "Functionally distinct NKT cell subsets and
subtypes." J Exp Med 202(12): 1623-1626.
Seth, A., F. Yan, D. B. Polk and R. K. Rao (2008). "Probiotics ameliorate the
hydrogen peroxide-induced epithelial barrier disruption by a PKC- and MAP kinase-
dependent mechanism." Am J Physiol Gastrointest Liver Physiol 294(4): G1060-
1069.
Sharon, J. (1998). Basic immunology. Baltimore, Md., Williams & Wilkins.
Shedlock, D. J. and H. Shen (2003). "Requirement for CD4 T cell help in generating
functional CD8 T cell memory." Science 300(5617): 337-339.
Sica, A., T. Schioppa, A. Mantovani and P. Allavena (2006). "Tumour-associated
macrophages are a distinct M2 polarised population promoting tumour progression:
potential targets of anti-cancer therapy." Eur J Cancer 42(6): 717-727.
Smeekens, S. P., F. L. van de Veerdonk, L. A. Joosten, L. Jacobs, T. Jansen, D. L.
Williams, J. W. van der Meer, B. J. Kullberg and M. G. Netea (2011). "The classical
CD14(+)(+) CD16(-) monocytes, but not the patrolling CD14(+) CD16(+) monocytes,
promote Th17 responses to Candida albicans." Eur J Immunol 41(10): 2915-2924.
Smyth, M. J., N. Y. Crowe, D. G. Pellicci, K. Kyparissoudis, J. M. Kelly, K. Takeda,
H. Yagita and D. I. Godfrey (2002). "Sequential production of interferon-gamma by
NK1.1(+) T cells and natural killer cells is essential for the antimetastatic effect of
alpha-galactosylceramide." Blood 99(4): 1259-1266.
Soltan Dallal, M. M., M. H. Yazdi, M. Holakuyee, Z. M. Hassan, M. Abolhassani and
M. Mahdavi (2012). "Lactobacillus casei ssp.casei Induced Th1 Cytokine Profile and
Natural Killer Cells Activity in Invasive Ductal Carcinoma Bearing Mice." Iran J
Allergy Asthma Immunol 11(2): 183-189.
Spottl, T., M. Hausmann, M. Kreutz, A. Peuker, D. Vogl, J. Scholmerich, W. Falk, R.
Andreesen, T. Andus, H. Herfarth and G. Rogler (2001). "Monocyte differentiation in
intestine-like macrophage phenotype induced by epithelial cells." J Leukoc Biol 70(2):
241-251.
Stec, M., K. Weglarczyk, J. Baran, E. Zuba, B. Mytar, J. Pryjma and M. Zembala
(2007). "Expansion and differentiation of CD14+CD16(-) and CD14+ +CD16+
human monocyte subsets from cord blood CD34+ hematopoietic progenitors." J
Leukoc Biol 82(3): 594-602.
243
Stein-Streilein, J., K. H. Sonoda, D. Faunce and J. Zhang-Hoover (2000). "Regulation
of adaptive immune responses by innate cells expressing NK markers and antigen-
transporting macrophages." J Leukoc Biol 67(4): 488-494.
Sugawara, G., M. Nagino, H. Nishio, T. Ebata, K. Takagi, T. Asahara, K. Nomoto
and Y. Nimura (2006). "Perioperative synbiotic treatment to prevent postoperative
infectious complications in biliary cancer surgery: a randomized controlled trial."
Ann Surg 244(5): 706-714.
Sugiyama, H., R. Gyulai, E. Toichi, E. Garaczi, S. Shimada, S. R. Stevens, T. S.
McCormick and K. D. Cooper (2005). "Dysfunctional blood and target tissue
CD4+CD25high regulatory T cells in psoriasis: mechanism underlying unrestrained
pathogenic effector T cell proliferation." J Immunol 174(1): 164-173.
Sun, J. L., G. W. Le, L. X. Hou, N. F. Wang, G. F. Chang and Y. H. Shi (2007).
"Nonopsonic phagocytosis of Lactobacilli by mice Peyer's patches' macrophages."
Asia Pac J Clin Nutr 16 Suppl 1: 204-207.
Suri-Payer, E., A. Z. Amar, A. M. Thornton and E. M. Shevach (1998).
"CD4+CD25+ T cells inhibit both the induction and effector function of autoreactive
