PaperBCMV6 28 18

Page 1 of 53
1 Comprehensive surveys of Bean common mosaic virus and Bean common mosaic necrosis
2 virus and molecular evidence for occurrence of other Phaseolus vulgaris viruses in
3 Tanzania
This paper has been peer reviewed and accepted for publication but has not yet been copyedited or proofread. The final published version may differ.
4 Beatrice Mwaipopo1,2, Susan Nchimbi-Msolla2, Paul J. R. Njau2, Deogratius Mark1, Deusdedith
5 R. Mbanzibwa1
1
6 Disease Control Unit, Mikocheni Agricultural Research Institute, P.O. Box 6226, Dar es
Plant Disease "First Look" paper • http://dx.doi.org/10.1094/PDIS-01-18-0198-RE • posted 05/17/2018
7 Salaam, Tanzania
2
8 Crop Science and Horticulture Department, Sokoine University of Agriculture, P.O. Box 3005,
9 Chuo Kikuu, Morogoro, Tanzania.
10 Corresponding author: D. R. Mbanzibwa; E-mail: mbanzibwad@yahoo.co.uk
11
12 Abstract
13 Virus diseases are among the main biotic factors constraining common bean (Phaseolus
14 vulgaris L.) production in Tanzania. Disease management requires information on types,
15 distribution and incidence, and genetic variation of the causal viruses, which is currently limited.
16 Thus, a countrywide comprehensive survey was conducted. Use of a next generation sequencing
17 technique enabled simultaneous detection of 15 viruses belonging to 11 genera. De novo
18 assembly resulted in many contigs including complete or nearly complete sequences of bean
19 common mosaic virus (BCMV), bean common mosaic necrosis virus (BCMNV) and southern
20 bean mosaic virus (SBMV). Some viruses, for example SBMV and tomato leaf curl Uganda
21 virus-related begomovirus, were detected for the first time in common bean in Tanzania.
Beatrice Mwaipopo Plant Disease 1

Page 2 of 53
22 Visually assessed virus-like disease incidence ranged from 0 to 98% but reverse-transcription
23 PCR-based incidence of BCMV and BCMNV (7,756 samples) was mostly less than 40%. The
24 Sanger-based nucleotide sequences encoding coat proteins of BCMV and BCMNV isolates were
25 90.2 to 100% and 97.1 to 100% identical to each other, respectively. Phylogenetic analysis
26 showed that BCMV isolates were more diverse than BCMNV isolates. The information
27 generated in this study will contribute to the development of molecular diagnostic tools and
28 strategies for management of virus diseases nationally and internationally.
29
30 Tanzania is the largest producer (>1,000,000 tonnes annually) of common bean
31 (Phaseolus vulgaris L.) in sub-Saharan Africa (FAO 2014). Common bean serves as the main
32 source of protein and starch for over 300 million people in East Africa and Latin America (Petry
33 et al. 2015). In some parts of the African Great Lakes region – for example, Kagera Region in
34 Tanzania – a meal served without beans is considered an incomplete diet, which indicates the
35 traditional values attached to it. The annual quantity of bean produced in Tanzania is associated
36 with the large cultivated area rather than high yield per unit area (FAO 2014). In terms of yield,
37 Tanzania is outperformed by several East African countries: Uganda, South Sudan, Madagascar
38 and Ethiopia (FAO 2014). The estimated yield of common bean for Tanzania is <1,000 kg/ha
39 and the potential yield is 1,500 to 3,000 kg/ha (Hillocks et al. 2006; Nchimbi-Msolla 2013).
40 Among other factors, the poor yields are attributed to fungal, bacterial and viral diseases
41 (Hillocks et al. 2006).
42 Many viruses are known to infect and cause diseases in common bean plants and can
43 cause yield losses as high as 100% (Hagedorn and Inglis 1986). Bean common mosaic virus
44 (BCMV) and bean common mosaic necrosis virus (BCMNV) are considered the most important

Page 3 of 53
45 of these viruses (Grogan and Walker 1948). These viruses cause mosaic symptoms on common
46 bean plants but BCMNV also causes systemic vascular necrosis, the disease also known as black
47 root (Drijfhout 1978; Grogan and Walker 1948). At least five viruses – BCMV, BCMNV,
48 cowpea mild mottle virus (CPMMV; Carlavirus), cucumber mosaic virus (CMV; Cucumovirus)
49 and cowpea aphid-borne mosaic virus (CABMV; Potyvirus) – have been detected either using
50 enzyme linked immunosorbent assays (ELISA) or differential cultivars in common bean plant
51 samples collected from different parts of Tanzania (Davis and Hampton 1986; Mink and
52 Keswani 1987; Mwaipopo et al. 2017; Njau and Lyimo 2000; Njau et al. 2006). Recently, using
53 next generation sequencing (NGS), two cryptic dsRNA viruses belonging to the genus
54 Alphaendornavirus – phaseolus vulgaris alphaendornavirus 1 (PvEV-1) and phaseolus vulgaris
55 alphaendornavirus 2 (PvEV-2) – and CPMMV, a disease-causing virus, were detected in seeds
56 collected from farmers in three agricultural research zones of Tanzania (Nordenstedt et al. 2017).
57 In neighboring countries, peanut mottle virus (PeMoV) was detected in common bean samples
58 collected from Zambia, and bean yellow mosaic virus from Kenya (Vetten and Allen 1991).
59 Overall, this information suggests that common bean plants in East Africa are infected by many
60 viruses.
61 There have been no comprehensive surveys of common bean virus diseases in Tanzania
62 for the past 18 years. BCMNV and BCMV are perhaps the only viruses in Tanzania that have
63 been surveyed adequately. Njau and Lyimo (2000) collected seeds from farmers and research
64 centers and showed that the highest incidences of BCMNV and BCMV were 36.6% and 12.4%,
65 respectively. Vetten and Allen (1991) found that common bean samples collected from East
66 Africa were mostly infected with BCMNV: in Tanzania, 23 out of 60 samples were infected with
67 BCMNV, five samples were infected with BCMV and two samples were co-infected. In a

Page 4 of 53
68 different survey conducted in the 1990s, BCMNV incidence was low in southern but high in
69 northern Tanzania; these geographical differences were associated with the vector population
70 (Myers et al. 2000). Since then, distribution and incidence of common bean viruses have not
71 been comprehensively studied.
72 Common bean is grown in many geographically isolated parts of the country and
73 consequently genetically distinct known and unknown viruses may occur. Molecular and
74 biological information are required for determining genetic diversities of plant viruses, which
75 then helps in developing diagnostic tools and predicting emergence of new strains or viruses.
76 Furthermore, information on distribution and types of viruses that infect common bean is
77 required for strategic breeding and deployment of planting material, as well as for guiding
78 decision-making on imposing quarantine. In past research, ELISA was used to detect viruses in
79 Tanzania (Mwaipopo et al. 2017; Njau and Lyimo 2000); unfortunately, a given antibody can
80 only be used to detect a single virus or a group of very closely related viruses. Thus, many plant
81 samples may test negative despite showing typical virus disease symptoms. NGS and Sanger
82 sequencing techniques were employed to universally and simultaneously detect viruses in
83 common bean plant samples collected during the first comprehensive countrywide survey. NGS
84 is presently the most robust technique for detection of viruses and has unique power to
85 universally detect viruses of all types, thus overcoming limitations of other plant pathogen
86 detection methods (Boonham et al. 2013; Kehoe et al. 2014; Kreuze et al. 2009). Prior to this
87 work, only one nucleotide sequence of a BCMNV isolate originating from Tanzania was
88 available in GenBank (Larsen et al. 2011; Accession no. HQ229995) and there were none for
89 any other common bean viruses (Mwaipopo et al. 2017).

Page 5 of 53
90 The objectives of this work were to: (1) determine the distribution and incidence of
91 virus-like disease symptoms; (2) map the distribution of BCMV and BCMNV – the most
92 commonly reported viruses from Tanzania; (3) universally detect viruses that infect common
93 bean in Tanzania; and (4) generate molecular information for genetic diversity studies and
94 development of diagnostic tools.
95 Materials and Methods

96 Survey areas and field selection. Surveys were carried out in 23 administrative districts
97 (herein called districts) in five national agricultural research zones (herein called agricultural
98 research zones) in Tanzania. These 23 districts are found in 12 administrative regions, which
99 border eight countries (Fig. 1). In each district, 4 to 15 common bean fields, located near main or
100 feeder roads were randomly selected for sample collection and visual assessment of virus-like
101 disease incidence. The distance between sampled fields was a few hundred meters to ten
102 kilometers or more depending on the availability of common bean fields. A geographical
103 positioning system (GPS 72H; Garmin, Taiwan) was used to record coordinates for all surveyed
104 fields. The maps of surveyed areas were then generated from the coordinates using Quantum GIS
105 (v. 2.6) available at http://qgis.osgeo.org/en/site/.
106 Sample collection and visual assessment of virus-like disease incidence. In each
107 selected common bean field, virus disease incidence was visually assessed by observations on 50
108 randomly selected plants. Five points were randomly chosen in each field and observations of
109 virus-like disease symptoms were made on 10 plants at each point. The plants were scored as
110 either diseased or not, and symptoms were recorded in a field disease survey sheet. The
111 incidence for virus-like disease symptoms was then computed as the percentage of plants
112 exhibiting symptoms (i.e., by dividing the number of plants with symptoms per field by the total

Page 6 of 53
113 number of plants on which observations were made). Overall disease symptom incidence for
114 each district was calculated by dividing the total number of plants with symptoms by the total
115 number of plants on which observations were made in that particular district.
116 RT-PCR based determination of BCMNV and BCMV incidence. From each surveyed
117 field, a total of 30 leaf samples (except in the western zone where only 10 to 13 samples were
118 collected per field) were randomly collected from 30 different plants, randomly selected from
119 among the 50 common bean plants on which symptoms were observed. The collected leaf
120 samples were placed in sampling bags containing silica gel. Another sample from the same plants
121 was placed between two flip-chart paper sheets and pressed using a plant press and stored at
122 room temperature until use. A total of 7,756 common bean leaf samples were collected from 279
123 fields and brought to the laboratory at the Mikocheni Agricultural Research Institute (MARI).
124 RNA was extracted from each sample as explained below. Then, reverse-transcription (RT)-PCR
125 was performed. RT-PCR-based incidence was calculated as the percentage of plants singly
126 infected with BCMNV and BCMV. All plants infected with each virus were summed up to
127 calculate incidence for each virus in each district. Samples infected with both viruses were
128 recorded after determining individually infected samples. In each district, prevalence for BCMV
129 and BCMNV was recorded as the percentage of fields with infected plants.
130 RNA extraction. RNA was extracted from either silica gel desiccated or plant-press
131 pressed dry common bean leaf samples using a modified CTAB method. The CTAB buffers
132 contained 2% CTAB, 100 mM Tris–HCl, 20 mM EDTA, 2.5 M NaCl, freshly prepared 1%
133 sodium sulfite, 2% PVP and 2.5% 2-mercaptoethanol in nuclease-free water. Other procedures
134 were as reported recently for RNA extracted at MARI (Nordenstedt et al. 2017). The integrity of
135 RNA in the samples was assessed visually by agarose gel electrophoresis after staining the gel

Page 7 of 53
136 with ethidium bromide. RNA concentration and purity were determined with a Nanodrop 2000c
137 UV–vis spectrophotometer (Thermo Scientific, Wilmington, DE, USA).
138 Complementary DNA synthesis. The first-strand complementary DNA (cDNA)

139 synthesis was done using Moloney Murine Leukemia Virus Reverse Transcriptase (M-MuLV;
140 #M0253; New England Biolabs (NEB; Ipswich, MA, USA) following a modified manufacturer’s
141 protocol. The first mix contained 1 µg of RNA, 1 µl of 100 µM oligo (dT)18 or random hexamer
142 (Bioneer, Seoul, South Korea), 1 µl of dNTPs and diethyl pyrocarbonate-treated water to a
143 volume of 10 µl. The mixture was heated at 65°C for 5 min and spun down after chilling on ice
144 for 2 min. The second master mix was prepared according to NEB’s standard protocol. Total
145 volume for cDNA synthesis reaction was 20 µl. Random hexamer and oligo dT18–21 primed
146 reactions were incubated at 37 and 42°C, respectively, for 90 min, and enzymes were inactivated
147 at 65°C for 20 min. For determination of virus incidence, equal amounts of RNA extracted from
148 five plants collected from the same field were pooled prior to cDNA synthesis. The pools that
149 tested positive were marked and previous plant RNA samples were retrieved and tested
150 individually by RT-PCR to identify the infected plant samples.
151 PCR. To determine incidences of BCMV and BCMNV, PCR reactions were run using
152 different pairs of primers (Table 1). These primers were initially designed using sequences of
153 BCMNV and BCMV retrieved from GenBank and later using some sequences obtained in this
154 study. A high fidelity Phusion DNA polymerase (#M0530S; NEB) was used when PCR was run
155 to generate PCR products for Sanger sequencing and AccuPower® PCR PreMix (K-2036;
156 Bioneer) was used for routine detection of BCMV and BCMNV in samples. For Phusion DNA
157 polymerase, the 50-µl PCR reaction contained 10 µl of 5× Phusion GC buffer, 1 µl of dNTPs (10
158 mM), 2 µl of each forward and reverse primer (10 µM), 0.5 µl of Phusion DNA polymerase (2

