See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/292176812

Systematic review on Endolimax nana: A less well studied intestinal ameba

Article · January 2016

DOI: 10.4103/2229-5070.175077

CITATIONS READS

5 1,287

2 authors:

Casper Sahl Poulsen Christen Rune Stensvold

Technical University of Denmark Statens Serum Institut
6 PUBLICATIONS   44 CITATIONS    194 PUBLICATIONS   3,451 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Global Water Pathogen Project View project

Escherichia coli in Inflammatory Bowel Disease View project

All content following this page was uploaded by Christen Rune Stensvold on 29 March 2016.

The user has requested enhancement of the downloaded file.

Vol 6/ Issue 1/ January 2016
Tropical Parasitology • Volume 6 • Issue 1 • January-June 2016 • Pages 01-000
 Review Article

Systematic review on Endolimax nana: A less well studied intestinal

ameba
Casper Sahl Poulsen, Christen Rune Stensvold
Department of Microbiology and Infection Control, Laboratory of Parasitology, Statens Serum Institut, Copenhagen, Denmark

KEY WORDS ABSTRACT

Diagnosis, epidemiology,
infectious diseases, protozoon,
public health
Of the so-called nonpathogenic intestinal protozoa, Endolimax nana belongs to the
ones least well described. Most data on E. nana have emerged from general surveys of
intestinal parasites in selected cohorts and mostly in the absence of any particular focus
on Endolimax. Hence, the genus of Endolimax remains largely unexplored in terms of
morphology, taxonomy, genetic diversity, host specificity, and epidemiology. In this review,
we seek to provide an overview of the work that has been performed on the parasite since
the genus Endolimax was described by Kuenen and Swellengrebel in 1917 and suggest
activities that may pave the way for a better understanding of E. nana in a clinical and
public health context.

INTRODUCTION unavailable at present. A simple search for “Endolimax”

in PubMed and Web of Science on the 26th  of March
The genus Endolimax appears to consist of a large number
2015 identified 265 and 304 articles, respectively, with
of species based on its reported occurrence in a vast range
an overlap of 255. The vast majority of these articles
of mammals, and it has moreover been described in birds,
were general surveys/prevalence studies focusing
reptiles, and amphibians. Descriptions have been based
on intestinal parasites in general with no particular
on morphology and sometimes limited to identification
focus on Endolimax. Narrowing down the search to
of a cyst stage. Analyzed specimens have been recovered
“Endolimax (title),” the number of articles decreased to
from stool samples or directly from the intestinal lumen
19 and 25 (overlap, 19), respectively. In reality, much
if the animal was necropsied. Recently, an ameba closely
more work than this has been carried out on Endolimax,
related to Endolimax was also recovered from various
but most of the literature is relatively old and might not
tissues of a fish (Solea senegalensis).[1]
be indexed in the aforementioned search engines; this
could also be the reason why such articles are not cited
An overview of fundamental information such as
in the more recent literature. In this study, older articles
host specificity, pathogenicity, and epidemiology is
were identified mainly by backtracking using already
Address for correspondence
available articles, and it turned out that Endolimax
Dr. Christen Rune Stensvold, research has been carried out by many groups that have
Laboratory of Parasitology, Statens Serum Institut, Building 37/137, been debating issues that can be resolved with modern
Artillerivej 5, DK–2300 Copenhagen S, Denmark.
E-mail: run@ssi.dk
This is an open access article distributed under the terms of the Creative
Commons Attribution‑NonCommercial‑ShareAlike 3.0 License, which allows
Access this article online others to remix, tweak, and build upon the work non‑commercially, as long as the
author is credited and the new creations are licensed under the identical terms.
Quick Response Code:
Website:
For reprints contact: reprints@medknow.com
www.tropicalparasitology.org

How to cite this article: Poulsen CS, Stensvold CR. Systematic review
DOI: on Endolimax nana: A less well studied intestinal ameba. Trop Parasitol
2016;6:8-29.
10.4103/2229-5070.175077
DOA: 04-11-2015, DOP: 28-01-2016

8 © 2016 Tropical Parasitology | Published by Wolters Kluwer - Medknow

 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion
day technologies. The goal of this review is therefore to
provide an overview of some of the work that has been
performed on Endolimax nana since the genus Endolimax
was described by Kuenen and Swellengrebel[2] in 1917
and the species E. nana by Wenyon and O’Connor[3]
in 1917 and Brug [4] in 1918. Central topics such as
morphology, taxonomy, host specificity, epidemiology,
pathogenicity, diagnosis, and treatment are reviewed
and discussed. Where applicable, emphasis is given on
how previous discussions in the scientific community
might be elucidated and resolved using state-of-the-art
technology.
MORPHOLOGY AND LIFE CYCLE
E. nana inhabits the colon and has also been found
in the appendix.[5-7] Trophozoites (8–10  µm) move by
pseudopodia and may reach a size of up to 30 µm during
locomotion. They feed exclusively on bacteria and
divide by binary fission. The nucleus is vesicular and
spherical, measuring 2.0–2.5  µm, with a polymorphic
karyosome. [6-9] Before excystation, the trophozoite
divides without growing, producing stages that are
smaller but with nuclei of the same size. At first, the
cyst contains one nucleus that divides twice by mitotic
division. When mature, cysts of Endolimax are oval and
very small (6–9  µm × 5–7  µm) compared with cysts
of other intestinal amebae. The cyst wall appears thin
(80  nm), colorless, and smooth on the outside. In the
cytoplasm, no mitochondria, Golgi apparatus, rough
endoplasmic reticulum, centrioles, or microtubules are
present. Uniquely among intestinal amebae, E. nana has
elongated tubular structures consisting of ribosome-like
particles.[7,9,10] The cyst typically contains four nuclei, but
it is possible that Endolimax may produce supernucleate
cysts where up to four of the four nuclei perform
an additional division, producing cysts containing
5–8 nuclei; this might, however, be a somewhat rare
phenomenon.[7,9] Segal[11] argued that the nuclei in excess
of four were in fact chromatoid bodies that might be
the same as the elongated tubular structures mentioned
above. The nucleus has a thin nuclear membrane with
chromatin deposits and no pores.[7,9,10] The cysts are
excreted in feces and may survive for up to 2 weeks when
incubated at room temperature and for up to 2 months
at lower temperatures; this, however, is under optimal
conditions, and survival times are lower under natural
settings such as in feces or water.[6,7] Trophozoites may
survive in stool for up to 1 day when feces is incubated
at room temperature.[6] After ingestion, the ameba excysts
by escaping through a pore in the cyst wall, divides
by successive cytoplasmic bipartition into uninucleate
amebae, and turn into the trophic stage.
Infection may last for many years exemplified by the
experimental infection that Dobell performed on himself,
Tropical Parasitology 9 Jan 2016 | Volume 6 | Issue 1 |
which had been lasting for 17 years at the time of his last
publication on Endolimax.[7]
TAXONOMY
Silberman et al.[12] performed the first DNA-based study
on E. nana and were able to obtain a complete sequence
of the Endolimax SSU rRNA gene. It is noteworthy that
this sequence is still the only available sequence of
E. nana in the NCBI database, despite the fact that it
has been 16  years since the sequence was deposited.
Compared with other amoebozoa, the SSU rRNA gene
of Endolimax is relatively long (more than 2500 bases),
which is in part due to AT-rich expansion regions, with
no evidence of introns.[12] In their phylogenetic analysis,
Silberman et al.[12] placed Endolimax as a sister taxon to
the Entamoeba assemblage. Cavalier-Smith et al.[13] later
performed phylogenetic analyses with more sequences,
including various Mastigamoeba sequences and placed
Endolimax in the family Endolimacidae, which included
Endolimax and Endamoeba. Sequencing the SSU rRNA
gene of Iodamoeba, Stensvold et al. [14] found that it
grouped together with Endolimax, but failed to establish
monophyly for Iodamoeba. To clarify the phylogenetic
position of Endolimax, there was a clear need for further
studies on intrageneric diversity.[14,15] Recently, and
mostly due to availability of more sequences from related
organisms, Zadrobílková et al.[16] were able to obtain
monophyly for both Endolimax and Iodamoeba.
SSU rRNA gene sequences were recently obtained
from a new species identified in a sole that was named
Endolimax piscium;[1] while these sequences did cluster
specifically with E. nana, they were highly divergent.[16]
However, there is still a need for additional sequences
of both E. nana and Endolimax isolated from nonhuman
hosts to investigate intrageneric diversity and further
clarify the taxonomic status of the genus.
Meanwhile, it has proved challenging to obtain complete
SSU rRNA genes from Endolimax. This is mostly due
to the fact that general eukaryotic primers are prone
to amplifying ribosomal genes that comprise fewer
bases than that of Endolimax; for instance, Blastocystis
has a SSU rRNA ribosomal gene of about 1800  bp,
and since Blastocystis is very often present in stool
samples positive for Endolimax, general primers tend
to amplify Blastocystis preferentially over Endolimax
when applied to genomic DNA extracted from stool.
Moreover, sequences derived from Endolimax-positive
polymerase chain reaction products often turn out to be
more or less unreadable, probably for the same reasons
as for Iodamoeba.[14] It might therefore prove useful to
develop phylogenies based on other genes; preferably
genes such as actin that are also likely to be conserved
in Endolimax.
 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