T cells and represent a unique lineage of immunoregulatory cells." J Immunol 160(3):
1212-1218.
Suri-Payer, E. and H. Cantor (2001). "Differential cytokine requirements for
regulation of autoimmune gastritis and colitis by CD4(+)CD25(+) T cells." J
Autoimmun 16(2): 115-123.
Suzuki, Y., M. A. Orellana, R. D. Schreiber and J. S. Remington (1988). "Interferon-
gamma: the major mediator of resistance against Toxoplasma gondii." Science
240(4851): 516-518.
Swanson, J. A. and A. D. Hoppe (2004). "The coordination of signaling during Fc
receptor-mediated phagocytosis." J Leukoc Biol 76(6): 1093-1103.
Szabo, S. J., S. T. Kim, G. L. Costa, X. Zhang, C. G. Fathman and L. H. Glimcher
(2000). "A novel transcription factor, T-bet, directs Th1 lineage commitment." Cell
100(6): 655-669.
Szajewska, H., P. Albrecht and A. Topczewska-Cabanek (2009). "Randomized,
double-blind, placebo-controlled trial: effect of lactobacillus GG supplementation on
Helicobacter pylori eradication rates and side effects during treatment in children." J
Pediatr Gastroenterol Nutr 48(4): 431-436.
Szajewska, H., M. Wanke and B. Patro (2011). "Meta-analysis: the effects of
Lactobacillus rhamnosus GG supplementation for the prevention of healthcare-
associated diarrhoea in children." Aliment Pharmacol Ther 34(9): 1079-1087.
Szlosarek, P., K. A. Charles and F. R. Balkwill (2006). "Tumour necrosis factor-
alpha as a tumour promoter." Eur J Cancer 42(6): 745-750.
Taams, L. S., D. B. Palmer, A. N. Akbar, D. S. Robinson, Z. Brown and C. M.
Hawrylowicz (2006). "Regulatory T cells in human disease and their potential for
therapeutic manipulation." Immunology 118(1): 1-9.
Takahashi, T., Y. Kuniyasu, M. Toda, N. Sakaguchi, M. Itoh, M. Iwata, J. Shimizu
and S. Sakaguchi (1998). "Immunologic self-tolerance maintained by CD25+CD4+
naturally anergic and suppressive T cells: induction of autoimmune disease by
breaking their anergic/suppressive state." Int Immunol 10(12): 1969-1980.
244
Takeda, K., T. Kaisho and S. Akira (2003). "Toll-like receptors." Annu Rev Immunol
21: 335-376.
Taleb, O., M. Maammar, D. Brumaru, J. J. Bourguignon, M. Schmitt, C. Klein, V.
Kemmel, M. Maitre and A. G. Mensah-Nyagan (2012). "Xanthurenic acid binds to
neuronal G-protein-coupled receptors that secondarily activate cationic channels in
the cell line NCB-20." PLoS One 7(11): e48553.
Tamauchi, H., M. Terashima, M. Ito, H. Maruyama, N. Ikewaki, M. Inoue, X. Gao, K.
Hozumi and S. Habu (2004). "Evidence of GATA-3-dependent Th2 commitment
during the in vivo immune response." Int Immunol 16(1): 179-187.
Tanabe, S., Y. Kinuta and Y. Saito (2008). "Bifidobacterium infantis suppresses
proinflammatory interleukin-17 production in murine splenocytes and dextran sodium
sulfate-induced intestinal inflammation." Int J Mol Med 22(2): 181-185.
Taniguchi, T. and Y. Minami (1993). "The IL-2/IL-2 receptor system: a current
overview." Cell 73(1): 5-8.
Tao, Y., K. A. Drabik, T. S. Waypa, M. W. Musch, J. C. Alverdy, O. Schneewind, E.
B. Chang and E. O. Petrof (2006). "Soluble factors from Lactobacillus GG activate
MAPKs and induce cytoprotective heat shock proteins in intestinal epithelial cells."
Am J Physiol Cell Physiol 290(4): C1018-1030.
Taweechotipatr, M., C. Iyer, J. K. Spinler, J. Versalovic and S. Tumwasorn (2009).
