BioControl (2015) 60:495–505

DOI 10.1007/s10526-015-9656-5

Phylogenetic diversity of Brazilian Metarhizium associated

with sugarcane agriculture
Janayne Maria Rezende • Ana Beatriz
Riguetti Zanardo • Mariana da Silva Lopes •

Italo Delalibera Jr. • Stephen A. Rehner

Received: 30 July 2014 / Accepted: 23 January 2015 / Published online: 1 February 2015
Ó International Organization for Biological Control (IOBC) 2015

Abstract Biological control of spittlebugs with
Metarhizium (Hypocreales: Clavicipitaceae) in Bra-
zilian sugarcane is an example of effective pest
management. However, little is known about the
richness, distribution and ecology of Metarhizium
species in Brazilian agroecosystems. We investigated
Metarhizium diversity within a collection of 96
Brazilian isolates from spittlebugs and other insects,
strains used for spittlebug control and soil isolates
from sugarcane and other field crops and pristine
habitats. A multilocus phylogenetic analysis of 50 -TEF
and nuclear intergenic loci MzFG543igs and MzIGS3
yielded robust support for current species limits of the
two most abundant taxa, Metarhizium anisopliae and
Metarhizium robertsii, and the resolution of two
lineages that lie beyond currently recognized species
limits in this complex. With a single exception, all
isolates from insects belong to a single subclade of M.
anisopliae. These data will serve as resources about
Metarhizium biodiversity for insect biological control
initiatives in South America.
Keywords Hypocreales  Clavicipitaceae 
Biological control  Entomopathogenic fungi 
Molecular characterization  Phylogeny
Introduction

Handling Editor: Helen Roy.

Electronic supplementary material The online version of
this article (doi:10.1007/s10526-015-9656-5) contains supple-
mentary material, which is available to authorized users.
J. M. Rezende (&)  A. B. R. Zanardo  M. da Silva
Lopes  I. Delalibera Jr.
Department of Entomology and Acarology, Luiz de
Queiroz College of Agriculture (ESALQ) – University of
São Paulo, Av. Padua Dias, 11, P.O. Box 9, Piracicaba,
São Paulo 13418-900, Brazil
e-mail: janaynerezende@gmail.com
S. A. Rehner
USDA-ARS Systematic Mycology and Microbiology
Laboratory, 10300 Baltimore Ave. Bldg 010A, Rm 213,
BARC-W, Beltsville, MD 20705, USA
Brazil is the world’s largest producer and consumer of
agricultural mycopesticides (Li et al. 2010) for insect
control. Commercial and non-commercial products
based on Metarhizium anisopliae (Metchn.) Sorokin
(Ascomycota: Hypocreales: Clavicipitaceae) are used
mainly against grass-feeding spittlebugs (Hemiptera:
Cercopidae), including Mahanarva fimbriolata (Stal
1854), M. posticata (Stal 1855), Deois flavopicta (Stal
1854) and Notozulia entreriana (Berg 1879), which
often infest sugarcane and pastures in Brazil (Alves
1998). Metarhizium anisopliae mycoinsecticides have
been shown to provide effective levels of control
against spittlebug pests, and it is estimated that M.
anisopliae s.l. strains are applied annually to more
than 2 million ha of Brazilian sugarcane fields

123
496
(Batista Filho et al. 2003). Also, there is to exists
significant potential to increase the market for M.
anisopliae mycoinsecticides considering the growth in
acreage allocated to sugarcane in Brazil, which in
2013–2014 totaled 8.810 million ha, and the simulta-
neous increase in the damage caused by spittlebugs in
this crop (CONAB 2013).
Evolving agricultural practices have shifted the
dynamics of sugarcane pest populations. Tradition-
ally, sugarcane fields were subjected to pre-harvest
burning to remove foliage and stem material. Due to
concerns about the environmental and human health
impacts of smoke pollution, atmospheric carbon
pollution, the destruction of soil biota and thermal
degradation of soil structure (Souza et al. 2012), the
practice of pre-harvest burning is being replaced by
mechanized harvest (Galdos et al. 2013). However,
annual reductions in pest populations associated with
burning no longer occur, and spittlebug populations
have increased in sugarcane fields where mechanical
harvesting has been adopted (Cheavegatti-Gianotto
et al. 2011).
Sugarcane fields infested with spittlebugs fre-
quently suffer drastic reductions in production yield
and quality. The most significant damage is caused by
immature spittlebugs, which deprive roots of water
and nutrients, causing water stress that predisposes
plants to stem-cracking and physiological deteriora-
tion. Adult spittlebugs cause foliar damage that, in
addition to the damage caused by immatures, weaken
plant’s resistance to other pathogens and pests (Garcia
et al. 2006). The use of chemical pesticides to control
spittlebug populations in mechanically managed fields
is expensive and difficult to implement due to the
dense aerial growth of the crop. Moreover, concerns
about effects of pesticides on human, animal and
environmental health have motivated the search for
more environmentally compatible strategies for con-
trolling these insects, with indigenous Metarhizium
isolates currently the most widely investigated.
Despite widespread adoption of M. anisopliae s.l.
for use in spittlebug control, little is known about the
diversity, distribution and ecology of Metarhizium
species in either natural or agricultural environments
of Brazil. Most Metarhizium strains used for research
and in biopesticide formulations are identified based
on morphological criteria, although it has been shown
that accurate identification of the nine currently
recognized species in the M. anisopliae s.l. complex
123
J. M. Rezende et al.
requires the use of diagnostic nucleotide characters
(Bischoff et al. 2009). To date, only a limited number
of studies have definitively identified Brazilian Meta-
rhizium strains using contemporary sequence-based
methods. Eight Metarhizium species have been doc-
umented to occur in Brazil using the 50 intron-
containing region of translation elongation factor
1-alpha (50 -TEF) as the species identification diag-
nostic (Bischoff et al. 2009), including M. anisopliae
s.s., M. pemphigi (Driver & R.J. Milner) Kepler, S.A.