Page 8 of 53
159 U/µl) and 5 µl of cDNA template. The primer pairs used to amplify BCMV and BCMNV for
160 sequencing were BCMVFcpF1/BCM-NVcommonR or BCMVFcpF1/BCMVFcpR1 and
161 BCMNVFcpF2/BCM-NVcommonR or BCMNVF1/BCMNVR1, respectively (Table 1). The

162 PCR program was the same for the four pairs of primers; initial denaturation was at 98°C for 30
163 s, followed by 32 cycles at 98°C for 5 s, 57°C for 20 s and 72°C for 30 s. Final extension was at
164 72°C for 10 min. Two primer pairs (533-340F1/533-340R1 and 533-139F1/533-139R) were
165 designed to amplify BCMV in order to compare sequences obtained by NGS and Sanger
166 sequencing data for isolate TZ:Mor533:2017. These primers annealed at 60°C. The primer pair
167 ToLCUV-F1/ToLCUV-R1 was used to detect a begomo-like virus in common bean samples
168 (Table 1). The PCR reaction for this primer pair contained forward and reverse primers, dNTPs
169 and Phusion DNA polymerase at the concentrations shown for other primer pairs when Phusion
170 DNA polymerase was used. The DNA template used was 25 ng per PCR reaction. The initial
171 denaturing was done at 98°C for 30 s followed by 35 cycles of amplification with denaturation at
172 98°C for 5 s, annealing at 56°C for 30 s and extension at 72°C for 30 s. The final extension was
173 done at 72°C for 10 min.
174 AccuPower® PCR PreMix was used in routine detection of BCMNV and BCMV and
175 determination of incidence using primer pairs BCMNVF1/BCMNVR1 and BCMV1F/BCMV1R,
176 respectively. To a 0.2-ml tube containing AccuPower® PCR PreMix, 15 µl of diethyl
177 pyrocarbonate-treated water, 1 µl of each of the forward and reverse primers (10 µM) and 3 µl of
178 cDNA template were added to make a total volume of 20 µl. For both pairs of primers, the PCR
179 program was as follows: initial denaturation was for 2 min at 94°C, followed by 35 cycles at
180 94°C for 25 s, 50°C for 30 s and 72°C for 1 min (primer pair BCMNVF1/BCMNVR1) or 30 s
181 (primer pair BCMV1F/BCMV1R) and finally extended at 72°C for 10 min. The PCR products

Page 9 of 53
182 were run in a 1% agarose gel stained with ethidium bromide. Gel images were captured using a
183 Benchtop UV Transilluminator (UVP; Upland, CA, USA) under UV light. Gel images were used
184 to score for infection status, and BCMV and BCMNV incidences were calculated as percentages
185 of samples infected with each virus, with the sampling domain being first a field and then a
186 district (Sseruwagi et al. 2004).
187 Sequencing of PCR products. PCR products were sequenced at three different facilities:
188 Haartman Institute (Finland), Mbeya Zonal Referral Hospital Laboratory (Tanzania) and
189 Bioneer. PCR products were purified using PCR purification kits (Bioneer) or treated with
190 exonuclease I and calf intestinal alkaline phosphatase (NEB) following the enzyme
191 manufacturers’ instructions, and then sequenced on both strands.
192 Sequencing of small RNAs and data analysis. Equal amounts (7 µg) of total RNA
193 extracted from 30 plants from each of the five zones were separately pooled to make six (two
194 samples for the Lake zone) zonal pooled RNA samples: HXH-1 (southern highlands zone),
195 HXH-2 (eastern zone), HXH-3 (northern zone), HXH-6 (also contained RNA from cassava
196 plants) and HXH-7 (Lake zone), and HXH-15 (western zone). Moreover, there were two non-
197 pooled RNA samples (HXH-4 and HXH-5), and the HXH-4 sample also contained RNA
198 extracted from cassava, a subject for another study. The 30 leaf samples from which RNA was
199 extracted for NGS were selected based on severity or uniqueness of disease symptoms observed
200 on common bean plants in fields but for each pool it was ensured that at least a sixth of the
201 samples were from asymptomatic plants. For sequencing, total RNA was shipped on dry ice to
202 Fasteris SA in Switzerland. Then the small RNAs were isolated (acrylamide gel size selection)
203 and cDNA libraries were prepared and sequenced using Illumina HiSeq 2500 (Illumina Inc., San
204 Diego, CA, USA) as described previously (Mbanzibwa et al. 2014; Nordenstedt et al. 2017).

Page 10 of 53
205 Analysis of NGS data was done using the VirusDetect program (v.1.6 and v.1.7; Zheng et al.
206 2017) on a supercomputer (https://www.csc.fi; Finland) accessed between January 2016 and
207 October 2017. The files received from Fasteris SA were unzipped using the command ‘tar -vxf
208 filename’. Then, all reads of sizes not within 21 to 24 nucleotides (nt) were deleted. The
209 remaining reads were analyzed using two approaches: de novo assembly was first done on each
210 read size separately, and later the inserts for these four sizes were combined (for simplicity
211 herein called ‘combined inserts’) using the command ‘cat *.fastq >filename.fastq’ to obtain one
212 fastq file and assembled using the command ‘virus_detect.pl *.fastq’ (for offline analysis the
213 command was ‘perl virus_detect.pl filename’). Offline analysis on desktop/laptop computers
214 (random access memory of 8 GB; installed with virtual Linux machine) using VirusDetect v.1.6
215 was possible for ‘not combined’ reads but failed for some combined inserts (i.e., inserts of sizes
216 21 to 24 nt as a single fastq file). The contigs obtained were inspected for open reading frames
217 using the Expasy-translate tool (http://www.expasy.org/). To obtain and manually edit longer
218 nucleotide sequences, contigs obtained by analyzing inserts of sizes 21 or 22 nt were aligned
219 against identical contigs obtained through analysis of combined inserts. For the non-pooled
220 sample HXH-4 (isolate TZ:Mor533:2015), the contigs that mapped to the same reference
221 sequence or to too-closely related virus sequences were assembled using the SeqMan program
222 (v.5.03) (DNASTAR, Madison, WI, USA) and cross-checked using Sanger sequencing.
223 NGS raw data received from Fasteris SA was submitted at Zenodo and assigned DOI
224 10.5281/zenodo.841170. Sanger and NGS sequences were submitted to GenBank and inserts of
225 sizes 21 to 24 nt were submitted to the European Nucleotides Archive. Accessions are shown in
226 Supplementary Table S1.

Page 11 of 53
227 Sequence analysis. Phylogenetic analysis was achieved using MEGA7 software (Kumar
228 et al. 2016). The coat protein (CP)-encoding nucleotide sequences of BCMV and BCMNV were
229 first aligned using the MUSCLE program (Edgar 2004) and trimmed to equal size (620 nt).
230 Then, the evolutionary history was inferred using the Maximum Likelihood method based on the
231 Tamura–Nei model (Tamura and Nei 1993). The tree with the highest log-likelihood was used.
232 Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and
233 BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite
234 Likelihood approach, and then selecting the topology with superior log-likelihood value.
235 Nucleotide and amino acid sequence identities were determined using the BioEdit
236 Sequence Alignment Editor (Hall 1999). Translation of nucleotide sequences into protein
237 sequences was achieved using the ‘translate’ option in MEGA7. Putative cleavage sites in
238 Potyviral sequences were predicted as described by Adams et al. (2005); for other viruses,
239 comparisons were made to previously annotated sequences.
240 Results
241 Virus disease symptoms on plants in fields. Virus and virus-like disease symptoms
242 were observed on common bean plants in fields across the country. The symptoms included vein
243 banding (green and yellow), vein clearing, leaf distortion, puckering and rugosity, mosaic,
244 upward and downward leaf curl, stunted growth, purpling, mild to conspicuous yellow
245 spots/patches, mottling, and necrosis on leaves (Fig. 2). These disease symptoms were observed
246 in the five agricultural research zones, but severe necrosis on leaves was most common in
247 Kilimanjaro Region of the northern zone. Vein clearing was most common on leaves in the
248 Kigoma Region of the western zone.

Page 12 of 53
249 Visual incidence of virus and virus-like disease symptoms. The incidence of virus and
250 virus-like disease symptoms was assessed visually on 50 plants per common bean field.
251 Incidence was in the range of 0 to 86%, 6 to 76%, 0 to 94%, 4 to 98%, and 0 to 80% in the
252 southern highlands, eastern, northern, Lake and western zones, respectively (Table 2). When
253 incidence was calculated at a district level (i.e., dividing total number of diseased plants by total
254 number of examined plants in each district), the range was 11.0 to 43.1%: the extremes in this
255 range for incidence were in Tarime (Lake zone) and Mvomero (eastern zone) districts,
256 respectively. There were no plants with virus disease symptoms in 46.7% of assessed fields in
257 the western zone (data not shown). In the northern zone, there was only one field with 0% virus
258 disease symptoms incidence, and in the southern highlands zone there were five fields with no
259 observable virus disease symptoms (6.2%). In the eastern and Lake zones, virus disease
260 symptoms were observed in all common bean fields.
261 RT-PCR based incidence and prevalence of BCMNV and BCMV. At field level, RT-
262 PCR of 7,756 common bean samples from the five agricultural research zones revealed virus
263 incidence in the range of 0 to 76.7% for BCMNV and 0 to 36.7% for BCMV (Table 2 and
264 Supplementary Fig. S1). The field with the highest incidence (76.7%) of BCMNV was in Gairo
265 District in the eastern zone. Three fields had the highest BCMV incidence (36.7%), in three
266 different districts: Mvomero, Lushoto and Tarime, in the eastern, northern and Lake zones,
267 respectively. Only 1 sample out of 316 leaf samples collected from Kigoma Region – on the
268 border with Burundi – was infected with BCMNV, and none were infected with BCMV.
269 Of the 248 fields surveyed in the eastern, northern, southern highlands and Lake zones, 7
270 and 6 fields had no plants infected by BCMNV and BCMV, respectively. In both cases, three of
271 the seven BCMNV and four of the six BCMV fields were in the southern highlands zone. Other

Page 13 of 53
272 fields without infected plants were in Ngara, Karagwe, Muleba and Biharamulo districts in
273 Kagera Region of the Lake zone (BCMNV), and Morogoro Rural in the eastern zone and Muleba
274 district in the Lake zone (BCMV). The infected plants were mainly found concentrated in a few
275 areas in fields.
276 Co-infections of BCMNV and BCMNV were rare. Most plants with co-infections were
277 from Siha district in the northern zone, in which four common bean plants from the same field
278 were co-infected. In the same zone but in Arumeru district, only one plant was co-infected. In the
279 eastern zone, only two plants from two different common bean fields were co-infected. No
280 BCMV and BCMNV co-infections were detected for samples from the western, Lake and
281 southern highlands zones.
282 Viruses detected by NGS. RNA extracted from common bean samples was pooled
283 separately for each zone and sent for sequencing at Fasteris SA. Briefly, 30 RNA samples from
284 30 different symptomatic and non-symptomatic plants were pooled to make a sample for each
285 zone (except that two pools were made for the Lake zone). In total, RNA from 180 individual
286 symptomatic and asymptomatic plants was sequenced by targeting virus-derived small RNAs of
287 sizes 21 to 24 nt, which are generated along with genomic small RNAs during plant defense
288 (Baulcombe 2004; Kreuze et al. 2009; Mlotshwa et al. 2008). Deep sequencing of the small
289 RNAs resulted in 5.87, 6.67, 5.28, 11.66, 7.99 and 28.22 million reads of sizes 21 to 24 nt for
290 samples HXH-1, HXH-2, HXH-3, HXH-6, HXH-7 and HXH-15, respectively (Table 3). Of
291 these, 80,846 (HXH-7) to 3,793,494 (HXH-15) reads were aligned to the reference virus
292 sequence database.
293 Blastn and Blastx revealed viruses belonging to 11 genera: Potyvirus (Potyviridae),
294 Sobemovirus (unassigned), Alphaendornavirus (Endornaviridae), Carlavirus (Betaflexiviridae),

Page 14 of 53
295 Cucumovirus (Bromoviridae), Umbravirus (Tombusviridae), Crinivirus (Closteroviridae),
296 Begomovirus (Geminiviridae), Cytorhabdovirus (Rhabdoviridae), and Caulimovirus and
297 Soymovirus (Caulimoviridae) (Supplementary Fig. S2). The Blast searches using contig
298 sequences obtained in this study matched sequences of over 32 viruses in the database. The
299 coverage, sequencing depth and number of contigs for these viruses were different
300 (Supplementary Table S2). The sequencing depths ranged from 5.2x for bean yellow disorder
301 virus (BnYDV; Crinivirus) in sample HXH-3 to 5,632x for SBMV in sample HXH-15. Some
302 contig sequences obtained through de novo assembly were related to more than one virus in the
303 sequence database (e.g., an umbravirus in sample HXH-2); the most likely viruses infecting
304 plants whose RNA was included in the sequenced samples are shown in Table 3. Therefore, the
305 NGS contigs revealed that common bean plants in Tanzania were infected by 15 viruses (Table
306 3).
307 The commonest viruses in samples were BCMNV, PvEV-1 and PvEV-2, which were
308 detected in samples from at least three agricultural research zones (Table 3). BCMNV was
309 detected in samples from all five agricultural research zones. PvEV-1 and PvEV-2 were detected
310 in pooled RNA samples HXH-1 (southern highlands zone), HXH-2 (eastern zone) and HXH-6
311 and HXH-7 (Lake zone). PvEV-1 but not PvEV-2 was detected in the pooled RNA sample from
312 the western zone (HXH-15). Neither PvEV-1 nor PvEV-2 was detected in sample HXH-3
313 (northern zone). BCMV, widely reported to infect common bean worldwide, was detected in
314 samples from the eastern (HXH-2) and northern (HXH-3) zones but not from the southern
315 highlands (HXH-1), Lake (HXH-6 and HXH-7) and western zones.
316 Other viruses detected were CPMMV (HXH-2 and HXH-3), PeMoV (HXH-1, Accession
317 nos. MF784805 and MF784806), SBMV (HXH-1, Accession nos. MF784807 and MF784807;