"Lactobacillus saerimneri and Lactobacillus ruminis: novel human-derived probiotic
strains with immunomodulatory activities." FEMS Microbiol Lett 293(1): 65-72.
Thomas, R. and P. E. Lipsky (1994). "Human peripheral blood dendritic cell subsets.
Isolation and characterization of precursor and mature antigen-presenting cells." J
Immunol 153(9): 4016-4028.
Thornton, A. M. and E. M. Shevach (1998). "CD4+CD25+ immunoregulatory T cells
suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production." J
Exp Med 188(2): 287-296.
Tiffany, H. L., L. L. Lautens, J. L. Gao, J. Pease, M. Locati, C. Combadiere, W. Modi,
T. I. Bonner and P. M. Murphy (1997). "Identification of CCR8: a human monocyte
and thymus receptor for the CC chemokine I-309." J Exp Med 186(1): 165-170.
Tilg, H., E. Trehu, M. B. Atkins, C. A. Dinarello and J. W. Mier (1994). "Interleukin-
6 (IL-6) as an anti-inflammatory cytokine: induction of circulating IL-1 receptor
antagonist and soluble tumor necrosis factor receptor p55." Blood 83(1): 113-118.
Tillinger, W., R. Jilch, B. Jilma, H. Brunner, U. Koeller, C. Lichtenberger, T.
Waldhor and W. Reinisch (2009). "Expression of the high-affinity IgG receptor FcRI
(CD64) in patients with inflammatory bowel disease: a new biomarker for
gastroenterologic diagnostics." Am J Gastroenterol 104(1): 102-109.
Tong, J., W. N. Wu, X. Kong, P. F. Wu, L. Tian, W. Du, M. Fang, F. Zheng, J. G.
Chen, Z. Tan and F. Gong (2011). "Acid-sensing ion channels contribute to the effect
of acidosis on the function of dendritic cells." J Immunol 186(6): 3686-3692.
Trinchieri, G. (1995). "Interleukin-12: a proinflammatory cytokine with
immunoregulatory functions that bridge innate resistance and antigen-specific
adaptive immunity." Annu Rev Immunol 13: 251-276.
Trinchieri, G. (2003). "Interleukin-12 and the regulation of innate resistance and
adaptive immunity." Nat Rev Immunol 3(2): 133-146.
245
Tsuda, M., A. Hosono, T. Yanagibashi, S. Hachimura, K. Hirayama, Y. Umesaki, K.
Itoh, K. Takahashi and S. Kaminogawa (2009). "Intestinal Bifidobacterium
association in germ-free T cell receptor transgenic mice down-regulates dietary
antigen-specific immune responses of the small intestine but enhances those of the
large intestine." Immunobiology 214(4): 279-289.
Uguccioni, M., M. D'Apuzzo, M. Loetscher, B. Dewald and M. Baggiolini (1995).
"Actions of the chemotactic cytokines MCP-1, MCP-2, MCP-3, RANTES, MIP-1
alpha and MIP-1 beta on human monocytes." Eur J Immunol 25(1): 64-68.
Unthank, M. W., Jonathan; Butler, Jason; Bratton, Gregory; Barbee, James; Chumley,
Michael; Cheek, Dennis; Mitchell, Joel; and Phillips, Melody (2012). Influence of
Fitness and Adiposity on Melanocortin-1 and Melanocortin-3 Receptors on
Monocytes. International Journal of Exercise Science.
Urban, J. F., Jr., N. Noben-Trauth, D. D. Donaldson, K. B. Madden, S. C. Morris, M.
Collins and F. D. Finkelman (1998). "IL-13, IL-4Ralpha, and Stat6 are required for
the expulsion of the gastrointestinal nematode parasite Nippostrongylus brasiliensis."
Immunity 8(2): 255-264.
Van Kaer, L., V. V. Parekh and L. Wu (2011). "Invariant natural killer T cells:
bridging innate and adaptive immunity." Cell Tissue Res 343(1): 43-55.
van Vliet, S. J., L. Steeghs, S. C. Bruijns, M. M. Vaezirad, C. Snijders Blok, J. A.
Arenas Busto, M. Deken, J. P. van Putten and Y. van Kooyk (2009). "Variation of