Rehner & Humber, comb. et stat. nov. (=M. flavoviride
var. pemphigi), M. lepidiotae (Driver & Milner) J.F.
Bisch., Rehner & Humber, M. pingshaense Q.T. Chen
& H.L. Guo and Metarhizium robertsii J.F. Bisch.,
Rehner & Humber, M. acridum (Driver & Milner) J.F.
Bisch., Rehner & Humber, M. brunneum Petch, M.
majus (J. Johnston) J.F. Bisch., Rehner & Humber
(Lopes et al. 2013a, b, 2014; Rocha et al. 2013). M.
guizhouense Q.T. Chen & H.L. Guo and M. globosum,
have not been reported from Brazil. The newly
proposed definition of Metarhizium by Kepler et al.
(2014) integrates the classification of sexual and
asexual states, which includes the majority of species
recognized in Metacordyceps (sensu Sung et al. 2007),
the green-spored species in Nomuraea, the genus
Chamaeleomyces and several species formerly
included in Paecilomyces. In accordance with this
recent revision, other species that are now classified in
the Metarhizium genus and occur in Brazil include
Metarhizium rileyi, and the species nov M. brasilense
Kepler, S.A. Rehner & Humber (=M. flavoviride
‘‘Type E’’).
Rocha et al. (2013) reported a predominance of the
M. anisopliae s.l. lineage (sensu Bischoff et al. 2009)
among soil isolates from central Brazilian savannah
(Cerrado) habitats. Whether the M. anisopliae lineage
similarly predominates in other Brazilian biomes and
agroecosystems is unknown. Furthermore, multiple 50 -
TEF haplotypes were reported among the M. anisop-
liae lineage strains characterized by Rocha et al.
(2013). It is not known if these novel 50 -TEF
haplotypes either represent cryptic species-level phy-
logenetic partitions or intraspecific allelic variants,
thus further investigation of species limits is needed.
In this study, we investigated Metarhizium species
diversity in Brazil within a collection of 96 isolates
representing: (1) soil and spittlebug isolates from
sugarcane fields, (2) commercially registered and non-
commercial research and locally selected indigenous
Phylogenetic diversity of Brazilian Metarhizium
strains used for biological control of spittlebugs, and
(3) isolates sampled from terrestrial insects and soils
from different sites throughout Brazil. The chief aim
of this study was to determine which Metarhizium
species are associated with sugarcane agriculture,
particularly those that are pathogens of spittlebugs,
and to assess their relationship to Metarhizium from
non-agricultural habitats. Species assignment of iso-
lates was determined using 50 -TEF sequences. Addi-
tionally, complementary data for a subset of isolates
was generated for two nuclear intergenic markers,
MzFG543igs and MzIGS3 (Kepler and Rehner 2013).
These latter two markers were used to verify the 50 -
TEF species identifications and to place these isolates
within a more robust phylogenetic context. Together
these data will serve as resources for routine identi-
fication and ongoing discovery and characterization of
indigenous Metarhizium biodiversity in Brazil and
elsewhere in South America.
Materials and methods
Fungal isolates
Ninety-six Metarhizium isolates from Brazil were
examined in this study (Table S1, supplementary
material) and include: (1) thirty-seven isolates asso-
ciated with sugarcane cropping systems, including two
commercially registered mycoinsecticidal strains
(ESALQ 1604, isolated from Biotech GÒ produced
by Biotech Controle Biológico and ESALQ 1605
Metarriz BiocontrolÒ, produced by Biocontrol Siste-
ma de Controle Biológico Ltda, Brazil), three isolates
from soil from sugarcane fields and thirty-two isolated
from mycosed spittlebugs that includes nine non-
registered indigenous strains produced in-farm for
spittlebug control, (2) fifteen isolates isolated from
other insect species and (3) forty-four isolates sampled
from soil from different sites throughout Brazil,
including Amazon, Cerrado (Brazilian Savanna),
Caatinga and Pampa biomes. Soil isolations were
performed either using the semi-selective medium
CTC1T (Fernandes et al. 2010), dodine-based selec-
tive media PDAY (Rangel et al. 2010) or insect baiting
with larvae of either Galleria mellonella L. 1758
(Lepidoptera: Pyralidae) or Tenebrio molitor L. 1758
(Coleoptera: Tenebrionidae) (Zimmermann 1986;
Meyling and Eilenberg 2006). Stocks of these cultures
497
are maintained in the Collection of Entomopathogenic
Microorganisms ‘‘Prof. Sérgio Batista Alves’’, Col-
lege of Agriculture Luiz de Queiroz (ESALQ), Brazil,
as lyophilized conidia stored at -40 °C.
DNA extraction, PCR and amplicon sequencing
Fungal isolates were grown in 100 ml SDY/4 liquid
medium (2.5 g l-1 bactopeptone, 10 g l-1 dextrose,
2.5 g l-1 yeast extract) in Erlenmeyer flasks on an
orbital shaker at 125 rpm at 26 °C for 5–7 days.
Mycelium was harvested by filtration, washed with
sterile distilled water and frozen at -20 °C. Frozen
mycelium was pulverized under liquid nitrogen in a
mortar and pestle, and the powder transferred to
microcentrifuge tubes containing 0.6 ml lysis buffer
(0.2 M Tris–HCl pH 8.0, 0.25 M NaCl, 0.025 M
EDTA, 1 % SDS). The samples were suspended by
vortexing and incubated 30 min at 65 °C. An equal
volume of phenol:chloroform (1:1) was added, mixed
thoroughly, and centrifuged to separate the aqueous,
particulate and organic phases. The aqueous layer was
transferred to a new tube and mixed with an equal
volume of chloroform, and the phases were separated
by centrifugation. Approximately 500 ll of the aque-
ous supernatant was transferred to a fresh tube, and the
DNA was precipitated with an equal volume of
isopropyl alcohol and 1/10 volume 5 M potassium
acetate. The DNA precipitate was collected by cen-
trifugation, rinsed with 70 % ethanol, air dried and
then resuspended in 0.05 ml of nuclease-free water.