HOST SPECIFICITY provided an overview of the different Endolimax species

named to date [Table  1]. Arguments have been made
The host specificity of Endolimax has been debated in the
against some of these species names, including the
older literature.[6,17,18] Wenrich[19] stated that Endolimax
possibility that some were in fact Iodamoeba as in the case
species cannot be differentiated based on morphology
of E. kueneni.[6] Moreover, morphological descriptions
and pointed out the need for experimental infection
disqualify the species described as E. reynoldsi, which
studies to investigate the host specificity of Endolimax.
has cysts with only one nucleus,[19] and some species
Among such studies, Dobell[6] is the only person to
described as distinct may in fact be the same species, for
date to have performed experimental infections on
instance E. nana, Endolimax gildemeisteri, and Endolimax
humans, namely on himself. He had examined his
cynomolgi.[6]
own feces for many years and found it to be negative
for Endolimax before experimentally infecting himself
There might be a need to revise the taxonomy of
with Endolimax from what was called a Macacus sinicus.
Endolimax. We have recently observed extensive genetic
The infection established, he was later able to infect
variation in the SSU rRNA gene among human-derived
a so-called M. rhesus with his own Endolimax isolate.
Endolimax (unpublished data). The only complete SSU
Some believed in a limited host range and proposed
rRNA sequence of E. nana available in Genbank is from
new species names for the isolates of different animals
a monkey (Cercocebus albigena) isolate,[33] which clusters
[Table  1], whereas others[18] believed that E. nana was
with only some of our unpublished human-derived
able to infect a wide range of hosts. Dobell[6] was more
sequences, indicating that there may be different
cautious in drawing conclusions before having more
ribosomal lineages infecting humans and nonhuman
evidence. This confusion is also evident from the great
primates, as was already observed in the closely related
number of Endolimax species described. Constenla et al.[1]
genus of Iodamoeba.[14] The genetic diversity might also
explain the differences in host specificity observed
Table 1: Species of Endolimax reported to date (modified from
between research groups, as discussed above. Yarinsky
Constenla et al. 2014)
and Burrows[34] observed general differences in the size
Species Host References
of trophozoites between infected individuals suggesting
E. reynoldsi American swift (lizard) McFall[20] the existence of at least two lineages of Endolimax based
E. greganiformis/ Bird Tyzzer;[21] Hegner[22]
on this morphological characteristic. To investigate the
E. janisae
E. leptocoridis Boxelder bug Kay[23]
host specificity and classification of Endolimax spp., DNA
E. blattae Cockroach Lucas[24] sequence data should be obtained from animal isolates as
E. ranarum Frog Hegner[22] well as humans and analyzed by phylogenetic methods.
E. caviae Guinea pig Hegner[22]
E. nana/ Human Wenyon and EPIDEMIOLOGY
E. gildemeisteri O’Connor;[3] Brug;[4]
Momcilo[25] Endolimax is transmitted through fecal-oral contamination
E. kueneni/ Monkey Brug[26] of food or water.[35-37] Endolimax cysts have been observed
E. cynomolgi* in drinking water from deep wells,[38] on raw consumed
E. tayassusi/ Pig De Mello and Amaral;[27] vegetables, [39] and on banknotes, which have been
E. suis Simitch et al.[28] suggested to be potential fomites.[40]
E. ratti Rat Chiang[29]
E. piscium Sole Constenla et al.[1]
The scientific literature abounds with studies that have
E. termitis Termite Kirby[30]
surveyed the prevalence of Endolimax in human stools
E. clevelandi Turtle Gutierrez‑Ballesteros
and Wenrich[31] samples. This can be explained by its inclusion in studies
No species Cattle, horse, goat, Wenrich;[19] Stark et al.[32] that investigate the prevalence of intestinal parasites
name provided sheep, rock fish, in general, based on for instance microscopy of fecal
millipede, crane‑fly concentrates. Due to the overwhelming number of
larva, Japanese beetle
studies, an overview of the prevalence, study groups, and
larva, and leech
*E. kueneni was erroneously identified as Iodamoeba by Brug  (1920), who
methods have been included in Supplementary Table 1.
later described E. cynomolgi as being a “true Endolimax”. Since Endolimax We tried to estimate the global prevalence based on
from macaques can infect humans and vice versa, E. cynomolgi is most likely data from healthy individuals and including articles
E. nana, as discussed by Dobell (1933). The names E. kueneni and E. cynomolgi
are still used. E. reynoldsi: Endolimax reynoldsi, E. greganiformis: Endolimax that were only 20 years old or less. These studies were
greganiformis, E. janisae: Endolimax janisae, E. leptocoridis: Endolimax mainly performed on schoolchildren, minority groups, or
leptocoridis, E. blattae: Endolimax blattae, E. ranarum: Endolimax ranarum,
E. caviae: Endolimax caviae, E. nana: Endolimax nana, E. gildemeisteri: Endolimax controls. By calculating weighted averages, we estimated
gildemeisteri, E. kueneni: Endolimax kueneni, E. cynomolgi: Endolimax cynomolgi, the global prevalence in healthy individuals to be 13.4%,
E. tayassusi: Endolimax tayassusi, E. suis: Endolimax suis, E. ratti: Endolimax ratti,
E. piscium: Endolimax piscium, E. termitis: Endolimax termitis, E. clevelandi: Endolimax
yielding 950,000,000 possibly infected individuals. Based
termitis on patient samples or reports in articles older than