Neisseria gonorrhoeae lipooligosaccharide directs dendritic cell-induced T helper
responses." PLoS Pathog 5(10): e1000625.
Van Vugt, M. J., I. E. Van den Herik-Oudijk and J. G. Van de Winkel (1998).
"FcgammaRIa-gamma-chain complexes trigger antibody-dependent cell-mediated
cytotoxicity (ADCC) in CD5+ B cell/macrophage IIA1.6 cells." Clin Exp Immunol
113(3): 415-422.
van Vuuren, A. J., J. A. van Roon, V. Walraven, I. Stuij, M. C. Harmsen, P. M.
McLaughlin, J. G. van de Winkel and T. Thepen (2006). "CD64-directed
immunotoxin inhibits arthritis in a novel CD64 transgenic rat model." J Immunol
176(10): 5833-5838.
Veckman, V., M. Miettinen, J. Pirhonen, J. Siren, S. Matikainen and I. Julkunen
(2004). "Streptococcus pyogenes and Lactobacillus rhamnosus differentially induce
maturation and production of Th1-type cytokines and chemokines in human
monocyte-derived dendritic cells." J Leukoc Biol 75(5): 764-771.
Veldhoen, M., R. J. Hocking, R. A. Flavell and B. Stockinger (2006). "Signals
mediated by transforming growth factor-beta initiate autoimmune encephalomyelitis,
but chronic inflammation is needed to sustain disease." Nat Immunol 7(11): 1151-
1156.
Viljanen, M., E. Pohjavuori, T. Haahtela, R. Korpela, M. Kuitunen, A. Sarnesto, O.
Vaarala and E. Savilahti (2005). "Induction of inflammation as a possible mechanism
of probiotic effect in atopic eczema-dermatitis syndrome." J Allergy Clin Immunol
115(6): 1254-1259.
Vinderola, G., C. Matar and G. Perdigon (2005). "Role of intestinal epithelial cells in
immune effects mediated by gram-positive probiotic bacteria: involvement of toll-
like receptors." Clin Diagn Lab Immunol 12(9): 1075-1084.
246
Vinderola, G., C. Matar and G. Perdigon (2007). "Milk fermentation products of L.
helveticus R389 activate calcineurin as a signal to promote gut mucosal immunity."
BMC Immunol 8: 19.
von Boehmer, H. (2005). "Mechanisms of suppression by suppressor T cells." Nat
Immunol 6(4): 338-344.
Waite, J. C. and D. Skokos (2012). "Th17 response and inflammatory autoimmune
diseases." Int J Inflam 2012: 819467.
Wakabayashi, H., C. Nariai, F. Takemura, W. Nakao and D. Fujiwara (2008).
"Dietary supplementation with lactic acid bacteria attenuates the development of
atopic-dermatitis-like skin lesions in NC/Nga mice in a strain-dependent manner." Int
Arch Allergy Immunol 145(2): 141-151.
Wakim, L. M. and M. J. Bevan (2011). "Cross-dressed dendritic cells drive memory
CD8+ T-cell activation after viral infection." Nature 471(7340): 629-632.
Walker, L. S., A. Chodos, M. Eggena, H. Dooms and A. K. Abbas (2003). "Antigen-
dependent proliferation of CD4+ CD25+ regulatory T cells in vivo." J Exp Med
198(2): 249-258.
Wan, Y. Y. and R. A. Flavell (2007). "Regulatory T-cell functions are subverted and
converted owing to attenuated Foxp3 expression." Nature 445(7129): 766-770.
Wang, Y., J. Xie, N. Wang, Y. Li, X. Sun, Y. Zhang and H. Zhang (2013).
"Lactobacillus casei Zhang modulate cytokine and toll-like receptor expression and
beneficially regulate poly I:C-induced immune responses in RAW264.7
macrophages." Microbiol Immunol 57(1): 54-62.
Watanabe, N. and H. Nakajima (2012). "Coinhibitory molecules in autoimmune
diseases." Clin Dev Immunol 2012: 269756.
Weaver, C. T., C. O. Elson, L. A. Fouser and J. K. Kolls (2013). "The Th17 pathway