RNA was removed by digestion with 3 ll RNase A
(10 mg ml-1) at 37 °C for 30 min. Genomic DNA
quality was assessed on a 1 % agarose gel and
quantitated approximately by comparison to Lambda
DNA/Hind III marker standards. Nuclear loci ana-
lyzed in this study include 50 -TEF (Bischoff et al.
2009) and the nuclear intergenic spacer regions
MzIGS3 and MzFG543igs (Kepler and Rehner
2013). The nuclear 50 -TEF locus was amplified and
sequenced for all isolates with the primers EF1T (50 -
ATGGGTAAGGARGACAAGAC) and EF2T (50 -
GGAAGTACCAGTGATCATGTT) according to
Bischoff et al. (2009). PCR amplification and sequenc-
ing of nuclear intergenic loci MzIGS3 and
MzFG543igs followed Kepler and Rehner (2013)
using the primer pairs MzIGS3_1F (50 -CGTGGCTCC
TGACCATGGTTGC) 9 MzIGS3_4R (50 -GCGGGG
GAGCCGACTTGGA) and MzFG543igs_2F (50 -TCT
123
498
CTACAACCGTACCCGACA) 9 MzFG543igs_6R
(50 -GATAGCTCGCCTTCTGCCTTG), respectively.
In cases where these primer combinations failed,
either primer pairs MzIGS3_2F (50 - GTGGCTCCTG
ACCATGGTTGC) 9 MzIGS3_4R, MzFG543igs_1F
(50 - ATTCATTCAGAACGCCTCCAA) 9 MzFG54
3igs_6R, MzFG543igs_1F 9 MzFG543igs_5R (50 -
GTTGGTTGCGACTGAGAATCC) or MzFG543igs_
2F 9 MzFG543igs_5R were substituted. Sequence
haplotype variation at MzFG543igs and MzIGS3
among the 96 isolates sample was determined by
sequencing all isolates on a single strand with primers
MzFG543igs_3F (50 -TGGTRTAACCRGCGAGA
CA) and MzIGS3_2F, respectively (data not shown).
Full-length FG43 and MzIGS3 sequences were
obtained using template-appropriate internal primers,
including MzIGS3_2F, MzIGS3_5R (50 -TGARGGC-
TATGCSGGACGG), MzFG543igs_2F and
MzFG543igs_5R. Sequencing reactions were ethanol
precipitated, suspended in Hi-Di formamide and run
on an ABI3730 DNA Analyzer (Applied Biosystems).
Multiple sequence alignment and phylogenetic
analysis
Sequences were assembled and edited using either
CodonCodeAligner 3.7.1 (CodonCode, Dedham, MA,
USA) or Sequencher 5.0 (Gene Codes Corp., Ann
Arbor, MI, USA). Multiple sequence alignments were
constructed with MAFFT version 7 (Katoh and
Standley 2013; webserver at http://mafft.cbrc.jp/
alignment/server/) implementing the FFT-NS-i align-
ment option. Sequence matrices were constructed for
two phylogenetic analyses presented here: (1) a 50 -
TEF matrix was constructed to assess the diversity of
96 isolates reported in this study, also included were
17 50 -TEF sequence haplotypes inclusive of diversity
reported in a survey of Metarhizium in Brazilian
Cerrado by Rocha et al. (2013) and (2) a combined
matrix of 50 -TEF, MzIGS3 and MzFG543igs for a
subset of 30 individuals from this study. Selection of
the 30 isolates included all haplotype diversity
detected at the three loci based on the 50 -TEF sequence
survey and single strand sequencing of variable
regions at MzFG543igs and MzIGS3 (unpublished).
Each data set also included ten previously determined
sequences from ex-type cultures or taxonomically
authenticated reference isolates for seven of the nine
M. anisopliae complex species currently recognized
123
J. M. Rezende et al.
(Bischoff et al. 2009; Kepler and Rehner 2013),
including M. anisopliae, M. brunneum, M. guizhou-
ense, M. lepidiotae, M. majus, M. pingshaense and M.
robertsii. Each data set was analyzed under maximum
likelihood with RAxML (Stamatakis 2006) imple-
menting GTRGAMMA model parameters and a
thousand bootstrap replicates (Stamatakis et al. 2008).
The 50 -TEF, MzFG543igs and MzIGS3 sequences
were concatenated, and a maximum likelihood ana-
lysis was performed as above with each locus run as a
separate partition.
Results
Diversity, taxonomic assignment and phylogeny
of Metarhizium isolates
A 50 -TEF sequence survey revealed ten sequence
haplotypes among the 96 Brazilian isolates introduced
here. Maximum likelihood phylogenetic analysis of
these data resolved nine terminal groups, seven of
which cluster within the currently recognized limits of
the M. anisopliae s.l. and M. robertsii s.l. species
lineages and two additional taxonomically unassigned
lineages that are referred to here as Metarhizium sp.
indet. 1 and Metarhizium sp. indet. 2 (Fig. 1). Meta-
rhizium anisopliae s.l. (n = 71) constituted the major-
ity of isolates, and these isolates form a well-supported
monophyletic group that included three sequence
haplotypes, with the Brazilian isolates either cluster-
ing with the M. anisopliae s.s. ex-type strain ARSEF
7,487 (n = 3) or the reference isolate ARSEF 6,347
(n = 65) sequence haplotypes, and these are referred
to henceforth as Mani 1 and Mani 2, respectively, and
a novel third haplotype, Mani 3 (n = 2). Mani 1
included one additional haplotype (ESALQ 1607) that
differed from the ex-type strain ARSEF 7487 by 1 bp
(99.9 % similarity). Within M. anisopliae s.l. only the
Mani 2 clade received significant bootstrap support.