Jan 2016 | Volume 6 | Issue 1 | 10 Tropical Parasitology

 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

20  years, the global prevalence is estimated to about
3.4% [Table 2]. The relatively high estimate in healthy
individuals is mainly attributable to two articles from
Africa where the prevalence of Endolimax was above
80%.[41,42] The inclusion of countries in Central America
in the continent of North America probably leads to
overestimation of the prevalence in this continent, the
opposite potentially being true by the inclusion of the
Middle East in Asia. In general, apparently most carriers
of E. nana are found in Africa and South America, which
comprise several developing countries. A relatively low
prevalence is generally observed in studies from Asia,
but the very low prevalence estimate in symptomatic
patients compared with controls is mainly due to
the inclusion of a large study carried out in Israel.[43]
It is challenging to develop a precise estimate of the
prevalence of Endolimax in Asia due to the limited
amount of data from India and China, the two most
populous countries in the world. It is expected that the
prevalence be overestimated from articles available
due to publication bias, since it is unlikely that E. nana
is mentioned unless observed and recorded. Likewise,
there are no studies to these authors’ knowledge where
the prevalence of Endolimax is described as the primary
focus of the article. On the other, it is expected that
some studies have not included findings of Endolimax
because it was considered unimportant in relation to
the study aim. In addition, investigators may lack the
skills to identify this parasite, including differentiating it
from other amebas, as reported by Angel Núñez et al.,[44]
leading to an underestimation of the prevalence of
E. nana.
CLINICAL SIGNIFICANCE
Endolimax is considered a nonpathogenic commensal
protozoon parasitizing the human colon;[6,9] this or a
similar description is given in most textbooks.[37,45-47]
The evidence supporting Endolimax as nonpathogenic is
scarce, but in the study where Dobell[6] infected himself,
the author did not experience any symptoms. Dobell[6]
performed postmortem examination of infected monkeys
and failed to discover any amebic lesions of the intestine.
Some authors have argued that Endolimax can cause
irritation of the crypts of the intestinal mucosa, referring
to observations by Swerdlow and Burrows; [48] the
empirical data to support such a statement are limited,
however, since this report is on Dientamoeba fragilis and
only one case was co-infected with Endolimax.
It is common to find reports on associations between
diarrhea and Endolimax infections.[49-52] This association
may at least in part be explained by Endolimax being
an indicator of fecal contamination, which may often
entail co-infection by other organisms capable of causing
diarrhea. In a couple of case studies, Endolimax was
associated with chronic diarrhea;[52-54] all cases responded
well to treatment, and it was not possible to detect other
infections except in the study by Shah et al.[52] where
one case was co-infected with Blastocystis. It is possible
that the cysts in the study published by Fitzgerald and
O’Farrell[53] are not Endolimax cysts since they were
described as having only one nucleus. Twelve cases were
described in the study by Sanchez[55] who concluded that
E. nana is possibly pathogenic.
There are also case studies that associate E. nana with
urticaria[56] and polyarthritis.[57] Alarcón-Segovia and
Abud-Mendoza[58] objected to the latter study, which
was followed by a reply from Liakos and Burnstein[59]
in the same journal issue. The objections included
that no tests of reactive arthritis were performed, that
Endolimax is presumably noninvasive, and that the
treatment with metronidazole could eradicate other
disease-causing organisms; in addition, no efforts were
made to investigate whether any such organisms were
present. The reply stated that testing did not reveal any
other pathogenic organisms, but that such organisms
could possibly be present. There is some evidence that
Endolimax may give rise to an immunological response,
including eosinophilia.[60,61] There are no known cases
of Endolimax crossing the intestinal barrier in humans;

Table 2: Estimated prevalence of Endolimax nana by continent and globally

Continent Prevalence range in Prevalence range in healthy Population† Total number of infected individuals
nonhealthy individuals (%)* individuals (%) (weighted based on prevalence of healthy individuals
(weighted average [%], total average [%], total number of (patients/surveys older than 20 years)
number of individuals tested) individuals tested)
Africa 0.33-30.4 (3.3, 370,962) 16.2-83.8 (81.5, 8,805) 995,000,000 811,029,528 (32,460,171)
Asia 0.098-21.4 (1.6, 707,009) 0-16.4 (0.51, 71,589) 4,140,000,000 21,050,161 (66,690,042)
Australia 0.80-41.2 (17.7, 3123) NA‡ 36,000,000 183,045§ (6,386,167)
Europe 0-29.9 (5.4, 13,836) 1.5-2.1 (1.7, 2482) 739,000,000 12,505,238 (39,844,897)
North America 0.39-50.2 (4.4, 237,186) 0.30-23.9 (6.9, 2,120) 529,000,000 36,431,132 (23,318,278)
South America 0.47-50.5 (16.6, 76,906) 1.8-41.2 (18.2, 8,819) 386,000,000 70,380,769 (64,028,840)
Globally 0-50.5 (3.4, 1,409,022) 0-83.8 (13.9, 93,815) 6,825,000,000 951,579,874 (232,728,396)
*This group comprises samples obtained from patient groups and from all studies performed before 1995. This cut‑off was chosen based on the difficulty of getting
clear information on study group and to avoid including articles in calculations of the prevalence in healthy individuals that are biased by being outdated, †Population
statistics obtained from June 8th 2015: http://www.worldpopulationstatistics.com/continent‑population/, ‡No studies performed that met the criteria, §Calculated
using the weighted average prevalence of Asia