and inflammatory diseases of the intestines, lungs, and skin." Annu Rev Pathol 8:
477-512.
Weaver, C. T., L. E. Harrington, P. R. Mangan, M. Gavrieli and K. M. Murphy
(2006). "Th17: an effector CD4 T cell lineage with regulatory T cell ties." Immunity
24(6): 677-688.
Weise, C., Y. Zhu, D. Ernst, A. A. Kuhl and M. Worm (2011). "Oral administration
of Escherichia coli Nissle 1917 prevents allergen-induced dermatitis in mice." Exp
Dermatol 20(10): 805-809.
Wemmie, J. A., M. P. Price and M. J. Welsh (2006). "Acid-sensing ion channels:
advances, questions and therapeutic opportunities." Trends Neurosci 29(10): 578-586.
Wen, H., J. Ostman, K. J. Bubb, C. Panayiotou, J. V. Priestley, M. D. Baker and A.
Ahluwalia (2012). "20-Hydroxyeicosatetraenoic acid (20-HETE) is a novel activator
of transient receptor potential vanilloid 1 (TRPV1) channel." J Biol Chem 287(17):
13868-13876.
Wentworth, J. M., G. Naselli, W. A. Brown, L. Doyle, B. Phipson, G. K. Smyth, M.
Wabitsch, P. E. O'Brien and L. C. Harrison (2010). "Pro-inflammatory
CD11c+CD206+ adipose tissue macrophages are associated with insulin resistance in
human obesity." Diabetes 59(7): 1648-1656.
Wenus, C., R. Goll, E. B. Loken, A. S. Biong, D. S. Halvorsen and J. Florholmen
(2008). "Prevention of antibiotic-associated diarrhoea by a fermented probiotic milk
drink." Eur J Clin Nutr 62(2): 299-301.
247
Wheeler, J. G., M. L. Bogle, S. J. Shema, M. A. Shirrell, K. C. Stine, A. J. Pittler, A.
W. Burks and R. M. Helm (1997). "Impact of dietary yogurt on immune function."
Am J Med Sci 313(2): 120-123.
Williams, L. M. and A. Y. Rudensky (2007). "Maintenance of the Foxp3-dependent
developmental program in mature regulatory T cells requires continued expression of
Foxp3." Nat Immunol 8(3): 277-284.
Williams, M. A., A. J. Tyznik and M. J. Bevan (2006). "Interleukin-2 signals during
priming are required for secondary expansion of CD8+ memory T cells." Nature
441(7095): 890-893.
Wong, K. L., J. J. Tai, W. C. Wong, H. Han, X. Sem, W. H. Yeap, P. Kourilsky and S.
C. Wong (2011). "Gene expression profiling reveals the defining features of the
classical, intermediate, and nonclassical human monocyte subsets." Blood 118(5):
e16-31.
Wynn, T. A. (2003). "IL-13 effector functions." Annu Rev Immunol 21: 425-456.
Yabu, M., H. Shime, H. Hara, T. Saito, M. Matsumoto, T. Seya, T. Akazawa and N.
Inoue (2011). "IL-23-dependent and -independent enhancement pathways of IL-17A
production by lactic acid." Int Immunol 23(1): 29-41.
Yakushijin, T., T. Kanto, M. Inoue, T. Oze, M. Miyazaki, I. Itose, H. Miyatake, M.
Sakakibara, N. Kuzushita, N. Hiramatsu, T. Takehara, A. Kasahara and N. Hayashi
(2006). "Reduced expression and functional impairment of Toll-like receptor 2 on
dendritic cells in chronic hepatitis C virus infection." Hepatol Res 34(3): 156-162.
Yan, F., H. Cao, T. L. Cover, R. Whitehead, M. K. Washington and D. B. Polk
(2007). "Soluble proteins produced by probiotic bacteria regulate intestinal epithelial
cell survival and growth." Gastroenterology 132(2): 562-575.
Yang, H. Y., S. L. Liu, S. A. Ibrahim, L. Zhao, J. L. Jiang, W. F. Sun and F. Z. Ren
(2009). "Oral administration of live Bifidobacterium substrains isolated from healthy
centenarians enhanced immune function in BALB/c mice." Nutr Res 29(4): 281-289.
Yang, Y. D., L. Zheng, G. C. Lu, Y. G. Chen and M. Salvato (2004). "[Effect of HIV