M. robertsii s.l. 50 -TEF sequence diversity included
four sequence haplotypes, referred to as Mrob 1
(n = 7), Mrob 2 (n = 6), Mrob 3 (n = 4) and Mrob 4
(n = 2), which together formed a robustly supported
monophyletic group. Mrob 1 and Mrob 2 clustered
with reference isolates ARSEF 727 and ARSEF 7501,
respectively, in addition to two novel haplotypes,
Mrob 3 and Mrob 4. Only Mrob 2 and Mrob 4 received
significant bootstrap support. Metarhizium sp. indet. 1
Phylogenetic diversity of Brazilian Metarhizium 499

Fig. 1 Maximum 92
M. lepidiotae ARSEF 7488
M. majus ARSEF1914
likelihood phylogeny of 50 - Metarhizium sp. indet. 2 ESALQ 1636
M. guizhouense CBS258.90
TEF including 96 Brazilian M. brunneum ARSEF 2107
M. pingshaense CBS25.790
76 ESALQ 1632 Mrob 4
Metarhizium isolates from ESALQ 1635
86 ESALQ 1621
the ESALQ culture IP145
97 ESALQ 1633 Mrob 3
collection, 16 50 -TEF ESALQ 1622
ESALQ 1629
sequence haplotypes ARSEF 7501
87 ESALQ 1619
86
reported by Rocha et al. ESALQ 1630
ESALQ 1618
(2013) (IPxxx strain codes) IP125 Mrob2
and from nine ESALQ 1620 Metarhizium robertsii s.l.
ESALQ 1631
ESALQ 1634
taxonomically validated IP348
IP146
reference strains ESALQ 1627
ESALQ 1625
accessioned in ARSEF ESALQ 1628
Mrob 1
ESALQ 1426
(ARS Entomopathogenic ESALQ 1623
ESALQ 1626
Fungal Culture Collection). ESALQ 1624
ARSEF 727
Bootstrap support values IP118
IP60
C70 % are listed above 94 IP86
IP30
branches IP101
IP120
IP63
IP71
IP106
IP90
Metarhizium sp. indet. 1
IP16
IP46
97 ESALQ 1608
ESALQ 1639
ESALQ 1637
ESALQ 1374
ESALQ 1638
ESALQ 1607
ESALQ 1592
IP119 Mani 1
ESALQ 1615
81 ESALQ 1616
ARSEF 7487
ESALQ 1617
ESALQ 1614
Mani 3
ESALQ 867
ESALQ 1452
70 ESALQ 1641
ESALQ 333
ESALQ 374
ESALQ 391
ESALQ 1473
ESALQ 1594
ESALQ 1605
ESALQ 1643
ESALQ 1462
ESALQ 1610
ESALQ 1598
ESALQ 319
ESALQ 1097
ESALQ 1640
ESALQ 1606
ESALQ 1593
ESALQ 1602
ESALQ 1184
ESALQ 353
ESALQ 1022
ESALQ 1597
ESALQ 1405
ESALQ 385
ESALQ 1596
ESALQ 1604
ESALQ 1601
ESALQ 26
ESALQ 1595
Metarhizium anisopliae s.l.
ESALQ 1603
ESALQ 1613
ESALQ 935
ESALQ 1464 Mani 2
ESALQ 818
ESALQ 1247
ESALQ 412
ESALQ 1076
ESALQ 1116
ESALQ 816
ESALQ 1204
ESALQ 1599
ESALQ 43
ESALQ 1175
ESALQ 1391
ARSEF 6347
ESALQ 860
ESALQ 1256
ESALQ 1642
ESALQ 959
ESALQ 425
ESALQ 1104
ESALQ 866
ESALQ 798
ESALQ 1644
ESALQ 1463
ESALQ 1444
ESALQ 334
ESALQ 1387
ESALQ 865
ESALQ 1600
ESALQ 1612
ESALQ 49
ESALQ 1611
ESALQ 1189
ESALQ 1037

123
500
was recovered at low frequency, and it was strongly
supported as the sister lineage to M. anisopliae.
Metarhizium sp. indet. 2, represented by the single
isolate ESALQ 1636, clusters with the M. majus and
M. guizhouense ex-type strains although its sequence
is divergent from both species.
Sequence surveys to identify nucleotide diversity at
MzFG543igs and MzIGS3 revealed 11 and 17 haplo-
types, respectively (data not shown; alignments
available on request). Phylogenies of both loci for
the subset of 30 exemplar isolates are provided as Figs.
S1 and S2, supplementary material. 50 -TEF, MzIGS3
and MzFG543igs sequences for these 30 exemplar
isolates are deposited in GenBank under accession
numbers KP027953–KP027982, KP028013–
KP028042 and KP027983–KP028012, respectively.