Tropical Parasitology 11 Jan 2016 | Volume 6 | Issue 1 |

 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion
however, E. piscium was recently described in a sole in
both intestinal and nonintestinal tissue.[1]
The authors of this review are of the opinion that the
sporadic articles on E. nana present too little evidence
in favor of the assertion that Endolimax should be
considered pathogenic with the ability to cause diarrhea
or intestinal inflammation. The clinical picture may
be subtle, however, and it has been suggested that
symptoms may develop if a heavy infection is present[54]
or that the pathogenicity might be limited to particularly
virulent strains.[59]
DIAGNOSIS AND TREATMENT
The diagnosis of Endolimax traditionally relies
on microscopy of cysts, which can be direct or
coupled with a concentration procedure and different
stains prior to analysis. Concentration can be
formalin-based [Figure 1a], and when the fecal concentrate
is stained with iodine, cysts of E. nana appear gibbous[7]
[Figure  1b]. This gibbous appearance is however not
always present and almost absent when cysts are
concentrated using a sucrose gradient and stained with
iodine [Figure 1c]. The cysts of Endolimax and E. hartmanni
both have four nuclei but can be differentiated by E. nana
having a larger punctuate karyosome and peripheral
chromatin, both of which features however may be
quite difficult to discern.[8,47] Endolimax stains with both
Ziehl–Neelsen and trichrome. Cysts of E. nana are some
of the smallest among those of the amebas, which is
why it is recommended to use a microscope with at
least ×400 magnification to avoid missing them but also
in order to be able to distinguish them from E. hartmanni.
A large number of cysts may be excreted compared with
other amebae (Entamoeba coli, E. histolytica/E. dispar),
with an estimate of about 8000 cysts/g, but with a few
“heavy shedders.” It is possible that Endolimax is shed
periodically.[62] Trophozoites are rarely observed, unless
a b
c d
Figure 1: Cysts of Endolimax nana in direct smear (a), concentrated
with formalin and ethyl acetate and stained with iodine showing the
characteristic gibbous appearance (b), and isolated on a sucrose
gradient and stained with iodine, respectively (c). Image (d) shows a
Endolimax nana trophozoite
Jan 2016 | Volume 6 | Issue 1 | 12 Tropical Parasitology
direct examination is performed on fresh stool samples
[Figure 1d].
Based on the single SSU rRNA gene sequence in
GenBank, in-house primers have been developed
[Table  3] that have proved partially effective for
diagnosing E. nana in genomic DNA extracted from
fresh stool. It was from sequences generated using these
primers that the high variation in the SSU rRNA genes
mentioned previously was observed. Meanwhile, DNA
from microscopy-positive samples have sometimes failed
to show amplification with these primers. Due to the
high variation in SSU rDNA (unpublished observations),
designing genus-specific primers based on a single
sequence or only a few sequences is problematic. There
is a need for more reference sequences to develop
better diagnostic primers that also eliminates selection
for specific Endolimax strains. It is currently unknown
whether the primers included in Table 3 will also amplify
Endolimax from hosts other than humans.
Endolimax appears to respond well to both metronidazole
and diphetarsone treatment. Stauffer and Levine[54] were
able to treat two cases with metronidazole, although it
appears that two courses of treatment were necessary in
one of the cases. The same treatment with metronidazole
was successful in a single case in the study by Burnstein
and Liakos.[57] Based on these two studies, Graczyk et al.[51]
recommend metronidazole for Endolimax treatment,
administered as 250  mg 3  times a day for 10  days. In
a study by Keystone et al.,[63] a 98% cure rate (n  =  44)
was observed with diphetarsone 500 mg 3 times a day
for 10 days. In vitro studies have revealed little effect of
streptomycin[64] and emetine[6] on Endolimax. Treatment
of concurrent pathogenic parasites revealed little effect
on Endolimax using emetine[6] or mebendazole.[35]
CONCLUSIONS
Based on available data, the global prevalence of E. nana
in healthy individuals is estimated to be 13.9% on
average, which, however, is probably an overestimation
as discussed above; still, hundreds of millions are most
likely infected. Very little research has been performed
on Endolimax since the 1920s, 30s, and 40s. With the
availability of DNA-based detection methods, resolving
major issues such as host specificity, diversity, and
which Endolimax species that can infect humans should
be straightforward. In addition, the development of
diagnostic primers will allow Endolimax to be detected
with high sensitivity using fecal DNAs and distinguished
easily from other amebae. The clinical significance of
Endolimax is still an unresolved issue. Prior exposure
(immunity), parasite load, and genetic variability might
influence clinical presentation. Little evidence points
toward Endolimax being pathogenic, but a few articles
provide data on Endolimax-based stimulation of the
 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion
Table 3: In‑house primers for detecting and characterizing Endolimax
Forward primer
Name Sequence
Endoligenus F 5´‑GTGGAATGCTTTCGCTCTC‑3´
Limax 1F 5´‑CGTGGAATGGAGAAGGATAAC‑3´
Limax 2F 5´‑GGAGCAATTGGAATGAAAGCAAG‑3´
immune system; whether this is a harmful or beneficial
modulatory effect remains unknown. Hopefully, the
present review will stimulate interest in Endolimax
research, which may eventually render Endolimax a not
so inconspicuous companion.
Acknowledgement
Dr. Marianne Lebbad, The Swedish Agency of
Public Health, and Dr. Maria Midgely, Liverpool School
of Tropical Medicine and Hygiene, are both thanked for
providing images.
Financial support and sponsorship
Nil.
Conflicts of interest
There are no conflicts of interest.
REFERENCES
1. Constenla M, Padrós F, Palenzuela O. Endolimax piscium sp.
nov. (Amoebozoa), causative agent of systemic granulomatous
disease of cultured sole, Solea senegalensis Kaup. J Fish
Dis 2014;37:229-40.
2. Kuenen W, Swellengrebel N. Korte beschrijving van
enkelc minder bekendc protozoeo uit denmenschelijkcn
darm. Geneesk. Tijdschr v Nederl; 1917. p. 496.
3. Wenyon C, O’Connor F. Human Intestinal Protozoa in the
Near East. London: J. Bale, Sons and Danielsson, Ltd.; 1917.
4. Brug S. Enkele opmerkingen over de nomenclatuur van
cenige nieuwere parasieten uit den menschelyken darm.
Batavia Geneesk: Tydsehr Ned Ind; 1918. p. 283-5.
5. Cerva L, Schrottenbaum M, Kliment V. Intestinal
parasites: A study of human appendices. Folia Parasitol
(Praha) 1991;38:5-9.
6. Dobell C. Researches on the intestinal protozoa of