Tat protein on CCR5 expression in monocytes and infection with monocyte-tropic
HIV strains]." Zhejiang Da Xue Xue Bao Yi Xue Ban 33(6): 532-534, 545.
Yao, Z., W. C. Fanslow, M. F. Seldin, A. M. Rousseau, S. L. Painter, M. R. Comeau,
J. I. Cohen and M. K. Spriggs (1995). "Herpesvirus Saimiri encodes a new cytokine,
IL-17, which binds to a novel cytokine receptor." Immunity 3(6): 811-821.
Yilma, A. N., S. R. Singh, S. J. Fairley, M. A. Taha and V. A. Dennis (2012). "The
Anti-Inflammatory Cytokine, Interleukin-10, Inhibits Inflammatory Mediators in
Human Epithelial Cells and Mouse Macrophages Exposed to Live and UV-
Inactivated Chlamydia trachomatis." Mediators Inflamm 2012: 520174.
Yoshimoto, T. and W. E. Paul (1994). "CD4pos, NK1.1pos T cells promptly produce
interleukin 4 in response to in vivo challenge with anti-CD3." J Exp Med 179(4):
1285-1295.
Yu, B., F. Su, L. Wang, B. Zhao, J. Qin, C. Ma, P. Xu and Y. Ma (2011). "Genome
sequence of Lactobacillus rhamnosus strain CASL, an efficient L-lactic acid producer
from cheap substrate cassava." J Bacteriol 193(24): 7013-7014.
Zelante, T., A. De Luca, C. D'Angelo, S. Moretti and L. Romani (2009). "IL-17/Th17
in anti-fungal immunity: what's new?" Eur J Immunol 39(3): 645-648.
248
Zemann, B., C. Schwaerzler, M. Griot-Wenk, M. Nefzger, P. Mayer, H. Schneider, A.
de Weck, J. M. Carballido and E. Liehl (2003). "Oral administration of specific
antigens to allergy-prone infant dogs induces IL-10 and TGF-beta expression and
prevents allergy in adult life." J Allergy Clin Immunol 111(5): 1069-1075.
Zenewicz, L. A., G. D. Yancopoulos, D. M. Valenzuela, A. J. Murphy, M. Karow and
R. A. Flavell (2007). "Interleukin-22 but not interleukin-17 provides protection to
hepatocytes during acute liver inflammation." Immunity 27(4): 647-659.
Zhang, B., J. An, T. Shimada, S. Liu and K. Maeyama (2012). "Oral administration
of Enterococcus faecalis FK-23 suppresses Th17 cell development and attenuates
allergic airway responses in mice." Int J Mol Med 30(2): 248-254.
Zhang, L. L., X. Chen, P. Y. Zheng, Y. Luo, G. F. Lu, Z. Q. Liu, H. Huang and P. C.
Yang (2010). "Oral Bifidobacterium modulates intestinal immune inflammation in
mice with food allergy." J Gastroenterol Hepatol 25(5): 928-934.
Zhang, Y., X. Wang, M. Zhong, M. Zhang, Q. Suo and K. Lv (2013). "MicroRNA
let-7a ameliorates con A-induced hepatitis by inhibiting IL-6-dependent Th17 cell
differentiation." J Clin Immunol 33(3): 630-639.
Zhao, H. M., X. Y. Huang, Z. Q. Zuo, Q. H. Pan, M. Y. Ao, F. Zhou, H. N. Liu, Z. Y.
Liu and D. Y. Liu (2013). "Probiotics increase T regulatory cells and reduce severity
of experimental colitis in mice." World J Gastroenterol 19(5): 742-749.
Zheng, W., Q. H. Wang, H. Feng, J. Liu, H. R. Meng and Y. M. Cao (2009).
"CD4+CD25+Foxp3+ regulatory T cells prevent the development of Th1 immune
response by inhibition of dendritic cell function during the early stage of Plasmodium
yoelii infection in susceptible BALB/c mice." Folia Parasitol (Praha) 56(4): 242-250.
Zheng, Y., D. M. Danilenko, P. Valdez, I. Kasman, J. Eastham-Anderson, J. Wu and
W. Ouyang (2007). "Interleukin-22, a T(H)17 cytokine, mediates IL-23-induced
dermal inflammation and acanthosis." Nature 445(7128): 648-651.
Zhou, D., J. Mattner, C. Cantu, 3rd, N. Schrantz, N. Yin, Y. Gao, Y. Sagiv, K.