Notable points of congruence and incongruence
among the individual 50 -TEF, MzFG543igs and
MzIGS3 phylogenies include: (1) congruent and
significant support for the monophyly of both the M.
anisopliae s.l. and M. robertsii s.l. lineages by 50 -TEF
and MzFG543igs that conflict with the MzIGS3
topology, but the points of topological disagreement
in the MzIGS3 phylogeny are not significantly
supported; (2) the sister group relationship of M.
pingshaense and M. anisopliae s.l. (Mani 1 ? Mani
2 ? Mani 3) is significantly supported by
MzFG543igs but lacks significant support with both
50 -TEF and MzIGS3; (3) subclades Mani 1, 2 and 3 are
concordantly partitioned by all loci, although sister
group relationships and bootstrap support varies by
locus; and (4) significant conflict in the resolution of
Mrob 2 and Mrob 4 was observed between 50 -TEF and
MzIGS3. Apart from this single instance of conflicting
support values for branches within M. robertsii s.l., the
sequence partitions were deemed compatible and
concatenated for combined phylogenetic analysis.
The combined three-locus data set totaled 2,503 bp
and included 50 -TEF (664 bp), MzIGS3 (1,078 bp) and
MzFG543igs (761 bp) sequence partitions. The max-
imum likelihood tree of these data (Fig. 2) is consistent
with the topology of a four-locus analysis by Bischoff
et al. (Figure 1, 2009) and the 50 -TEF phylogeny
presented here. The monophyly of both M. anisopliae
s.l. and M. robertsii s.l. were highly supported (Fig. 2)
and both species contain two strongly supported
bipartitions, each including 50 -TEF that differ from
the reference sequences included from Bischoff et al.
(2009). Additionally, all supported terminal clades
123
J. M. Rezende et al.
include two or more multilocus sequence haplotypes,
demonstrating that strain-level discrimination is
achieved with this multi-locus approach.
Association of Metarhizium by habitat, host
and substrate
The most abundant clade reported in this study, M.
anisopliae Mani2 (n = 63), also had the widest
geographic distribution and was isolated from the
greatest number and diversity of natural and agricul-
tural habitats sampled. Moreover, Mani 2 isolates
accounted for all but one of the 43 isolates isolated
from insects, which included host species classified in
five insect orders (Blaberidae, Coleoptera, Hemiptera,
Hymenoptera, Lepidoptera) that originated from
diverse sites throughout Brazil as well as all 32
isolates isolated from spittlebug pests collected from
sugarcane fields. Both commercially registered Meta-
rhizium mycoinsecticide products, Biotech GÒ
(ESALQ 1604) and Metarriz BiocontrolÒ (ESALQ
1605), as well as nine isolates produced for in-farm use
are all members of Mani 2. Of the remaining 17 Mani 2
isolates two were isolated from native forest soils, five
from agricultural soils and ten from soils of unre-
corded habitats. Other M. anisopliae s.l. lineages
isolated from soil include all Mani 1 isolates, three
from forest and one from agricultural soils, and the
two Mani 3 isolates, both of which were isolated from
native forest soils. Metarhizium sp. indet. 1 (n = 3),
which is closely related to M. anisopliae s.l., with two
isolates from native forest soils, and a single isolate,
ESALQ 1374, was isolated from a hemipteran host
that is not known to be a sugarcane pest. M. robertsii
s.l. was the second most abundant and widely distrib-
uted species lineage detected (n = 19) and all isolates
were originated from soil, including three from
sugarcane fields, eight from other agricultural crop
soils and eight from native forest soils. Only one
isolate, ESALQ 1636, was assigned to the MGT clade.
Discussion
Adoption of identification-by-sequencing as the prin-
cipal means to categorize insect pathogenic fungi is
accelerating and unifying progress in elucidating their
diversity and landscape ecology (Steinwender et al.
2014; Nishi et al. 2011; Fisher et al. 2011; Carrillo-
Phylogenetic diversity of Brazilian Metarhizium
Fig. 2 Maximum
likelihood phylogeny of the
combined data set of 50 -
TEF, MzIGS3 and
MzFG543igs sequences for
30 Brazilian Metarhizium
isolates. Bootstrap support
values C70 % are listed
above branches
Benı́tez et al. 2013; Rocha et al. 2013; Lopes et al.
2013a, b). Here, we present results of a survey of
Metarhizium isolates from insects and soil originating
from agricultural and natural habitats of Brazil.
Sampling of Metarhizium in sugarcane agroecosys-
tems was emphasized to identify the species that
naturally occur in sugarcane fields and to determine
the identity of indigenous strains that are currently in
use to control spittlebug pests in Brazilian sugarcane
crops.
A principal finding of this study was the wide
geographic distribution and prominence of the M.
anisopliae s.l. Mani 2 subclade across the majority of
Brazilian habitats sampled. Among the isolates exam-
ined here, isolates of Mani 2 subclade originated from
14 Brazilian states, spanning an area of approximately
501
5.4 9 106 km2 or nearly 2/3 of Brazilian land area.
Significantly Mani2 isolates accounted for all but one
strain isolated from mycosed insects, including all
isolates from mycosed spittlebugs. Based on these
observations, Mani 2 would appear to be one of the
most abundant and widely circulating species infect-
ing terrestrial insect hosts throughout Brazil.
Metarhizium robertsii s.l. was the second most
abundant and geographically widespread species
group recovered and all isolates here were exclusively
from soil. These results, as well as those from several
recent studies, are consistent with a primarily soil-
based ecology for M. robertsii s.l. The species has
been shown to form stable associations with the roots
of plants (Bidochka et al. 2001; Wyrebeck et al. 2011;
Sasan and Bidochka 2012). Further, genome and
123
502
transcriptome analyses have demonstrated the conser-
vation and up-regulation of genes commonly associ-
ated with acquisition of plant-based carbohydrates and
their physiological interaction with plant roots (Wang
et al. 2005). Whereas plant roots appear to provide an
alternate trophic niche for M. robertsii s.l., this species
lineage has also been isolated from soils baited with
Phyllophaga capillata (Blanchard) (Coleoptera: Mel-
olonthidae) (Lopes et al. 2013b), G. mellonella and T.
molitor larvae (Steinwender et al. 2011), as well as
isolates from naturally infected insects (Lopes et al.