monkeys and man. V. The endolimax of macaques.
Parasitology 1933;25:436-67.
7. Dobell C. Researches on the intestinal protozoa of
monkeys and man. XI. The cytology and life-history of
endolimax nana. Parasitology 1943;35:134-58.
8. Yarinsky A, Burrows R. Atypical nuclei of Endolimax
nana in purged stool specimens. Am J Clin Pathol
1966;46:490-3.
9. Dobell C. The Amoebae Living in Man: A Zoological
Monograph. London: J. Bale and Danielsson; 1919.
10. Zaman V, Howe J, Ng M, Goh TK. Ultrastructure of the
Endolimax nana cyst. Parasitol Res 2000;86:54-6.
11. Segal B. Budding and other variations in Endolimax nana,
a comparison with Councilmania tenuis Kofoid, 1928.
Am J Hyg 1932;15:741-52.
12. Silberman JD, Clark CG, Diamond LS, Sogin ML.
Tropical Parasitology 13 Jan 2016 | Volume 6 | Issue 1 |
Reverse primer
Name Sequence
Endoligenus R 5´‑GAGATTGTGCTTGGATGGAC‑3´
Limax 1R 5´‑GCTACTCTATCATGTCTTTGTCTTGC‑3´
Limax 2R 5´‑CGTCGTAGTCTCAACCATAAACG‑3´
Phylogeny of the genera Entamoeba and Endolimax as
deduced from small-subunit ribosomal RNA sequences.
Mol Biol Evol 1999;16:1740-51.
13. Cavalier-Smith T, Chao E, Oates B. Molecular phylogeny
of Amoebozoa and the evolutionary significance of the
unikont Phalansterium. Eur J Protistol 2004;40:21-48.
14. Stensvold CR, Lebbad M, Clark CG. Last of the human
protists: The phylogeny and genetic diversity of
Iodamoeba. Mol Biol Evol 2012;29:39-42.
15. Ptácková E, Kostygov AY, Chistyakova LV, Falteisek L,
Frolov AO, Patterson DJ, et al. Evolution of archamoebae:
Morphological and molecular evidence for pelobionts
including Rhizomastix, Entamoeba, Iodamoeba, and
Endolimax. Protist 2013;164:380-410.
16. Zadrobílková E, Walker G, Cepicka I. Morphological and
molecular evidence support a close relationship between
the free-living archamoebae Mastigella and Pelomyxa.
Protist 2015;166:14-41.
17. Hegner R. Host-parasite Relations Between Man and His
Intestinal Protozoa. New York: The Century Co.; 1927.
18. Kessel J. Host-parasite relationships of certain intestinal
protozoa important to medical zoology. JAMA
1928;90:1089-92.
19. Wenrich D. Host-parasite Relations Between Parasitic
Protozoa and Their Hosts. American Philosophical
Society: Proceedings of the American Philosophical
Society; 1935. p. 605-50.
20. McFall CM. Endolimax reynoldsi nov. sp. from the
Intestine of the Common Swift, Sceloporus undulatus.
J Parasitol 1926;12:191-8.
21. Tyzzer EE. Amoebae of the caeca of the common fowl
and of the Turkey.– Entamoeba gallinarum, SP. N. and
Pygolimax gregariniformis, Gen. et Spec. Nov. J Med Res
1920;41:199-210.1.
22. Hegner RW. Endolimax caviae n. sp. from the Guinea-Pig
and Endolimax janisae n. sp. from the Domestic Fowl.
The American Society of Parasitologists. J Parasitol
1926;12:146-7.
23. Kay MW. Two new amoebae from the box elder bug,
Leptocoris trivittatus Say. Am Midl Nat 1940;23:724-8.
24. Lucas CL. Two New Species of Amoeba found in
Cockroaches: With notes on the cysts of Nyctotherus
ovalis Leidy. Parasitology 1927;19:223-35.
25. M o m c i l o I . B e i t r ä g e z u r k e n n t n i s d e r
entwicklungsgeschichte einer im menschlichen
enddarme lebenden Endolimax-amöbe (Endolimax
gildemeisteri spec. nov.). Zentralblatt für Bakteriologie,
Parasitenkunde, Infektionskrankheiten und Hygiene;
1936. p. 377-98.
26. Brug S. Endolimax kueneni n.sp., Parasitic in the intestinal
tract of the monkey Macacus cynomolgus. Parasitology
1920;12:378-9.
27. De Mello IF, Amaral AD. Note on an ameba of the genus
Endolimax, intestinal parasite of the peccary Tayassus
tajacu. An Inst Med Trop (Lisb) 1952;8:615-9.
 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion
28. Simitch T, Chibalitch D, Petrovitch Z, Heneberg N.
Contribution to the knowledge of the fauna of intestinal
protozoa of Yugoslavian pigs. Their experimental
identification. Arch Inst Pasteur Alger 1959;37:401-8.
29. Chiang SF. The rat as a possible carrier of the dysentery
amoeba. Proc Natl Acad Sci USA 1925;11:239-46.
30. Kirby H. Studies on some amoebae from the termite
Mirptermes with notes on some other Protozoa from the
Termitidae. Q J Microsc Sci 1927;71:189-223.
31. Gutierrez-Ballesteros E, Wenrich DH. Endolimax
clevelandi, n. sp. from turtles. J Parasitol 1950;36:489-93.
32. Stark D, Phillips O, Peckett D, Munro U, Marriott D,
Harkness J, et al. Gorillas are a host for Dientamoeba
fragilis: An update on the life cycle and host distribution.
Vet Parasitol 2008;151:21-6.
33. Clark CG, Diamond LS. Intraspecific variation and
phylogenetic relationships in the genus Entamoeba
as revealed by riboprinting. J Eukaryot Microbiol
1997;44:142-54.
34. Yarinsky A, Burrows R. Increase in number of Endolimax
nana trophozoites with typical nuclei in serial
samples of purged stool specimens. Am J Clin Pathol
1966;46:494-5.
35. Hostetler LD. Microbiology problem. Am J Med Technol
1981;47:328-9.
36. Sard BG, Navarro RT, Esteban Sanchis JG. Non-pathogenic
intestinal amoebae: A clinical-analytical overview.
Enferm Infecc Microbiol Clin 2011;29 Suppl 3:20-8.
37. Garcia L, Bruckner D. Diagnostic Medical Parasitology.
2nd ed. Washington, DC: ASM Press; 1993.
38. Guillen A, Gonzalez M, Gallego L, Suarez B, Heredia H,
Hernandez T, et al. Presence of intestinal protozoans
in water of consumption in “18 de Mayo Community”.
Aragua State-Venezuela. 2011. Bol Malariol Salud
Ambient 2013;53:29-36.
39. Monge R, Chinchilla M, Reyes L. Seasonality of parasites
and intestinal bacteria in vegetables that are consumed
raw in Costa Rica. Rev Biol Trop 1996;44:369-75.
40. Moreno P, Perfetti D, Antequera I, Navas P, Acosta M.
Contamination of banknotes with enteric parasites
in Coro, Falcon state, Venezuela. Bol Malariol Salud
Ambient 2014;54:38-46.
41. Raso G, Utzinger J, Silué KD, Ouattara M, Yapi A, Toty A,
et al. Disparities in parasitic infections, perceived ill
health and access to health care among poorer and less
poor schoolchildren of rural Côte d’Ivoire. Trop Med Int
Health 2005;10:42-57.
42. Ouattara M, Silué KD, N’Guéssan AN, Yapi A, Barbara M,
Raso G, et al. Prevalence and polyparasitism of intestinal
protozoa and spatial distribution of Entamoeba histolytica,
E. dispar and Giardia intestinalis from pupils in the rural
zone of Man in Côte d’Ivoire. Sante 2008;18:215-22.
43. Ben-Shimol S, Sagi O, Greenberg D. Differences in
prevalence of parasites in stool samples between three
distinct ethnic pediatric populations in Southern Israel,
2007-2011. Parasitol Int 2014;63:456-62.
44. Angel Núñez F, Ginorio DE, Finlay CM. External quality
assessment in coproparasitology in Havana City Province,
Cuba. Cad Saude Publica 1997;13:67-72.
Jan 2016 | Volume 6 | Issue 1 | 14 Tropical Parasitology
45. Roberts L, Schmidt G, Janovy J. Gerald D. Schmidt and
Larry S. Roberts’ Foundations of Parasitology. 8th ed.
Boston: McGraw-Hill Higher Education; 2009.