Hudspeth, Y. P. Wu, T. Yamashita, S. Teneberg, D. Wang, R. L. Proia, S. B. Levery,
P. B. Savage, L. Teyton and A. Bendelac (2004). "Lysosomal glycosphingolipid
recognition by NKT cells." Science 306(5702): 1786-1789.
Zhou, L., Ivanov, II, R. Spolski, R. Min, K. Shenderov, T. Egawa, D. E. Levy, W. J.
Leonard and D. R. Littman (2007). "IL-6 programs T(H)-17 cell differentiation by
promoting sequential engagement of the IL-21 and IL-23 pathways." Nat Immunol
8(9): 967-974.
Zhu, J., B. Min, J. Hu-Li, C. J. Watson, A. Grinberg, Q. Wang, N. Killeen, J. F.
Urban, Jr., L. Guo and W. E. Paul (2004). "Conditional deletion of Gata3 shows its
essential function in T(H)1-T(H)2 responses." Nat Immunol 5(11): 1157-1165.
Zhu, J. and W. E. Paul (2008). "CD4 T cells: fates, functions, and faults." Blood
112(5): 1557-1569.
Ziegler-Heitbrock, L. (2007). "The CD14+ CD16+ blood monocytes: their role in
infection and inflammation." J Leukoc Biol 81(3): 584-592.
Zimmermann, H. W., S. Seidler, J. Nattermann, N. Gassler, C. Hellerbrand, A.
Zernecke, J. J. Tischendorf, T. Luedde, R. Weiskirchen, C. Trautwein and F. Tacke
(2010). "Functional contribution of elevated circulating and hepatic non-classical
CD14CD16 monocytes to inflammation and human liver fibrosis." PLoS One 5(6):
e11049.
249
Zitvogel, L., B. Couderc, J. I. Mayordomo, P. D. Robbins, M. T. Lotze and W. J.
Storkus (1996). "IL-12-engineered dendritic cells serve as effective tumor vaccine
adjuvants in vivo." Ann N Y Acad Sci 795: 284-293.
250
Original Publications
Fiona Long Yan Fong, Pirkka Kirjavainen, Otto Mykkänen, Hani El-Nezami.
Effects of single and mixed probiotic strains on mouse cytokine profile.
Gordon Research Conference – Immunochemistry and Immunobiology. Les
Diablerets, Switzerland. 2012. Poster Presentation.
Fiona Long Yan Fong, Pirkka Kirjavainen, Victoria Ho Yee Wong, Hani El-
Nezami. Differential effects of Lactobacillus rhamnosus GG on toll-like
receptor expression of dendritic cells, macrophages and monocytes.
International Yakult Symposium – The Intestinal Microbiota and Probiotics:
Exploiting Their Influence on Health. London, UK. 2013. Poster Presentation.
Victoria Ho Yee Wong, William Chi Shing Tai, Fiona Long Yan Fong, Wing Yan
Wong, Muk Lan Lee, Wendy W.L. Hsiao, Hani Said El-Nezami.
Chemoprevention of intestinal adenomatous polyposis by Lactobacillus
rhamnosus GG in Apcmin/+ mice. International Yakult Symposium – The
Intestinal Microbiota and Probiotics: Exploiting Their Influence on Health.
London, UK. 2013. Poster Presentation.
Fiona Long Yan Fong, Hani El-Nezami, Otto Mykkänen, Pirkka Kirjavainen.
Immunomodulation of probiotic bacteria on systemic immune response of
healthy C57BL/6 mice. (Ready for submission)
251
Fiona Long Yan Fong, Pirkka Kirjavainen, Victoria Ho Yee Wong, Hani El-Nezami.
Immunomodulatory effects of Lactobacillus rhamnosus GG on dendritic cells,
macrophages and monocytes from healthy donors. (Ready for submission)
Fiona Long Yan Fong, Hani El-Nezami, Victoria Ho Yee Wong, Pirkka Kirjavainen.
Soluble factors secreted by Lactobacillus rhamnosus GG modulate healthy
human dendritic cells, macrophages and monocytes. (Ready for submission)
Fiona Long Yan Fong, Pirkka Kirjavainen, Victoria Ho Yee Wong, Hani El-Nezami.
Lactic acid may modulate human immune response. (Ready for submission)
252