Page 15 of 53
318 and HXH-15, Accession no. MG344643), CABMV (HXH-6), BnYDV (HXH-3), CMV (HXH-
319 2), unidentified umbravirus closely related to carrot mottle mimic virus (CMoMV), carrot mottle
320 virus (CMoV), opium poppy mosaic virus (OPMV), Ethiopian tobacco bushy top virus (ETBTV)
321 and tobacco bushy top virus (TBTV) (HXH-2), tobacco mottle virus (TMoV) (HXH-7), northern
322 cereal mosaic virus (NCMV) (HXH-3), and a caulimovirus most closely related to strawberry
323 vein banding virus (SVBV) and other caulimoviruses (HXH-7; Table 3). A sequence with some
324 similarity to begomoviruses (tomato leaf curl Uganda virus; ToLCUV) was found in sample
325 HXH-6. Further PCR and Sanger sequencing work confirmed that ToLCUV-related
326 begomovirus was found in only one common bean sample.
327 NGS sequences of BCMNV. De novo assembly of NGS data generated complete or
328 nearly complete genomes for BCMNV. In the pooled RNA sample HXH-1, a contig of 9.6-kb
329 (insert size 21; Accession no. MF078483) was obtained. Alignment against the complete
330 sequence of strain TN1 (Accession no. KY659306) showed it to be a complete sequence and that
331 the two sequences were 99% similar at both nucleotide and amino acid sequence levels. In the
332 pooled RNA sample HXH-2, the contig obtained from reads of size 22 nt (9.2-kb; Accession no.
333 MF405187) was closely related to a published sequence of BCMNV isolate 1755b (Accession
334 no. KY659305). This contig sequence translated to yield a partial first potyviral protein (P1) and
335 the other nine typical potyviral proteins (Adams et al. 2005). In the samples collected from
336 Tarime (pooled RNA sample HXH-6), a 9.4-kb sequence (Accession no. MF405189) was
337 obtained. It was closely related (99% similar at nucleotide level) to isolate 1755b (Feng et al.
338 2017; Accession no. KY659305; pathogenic group VI) and also strain TN1 (Accession no.
339 HQ229995; 99% similarity at nucleotide level). In a non-pooled RNA sample (HXH-5), a 9.3-kb
340 sequence (Accession no. MF405192) was obtained and found to be closely related to published

Page 16 of 53
341 isolate 1755b (Accession no. KY659305). Thus, in all common bean growing areas in Tanzania,
342 the NGS-based sequences of BCMNV isolates were closely related to the sequences of a strain in
343 pathogenic group VI (Feng et al. 2017). Comparison of these four sequences revealed they were
344 98.3 to 99.0% and 99.2 to 99.7% identical at nucleotide (9,248 nt, including 3′UTR) and amino
345 acid (3,001 aa) levels, respectively, suggesting low sequence variability within BCMNV isolates
346 in Tanzania.
347 NGS sequences of BCMV. De novo assembly of NGS data generated a sequence of
348 10,051 nt (excluding poly-A tail) for pooled RNA sample HXH-2 (eastern zone). This sequence
349 (combined inserts; Accession no. MF405191) was 99% similar to that of strain NL-1 (Accession
350 no. AY112735). In another pooled RNA sample HXH-3, a 7.1-kb contig was obtained
351 (Accession no. MF405188) and was closely related to sequence of strain NL-1 (Accession no.
352 AY112735).
353 In a non-pooled RNA sample (HXH-4), a complete sequence of BCMV (10,003 nt;
354 isolate TZ:Mor533:2015; Accession no. MF405190) was obtained by aligning contigs obtained
355 by de novo assembly of read size 21 nt and combined inserts using SeqMan v. 5.03. NCBI Blast
356 showed it was 92% similar to isolate RU1 (Accession no. GQ219793; Naderpour et al. 2009),
357 which is a revised sequence of a recombinant isolate originally sequenced by Larsen et al. (2005)
358 (Accession no. AY864314). Because this NGS-based sequence was obtained by assembling
359 several contigs, we designed three pairs of primers to target the Potyviral P3, CI and CP genomic
360 regions – RT-PCR and sequencing confirmed that the NGS sequence was identical in
361 corresponding regions of three Sanger-based sequences of this isolate: MF784802, MF784803
362 and MF784804. These Sanger sequences were <95.5% similar to Potyviral sequences in

Page 17 of 53
363 GenBank. One common bean plant infected with TZ:Mor533:2015 isolate had severe necrotic
364 symptoms on leaves.
365 CP sequence variability of BCMNV and BCMV. Sanger sequencing was used to
366 generate 31 partial CP-encoding sequences of BCMNV (12) and BCMV (19). These sequences
367 were used to generate a phylogenetic tree for BCMNV and BCMV isolates. Phylogenetic
368 analysis of these sequences (size 620 nt) at the conserved 3′-end resulted in two groups of virus
369 species: BCMV and BCMNV (Fig. 3). Furthermore, the BCMV group consisted of three sub-
370 clusters. Considering only Tanzanian isolates, one sub-cluster consisted of 15 isolates and the
371 other two consisted of 3 (TZ:KRG2-7:2015, TZ:MSY1-1:2015 and unknown) and a single
372 (TZ:Mor533:2015) isolate from Tanzania. The isolates of strain NL-1 were predominant. Isolates
373 TZ:KRG2-7:2015 and TZ:MSY1-1:2015, which clustered with the Russian strain (Accession no.
374 KF919297; Feng et al. 2014), were collected from the Lake zone. The nucleotide sequences (782
375 nt) of the 19 BCMV isolates were 90.2 to 100% similar to each other (Table 4A). The same
376 sequences were 91.9 to 100% similar at the amino acid level. The CP sequence of isolate
377 TZ:Mor533:2015 was 90.2 to 91.1% similar to sequences of all other isolates. For the amino acid
378 sequences, this isolate was closely related to the RU1-like isolate TZ:KRG2-7:2015 collected
379 from the Lake zone. The analysis of CP-encoding sequences of BCMNV (626 nt; starting at
380 position 78 with reference to the sequence of isolate TZ:MSY15-1:2015; Accession no.
381 MF066261) showed genetic variation ranging within 97.1 to 100% and 99.0 to 100% at
382 nucleotide and amino acid levels, respectively (Table 4B).
383 Discussion
384 We detected 15 viruses belonging to 11 genera in the common bean samples collected
385 from all over Tanzania. They included viruses reported in previous surveys of common bean

Page 18 of 53
386 virus diseases in the country – BCMNV, BCMV, CMV and CPMMV (Mink and Keswani 1987;
387 Njau and Lyimo 2000; Njau et al. 2006; Vetten and Allen 1991) – and the most recently reported
388 seedborne, cryptic viruses, PvEV-1 and PvEV-2 (Nordenstedt et al. 2017). Other viruses detected
389 have been reported to infect plants other than common bean in Tanzania: CABMV (Potyvirus) in
390 cowpea (Vigna unguiculata (L.) Walp) (Patel and Kuwite 1982) and CMV in cucurbits
391 (Sydänmetsä and Mbanzibwa 2016). There are no documented occurrences in Tanzania of some
392 detected viruses, including SBMV, umbraviruses (ToMV and CMoMV) and ToLCUV-related
393 begomovirus. Begomoviruses have been reported to infect common bean in Latin America, and
394 viruses that infect tomato can also infect common bean (Macedo et al. 2017) but not in Africa.
395 Previously, the use of ELISA assays had limited our knowledge of viruses infecting common
396 bean in Tanzania and did not generate molecular evidence to confirm occurrence of specific
397 viruses (Mwaipopo et al. 2017). The use of NGS not only helped reveal viruses infecting
398 common bean in Tanzania but also generated much needed molecular information for
399 development of diagnostic tools for virus disease management. Indeed, primers developed and
400 used in this work are being used in other studies.
401 Discovery of viruses through de novo assembly of NGS data requires that a database
402 contains previously submitted sequences that are related to the query contig sequences. In this
403 study, some detected viruses could only be identified to the genus level because of low identities.
404 In some instances, a certain contig matched more than one virus sequence in the database. When
405 a contig matches more than one virus in a database with low coverages and similarities, it
406 indicates that it is only related to those viruses and that it could be a sequence of a different virus
407 or strain. Therefore, some identified viruses may not be exactly the same as those infecting
408 common beans in Tanzania but closely or distantly related viruses or strains and for which

Page 19 of 53
409 sequences have not been deposited in sequence databases. Examples from our study include an
410 umbravirus (pooled RNA sample HXH-2) and a caulimovirus (pooled RNA sample HXH-7).
411 Moreover, it is worth noting that small RNAs were extracted from samples stored in silica gel or
412 dried using a plant press. We are unaware of previous work that used samples stored under
413 similar conditions but it is reasonable that the use of dry leaf samples could affect the amount of
414 small RNAs extracted and thus the coverage and viruses detected. However, in this study it was
415 possible to obtain complete or nearly complete nucleotide sequences from some of these
416 samples.
417 NGS technology is still in its infancy, and the possibility of sequencing errors and further
418 problems is expected during de novo assembly of reads. There are concerns that sequences
419 derived from pools of plant material can be chimeras artificially assembled from pieces of
420 multiple viruses (Roossinck et al. 2015; Simmonds et al. 2017). We cannot discount this
421 possibility; however, some sequences obtained in this study were over 99% identical to Sanger
422 sequences in nucleotide databases. Moreover, for one isolate (TZ:Mor533:2015), the three
423 randomly selected genomic regions that were Sanger sequenced were identical to the NGS-based
424 sequence. Additionally, primers designed using NGS sequences worked perfectly for specific
425 detection of viruses e.g. CPMMV, SBMV and ToLCUV-related begomovirus.
426 De novo assembly for detection of plant viruses is normally done on reads of sizes 21 to
427 24 nt contained in one fastq file. In the present study, combined and separate read sizes (21 to 24
428 nt) were analyzed. The viruses detected following analysis of combined inserts or separate reads
429 of sizes 21 to 24 nt were the same (especially for sizes 21 and 22 nt) but the contigs obtained
430 differed in size. Interestingly, when the contigs overlapped they were identical to each other.
431 Although not a subject of this work, it is noteworthy that SBMV was still reliably detectable in

Page 20 of 53
432 reads of size >25 nt but not >35 nt. Analyzing sequences first as combined reads and then
433 separately enabled the obtaining of two sequences for alignment and manual editing.
434 Furthermore, it took less time to assemble sequences and less computational capability was
435 required when reads of different sizes were analyzed separately. This is particularly important in
436 developing countries where supercomputers are generally lacking (Mwaipopo et al. 2017).
437 Previously BCMV and BCMNV were the most commonly reported viruses of common
438 bean in Tanzania (e.g., Njau and Lyimo, 2000; Myers et al. 2000). Thus, it was reasonable to
439 focus on determining their distribution in the country and incidence in common bean fields.
440 Whereas visual assessment indicated the incidence of virus diseases could be as high as 98%,
441 RT-PCR based assessment revealed the incidence of diseases caused by BCMNV and BCMV in
442 the range of 0.0 to 76.7% and 0.0 to 36.7%, respectively. These viruses were more abundant in
443 samples collected from the eastern and northern zones than from the Lake, western and southern
444 highlands zones. The districts Wanging’ombe, Mbinga and Namtumbo in the southern highlands
445 were nearly free of BCMNV and BCMV. Myers et al. (2000) found low incidence of BCMNV in
446 southern Tanzania, which they attributed to low vector population densities due to the high
447 altitudes of these areas. Data obtained in this study suggested mixed infections between BCMNV
448 and BCMV were rare in Tanzania, in agreement with previous observations; however, co-
449 infections can be high elsewhere (Vetten and Allen 1991). In Mexico, Chiquito-Almanza et al.
450 (2017) found a 7% mixed infection in common bean samples collected from fields. In all
451 agricultural research zones in the current study, visual assessment suggested that virus diseases
452 were commonplace in common bean fields.
453 The observed differences in visually assessed and RT-PCR-based incidence levels can be
454 explained by occurrence of pathogenic viruses other than BCMNV and BCMNV as revealed by