2014), thus confirming their innate ability and eco-
logical potential as entomopathogens. As further
evidence of their competence as insect pathogens, a
91 % mortality was observed in a laboratory bioassay
testing virulence by M. robertsii strain ESALQ 1426
against sugarcane spittlebug nymphs (J.M. Rezende,
data unpublished). Moreover, M. robertsii has been
shown to translocate nitrogen from insect cadavers to
plants via these rhizosphere associations (Behie et al.
2012), demonstrating an ability to coordinate both
symbiotic capacities simultaneously. Our results indi-
cate that Brazilian M. robertsii may be better adapted
as an entomopathogen in the soil as opposed to above-
ground. Efforts to understand the below-ground ecol-
ogy of Metarhizium are still in their initial phases and
the potential for M. robertsii s.l. both to enhance plant
growth while simultaneously providing protection
against soil insect pests warrants further investigation.
Increasing use of 50 -TEF sequence variation as the
principal identification diagnostic for Metarhizium
enables more objective comparison of Metarhizium
species reported among different studies. In a survey
closely relevant to this study, Rocha et al. (2013) used
insect baiting with Triatoma infestans (Klug 1834)
(Hemiptera: Reduviidae) to evaluate Metarhizium
diversity in native soils from Cerrado habitats in
Goiás State, Brazil. Among 63 soil isolates character-
ized by 50 -TEF sequencing, Rocha et al. (2013)
reported a community profile in which M. anisopliae
s.l. (n = 53) and M. robertsii s.l. (n = 8) were the
principal lineages recovered. We showed here (Fig. 1)
that the principal M. anisopliae lineage reported by
Rocha et al. (2013) is Metarhizium sp. indet 1.
Additional isolates with this haplotype have been
reported by Lopes et al. (2014). Although a minority
component of this study, Rocha et al. (2013) observed
substantially greater molecular diversity in Metarhiz-
ium sp. indet. 1 as evidenced by the 11 50 -TEF
123
J. M. Rezende et al.
haplotypes they reported, which included the single
haplotype observed here. In both studies, Metarhizium
sp. indet. 1 was isolated primarily from undisturbed
soils of native plant communities, perhaps indicating
an ecological association of this taxon with pristine
Cerrado soil habitats. Interestingly, Mani 2 was
conspicuously absent in the survey of Rocha et al.
(2013), whereas it was the predominant group reported
here. This discrepancy is noteworthy given the
widespread occurrence of Mani 2 throughout the
diverse agro-ecosystems and undisturbed native plant
communities reported here, which includes isolates
from the Cerrado biome (n = 7). Whether the differ-
ence in taxa isolated in these studies stems from
sampling bias introduced by the different isolation
methods employed or to habitat-dependent composi-
tional differences in the Metarhizium communities
sampled are important future questions.
In the study of Rocha et al. (2013) the M. robertsii
species lineage was also the second most abundant
species lineage recovered. Interestingly, the diversity
of 50 -TEF haplotypes recovered in both studies was
similar, except for the absence of Mrob 2 in Rocha
et al. (2013) and the absence here of a single haplotype
that in Rocha et al. (2013) was the sister to Mrob1 (i.e.,
IP146, IP348). Although few isolates were character-
ized in the studies of Lopes et al. (2013b) in the
Cerrado of Goiás State and by Carrillo-Benı́tez et al.
(2013) in Guanajuato, Mexico, their findings of both
M. anisopliae and M. robertsii is consistent with the
prevalence of these two lineages elsewhere in South
America. Additional sampling of Metarhizium across
habitats in South America will clarify species com-
position and community structure across this region.
In contrast to the predominance of the M. anisop-
liae s.l. and M. robertsii s.l. species lineages observed
in South America, Metarhizium communities else-
where often differ markedly in species composition
and structure. In Ontario, M. robertsii (n = 81), M.
brunneum (n = 15) and M. guizhouense (n = 11)
were the principal taxa reported from the rhizospheres
of indigenous vegetation by Wyrebek et al. (2011). In
Oregon, M. brunneum (n = 48), M. guizhouense
(n = 29), M. robertsii (n = 17) and M. pemphigi
(=M. flavoviride var. pemphigi) (n = 3) were shown to
occur in association with rhizospheres of perennial
herbs, shrubs and conifer nursery stock (Fisher et al.
2011). In Europe, Steinwender et al. (2011) identified
M. brunneum (n = 99), M. robertsii (n = 13) and M.
Phylogenetic diversity of Brazilian Metarhizium
majus (n = 4) in experimental research fields in
Denmark. Thus, Metarhizium communities in temper-
ate North America and Europe appear to be dominated
by either or both M. brunneum and M. robertsii with
M. anisopliae s.l. a minor component or absent
altogether. In Japan, Nishi et al. (2011) reported eight
species from soil, including M. pingshaense (n = 81),
M. pemphigi (=M. flavoviride var. pemphigi)
(n = 16), M. robertsii (n = 15), M. brunneum
(n = 14), M. lepidiotae (n = 8), M. guizhouense
(n = 5), M. anisopliae (n = 3) and M. majus
(n = 3). In view of these regional scale differences
in Metarhizium community structure, a principal
challenge for the future is to understand the underlying
historical, biotic and abiotic factors that interact to
determine community structure and what practical
implications this may hold for managing these organ-
isms for insect biological control.
In this research, we investigated the diagnostic and
phylogenetic utility of two nuclear intergenic markers,
MzIGS3 and MzFG543igs (Kepler and Rehner 2013)
that were specifically developed for species level
investigations within the M. anisopliae complex, or
PARB clade sensu Bischoff et al. (2009). Our chief
objective was to determine their usefulness for species
identification and phylogenetic reconstruction in
comparison to the current reference marker, 50 -TEF.