46. Levine N. Protozoan Parasites of Domestic Animals and
of Man. 1st ed. Minneapolis: Burgess Pub. Co.; 1961.
47. Ash LR, Orihel TC. Atlas of Human Parasitology. 5th ed.
Chicago: ASCP Press; 2007.
48. Swerdlow MA, Burrows RB. Dientamoeba fragilis, an
intestinal pathogen. J Am Med Assoc 1955;158:176-8.
49. Peters C, Kocka F, Chittom A, Sable R, Janda W. High
carriage of Endolimax-nana in diarrheal specimens from
homosexual men. Lett Appl Microbiol 1987;5:65-6.
50. Iqbal J, Hira PR, Al-Ali F, Philip R. Cryptosporidiosis
in Kuwaiti children: Seasonality and endemicity. Clin
Microbiol Infect 2001;7:261-6.
51. Graczyk TK, Shiff CK, Tamang L, Munsaka F, Beitin AM,
Moss WJ. The association of Blastocystis hominis and
Endolimax nana with diarrheal stools in Zambian
school-age children. Parasitol Res 2005;98:38-43.
52. Shah M, Tan CB, Rajan D, Ahmed S, Subramani K, Rizvon K,
et al. Blastocystis hominis and Endolimax nana co-infection
resulting in chronic diarrhea in an immunocompetent
male. Case Rep Gastroenterol 2012;6:358-64.
53. Fitzgerald O, O’farrell TT. Chronic diarrhoea due to
Endolimax nana infestation. Ir J Med Sci 1954;346:467-8.
54. Stauffer JQ, Levine WL. Chronic diarrhea related
to Endolimax nana: Response to treatment with
metronidazole. Am J Dig Dis 1974;19:59-63.
55. Salazar Sanchez A. Infestation with Endolimax nana;
preliminary report. Rev Fac Med Univ Nac Colomb
1957;25:214-8.
56. Veraldi S, Schianchi-Veraldi R, Gasparini G. Urticaria
probably caused by Endolimax nana. Int J Dermatol
1991;30:376.
57. Burnstein SL, Liakos S. Parasitic rheumatism presenting
as rheumatoid arthritis. J Rheumatol 1983;10:514-5.
58. Alarcón-Segovia D, Abud-Mendoza C. Parasitic
rheumatism by Endolimax nana. Objections. J Rheumatol
1985;12:184-5.
59. Liakos S, Burnstein S. Parasitic rheumatism by
Endolimax-nana – Reply. J Rheumatol 1985;12:184-5.
60. Cerva L, Kliment V. Contribution to the problem of the
so-called nonpathogenic amoebae in the intestine of man.
Folia Parasitol (Praha) 1978;25:367-70.
61. Yamaguchi N, Takeuchi T, Kobayashi S, Tanabe M,
Miura S, Asami K, et al. Health status of Indochinese
refugees in Japan: Statistical analyses on anemia,
eosinophilia and serum alkaline phosphatase. Southeast
Asian J Trop Med Public Health 1984;15:209-16.
62. Garrido-Gonzalez E, Zurabian R, Acuna-Soto R.
Cyst production and transmission of Entamoeba and
Endolimax. Trans R Soc Trop Med Hyg 2002;96:119-23.
63. Keystone JS, Proctor E, Glenn C, McIntyre L. Safety and
efficacy of diphetarsone in the treatment of amoebiasis,
non-pathogenic amoebiasis and trichuriasis. Trans R Soc
Trop Med Hyg 1983;77:84-6.
64. Pfeiffer AV. Effect of streptomycin on Endolimax nana
in vitro. J Parasitol 1948;34:142-6.
 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Summary of prevalence articles used to estimate the global prevalence
Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Europe. From Armengol et al.[1] Spain, Guadalquivir Valley, in the period 1.6 (1,917) Only specify coprological
articles with healthy 1994-1996, Children between 6 and analysis and Graham method
that are not older 10 years old without symptoms from
than 20 years 20 villages
Sagebiel et al.[2] Germany, Berlin, Kids in kindergarten, 1.5 (202) Microscopically examination
response rate 59 % of stools does not specify
concentration or staining methods
Schlosser et al.[3] France, two groups: Group one sewage 2.1 (363) from Two concentration techniques
workers and group two food-handlers group two merthiolate-iodine-formalin and
Bailenger’s method
Europe. From Cerva and Kliment[4] Czech republic, Prague hospital, 5.7 (10,418) Faust’s flotation-concentration
articles with symptomatic patients with suspected method and wet smears stained
patients that are intestinal parasitosis with ferric haematoxylin after
older than 20 years Heidenhain
Chin and Gerken[5] Great Britain, London, two groups: 21.7 (83) and 0 (43) Formol-ether concentration
Group one homosexual attending the from group one and
department of genitourinary medicine two, respectively
and group two controls medical students
and laboratory technicians
Jokipii et al.[6] Finland, two groups: Group one healthy 29.9 (190) and Fresh stools: Diluted in warm
homosexual volunteers and group 1.2 (172) from Locke’s solution and examined
two healthy students, employees of group one and two, to detect trophozoites, iodine
a government office and hospital or respectively staining and formalin ether
laboratory personel serving as controls concentration
Portus and Prats[7] Spain, Barcelona, Stool samples from 4.5 (650) Sapero and Lawless (MIFD) and
patients at hospital that was submitted with the biphasic concentration
for parasitic investigation method of Blagg et al. (MIFC)
Schlosser et al.[3] France, two groups: Group one sewage 5.1 (126) from Two concentration techniques
workers and group two food-handlers group one merthiolate-iodine-formalin and
Bailenger’s method
Soriano et al.[8] Saharawi children hosted in Spain 8.9 (270) Direct smear, Ritche
concentration, Kinyoun’s
modified staining and
trichrome staining
Sterba et al.[9] Czechoslovakia, South Bohemia, 0.8 (1750) NA
agricultural workers, from 1975 to 1982
Stürchler and Peter[10] Switzerland, Jura, schoolchildren 7 to 1.5 (134) MIF-stool-samples
16 years
Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
North America. Aimpun and Hsieh[11] Belize, Toledo district, 5 villages 0.30 (672) Formalin-ethyl-acetate
From articles with concentration
healthy that are not Faulkner et al.[12] Mexico, state of Tamaulipas, children 5.3 (438) Centrifugal flotation with
older than 20 years saturated zinc sulfate and
Sheathers sucrose solutions, fecal
smears stained with trichrome
Kurup and Hunjan[13] Saint Lucia, rural villages, school children 2.1 (554) Parasep concentration and
aged 0-19 years, response rate 100 % Kato-Katz
Mendoza et al.[14] Cuba, San Miguel del Padron 23.9 (456) Direct and Ritchie’s
municipality, from children in day-care concentration
centers, three fecal samples from each
North America. Acuna-Soto et al.[15] Mexico, state of Chiapas, in the village 50.2 (201) Formalin-ethyl acetate
From articles with of Navenchauc, random sample of sedimentation, lugol
patients that are 48 households
older than 20 years Barrett et al.[16] Jamaica, children with HIV/AIDS in 2.4 (42) NA
children’s homes, two fecal examined
from each child
Bruckner [17] USA, Los Angeles, patients, large part 13.0 (1,350) and 8.5 Formail-ether concentration,
had Spanish surnames, two groups: (493) from group one Gomori’s Trichrome
Group one from Olive view Medical and two, respectively
center and group two from Harbor
General hospital
Contd...
Tropical Parasitology 15 Jan 2016 | Volume 6 | Issue 1 |
 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...

Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Church et al.[18] USA, Rocky Mountain region, patients 1.5 (2,604) ParaPak, Formalin vial
experiencing gastrointestinal discomfort processed by filtered
centrifugation stained with
Lugol’s iodine, confirmation
stool in Zn-PVA vials stained
with trichrome
Church et al.[19] Canada, Calgary, gay men with a 41 (58) Specified as standard methods
majority HIV positive, it is not clear if it
is the whole group that the prevalence is
specified from
Edouard et al.[20] Martinique, samples examined at Fort de 1.25 (4,684) NA
France University Hospital, patients, not
unique samples
Elliott et al.[21] USA, Texas Gulf Coast, samples send for 0.5 (1,626) Direct smear with saline
parasitological investigation and stained with D’Antoni’s
iodine, then by a smear from
a concentrate prepared by the
zinc-sulfate flotation method.
Some samples also concentrated
by formol-ether and ethyl-
acetate
Haddad and USA, New Orleans, foreign seamen with 5 (99) NA
Agrawal[22] adominal symptoms
Kabani et al.[23] Canada, Calgary, patients at childrens 0.39 (1,532) Formalin-ethyl acetate
hospital concentration, hematoxylin/
Kinyoun stain and unstained
Kappus et al.[24] USA, specimens examined for intestinal 4.2 (216,275) NA
parasites by the state diagnostic
laboratories in 1987
Peters et al.[25] USA, Chicago, 3 hospitals (1, 2 and 39 (61), 31.6 (418) Iodine stain direct and
3) Patients from hospital 1 and 2 was and 9 (418) attending after formalin ethyl acetate
primarily homosexual men. Symptomatic hospital 1, 2 and 3, concentration
respectively
Ramirez-Miranda Mexico, IBS patients 3.2 (62) NA
et al.[26]
Ribes et al.[27] USA, Kentucky, patients suffering from 0.95 (315) Formalin-ethyl acetate
diarrhea submitting samples for ova and concentration, Kinyoun
parasite examination modified acid-fast- and
trichrome stain
Robinson et al.[28] Jamaica, healthy food handlers, two 8.1 (99) and 8.8 (113) Ritchie formalin-ether
groups: Group one HTLV-1 positive and from group one and concentration
group two HTLV-1 negative two, respectively
Rojas et al.[29] Cuba 10.3 (5,850) Direct, Willis’ brine flotation and
Kato-Katz thick smear
Tsaihong et al.[30] USA, New York city, homosexual men 5.2 (77), 15.3 (111) Filtered and concentrated
with gastrointestinal illness, three and 13.9 (72) from by centrifugation, saline wet
groups: Group one AIDS patients, anti group one, two and mount, iodine wet mount and
HIV positive and anti HIV negative three, respectively trichrome stain
Ungar et al.[31] USA, Migrant farmworkers working on 6.8 (339) Formaldehyde-ether technique
the Delmarva Peninsula
Wilkins and USA Texas and Northern Mexico 9.5 (273) NA
Horner[32] Chihuahua, clinical patients
Yamamoto-Furusho Mexico, patients with ulcerative colitis 9 (215) Trichrome stain on polyvinyl
and Torijano- alcohol preserved samples
Carrera[33] other formalin-ethyl acetate
concentration examined no stain
described
Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Contd...