Page 21 of 53
455 NGS data. Findings of visual symptoms incidence higher than virus incidence in samples were
456 also reported by Segundo et al. (2008), who did not detect any viruses in 61% of samples from
457 plants with virus-like disease symptoms. There are different possible reasons for this
458 discrepancy. Viruses such as CPMMV and SBMV, for example, cause mild to severe disease
459 symptoms on common bean genotypes in Tanzania (our unpublished results) and could be
460 responsible for some of the observed symptoms. Moreover, some symptoms on plants caused by
461 edaphic factors (e.g., nutrient toxicities) can be confused with virus disease symptoms (Kennelly
462 et al. 2012).
463 Incidence of BCMV and BCMNV was relatively low in the western (Kigoma) and
464 southern highlands areas. The factors driving the spread of viruses that infect common bean in
465 Tanzania remain largely unknown. Some viruses detected in this work are known to be
466 transmitted through seeds at different efficiencies (Njau and Lyimo 2000; Okada et al. 2013).
467 Njau and Lyimo (2000) reported incidence of 12.4% and 36.6% for BCMNV and BCMV,
468 respectively, in seed-lots collected from farmers and research centers in Tanzania. However, a
469 recent study showed that pathogenic viruses – but not CPMMV – are rarely transmitted in seeds
470 of different common bean varieties collected from farmers in Tanzania (Nordenstedt et al. 2017).
471 This rare transmission of pathogenic viruses was associated with efforts invested in breeding for
472 resistance (e.g. Kusolwa et al. 2016). It is understood that the rate of virus transmission in seeds
473 is not always a good indicator of disease epidemiology because, in the presence of vectors, low
474 seed transmission is sufficient to spread viruses and cause disease epidemics (reviewed in
475 Johansen et al. 1994). The observed variation in virus incidence could be attributed to the wide
476 range of cultivars grown in Tanzania (Fivawo and Msolla 2011; Nordenstedt et al. 2017).
477 However, for a variety of reasons that include lack of awareness and cost avoidance, some

Page 22 of 53
478 farmers are reluctant to adopt and plant new varieties or use certified and Quality Declared
479 Seeds. Other factors likely to affect levels of virus disease incidence in the area are the
480 availability of alternative hosts and vectors for viruses (Spence and Walkey 1995). These play an
481 important role in new virus infections in different cropping seasons. For example, in Tanzania,
482 BCMNV, BCMV, CMV and CABMV have been detected in hosts other than common bean
483 (Myers et al. 2000; Patel and Kuwite 1982). Very low incidence of BCMNV and absence of
484 BCMV in the western zone could be partly due to the isolation of the area from other common
485 bean growing areas in Tanzania. The interregional (within country) bean seed trade may not lead
486 to virus spread because seedborne virus diseases are rare (Nordenstedt et al. 2017). Considering
487 all this information, it was not surprising to find differences in virus disease incidence between
488 two fields located in close proximity and within or between agricultural research zones.
489 The RT-PCR results showed that BCMV was present in all zones, except the western
490 zone. However, NGS data indicated absence of BCMV in the southern highlands, western and
491 Lake zones. This discrepancy can be explained by low incidence of BCMV in common bean
492 plants in Tanzania as well as a small sample size (30 plants per zone) used in NGS; it is not
493 related to the detection sensitivity of NGS and RT-PCR methods. It is therefore likely that the
494 chance of detection of BCMV, and possibly other viruses, may rise with an increased number of
495 pooled RNA samples per zone.
496 The results showed that isolates of BCMV were more diverse than those of BCMNV.
497 Occurrence of many strains of BCMV has been known for quite a long time through studies on
498 genetic interaction between this virus and common bean genotypes (e.g., Drijfhout, 1978). Using
499 differential cultivars, it has been shown that the strains NL1, NL3, NL5, NL8, TN1, TN2 and
500 TN3 occur in Tanzania (Njau and Lyimo 2000; Spence and Walkey 1994; Vetten and Allen

Page 23 of 53
501 1991). In our study, RT-PCR revealed the isolates of NL1 strain could be the most dominant
502 isolates in Tanzania. The other strain that was detected was RU1. Isolate TZ:Mor533:2015
503 appears to be genetically distinct from all other sequenced isolates but at amino acid sequence
504 level it was closely related to the RU1-like isolate TZ:KRG2-7:2015. This may suggest
505 occurrence of distinct strains of RU1 isolates in Tanzania. We did not analyze for recombination
506 given the fact that sequences were obtained through NGS but the BCMV isolate
507 TZ:Mor533:2015 was related to recombinant isolates. Occurrence of natural recombinant
508 isolates of BCMV is common and some recombinant isolates can overcome resistance conferred
509 by such genes as bc-2 and bc-3 (Feng et al. 2014; Feng et al. 2015). High genetic variability
510 among BCMV isolates means that common bean genotypes bred for resistance to this virus must
511 be challenged against a wide range of isolates before being considered for release.
512 During field surveys we observed that common bean plants in Tanzania exhibit severe
513 virus disease symptoms of unknown cause. Laboratory analysis revealed that, apart from BCMV
514 and BCMNV, there were other pathogenic viruses – e.g. CPMMV, PeMoV, CABMV, SBMV
515 and ToLCUV – infecting common bean plants that could be responsible for the unexplained
516 symptoms in fields throughout the country. Thus, plant breeders and pathologists should
517 investigate the damage and yield losses caused by these viruses and also consider any possible
518 interactions between pathogenic viruses and viruses whose pathogenic roles remain
519 undetermined (e.g., PvEV-1 and PvEV-2). We anticipate that the results reported herein will
520 form the basis for future studies on common bean viruses as well as guide plant breeders and
521 plant pathologists in developing strategies for management of common bean virus diseases in
522 Tanzania. For example, this information can be used in selecting seed multiplication sites or
523 deploying planting material. To the best of our knowledge this work represents the first

Page 24 of 53
524 comprehensive survey for common bean viruses in Tanzania and provides unprecedented
525 molecular evidence for occurrence of different viruses in common bean plants in the country.
526 Acknowledgements
527 The authors wish to acknowledge the Bill & Melinda Gates Foundation and the
528 Government of Tanzania for financial support to Dr. Deusdedith Mbanzibwa through the
529 Program for Emerging Agricultural Research Leaders (PEARL; contract ID OPP1112522). We
530 are indebted to all persons who participated in surveys: Mr. Julius Mugini, Ms. Elisiana Kweka,
531 Ms. Fracia Swai, Ms. Evangelista Chiunga, Ms. Hilda Bachwenkizi and Ms. Venerenda Mlegi
532 (MARI); Mr. Michael Kilango (ARI-Uyole); Dr. Magdalena William (ARI-Maruku); and Edith
533 Kadege (ARI-Selian). We thank all the common bean farmers and District Agricultural and
534 Livestock Officers in the 23 districts covered in this study. Access to the supercomputer at CSC-
535 IT Centre for Science was possible through collaboration with Prof. Jari Valkonen at the
536 University of Helsinki. Maps were kindly prepared by Mr. Nyemo A. Chilagane of Sokoine
537 University of Agriculture.
538
539 Literature Cited
540 Adams, M. J., Antoniw, J. F., and Beaudoin F. 2005. Overview and analysis of the polyprotein
541 cleavage sites in the family Potyviridae. Mol. Plant Pathol. 6:471-487.
542 Baulcombe, D. 2004. RNA silencing in plants. Nature 431:356-363.

Page 25 of 53
543 Boonham, N., Kreuze, J., Winter, S., van der Vlugt, R., Bergervoet, J., Tomlinson, J., and
544 Mumford, R. 2013. Methods in virus diagnostics: from ELISA to next generation sequencing.
545 Virus Res. 186:20-31.

546 Chiquito-Almanza, E., Acosta-Gallegos, J. A., García-Álvarez, N. C., Garrido-Ramírez, E. R.,
547 Montero-Tavera, V., Guevara-Olvera, L., and Anaya-López, J. L. 2017. Simultaneous
548 detection of both RNA and DNA viruses infecting dry bean and occurrence of mixed
549 infections by BGYMV, BCMV and BCMNV in the central-west region of Mexico. Viruses
550 9:63 doi:10.3390/v9040063.
551 Davis, R. F., and Hampton, R. O. 1986. Cucumber mosaic virus isolates seedborne in Phaseolus
552 vulgaris: serology, host-pathogen relationship, and seed transmission. Phytopathology
553 76:999-1004.
554 Drijfhout, E. 1978. Genetic interaction between Phaseolus vulgaris and Bean common mosaic
555 virus with implications for strain identification and breeding for resistance. Agricultural
556 Research Report 872. Wageningen, The Netherlands, 98 p.
557 Edgar, R. C. 2004. MUSCLE: a multiple sequence alignment method with reduced time and
558 space complexity. BMC Bioinformatics 5:113.
559 FAO (2014). Retrieved 24 August 2017 from http://www.fao.org/faostat/en/#data/QC.
560 Feng, X., Guzmán, P., Myers J. R., and Karasev, A. V. 2017. Resistance to Bean common
561 mosaic necrosis virus conferred by the bc-1 gene affects systemic spread of the virus in
562 common bean. Phytopathology 107:893-900.

Page 26 of 53
563 Feng, X., Myers, J. R., and Karasev, A. V. 2015. Bean common mosaic virus isolate exhibits a
564 novel pathogenicity profile in common bean, overcoming the bc-3 resistance allele coding for
565 the mutated eIF4E translation initiation factor. Phytopathology 105:1487-1495.

566 Feng, X., Poplawsky, A. R., Nikolaeva, O. V., Myers, J. R., and Karasev, A. V. 2014.
567 Recombinants of Bean common mosaic virus (BCMV) and genetic determinants of BCMV
568 involved in overcoming resistance in common bean. Phytopathology 104:786-793.

569 Fivawo, N. C., and Msolla, S. N. 2011. The diversity of common bean landraces in Tanzania.
570 Tanzania J. Nat. Appl. Sci. 2:337-351.
571 Grogan, R. G., and Walker, J. C. 1948. The relation of common mosaic to black root of bean. J.
572 Agric. Res. 77:315-331.
573 Hagedorn, D. J., and Inglis, D. A. 1986. Handbook of bean diseases. Coop. Ext. Publ., Univ. of
574 Wis.-Ext., Madison. Or Hagedorn, D. J., and Inglis, D. A. 1986. Handbook of bean diseases.
575 Madison: UW-Extension Publication.
576 Hall, T. A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis
577 program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41:95-98.
578 Hillocks, R. J., Madata, C. S., Chirwa, R., Minja, E. M., and Msolla, S. 2006. Phaseolus bean
579 improvement in Tanzania, 1959–2005. Euphytica 150:225-231.
580 Johansen, E., Edwards, M. C., and Hampton, R. O. 1994. Seed transmission of viruses: current
581 perspectives. Annu. Rev. Phytopathol. 32:363-386.
582 Kehoe, M. A., Coutts, B. A., Buirchell, B. J., and Jones, R. A. C. 2014. Plant virology and next
583 generation sequencing: experiences with a Potyvirus. PLoS One 9:e104580.

Page 27 of 53
584 Kennelly, M., O'Mara, J., Rivard, C., Miller, G.L. and D. Smith 2012. Introduction to abiotic
585 disorders in plants. The Plant Health Instructor. doi: 10.1094/PHI-I-2012-10-29-01.
586 Kreuze, J. F., Perez, A., Untiveros, M., Quispe D., Fuentes, S., Barker, I., and Simon, R. 2009.
587 Complete viral genome sequence and discovery of novel viruses by deep sequencing of small
588 RNAs: a generic method for diagnosis, discovery and sequencing of viruses. Virology 388:1-
589 7.
590 Kumar, S., Stecher, G., and Tamura, K. 2016. MEGA7: Molecular Evolutionary Genetics
591 Analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33:1870-1874.
592 Kusolwa, P. M., Myers, J. R., Porch, T. G., Trukhina, Y. O., Gonzalez-Velez, A., and Beaver, J.
593 S. 2016. Registration of AO-1012-29-3-3A red kidney bean germplasm line with bean weevil,
594 BCMV and BCMNV resistance. J. Plant Reg. 10:149-153.
595 Larsen, R. C., Druffel, K. L., and Wyatt, S. D. 2011. The complete nucleotide sequences of Bean
596 common mosaic necrosis virus strains NL-5, NL-8 and TN-1. Arch. Virol. 156:729-732.
597 Larsen, R. C., Miklas, P. N., Druffel, K. L., and Wyatt, S. D. 2005. NL-3 K Strain is a stable and
598 naturally occurring interspecific recombinant derived from Bean common mosaic necrosis
599 virus and Bean common mosaic virus. Phytopathology 95:1037-1042.
600 Macedo, M. A., Barreto, S. S., Costa T. M., Maliano, M. R., Rojas, M. R., Gilbertson, R. L., and
601 Inoue-Nagata, A. K. 2017. First report of common beans as a non-symptomatic host of
602 Tomato severe rugose virus in Brazil. Plant Dis. 101:261.

Page 28 of 53
603 Mbanzibwa, D. R., Tugume, A. K., Chiunga, E., Mark, D., and Tairo, F. D. 2014. Small RNA
604 deep sequencing-based detection and further evidence of DNA viruses infecting sweetpotato
605 plants in Tanzania. Ann. Appl. Biol. 165:329-339.