Among the isolates characterized here, MzFG543igs
performed on par with 50 -TEF, revealing similar levels
of haplotype variation and provided equivalent taxo-
nomic accuracy and phylogenetic resolution. In par-
ticular, MzFG543igs clearly resolves all currently
recognized species lineages. By contrast, MzIGS3,
although providing a greater degree of sequence level
differentiation among isolates, yields a weakly sup-
ported phylogeny that is incongruent with both 50 -TEF
and MzFG543igs topologies and that fails to support
the monophyly of either the M. anisopliae s.l. and M.
robertsii s.l. species lineages. The inability of MzIGS3
to replicate the consensus phylogeny for the PARB
clade complicates its use as a stand-alone tool for
species identification or phylogenetic analysis of
Metarhizium. In light of these results, continued use
of 50 -TEF as a primary marker for species identifica-
tion and diversity screening in this group is recom-
mended. Nevertheless, concatenation of the three
markers yields a highly resolved and well-supported
phylogeny of the PARB clade, demonstrating the
usefulness of these nuclear loci for species
503
identification, providing insight into intraspecific
genetic partitions and for the recognition and place-
ment of novel genetic diversity.
In this study, we revealed that although a large
diversity of Metarhizium haplotypes occur in Brazilian
soils, the abundance of the M. anisopliae s.l. Mani 2
subclade is remarkable, especially in sugarcane agri-
culture, accounting for all isolates from mycosed
spittlebugs and all strains currently used for spittlebug
control. The prevalence of this lineage in sugarcane
emphasizes the need for understanding its above- and
below-ground ecology and the interaction between
crop, host and pathogen in order to enhance beneficial
interactions between them.
Acknowledgments The first author is grateful to the National
Council for the Improvement of Higher Education (CAPES) and
National Council for Scientific and Technological Development
(CNPq) for research scholarship awards that supported this
project in Brazil and USA, respectively. This work was partly
supported by the research project SISBIOTA BRASIL (FAPs
N8 47/2010) from CNPq (Grant N8 563233/2010-9) and
FAPESP (Grant N8 2010/52342-4). We thank Veronica
Martins for laboratory assistance. The authors declare no
conflict of interest. The mention of trade products or company
or firm names does not imply that the U.S. Department of
Agriculture recommends them over similar products or
companies not mentioned.
References
Alves SB (1998) Controle Microbiano de Insetos. FEALQ, Pi-
racicaba, Brazil
Batista Filho A, Almeida JEM, Santos AS, Machado LA, Alves
SB (2003) Eficiência de isolados de Metarhizium anisop-
liae no controle de cigarrinha-da-raiz da cana-de-açúcar
Mahanarva fimbriolata (Hom.: Cercopidae). Arq Inst Biol
70:309–314
Behie SW, Zelisko PM, Bidochka MJ (2012) Endophytic insect-
parasitic fungi translocate nitrogen directly from insects to
plants. Science 336:1576–1577
Bidochka MJ, Kamp AM, Lavender TM, Dekoning J, De Croos
JNA (2001) Habitat association in two genetic groups of
the insect-pathogenic fungus Metarhizium anisopliae:
uncovering cryptic species? Appl Environ Microbiol
67:1335–1342
Bischoff JF, Rehner SA, Humber RA (2009) A multilocus
phylogeny of the Metarhizium anisopliae lineage. Myco-
logia 101:512–530
Carrillo-Benı́tez MG, Guzmán-Franco AW, Alatorre-Rosas R,
Enrı́quez-Vara JN (2013) Diversity and genetic population
structure of fungal pathogens infecting white grub larvae in
agricultural soils. Microbiol Ecol 65:437–449
123
504
Cheavegatti-Gianotto A, Abreu HMC, Arruda P, Bespalhok
Filho JC, Burnquist WL, Creste S, di Ciero L, Ferro JA,
Figueira AVO, Filgueiras TS, Grossi-de-Sá MF, Guzzo
EC, Hoffmann HP, Landell MGA, Macedo N, Matsuoka S,
Reinach FC, Romano E, Silva WJ, Silva Filho MC, Ulian
EC (2011) Sugarcane (Saccharum 9 officinarum): a ref-
erence study for the regulation of genetically modified
cultivars in Brazil. Trop Plant Biol 4:62–89
CONAB (2013) Companhia Nacional de Abastecimento. In:
Acompanhamento de safra brasileira: cana-de-açúcar,
terceiro levantamento, dezembro/2013—Companhia Nac-
ional de Abastecimento. Brası́lia, Brazil: Conab 2013.
http://www.conab.gov.br
Fernandes EKK, Keyser CA, Rangel DEN, Foster RN, Roberts
DW (2010) CTC medium: A novel dodine-free selective
medium for isolating entomopathogenic fungi, especially
Metarhizium acridum, from soil. Biol Control 54:197–
205
Fisher JJ, Rehner SA, Bruck DJ (2011) Diversity of rhizosphere
associated entomopathogenic fungi of perennial herbs,
shrubs and coniferous trees. J Invertebr Pathol 106:
289–295
Galdos M, Cavalett O, Seabra JEA, Nogueira LAH, Bonomi A
(2013) Trends in global warming and human health
impacts related to Brazilian sugarcane ethanol production
considering black carbon emissions. Appl Energy 104:
576–582
Garcia JF, Botelho PSM, Parra JRP (2006) Biology and fertility
life table of Mahanarva fimbriolata (Stal) (Hemiptera:
Cercopidae) in sugarcane. Sci Agric 63:317–320
Katoh K, Standley DM (2013) MAFFT multiple sequence
alignment software version 7: improvements in perfor-
mance and usability. Mol Biol Evol 30:772–780
Kepler RM, Rehner SA (2013) Genome-assisted development
of nuclear intergenic sequence markers for entomopatho-
genic fungi of the Metarhizium anisopliae species com-
plex. Mol Ecol Resour 13:210–217
Kepler RM, Humber RA, Bischoff JF, Rehner SA (2014)
Clarification of generic and species boundaries for Meta-
rhizium and related fungi through multigene phylogenetics.