Full Text

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Full Text

Uploaded by

Copyright:

Available Formats

Title Immunomodulatory properties of probiotic bacteria

Author(s) Fong, Long-yan; 方朗茵

Fong, L. [方朗茵]. (2013). Immunomodulatory properties of

Issued Date 2013

The author retains all proprietary rights, (such as patent rights)

Fiona Long Yan Fong

at the University of Hong Kong

“Immunomodulatory properties of probiotic bacteria”

Fiona Long Yan Fong

for the degree of Doctor of Philosophy

Probiotics are living microorganisms, which when administered in adequate

diarrhoea, atopic dermatitis and irritable bowel syndrome in disease-specific animal

by general healthy population with limited knowledge in the immunomodulation of

probiotics of local and systemic immune responses in healthy experimental models.

intestine is supposed to be the first organ to encounter probiotics as probiotics are

systemic immune responses in healthy population; and the immunomodulation of

rhamnosus GG (LGG), Lactobacillus rhamnosus LC705 (LC705), Bifidobacterium

breve Bb99 (Bb99), Propionibacterium freudenreichii ssp. shermanii JS (PJS) or

response, suggesting that immune homeostasis was maintained in healthy individuals.

widely studied probiotics. It was hypothesized that LGG exerts immunomodulatory

Cytokine secretion profile, expressions of toll-like receptors (TLRs) and activation-

immunomodulation of probiotics in healthy models, prophylactic efficacy of

probiotics in preventing infections and diseases can be availed.

Fiona Long Yan Fong

“Temporary Binding for Examination Purpose”

at the University of Hong Kong

“Immunomodulatory properties of probiotic bacteria”

Fiona Long Yan Fong

for the degree of Doctor of Philosophy

Probiotics are living microorganisms, which when administered in adequate

diarrhoea, atopic dermatitis and irritable bowel syndrome in disease-specific animal

by general healthy population with limited knowledge in the immunomodulation of

probiotics of local and systemic immune responses in healthy experimental models.

intestine is supposed to be the first organ to encounter probiotics as probiotics are

systemic immune responses in healthy population; and the immunomodulation of

rhamnosus GG (LGG), Lactobacillus rhamnosus LC705 (LC705), Bifidobacterium

breve Bb99 (Bb99), Propionibacterium freudenreichii ssp. shermanii JS (PJS) or

response, suggesting that immune homeostasis was maintained in healthy individuals.

widely studied probiotics. It was hypothesized that LGG exerts immunomodulatory

Cytokine secretion profile, expressions of toll-like receptors (TLRs) and activation-

immunomodulation of probiotics in healthy models, prophylactic efficacy of

probiotics in preventing infections and diseases can be availed.

University of Hong Kong or other institutions for a degree, diploma or other

be possible and accomplished if without their support.

I owe my deepest gratitude to my primary supervisor, Dr. Hani El-Nezami, whose

contribution in stimulating suggestions, advice and encouragement. I would like to

exposure, which absolutely widened my horizon. I am indebted to Dr. Hani El-

excellent atmosphere for doing research.

Kirjavainen, for his advice, continued support and patience. I am so sincerely

thankful to his help in developing and strengthening my background of immunology.

He is always a kind and gracious supervisor, who guides me to think precisely. I

and Toxicology Laboratory in School of Biological Sciences of the University of

invaluable experience exchange and cordiality.

I would like to acknowledge the help of technicians in School of Biological Sciences,

like to thank the laboratory colleagues in the University of Eastern Finland.

taking care of me when I was in Finland.

tolerance, kindness, love and understanding.

Abstract of thesis .......................................................................................................... ii

Table 1. Table of TLR recognition of bacterial components………………………...4

Symbol Meaning Symbol Meaning

°C degree Celsius M molar

g gram mol mole

min minute SD standard deviation

µ micro SEM standard error of the mean