606 Mink, G. I., and Keswani, C. L. 1987. First report of cowpea mild mottle virus on bean and
607 mung bean in Tanzania. Plant Dis. 71:55.
608 Mlotshwa, S., Pruss, G. J., and Vance, V. 2008. Small RNAs in viral infection and host defense.
609 Trends Plant Sci. 7:375-382.
610 Mwaipopo, B., Nchimbi-Msolla, S., Njau, P., Tairo, F., William, M., Binagwa, P., Kweka, E.,
611 Kilango, M., and Mbanzibwa, D. 2017. Viruses infecting common bean (Phaseolus vulgaris
612 L.) in Tanzania: A review on molecular characterization, detection and disease management
613 options. Afr. J. Agric. Res. 12:1486-1500.
614 Myers, J. R., Mink, G. A., and Mabagala, R. 2000. Surveys for Bean common mosaic virus in
615 East Africa. Annual Report of Bean Improvement Cooperative and National Dry Bean
616 Council Research Conference pp. 13-14.
617 Naderpour, M., Lund, O. S., and Johansen, I. E. 2009. Sequence analysis of expressed cDNA of
618 bean common mosaic virus RU1 isolate. Iran. J. Virol. 3:39-41.
619 Nchimbi-Msolla, S. 2013. Bean variety ‘Kablanketi’. Kirkhouse Times.
620 https://www.kirkhousetrust.org/docs/newsletters/kt_newsletter_001_Dec_2013.pdf.
621 Njau, P. J. R., Saria, J. E., Mwakitwange, F. E., and Lyimo, H. F. J. 2006. Detection of mixtures
622 of bean and cowpea viruses by using single and mixed antisera in enzyme-linked
623 immunosorbent assay. Tanz. J. Agric. Sci. 7:50-55.

Page 29 of 53
624 Njau, P. J. R., and Lyimo, H. F. J. 2000. Incidence of Bean common mosaic virus and Bean
625 common mosaic necrosis virus in bean (Phaseolus vulgaris L.) and wild legume seedlots in
626 Tanzania. Seed Sci. Technol. 28:85-92.

627 Nordenstedt, N., Marcenaro, D., Chilagane, D., Mwaipopo, B., Rajamäki, M.-L., Nchimbi-
628 Msolla., S, Njau, P. J. R., Mbanzibwa, D. R., and Valkonen, J. P. T. 2017. Pathogenic
629 seedborne viruses are rare but Phaseolus vulgaris endornaviruses are common in bean
630 varieties grown in Nicaragua and Tanzania. PLoS One 12(5):e0178242.
631 Okada, R., Yong, C. K., Valverde, R. A., Sabanadzovic, S., Aoki, N., Hotate, S., Kiyota, E.,
632 Moriyama, H., and Fukuhara, T. 2013. Molecular characterization of two evolutionarily
633 distinct endornaviruses co-infecting common bean (Phaseolus vulgaris). J. Gen. Virol.
634 94:220-229.
635 Patel, P. N., and Kuwite, C. 1982. Prevalence of Cowpea aphid-borne mosaic virus and two
636 strains of cowpea mosaic virus in Tanzania. Indian Phytopathol. 35:467-472.
637 Petry, N., Boy, E., Wirth, J. P., and Hurrell, R. F. 2015. Review: the potential of the common
638 bean (Phaseolus vulgaris) as a vehicle for iron biofortification. Nutrients 7:1144-1173.
639 Roossinck, M. J., Martin, D. P., and Roumagnac, P. 2015. Plant virus metagenomics: Advances
640 in virus discovery. Phytopathology 105:716-727.
641 Segundo, E., Carmona, M. P., Sáez, E., Velasco, L., Martín, G., Ruiz, L., Janssen, D., and
642 Cuadrado, I. M. 2008. Occurrence and incidence of viruses infecting green beans in south-
643 eastern Spain. European Journal of Plant Pathology 122:579-591.

Page 30 of 53
644 Simmonds, P., Adams, M. J., Benko, M., Breitbart, M., Brister J. R., Carstens, E. B., Davison, A.
645 J., Delwart, E., Gorbalenya, A. E., Harrach, B., Hull, R., King, A. M., Koonin, E. V.,
646 Krupovic, M., Kuhn, J. H., Lefkowitz, E. J., Nibert, M. L., Orton, R., Roossinck, M. J.,
647 Sabanadzovic, S., Sullivan, M. B., Suttle, C. A., Tesh, R. B., van der Vlugt, R. A., Varsani,
648 A., and Zerbini, F. M. 2017. Consensus statement: Virus taxonomy in the age of
649 metagenomics. Nat. Rev. Microbiol. 15:161-168.

650 Spence, N. J., and Walkey, D. G. A. 1995. Variation of pathogenicity among isolates of Bean
651 common mosaic virus in Africa and reinterpretation of the genetic relationship between
652 cultivars of Phaseolus vulgaris and pathotypes of BCMV. Plant Pathol. 44:527-546.
653 Sseruwagi, P., Sserubombwe, W. S., Legg, J. P., Ndunguru, J., and Thresh, J. M. 2004. Methods
654 of surveying the incidence and severity of cassava mosaic disease and whitefly vector
655 populations on cassava in Africa: a review. Virus Res. 100:129-142.
656 Sydänmetsä, M., and Mbanzibwa, D. R. 2016. Occurrence of Cucumber mosaic virus, Zucchini
657 yellow mosaic virus and Watermelon mosaic virus in cultivated and wild cucurbits in the
658 coastal areas of Tanzania. Afr. J. Agric. Res. 40:4062-4069.
659 Tamura, K., and Nei, M. 1993. Estimation of the number of nucleotide substitutions in the
660 control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10:512-
661 526.
662 Vetten, H. J., and Allen, D. J. 1991. Recent progress in the identification of viruses of Phaseolus
663 vulgaris in Africa. Annual report of the bean improvement cooperatives and National Dry
664 Bean Council Research Conference. USDA National Agricultural Library pp. 3-4.

Page 31 of 53
665 Zheng, Y., Gao, S., Padmanabhan, C., Li, R., Galvez, M., Gutierrez, D., Fuentes, S., Ling, K. S.,
666 Kreuze, J., and Fei, Z. 2017. VirusDetect: An automated pipeline for efficient virus
667 discovery using deep sequencing of small RNAs. Virology 500:130-138.

668

Page 32 of 53
Tables
Table 1. Primers designed and used in this study.
Primer name Primer sequences 5′–3′ direction Product Targeted Virus b

region a
(in pairs) size

(bp)
BCMVFcpF1 GCGGAGAATCTGTGCACCTACA
BCM- GTCCCKTGCAGTGTGCCT 839 CP BCMV
NVcommonR
BCMVFcpF1 GCGGAGAATCTGTGCACCTACA
BCMVFcpR1 ATTGCAATGGTTCTTCCGGC 1075 CP & 3′UTR BCMV

BCMNVFcpF2 GCTGGGGCCGATGAGAG
BCM- GTCCCKTGCAGTGTGCCT 711 CP BCMNV
NVcommonR
BCMNVF1 CAAAGGCCCAGCGGATAAA
BCMNVR1 GGTGGTATAACCACACTGGAATTG 823 CP & 3′UTR BCMNV
BCMV1F GTAGCACAGATGAAGGCAGCA
BCMV1R GGTTCTTCCGGCTTACTCATA 339 CP & 3′UTR BCMV
533-340F1 GCTGGAACAGCTCACCAA
533-340R1 CCTTTGATTCTCTCTGCCTTT 668 P3 BCMV;
TZ:Mor533:2017
533-139F1 GTCAAGCAAGCAAAGAGTGC
533-139R1 TGTGTAATCCCTCAAATACCGC 546 CI BCMV;
TZ:Mor533:2017
ToLCUV-F1 GTGAATCCCCAATTCCTTCCTC
ToLCUV-R1 TCCCACTATCTTCCTCTGCAA 434 C2 & C3 ToLCUV
a
CP, UTR, P3 and CI indicate potyviral coat protein, untranslated region, third protein and cytoplasmic inclusion,
respectively, while C2 and C3 refer to transcriptional activation and replication enhancement proteins of tomato leaf
curl Uganda virus (ToLCUV)-related begomovirus detected in this study. b TZ:Mor533:2017 is an isolate of BCMV.

Page 33 of 53
Table 2. Visual and RT-PCR based incidence and prevalence of BCMNV and BCMV in
common bean plants in different agricultural zones of Tanzania.
Zone District a RT-PCR based Visually

RT-PCR based disease incidence prevalence (%) assessed
range at field and district levels incidence of

(%) virus-like
disease
symptoms in 50
plants per field
(%)
Nb BCMNV BCMV BCMNV BCMV
SHZ Nkasi (H) 450 0–10.0 0–13.3 6.7 13.3 0–86

Mbozi (I) 420 0–3.3 0 7.1 0 10–60
Mbeya Rural (I) 420 0–10.0 0–6.7 28.6 14.3 0–80
Njombe (J) 330 0 0–26.7 0 36.4 0–30
Wanging’ombe (J) 150 0 0 0 0 6–48
Mbinga (K) 450 0 0 0 0 2–42
Namtumbo (K) 300 0–3.3 0 10.0 0 6–44
EZ Gairo (G) 450 0–76.7 0–26.7 13.3 13.3 6–54

Mvomero (G) 450 0–40.0 0–36.7 33.3 33.3 12–76
Morogoro R. (G) 120 0–3.3 0 50.0 c 0 18–24
NZ Karatu (D) 450 0–16.7 0–20.0 20.0 46.7 2–86

Arumeru (D) 420 0–3.3 0–26.7 7.1 28.6 6–94
Siha (E) 240 0–23.3 0–33.3 25.0 50.0 2–34
Hai (E) 210 0–36.7 0–20.0 28.6 28.6 0–52
Lushoto (F) 420 0–30.0 0–36.7 14.3 21.4 2–56
LZ Ngara (A) 240 0 0–3.3 0 12.5 12–36

Karagwe (A) 450 0 0–10.0 0 26.7 4–54
Missenyi (A) 450 0–16.7 0–16.7 13.3 13.3 8–98
Muleba (A) 450 0 0 0 0.0 18–64
Biharamulo (A) 150 0.0 0–10.0 0 20.0 4–38
Tarime (B) 420 0–3.3 0–36.7 14.3 7.1 4–22
WZ Kasulu (C) 163 0 0 0 0 0–80

Kibondo (C) 153 0 – 3.3 0 0 0 0–60
a
The letters A to H represent locations as shown in Fig. 1. b Indicates the number of common bean samples collected
from each district and on which RT-PCR was performed. c Only four common bean fields were surveyed in
Morogoro Rural district. SHZ, EZ, NZ, LZ and WZ abbreviations indicate agricultural research zones in Tanzania:
southern highlands, eastern, northern, Lake and western zones, respectively. Visually assessed incidence shown in
parenthesis was computed at district level. The survey in SHZ, EZ, NZ and LZ was carried out in 2015, whereas the
WZ survey was conducted in 2017.

Beatrice Mwaipopo
Plant Disease
34
Page 34 of 53
Page 35 of 53
Table 3. Viruses detected by deep sequencing of virus-derived small RNAs from common bean
samples collected from five different agricultural research zones in Tanzania.
Zonea RNA Total Reads Viruses detected (reference sequences and coverage in
pool reads (21– aligned to % are shown in parentheses) b
sample 24 nt) reference

SHZ HXH-1 5,869,348 370,969 BCMNV; +ssRNA; Potyvirus (AY864314; 95.1)
PeMoV; +ssRNA; Potyvirus (AF023848; 98.6)
SBMV; +ssRNA; Sobemovirus (DQ875594; 99.9)
PvEV-1; dsRNA; Alphaendornavirus (KT456287; 95.0)
PvEV-2; dsRNA; Alphaendornavirus (AB719398; 96.4)
EZ HXH-2 6,674,109 264,061 BCMNV; +ssRNA; Potyvirus (AY864314; 93.4)

BCMV; +ssRNA; Potyvirus (KT175569; 100)
CPMMV; +ssRNA; Carlavirus (KC774020; 68.4)
CMV; +ssRNA; Cucumovirus (KJ400004; 86.0)
CMoV; +ssRNA; Umbravirus (CED51824; 51.5)
CMoMV; +ssRNA; Umbravirus (ACJ03575; 56.1)
OPMV; +ssRNA; Umbravirus (AHZ65104; 33.0)
ETBTV; +ssRNA; Umbravirus (AIL27641; 33.1)
TBTV; +ssRNA; Umbravirus (TBTV; 77.9)
NZ HXH-3 5,286,206 203,035 BCMNV; +ssRNA; Potyvirus (AY864314; 86.1)
BCMV; +ssRNA; Potyvirus (KF114860; 99.9)
BnYDV; +ssRNA; Crinivirus (EU191905; 77.9)
CPMMV; +ssRNA; Carlavirus (KJ534277; 73.6)
NCMV; –ssRNA; Cytorhabdovirus (ADE61669; 24.6)
LZ HXH-6 11,658,110 378,180 BCMNV; +ssRNA; Potyvirus (AY864314; 95.8)
CABMV; +ssRNA; Potyvirus (DQ397527; 89.2)
ToLCArV; +/–ssDNA; Begomovirus (DQ519575; 24)
ToLCYTV; +/–ssDNA, (AJ865340; 19.3)
ToLCUV; +/–ssDNA; Begomovirus (DQ127170; 62.8)
HXH-7 7,989,740 80,846 TMoV; +ssRNA; Umbravirus (AY007231; 91.1)
RuFDV; dsDNA-RT; unassigned (ACL36982; 23.1)
HRLV; dsDNA-RT; Caulimovirus (AAW56089; 14.3)
CERV; dsDNA-RT; Caulimovirus (ABX80503; 23.2)
EVCV; dsDNA-RT; unassigned (ACB69773; 13.1)
MMV; dsDNA-RT; Caulimovirus (AAM53128; 22.6)
DMV; dsDNA-RT; Caulimovirus (ABW80581; 24.1)
SbCMV; dsDNA-RT; Soymovirus (CAA33833; 14.2)
PEMV; +ssRNA; Umbravirus (AAU20330; 22.3)
SVBV; dsDNA-RT; Caulimovirus (AKB94072; 36.7)
GRV; +ssRNA; Umbravirus (CTQ57207; 33.7)
SPuV; dsDNA-RT; Caulimovirus (AFP95350; 15.9)
WZ HXH- 28,223,699 3,793,494 BCMNV; +ssRNA; Potyvirus (AY864314; 77.2)