Mycologia 106:811–829
Li Z, Alves SB, Roberts DW, Fan M, Delalibera I, Tang J, Lopes
RB, Faria M, Rangel DEM (2010) Biological control of
insects in Brazil and China: history, current programs and
reasons for their success using entomopathogenic fungi.
Biocontrol Sci Tech 20:117–136
Lopes RB, Mesquita ALM, Tigano MS, Souza DA, Martins I,
Faria M (2013a) Diversity of indigenous Beauveria and
Metarhizium spp. in a commercial banana field and their
virulence toward Cosmopolites sordidus (Coleoptera:
Curculionidae). Fungal Ecol 6:356–364
Lopes RB, Souza DA, Oliveira CM, Faria M (2013b) Genetic
diversity and pathogenicity of Metarhizium spp. associated
with the white grub Phyllophaga capillata (Blanchard)
(Coleoptera: Melolonthidae) in a soybean field. Neotrop
Entomol 42:436–438
Lopes RB, Faria M, Souza DA, Bloch Jr. C, Silva LP, Humber
RA (2014) MALDI-TOF mass spectrometry applied to
identifying species of insect-pathogenic fungi from the
Metarhizium anisopliae complex. Mycologia 106:865–
878
123
J. M. Rezende et al.
Meyling NV, Eilenberg J (2006) Occurrence and distribution of
soil borne entomopathogenic fungi within a single organic
agroecosystem. Agric Ecosyst Environ 113:336–341
Nishi O, Hasegawa K, Iiyama K, Yasunaga-Aoki C, Shimizu S
(2011) Phylogenetic analysis of Metarhizium spp. isolated
from soil in Japan. Appl Entomol Zool 46:301–309
Rangel DEN, Dettenmaier SJ, Fernandes EKK, Roberts DW
(2010) Susceptibility of Metarhizium spp. and other
entomopathogenic fungi to dodine-based selective media.
Biocontrol Sci Tech 20:375–389
Rocha LFN, Inglis PW, Humber RA, Kipnis A, Luz C (2013)
Occurrence of Metarhizium spp. in Central Brazilian soils.
J Basic Microbiol 53:251–259
Sasan RK, Bidochka MJ (2012) The insect-pathogenic fungus
Metarhizium robertsii (Clavicipitaceae) is also an endo-
phyte that stimulates plant root development. Am J Bot
99:101–107
Souza RA, Telles TS, Machado W, Hungria M, Filho JT (2012)
Effects of sugarcane harvesting with burning on the
chemical and microbiological properties of the soil. Agric
Ecosyst Environ 155:1–6
Stamatakis A (2006) RAxML-VI-HPC: Maximum likelihood-
based phylogenetic analyses with thousands of taxa and
mixed models. Bioinformatics 22:2688–2690
Stamatakis A, Hoover P, Rougemont J (2008) A rapid bootstrap
algorithm for the RAxML Web-Servers. Syst Biol
57:758–771
Steinwender BM, Enkerli J, Widmer F, Eilenberg J, Meyling
NV (2011) Molecular diversity of the Metarhizium ani-
sopliae lineage in an agricultural field. IOBC/WPRS Bull
66:113–115
Steinwender BM, Enkerli J, Widmer F, Eilenberg J, Thorup-
Kristenson K, Meyling NV (2014) Molecular diversity of
the entomopathogenic fungal Metarhizium community
within an agroecosystem. J Invertebr Pathol 123:6–12
Sung G-H, Hywel-Jones NL, Sung J-M, Luangsa-ard JJ,
Shrestha B, Spatafora JW (2007) Phylogenetic classifica-
tion of Cordyceps and the clavicipitaceous fungi. Stud
Mycol 57:5–59
Wang C, Hu G, St. Leger R (2005) Differential gene expression
by Metarhizium anisopliae growing in root exudates and
host (Manduca sexta) cuticle or hemolymph reveals
mechanism of physiological adaptation. Fungal Genet Biol
42:704–718
Wyrebeck M, Huber D, Sasan RK, Bidochka MJ (2011) Three
sympatrically occurring species of Metarhizium show plant
rhizosphere specificity. Microbiology 157:2904–2911
Zimmermann G (1986) The Galleria bait method for detection
of entomopathogenic fungi in soil. J Appl Entomol
102:213–215
Janayne Maria Rezende has a PhD in Entomology. The
presented work was part of her PhD thesis, devoted to the
phylogenetic diversity and expression of virulence genes of
Metarhizium focusing on Brazilian strains associated with
sugarcane crops.
Ana Beatriz Riguetti Zanardo is a PhD candidate in
entomology studying the diversity and abundance of the
Hypocrealean fungi in five Brazilian biomes.
Phylogenetic diversity of Brazilian Metarhizium
Mariana da Silva Lopes is an undergraduate student in
biology. The first three authors were students under supervision
of Dr. Italo Delalibera Jr., professor in the Department of
Entomology and Acarology at University of São Paulo in
Piracicaba-SP, Brazil.
Dr. Italo Delalibera Jr. teaches undergraduate courses in
Zoology and graduate courses in Arthropod Pathology and
505
Microbial Control of Pests. His main research is microbe—
arthropod interactions, with emphasis on microbial control of
agricultural pests using entomopathogenic fungi.
Stephen A. Rehner is a USDA-ARS scientist and studies the
phylogenetics, population genetics and molecular ecology of
entomopathogenic fungi, most notably Metarhizium and
Beauveria.
123