Page 36 of 53
15
SBMV; +ssRNA; Sobemovirus (DQ875594; 98.5)
PvEV-1; dsRNA; Endornavirus (KT456287; 99.3)
a
Abbreviations SHZ, EZ, NZ, LZ and WZ are as described for Table 2. b Database searches for viruses in bold type
was achieved using the Blastx approach. Expanded names for abbreviations used: BCMNV ‘bean common mosaic
necrosis virus’, BCMV ‘bean common mosaic virus’, PeMoV ‘peanut mottle virus’, SBMV ‘southern bean mosaic
virus’, PvEV-1 ‘phaseolus vulgaris alphaendornavirus 1’, PvEV-2 ‘phaseolus vulgaris alphaendornavirus 2’,
CPMMV ‘cowpea mild mottle virus’, CMV ‘cucumber mosaic virus’, CMoV ‘carrot mottle virus’, CMoMV ‘carrot
mottle mimic virus’, OPMV ‘opium poppy mosaic virus’, ETBTV ‘Ethiopian tobacco bushy top virus’, TBTV
‘tobacco bushy top virus’, CABMV ‘cowpea aphid-borne mosaic virus’, BnYDV ‘bean yellow disorder virus’,
NCMV ‘northern cereal mosaic virus’, ToLCArV ‘tomato leaf curl Arusha virus’, ToLCYTV ‘tomato leaf curl
Mayotte virus’, ToLCUV ‘tomato leaf curl Uganda virus’, TMoV ‘tobacco mottle virus’, RuFDV ‘rudbeckia flower
distortion virus’, HRLV ‘horseradish latent virus’, CERV ‘carnation etched ring virus’, EVCV ‘eupatorium vein
clearing virus’, MMV ‘mirabilis mosaic virus’, DMV ‘dahlia mosaic virus’, SbCMV ‘soybean chlorotic mottle
virus’, PEMV ‘pea enation mosaic virus’, GRV ‘groundnut rosette virus’, SVBV ‘strawberry vein banding virus’
and SPuV ‘soybean putnam virus’. For sample HXH-2 viruses CMoV, CMoMV, OPMV, ETBTV and TBTV (all
belonging to genus Umbravirus) identified through Blastx are most likely sequences of one and the same novel
virus.

Page 37 of 53
Table 4. Nucleotide and amino acid sequence similarities among BCMV and BCMNV isolates.
Seq A B C D E F G H I J K L M N O P Q R S
A 100 91.5 91.0 98.3 98.3 97.8 97.8 97.8 97.6 98.2 98.8 98.3 98.3 98.0 98.2 98.3 91.0 90.2
B 100 ** 91.5 91.0 98.3 98.3 97.8 97.8 97.8 97.6 98.2 98.8 98.3 98.3 98.0 98.2 98.3 91.0 90.2
C 93.4 93.4 ** 99.3 92.0 92.0 91.8 91.8 91.8 91.6 91.9 92.0 91.9 91.9 92.0 92.1 91.9 99.3 90.2
D 92.6 92.6 98.8 ** 91.5 91.5 91.3 91.3 91.3 91.1 91.4 91.5 91.4 91.4 91.5 91.6 91.4 100 90.5
E 98.8 98.8 93.4 92.6 ** 100 98.9 98.9 98.9 98.8 99.6 99.2 99.6 99.6 99.2 99.3 99.6 91.5 91.1
F 98.8 98.8 93.4 92.6 100 ** 98.9 98.9 98.9 98.8 99.6 99.2 99.6 99.6 99.2 99.3 99.6 91.5 91.1
G 98.4 98.4 93.0 92.3 98.8 98.8 ** 100 100 99.8 98.8 98.7 98.8 98.8 98.9 99.3 98.8 91.3 90.6
H 98.4 98.4 93.0 92.3 98.8 98.8 100 ** 100 99.8 98.8 98.7 98.8 98.8 98.9 99.3 98.8 91.3 90.6
I 98.4 98.4 93.0 92.3 98.8 98.8 100 100 ** 99.8 98.8 98.7 98.8 98.8 98.9 99.3 98.8 91.3 90.6
J 98.0 98.0 92.6 91.9 98.4 98.4 99.6 99.6 99.6 ** 98.7 98.5 98.7 98.7 98.8 99.2 98.7 91.1 90.5
K 98.8 98.8 93.4 92.6 100 100 98.8 98.8 98.8 98.4 ** 98.8 99.4 99.4 99.1 99.2 99.4 91.4 91.0
L 99.2 99.2 93.8 93.0 99.6 99.6 99.2 99.2 99.2 98.8 99.6 ** 98.9 98.9 98.9 99.1 98.9 91.5 90.9
M 98.8 98.8 93.4 92.6 100 100 98.8 98.8 98.8 98.4 100 99.6 ** 100 99.1 99.2 100 91.4 90.7
N 98.8 98.8 93.4 92.6 100 100 98.8 98.8 98.8 98.4 100 99.6 100 ** 99.1 99.2 100 91.4 90.7
O 99.2 99.2 93.8 93.0 99.6 99.6 99.2 99.2 99.2 98.8 99.6 100 99.6 99.6 ** 99.3 99.1 91.5 90.9
P 98.8 98.8 93.4 92.6 99.2 99.2 99.6 99.6 99.6 99.2 99.2 99.6 99.2 99.2 99.6 ** 99.2 91.6 90.7
Q 98.8 98.8 93.4 92.6 100 100 98.8 98.8 98.8 98.4 100 99.6 100 100 99.6 99.2 ** 91.4 90.7
R 92.6 92.6 98.8 100 92.6 92.6 92.3 92.3 92.3 91.9 92.6 93.0 92.6 92.6 93.0 92.6 92.6 ** 90.5
S 92.3 92.3 94.2 95.3 92.6 92.6 92.3 92.3 92.3 91.9 92.6 93.0 92.6 92.6 93.0 92.6 92.6 95.3 **

This paper has been peer reviewed and accepted for publication but has not yet been copyedited or proofread. The final published version may differ. Page 38 of 53
B
Seq A B C D E F G H I J K L M
A ** 97.9 97.7 97.4 97.9 98.0 98.0 97.9 97.9 97.1 97.1 97.1 97.6
B 99.5 ** 98.2 98.8 99.3 99.5 99.5 99.0 98.4 98.5 98.5 98.5 99.0
C 99.5 100 ** 98.7 98.2 98.4 98.4 98.8 97.6 98.0 98.0 98.0 97.9
D 99.0 99.5 99.5 ** 98.8 99.0 99.0 99.2 98.2 98.7 98.7 98.7 98.5
E 99.0 99.5 99.5 99.0 ** 99.8 99.8 99.0 98.4 98.5 98.5 98.5 99.0
F 99.5 100 100 99.5 99.5 ** 100 99.2 98.5 98.7 98.7 98.7 99.2
G 99.5 100 100 99.5 99.5 100 ** 99.2 98.5 98.7 98.7 98.7 99.2
H 99.5 100 100 99.5 99.5 100 100 ** 98.4 98.8 98.8 98.8 98.7
I 99.5 100 100 99.5 99.5 100 100 100 ** 97.6 97.6 97.6 98.0
J 99.5 100 100 99.5 99.5 100 100 100 100 ** 100 100 98.2
K 99.5 100 100 99.5 99.5 100 100 100 100 100 ** 100 98.2
L 99.5 100 100 99.5 99.5 100 100 100 100 100 100 ** 98.2
M 99.0 99.5 99.5 99.0 99.0 99.5 99.5 99.5 99.5 99.5 99.5 99.5 **
Percent nucleotide (upper triangle) and amino acid (lower triangle) sequence similarities among Tanzanian isolates of BCMV and BCMNV. A. Genetic
variability among BCMV isolates. The BCMV-CP nucleotide sequence length used was 782 nt (starting with the 52nd nt with reference to isolate TZ:KRG2-
7:2015). The corresponding amino acids were used to determine amino acid sequence identity. The letters A–S represent, in order, the following isolates:
TZ:MBY1:2016 (MF066258), TZ:MBY3:2016 (MF066259), TZ:MSY1-1:2015 (MF066260)’ UNKNOWN (MF043409), TZ:MVR15-16:2015 (MF043410),
TZ:MVR15-23:2015 (MF043411), TZ:MVR14-13:2015 (MF043412), TZ:MVR14-17:2015 (MF043413), TZ:MVR14-16:2015 (MF043414), TZ:MVR14-
15:2015 (MF043415), TZ:KRT7-18:2015 (MF043416), TZ:ARM1219:2015 (MF043417), TZ:SIHA117:2015 (MF043418), TZ:SIHA115:2015 (MF043419),
TZ:MVR4-3:2015 (MF043420), TZ:MVR3-1:2015 (MF043421), TZ:KRT3-4:2015 (MF043422), TZ:KRG2-7:2015 (MF043423) and TZ:Mor533:2015
(MF784804). B. Genetic variability among BCMNV isolates. The BCMNV-CP nucleotide sequence length used was 626 nt. The letters A–M represent the
following isolates in order: TZ:MSY15-1:2015 (MF066261), TZ:MBZ4-18:2015 (MF066262), TZ:MVR13-2:2015 (MF066263), TZ:TRM10-4:201
(MF066264), TZ:NKS3-19:2015 (MF066265), TZ:NKS3-1:2015_MF066266, TZ:NKS3-5:2015 (MF066267), TZ:MVRD:2016 (MF066268), TZ:ARM7-
51:2015 (MF066269), TZ:Maruku:2016 (MF066270), TZ:KRT1-3:2015 (MF066271), TZ:NMT1-8:201 (MF066272) and Strain TN1 (HQ229995).

Page 39 of 53
Figure Captions
Fig. 1. Locations surveyed for common bean viral diseases in Tanzania. Lake zone: A, Kagera
Region (Ngara, Biharamulo, Muleba, Missenyi and Karagwe districts) and B, Mara Region
(Tarime District). Western zone: C, Kigoma Region (Kasulu and Kibondo districts). Northern
zone: D, Arusha Region (Karatu and Arumeru districts), E, Kilimanjaro Region (Siha and Hai
districts) and F, Tanga Region (Lushoto district). Eastern zone: G, Morogoro Region (Morogoro
Rural, Mvomero and Gairo districts). Southern highlands zone: H, Rukwa Region (Nkasi
District), I, Mbeya and Songwe Regions (Mbozi, Mbeya Rural districts), J, Njombe Region
(Njombe Rural and Wanging’ombe districts) and K, Ruvuma Region (Namtumbo and Mbinga
districts).
Fig. 2. Some symptoms observed on common bean plants in fields during 2015–2017. A, Vein
clearing in plants infected with SBMV (Kasulu District in the western zone). B, Yellow mottling
(Missenyi District in Lake zone). C and D, Mosaic and leaf curl (Missenyi District in Lake
zone). E, mosaic (Karatu District in northern zone). F, Mosaic and stunted growth (northern
zone). G and H, leaf necrosis (Kilimanjaro Region in northern zone). I, Mosaic and severe leaf
deformation (Mvomero District in eastern zone).
Fig. 3. Phylogenetic tree generated using the coat protein nucleotide sequences (620 nt) of
BCMV and BCMNV isolates. The tree is drawn to scale, with branch lengths measured in the
number of substitutions per site. Numbers at branches represent bootstrap values of 1,000
replicates, of which only values of >60% are shown. The isolate names are shown along with the
accession numbers assigned to their sequences in this study (non-bold text) and in previous
studies (bold text).

Beatrice Mwaipopo
Plant Disease
40
Page 40 of 53
Page 41 of 53
Supplementary figures
Supplementary Fig. S1. Maps of incidence of viruses and virus disease symptoms. A, Map of
visual-based incidence of virus and virus-like disease symptoms. B, RT-PCR (laboratory)-based

incidence and distribution of BCMV. C, RT-PCR-based incidence and distribution of BCMNV.
For clarity, some fields with 0% virus disease incidence were not included in the maps.
Supplementary Fig. S2. Mapping of viral contigs (obtained through de novo assembly of reads)
to viral sequences in the database (numbers on blue and red bars are accession and contig
numbers, respectively). A, BCMNV detected in pooled RNA sample HXH-1 by de novo
assembly of reads of size 21 nt. B, BCMV detected in pooled RNA sample HXH-2 (combined
inserts). C, SBMV detected in pooled RNA sample HXH-1(combined inserts). D, PeMoV in
pooled RNA sample HXH-1 (combined inserts). E, CPMMV detected in pooled RNA HXH-3
(combined inserts). F, CMV in pooled RNA sample HXH-2 (combined inserts). G, CMoV in
pooled RNA sample HXH-2 (insert size 22 nt; Blastx). H, ToLCUV-related virus in pooled RNA
sample HXH-6 (combined inserts). I, CABMV in pooled RNA sample HXH-6 (combined
inserts). J, Umbravirus related to TMoV in pooled RNA sample HXH-7 (combined inserts).

Fig. 1. Locations surveyed for common bean viral diseases in Tanzania. Lake zone: A, Kagera Region
(Ngara, Biharamulo, Muleba, Missenyi and Karagwe districts) and B, Mara Region (Tarime District). Western
zone: C, Kigoma Region (Kasulu and Kibondo districts). Northern zone: D, Arusha Region (Karatu and
Arumeru districts), E, Kilimanjaro Region (Siha and Hai districts) and F, Tanga Region (Lushoto district).
Eastern zone: G, Morogoro Region (Morogoro Rural, Mvomero and Gairo districts). Southern highlands zone:
H, Rukwa Region (Nkasi District), I, Mbeya and Songwe Regions (Mbozi, Mbeya Rural districts), J, Njombe
Region (Njombe Rural and Wanging’ombe districts) and K, Ruvuma Region (Namtumbo and Mbinga
districts).
39x34mm (600 x 600 DPI)

Page 43 of 53
Fig. 2. Some symptoms observed on common bean plants in fields during 2015–2017. A, Vein clearing in
plants infected with SBMV (Kasulu District in western zone). B, Yellow mottling (Missenyi District in Lake
zone). C and D, Mosaic and leaf curl (Missenyi District in Lake zone). E, mosaic (Karatu District in northern
zone). F, Mosaic and stunted growth (northern zone). G and H, leaf necrosis (Kilimanjaro Region in northern
zone). I, Mosaic and severe leaf deformation (Mvomero District in eastern zone).
44x22mm (300 x 300 DPI)

Fig. 3. Phylogenetic tree generated using the coat protein nucleotide sequences (620 nt) of BCMV and
BCMNV isolates. The tree is drawn to scale, with branch lengths measured in the number of substitutions per
site. Numbers at branches represent bootstrap values of 1000 replicates, of which only values of >60% are
shown. The isolates names are shown along with the accession numbers assigned to their sequences in this
study (non-bold text) and in previous studies (bold text).
42x44mm (600 x 600 DPI)

Page 45 of 53
Supplementary Fig. S1. Maps of incidence of viruses and virus disease symptoms. A, Map of visual-based
incidence of virus and virus-like disease symptoms. B, RT-PCR (laboratory)-based incidence and distribution
of BCMV. C, RT-PCR based incidence and distribution of BCMNV. For clarity, some fields with 0% virus
disease incidence were not included in the maps.
61x19mm (300 x 300 DPI)

Supplementary Fig. S2. Mapping of viral contigs (obtained through de novo assembly of reads) to viral
sequences in database (numbers on blue and red bars are accession and contig numbers, respectively). A,
BCMNV detected in pooled RNA sample HXH-1 by de novo assembly of reads of size 21 nt. B, BCMV detected
in pooled RNA sample HXH-2 (combined inserts). C, SBMV detected in pooled RNA sample HXH-1(combined
inserts). D, PeMoV in pooled RNA sample HXH-1 (combined inserts). E, CPMMV detected in pooled RNA HXH-
3 (combined inserts). F, CMV in pooled RNA sample HXH-2 (combined inserts). G, CMoV in pooled RNA
sample HXH-2 (insert size 22 nt; Blastx). H, ToLCUV-related virus in pooled RNA sample HXH-6 (combined
inserts). I, CABMV in pooled RNA sample HXH-6 (combined inserts). J, Umbravirus related to TMoV in pooled
RNA sample HXH-7 (combined inserts).
44x22mm (300 x 300 DPI)

Page 47 of 53
Supplementary Table S1. Accession numbers assigned to sequences and NGS raw data obtained in this
study.
A.
Isolate Place of collection in Virus and Accession Sequencing

Tanzania a region number technique c

sequenced b
1 Unknown Unknown BCMV; CP MF043409 Sanger
2 TZ:MVR15- Mvormero – Morogoro; BCMV; CP MF043410 Sanger
16:2015 EZ
3 TZ:MVR15- Mvomero – Morogoro; EZ BCMV; CP MF043411 Sanger
23:2015
4 TZ:MVR14- Mvomero – Morogoro; EZ BCMV; CP MF043412 Sanger
13:2015
5 TZ:MVR14- Mvomero – Morogoro; EZ BCMV; CP, MF043413 Sanger
17:2015 3′UTR
16:2015 3′UTR
15:2015 3′UTR
8 TZ:KRT7-18:2015 Karatu – Arusha; NZ BCMV; CP, MF043416 Sanger
3′UTR
9 TZ:ARM12- Arumeru – Arusha; NZ BCMV; CP MF043417 Sanger
19:2015
10 TZ:SIHA1-17:2015 Siha – Kilimanjaro; NZ BCMV; CP, MF043418 Sanger
3′UTR
11 TZ:SIHA1-15:2015 Siha – Kilimanjaro; NZ BCMV; CP, MF043419 Sanger
3′UTR
12 TZ:MVR4-3:2015 Mvomero – Morogoro; EZ BCMV; CP, MF043420 Sanger
3′UTR
13 TZ:MVR3-1:2015 Mvomero – Morogoro; EZ BCMV; CP, MF043421 Sanger
3′UTR
14 TZ:KRT3-4:2015 Karatu – Arusha; NZ BCMV; CP; MF043422 Sanger
3′UTR
15 TZ:KRG2-7:2015 Karagwe – Kagera; LZ BCMV; CP, MF043423 Sanger
3′UTR
16 TZ:MBY1:2016 Mbeya DC – Mbeya; SHZ BCMV; CP, MF066258 Sanger
3′UTR
17 TZ:MBY3:2016 Mbeya DC – Mbeya; SHZ BCMV; CP, MF066259 Sanger
3′UTR
18 TZ:MSY1-1:2015 Missenyi – Kagera; LZ BCMV; CP, MF066260 Sanger
3′UTR
19 TZ:MSY15-1:2015 Missenyi – Kagera; LZ BCMNV; CP MF066261 Sanger
20 TZ:MBZ4-18:2015 Mbozi – Songwe; SHZ BCMNV; CP MF066262 Sanger
21 TZ:MVR13-2:2015 Mvomero – Morogoro; EZ BCMNV; CP MF066263 Sanger
22 TZ:TRM10-4:2015 Tarime – Tarime; LZ BCMNV; CP MF066264 Sanger
23 TZ:NKS3-19:2015 Nkasi – Rukwa; SHZ BCMNV; CP MF066265 Sanger
Page 48 of 53

26 TZ:MVRD:2016 Mvomero – Morogoro; EZ BCMNV; CP, MF066268 Sanger
3′UTR
27 TZ:ARM7-51:2015 Arumeru – Arusha; NZ BCMNV; CP, MF066269 Sanger
3′UTR
28 TZ:Maruku:2016 Bukoba – Kagera; LZ BCMNV; CP, MF066270 Sanger
3′UTR
29 TZ:KRT1-3:2015 Karatu – Arusha; NZ BCMNV; CP, MF066271 Sanger

3′UTR
30 TZ:NMT1-8:2015 Namtumbo – Ruvuma; BCMNV; CP, MF066272 Sanger
SHZ 3′UTR
31 BCMNV pool BCMNV; MF078483 NGS; reads
HXH-1 Complete size 21;
Pooled RNA
32 BCMNVHXH2 EZ BCMNV; MF405187 NGS; reads
Partial P1, HC- size 22;
Pro, P3, 6K1, Pooled RNA
CI, 6K2, VPg,
NIa-Pro, NIb,
CP
33 BCMVHXH3; NZ BCMV; P1, MF405188 NGS;
Pooled RNA HC-Pro, P3, combined
6K1, CI, 6K2, inserts;
VPg, partial pooled RNA
NIb-Pro
34 BCMNVHXH6; Tarime; LZ BCMNV; MF405189 NGS;
Pooled RNA Partial P1, HC- combined
Pro, P3, 6K1, inserts;
CI, 6K2, VPg, pooled RNA
NIa-Pro, NIb,
CP
35 TZ:Mor533:2015 Morogoro Urban; EZ BCMV; MF405190 NGS; reads
Complete size 21 and
combined
inserts;
contigs
assembled
using
SeqMan 5.03
36 BCMVHXH-2-21- EZ BCMV; MF405191 NGS;
24; pooled RNA Complete or combined
nearly complete inserts
37 TZ:NKS3:2015 Nkasi district; SHZ BCMNV; MF405192 NGS;
Partial P1, HC- combined
Pro, P3, 6K1, inserts
CI, 6K2, VPg,
NIa-Pro, NIb,
CP
38 TZ:Mor533:2015 Morogoro Urban; EZ BCMV; P3 MF784802 Sanger
TZ:Mor533:2015 Morogoro Urban; EZ BCMV; CI MF784803 Sanger
TZ:Mor533:2015 Morogoro Urban; EZ BCMV; CP MF784804 Sanger
Page 49 of 53
HXH-1 southern SHZ PeMoV; HC- MF784805 NGS;

zone pooled RNA Pro, P3 combined
inserts 21–24 inserts
contig506
39 HXH-1 southern SHZ PeMoV; Partial MF784806 NGS;
zone pooled RNA 6K2, VPg, combined
inserts 21–24 NIa_Pro, NIb, inserts
contig 531 partial CP

40 HXH-1 southern SHZ SBMV; P2a, MF784807 NGS;
zone pooled RNA P2ab, CP combined
contig 608
41 HXH-1 southern SHZ SBMV; MP, MF784808 NGS;
zone pooled RNA P2a combined

contig 468
42 TZ:SBMV pooled Kigoma; WZ SBMV; MP, MG344643 NGS;
RNA P2a, P2ab, CP combined
inserts
B.
Sample name Sample accession Experiment accession Run accession
HXH-1 ERS2046931 ERX2279595 ERR2226232
HXH-2 ERS2046932 ERX2279596 ERR2226233
HXH-3 ERS2046933 ERX2279597 ERR2226234
HXH-4 ERS2046934 ERX2279598 ERR2226235
HXH-5 ERS2046935 ERX2281902 ERR2228563
HXH-6 ERS2046938 ERX2279599 ERR2226236
HXH-7 ERS2046936 ERX2279600 ERR2226237
HXH-15 ERS2046937 ERX2279601 ERR2226238
NGS and Sanger sequences submission details. A. Accession numbers assigned to Sanger and NGS
sequences/contigs submitted to the NCBI database. a EZ, NZ, LZ, SHZ and WZ indicate eastern, northern, Lake,
southern highlands and western zones, respectively; b P1, HC-Pro, P3, 6K1, CI, 6K2, VPg, NIa-Pro, NIb and CP
represent potyviral proteins: first protein, helper component proteinase, third protein, first 6-kDa protein,
cytoplasmic inclusion, second 6-kDa protein, genome-linked viral protein, nuclear inclusion a, nuclear inclusion b
and coat protein, respectively; 3′UTR indicates 3′ untranslated region. southern bean mosaic virus (SBMV) proteins
are MP, P2a, P2ab and coat protein (CP), NGS indicates next generation sequencing and Sanger indicates Sanger
sequencing. c Combined inserts indicates that reads of sizes 21 to 24 nt were analyzed as one fastq file. B. Details of
small RNA raw data (combined inserts) submission to the European Nucleotides Archive: accessions assigned to
samples, experiments and runs. Study primary accession number is PRJEB23835 (secondary accession number
ERP105614) and the unique study name is ena-STUDY-Mikocheni Agricultural Research Institute-08-12-2017-
08:13:19:782-21.
Page 50 of 53
Supplementary Table S2. Molecular evidence for occurrence of viruses in different RNA
samples of common bean plants collected from five agricultural research zones in Tanzania.
Samplea Mapped Virus detected Number of Coverage Depth Contig lengths d

Referenceb contigs (%)
Blastn Blastx Combined Only insert
c
inserts size 21 nt
(21–24)
HXH-1 AY864314 BCMNV; Potyvirus 2 - 95.1 614.4 45–9412 9634
(SHZ)
AF023848 PeMoV; Potyvirus 18 - 98.6 39.1 57–3186 41–1808
DQ875594 SBMV; 4 - 99.9 386.8 62–2345
Sobemovirus
KT456287 PvEV-1; 68 - 95.0 14.3 41–825 41–482
Endornavirus
AB719398 PvEV-2; 40 - 96.4 23.4 60–1106 43–794
Endornavirus
HXH-2 AY864314 BCMNV; Potyvirus 9 - 93.4 189.5 41–6769 41–2494
(EZ)
KT175570 BCMV; Potyvirus 28 - 99.1 217.2 42–10061 42–5037
HG792064 BCMV; Potyvirus 32 - 34.0 155.0 41–499 41–2804
KJ645793 BCMV; Potyvirus 47 - 32.0 69.3 41–157 41–233
KF114860 BCMV; Potyvirus 33 - 99.9 217.6 42–10061 42–5037
KT175569 BCMV; Potyvirus 28 - 100 212.8 42–10061 43–1868
KT456287 PvEV-1; 87 - 86.6 41–537 41–311
Endornavirus 10.8
AB719398 PvEV-2; 32 - 97.5 37.9 42–537 42–1160
Endornavirus
KJ534277 CPMMV; 9 - 63.7 8.4 45–190 45–110
Carlavirus
KC774020 CPMMV; 60 - 68.4 10.4 43–389 41–230
Carlavirus
HM015286 CMV; Cucumovirus 7 - 81.7 112.2 51–282 50–434
FN552599 CMV; Cucumovirus 4 - 80.2 18.6 45–138 45–97
AY429434 CMV; Cucumovirus 30 - 68.0 31.5 40–310 41–282
HQ283392 CMV; Cucumovirus 31 - 67.6 31.3 41– 310 41–282
D16403 CMV; Cucumovirus 30 - 66.8 30.1 41–310 41–282
JX993909 CMV; Cucumovirus 28 - 66.0 35.8 43–310 41–282
DQ412732 CMV; Cucumovirus 9 - 97.1 123.0 51–1209 -
KJ400004 CMV; Cucumovirus 9 - 86.0 119.0 51–1209 -
ACJ03575 CMoMV; - 7 (10) 56.1 321.1 151–589 77–160
Umbravirus
ACT09533 CMoV; Umbravirus - 0 (2) 47.5 206.5 - 125–143
CED51824 CMoV; Umbravirus - 0 (2) 51.5 217.9 - 77–143
AHZ65104 OPMV; Umbravirus 0 (5) 33.0 165.3 - 48–160
AIL27641 ETBTV; - 3 (0) 33.1 330.5 104–589 -
Umbravirus
AAN62864 TBTV; Umbravirus - 3 (0) 77.9 142–409 -
618.9
HXH-3 AY864314 BCMNV; Potyvirus 50 - 86.1 53.5 41–1007 48 -894
(NZ)
Page 51 of 53
JF833417 CABMV; Potyvirus 2 - 17.6 81.9 104–107 -

X96665 SMV; Potyvirus 4 - 17.4 186.9 104–130 -
EU191905 BnYDV; Crinivirus 50 - 77.9 11.1 41 -402 -
KC884248 CPMMV; 43 - 44.0 12.6 41–214 -
Carlavirus
KC774020 CPMMV; 57 - 57.7 12.6 41–214 41–184
Carlavirus
KJ534277 CPMMV; 14 - 73.6 7.7 44–154 42–150
Carlavirus
ADE61669 NCMV; - 1 (1) 24.6 131.0 348 256
Cytorhabdovirus
AGZ92019 BCMV; Potyvirus - 7 15.7 215.5 213 -317 -
AAW50598 BCMNV; Potyvirus 18 56.3 230.4 71–556 92–616
(25)
ABY66967 BnYDV; Crinivirus - 0 (3) 22.6 5.2 - 106–111

ABY66967 BnYDV; Crinivirus - 0 (1) 14.9 5.6 - 233
ACV40161 BCMV; Potyvirus 0 (2) 47.4 176.8 - 106–280
HXH-6 DQ519575 ToLCArV; 8 - 24 46.7 55–191 -
Begomovirus
AJ865340 ToLCYTV; 6 - 19.3 52.8 55–177 -
Begomovirus
EF194760 ToLCArV; 6 - 15.6 30.9 47–177 -
Begomovirus
DQ127170 ToLCUV; 12 - 62.8 37.5 54–481 44–140
Begomovirus
KT456287 PvEV-1; 98 - 61.8 18.8 41–360 41–201
Endornavirus
AB719398 PvEV-2; 55 - 94.2 34.8 46–1138 43–727
Endornavirus
AY864314 BCMNV; Potyvirus 8 - 95.8 345.3 48–9419 42–9161
AF348210 CABMV; Potyvirus 44 - 67.3 1022. 50–801 44–883
7
DQ397527 CABMV; Potyvirus 3 - 89.2 879.9 53–801 -
Y17824 CABMV; Potyvirus 3 - 76.6 859.7 54–801 -
HQ880242 CABMV; Potyvirus 48 - 63.7 1002. 45–801 41–883
9
HQ880243 CABMV; Potyvirus 42 - 53.3 955.8 45–801 41–883
KC777390 CABMV; Potyvirus 3 - 44.0 817.3 52–177 -
EF547367 CABMV; Potyvirus 8 - 64.7 780.5 46–801 -
AAL83896 CABMV; Potyvirus - 15 (0) 13.7 119.7 48–187 -
HXH-7 AY007231 TMoV; Umbravirus 8 - 91.1 1063. 44–562
(LZ) 3
KT456287 PvEV-1; 75 - 91.0 11.6 43–849 -
Endornavirus
AB719398 PvEV-2; 51 - 94.7 17.4 41–1519 -
Endornavirus
ACL36982 RuFDV; unassigned - 5 (7) 23.1 76–181 51–187
263.0
AAW56089 HRLV; - 3 14.3 226.5 83–129 -
Caulimovirus
ABX80503 CERV; - 4 23.2 58–87 -
Caulimovirus 173.8
CAA28360 CERV; - 3 15.9 250.1 67–181 87–104
Page 52 of 53
Caulimovirus
ACB69773 EVCV; - 3 13.1 246.4 77–129 -
Caulimovirus
AAM53129 MMV; - 1 14.0 1133. 73–238 -
Caulimovirus 0
AAM53128 MMV; - 5 (6) 22.6 257.2 73–238 65–100
Caulimovirus
ABW80581 DMV; Caulimovirus - 5 24.1 259.1 76–181 -
CAA33833 SbCMV; - 1 14.2 271.8 188 -

Soymovirus
AAU20330 PEMV-2; - 4 22.3 68–414 -
Umbravirus 638.4
ACL36982.1 RuFDV; - 0 (7) 28.0 151.6 - 51 - 187
Caulimovirus
AKB94072 SVBV; - 0 (1) 36.7 - 519

Caulimovirus 875.0
AEA39176 DMV; Caulimovirus - 0 (6) 22.5 130.6 - 65–187
AFP95350 SPuV; Caulimovirus - 0 (3) 15.9 153.5 - 78–187
CTQ57207 GRV; Umbravirus - 0 (3) 33.7 443.3 - 112–558
HXH-15 AY864314 BCMNV; Potyvirus 54 - 77.2 13.6 40–806 42–405
(WZ)
DQ875594 SBMV; 1 - 98.5 5632. 4132 120–3364
Sobemovirus 0
KT456287 PvEV-1; 20 - 99.3 163.8 62–2022 46–592
Endornavirus
a
SHZ, EZ, NZ, LZ and WZ refer to agricultural zones in Tanzania: southern highlands, eastern, northern, Lake
and western zones, respectively. HXH-1, HXH-2, HXH-3, HXH-6, HXH-7 and HXH-15 are sample codes
given by the sequencing company. b Only one representative accession no. for mapped references is shown even
when there were many mapped references for the same virus in the same RNA sample; low covered references
are not shown. c Number of contigs shown in parenthesis in column five are for Blastx, considering only inserts
d
of size 21 nt while those not in parenthesis are contigs obtained under combined inserts. Combined inserts
indicates reads of sizes 21, 22, 23 and 24 nt were analyzed as one fastq file. When contig lengths are shown for
both combined inserts and only 21-nt inserts, the coverage shown is for the combined inserts. Accession
numbers for mapped reference sequences are shown for both Blastn and Blastx. Some contig sequences matched
sequences of more than one virus in the same genus [for example, the contig sequence that matched SMV
(HXH-3) also matched BCMV suggesting they may be contigs of BCMV; some Blastx found viruses, for
example in sample HXH-3, were not shown because they are most likely sequences of BCMNV as contigs
matched BCMNV sequences for which there was strong evidence of its occurrence]. For simplicity, virus names
were abbreviated: BCMNV ‘Bean common mosaic necrosis virus’, BCMV ‘bean common mosaic virus’,
PeMoV ‘peanut mottle virus’, SBMV ‘southern bean mosaic virus’, PvEV-1 ‘phaseolus vulgaris
alphaendornavirus 1’, PvEV-2 ‘Phaseolus vulgaris Endornavirus 2’, CPMMV ‘cowpea mild mottle virus’,
CMV ‘cucumber mosaic virus’, CMoV ‘carrot mottle virus’, CMoMV ‘carrot mottle mimic virus’, OPMV
‘Opium poppy mosaic virus’, ETBTV ‘Ethiopian tobacco bushy top virus’, TBTV ‘tobacco bushy top virus’,
CABMV ‘cowpea aphid-borne mosaic virus’, SMV ‘soybean mosaic virus’, BnYDV ‘bean yellow disorder
virus’, NCMV ‘northern cereal mosaic virus’, ToLCArV ‘tomato leaf curl Arusha virus’, ToLCYTV ‘tomato
leaf curl Mayotte virus’, ToLCUV ‘tomato leaf curl Uganda virus’, TMoV ‘tobacco mottle virus’, RuFDV
‘rudbeckia flower distortion virus’, HRLV ‘horseradish latent virus’, CERV ‘carnation etched ring virus’,
Page 53 of 53
EVCV ‘eupatorium vein clearing virus’, MMV ‘mirabilis mosaic virus’; DMV ‘dahlia mosaic virus’, SbCMV
‘soybean chlorotic mottle virus’, PEMV-2 ‘pea enation mosaic virus-2’, GRV ‘groundnut rosette virus’, SVBV
‘strawberry vein banding virus’ and SPuV ‘soybean Putnam virus’.

PaperBCMV6 28 18

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

PaperBCMV6 28 18

Uploaded by

Copyright:

Available Formats

Page 1 of 53

4 Beatrice Mwaipopo1,2, Susan Nchimbi-Msolla2, Paul J. R. Njau2, Deogratius Mark1, Deusdedith

9 Chuo Kikuu, Morogoro, Tanzania.

10 Corresponding author: D. R. Mbanzibwa; E-mail: mbanzibwad@yahoo.co.uk

14 vulgaris L.) production in Tanzania. Disease management requires information on types,

17 technique enabled simultaneous detection of 15 viruses belonging to 11 genera. De novo

Beatrice Mwaipopo Plant Disease 1

28 strategies for management of virus diseases nationally and internationally.

30 Tanzania is the largest producer (>1,000,000 tonnes annually) of common bean

41 (Hillocks et al. 2006).

Beatrice Mwaipopo Plant Disease 2

54 Alphaendornavirus – phaseolus vulgaris alphaendornavirus 1 (PvEV-1) and phaseolus vulgaris

55 alphaendornavirus 2 (PvEV-2) – and CPMMV, a disease-causing virus, were detected in seeds

Beatrice Mwaipopo Plant Disease 3

71 been comprehensively studied.

82 sequencing techniques were employed to universally and simultaneously detect viruses in

89 any other common bean viruses (Mwaipopo et al. 2017).

Beatrice Mwaipopo Plant Disease 4

94 development of diagnostic tools.

95 Materials and Methods

105 (v. 2.6) available at http://qgis.osgeo.org/en/site/.

Beatrice Mwaipopo Plant Disease 5

Beatrice Mwaipopo Plant Disease 6

137 UV–vis spectrophotometer (Thermo Scientific, Wilmington, DE, USA).

138 Complementary DNA synthesis. The first-strand complementary DNA (cDNA)

150 individually by RT-PCR to identify the infected plant samples.

Beatrice Mwaipopo Plant Disease 7

160 sequencing were BCMVFcpF1/BCM-NVcommonR or BCMVFcpF1/BCMVFcpR1 and

161 BCMNVFcpF2/BCM-NVcommonR or BCMNVF1/BCMNVR1, respectively (Table 1). The

173 done at 72°C for 10 min.

175 determination of incidence using primer pairs BCMNVF1/BCMNVR1 and BCMV1F/BCMV1R,

176 respectively. To a 0.2-ml tube containing AccuPower® PCR PreMix, 15 µl of diethyl

Beatrice Mwaipopo Plant Disease 8

186 district (Sseruwagi et al. 2004).

191 manufacturers’ instructions, and then sequenced on both strands.

Beatrice Mwaipopo Plant Disease 9

226 Supplementary Table S1.

Beatrice Mwaipopo Plant Disease 10

239 comparisons were made to previously annotated sequences.

248 Kigoma Region of the western zone.

Beatrice Mwaipopo Plant Disease 11

260 symptoms were observed in all common bean fields.

Beatrice Mwaipopo Plant Disease 12

275 areas in fields.

281 southern highlands zones.

292 sequence database.

294 Sobemovirus (unassigned), Alphaendornavirus (Endornaviridae), Carlavirus (Betaflexiviridae),

Beatrice Mwaipopo Plant Disease 13

295 Cucumovirus (Bromoviridae), Umbravirus (Tombusviridae), Crinivirus (Closteroviridae),

296 Begomovirus (Geminiviridae), Cytorhabdovirus (Rhabdoviridae), and Caulimovirus and

Beatrice Mwaipopo Plant Disease 14

326 begomovirus was found in only one common bean sample.

Beatrice Mwaipopo Plant Disease 15

Beatrice Mwaipopo Plant Disease 16

364 symptoms on leaves.

382 nucleotide and amino acid levels, respectively (Table 4B).

Beatrice Mwaipopo Plant Disease 17

400 used in this work are being used in other studies.

Beatrice Mwaipopo Plant Disease 18

425 detection of viruses e.g. CPMMV, SBMV and ToLCUV-related begomovirus.

Beatrice Mwaipopo Plant Disease 19

452 were commonplace in common bean fields.

Beatrice Mwaipopo Plant Disease 20