Jan 2016 | Volume 6 | Issue 1 | 16 Tropical Parasitology

 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...

Characteristics Reference Country, region and study group
South America. Acurero et al.[34] Venezuela, State of Zulia, school
From articles with children, one fecal sample from each
healthy that are not Alves et al.[35] Brazil, Southeast Piaui state
older than 20 years Assis et al.[36] Brazil, Maxakali indigenous villages in
Minas Gerais, three stools collected on
alternate days
Berbert-Ferreira and Brazil, State of Minas Gerais, Sucling
Costa-Cruz [37] babies (4-12 months), at nursery, 6 slides
for each sample
Bermudez et al.[38] Colombia, Cali, children, at least two
samples examined
Biscegli et al.[39] Brazil, Catanduva, children from day
care center 7 – 78 months
Bracciaforte et al.[40] Argentina, Cordoba, children 6 months
to 21 years old
Castro et al.[41] Brazil, Sao Paolo, Children from
a daycare center, two groups: Group one
exhibiting diarrhea and group two non
diarrheal
Damazio et al.[42] Brazil, northern Espirito Santo,
quilombola community
Flores et al.[43] Peru, communities located along the
banks of Lake Titicaca, adults and
children
Franke et al.[44] Peru, Lima, children, two groups: Group 18.5 (189) from
one diagnosed with Tuberculosis and
group two healthy
Freites et al.[45] Venezuela, State of Zulia, food handlers 41.2 (119)
Ibanez et al.[46] Peru, Alto Maranon area in the amazon
jungle, schoolchildren 6-15 years old
Kobayashii et al.[47] Brazil, Sao Paulo, inhabitants of five
farms
Korkes et al.[48] Brazil, Sao Paulo, children
Laugart et al.[49] Venezuela, Barinas state, children
younger than 15 years old
Machado et al.[50] Brazil, Minas Gerais, children, Three
fecal samples collected from each
Mercado et al.[51] Chile, Calbuco county, rural county, one 16.4 (256)
sample per individual
Milano et al.[52] Argentina, children
Mora et al.[53] Venezuela, Sucre state, inhabitants of
cities neighboring different rivers that
was also investigated for the presence of
parasites
Moura et al.[54] Brazil, Sao Paulo, first grade school
children
% prevalence (no. of Methods
samples examined)
19 (133) Direct examination, formol-ether
concentration and lugol
13.6 (265) Spontaneous sedimentation
10.3 (1497) Formalin ethyl-acetate based
concentration (TF-test® kit)
1.76 (56) Hoffman, Pons and Janer’s
method, lugol stain
60 (63) Direct and after concentration
does not specify which, Kato-
Katz and Ziehl-Neelsen
2.3 (133) NA
7.3 (150) Direct and after Willis and
Ritchie concentration methods
2 (50) from group Hoffman-Pons-Janer centrifugal
two flotation in zinc sulfate and
Baermann-Moraes
4.9 (82) Spontaneous sedimentation,
stained with Lugol and
examined in triplicates
39.6 (91) Direct examination, Kato
technique, spontaneous
sedimentation, Lumbreras rapid
sedimentation
Direct smear and spontaneous
group two sedimentation methods
Wet mount, Ritchie
concentration, Modified Ziehl-
Neelsen staining
23.9 (1049) Direct microscopy and lugol
stain, Teleman’s and Kinnyouns
technique
2.3 (222) Formalin-ether concentration,
Lugol stain
20.8 (120) Direct exam, Kato-Katz,
Lutz-Hoffman spontaneous
sedimentation, Rugai, Mattos
and Brisola, thermal migration
and Zinc sulfate flotation
38.9 (262) Direct wet mount, Ritchie
(formalin-ether) concentration
and Kato Katz thick smear
2.5 (160) Modified Baermann, Lutz,
lugols iodine stain of six slides
for each sample and read by two
investigators
NA
1.8 (113) Modified Teleman, lugol
staining
17.8 (426) Direct, physiological saline
solution and modified Ritchie
concentration, stained with lugol,
modified Kinyoun and trichrome
4.8 (146) NA
Contd...

Tropical Parasitology 17 Jan 2016 | Volume 6 | Issue 1 |

 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...

Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Munoz-Antoli et al.[55] Nicaragua, children 34.8 (382) Formalin-ether concentration
and examination using iodine
wet mount and modified Ziehl-
Neelsen
Nascimento and Brazil, Pitanga city 33.7 (128) Direct wet mount, zinc sulphate
Moitinho[56] flotation, tube sedimentation,
formalin-ether, stained by
Kinyoun and iron hematoxylin
Rios et al.[57] Brazil, state of Amazonas, Lauarete district 10.3 (895) NA
Rivero-Rodriguez Venezuela, Maracaibo, schoolchildren 22.9 (349) Fresh test and after formol-ether
et al.[58] concentration
Saldiva et al.[59] Brazil, Sao Paolo, children 1-12 years 43 (520) NA
from rural areas, Three fecal samples
collected from each
Santos and Merlini[60] Brazil, Parana state 6.5 (431) Spontaneous sedimentation and
centrifugal fecal flotation
Silva et al.[61] Brazil, Minas Gerais, horticulturists, 13 (30) NA
three stool samples
Tabares and Columbia, Antioquia, Sabaneta, children 8.2 (97) NA
Gonzalez 2008[62] under 12 years, examined up to three
stool samples or less if positive
Takizawa et al.[63] Brazil, food handlers, 3 fecal samples 25.9 (343) Lutz, modified Ritchie and
collected over a 7 day period in same modified Ziehl-Neelsen staining
flask
Tashimi et al.[64] Brazil, children 3.0 (101) Faust concentration
RAPD agarose gel image
analyzer
South America. Amancio et al.[65] Brazil, Botucatu, HIV/AIDS patients, 1.9 (105) Formalin ethyl-acetate based
From articles with three fecal samples collected on alternate concentration (TF-test® kit) and
patients or that are days stained with Lugol’s solution
older than 20 years Bouree et al.[66] Peru, 4 native villages from the tribe 46 (165) NA
Cashibo in Amazonia
Cancrini et al.[67] Bolivia, Camiri, Gutierrez and Boyuibe 2.1 (381) NA
areas, healthy individuals
Carvalho-Costa Brazil, Rio de Janeiro, children with acute 0.5 (213) Not all methods performed on
et al.[68] diarrhea all samples but included, Direct
examination and examination
after Ritchie and safranin-
methylene blue staining
Castro et al.[41] Brazil, Sao Paolo, Children from a 6 (50) from group Hoffman-Pons-Janer centrifugal
daycare center, two groups: Group one one flotation in zinc sulfate and
exhibiting diarrhea and group two non Baermann-Moraes
diarrheal
Cho et al.[69] Ecuador, Guayas province, Palmar, 5.5 (325) Direct smear stained with lugol
mestizo population, collected from patients
Cimerman et al.[70] Brazil, AIDS patients 3.5 (200) Processed according to
Hoffman, Faust and Rugai
Franke et al.[44] Peru, Lima, children, two groups: Group 21.2 (189) from Direct smear and spontaneous
one diagnosed with Tuberculosis and group one sedimentation methods
group two healthy
Garibaldi et al.[71] Chile, Putaendo chronic patients from 50.5 (229) NA
the psychiatric hospital
Goldin et al.[72] Chile, Santiago nursery and primary 43 (722) Formol-ether concentration
school children
Guignard et al.[73] Argentina, orphaned and homeless 34.6 (396) Concentrated with Teleman
children living in substitute homes method, stained with Kinyoun’s
stain, Lugol and trichomic.
Kulik et al.[74] Brazil, two groups: Group one 16.3 (86) and 1.4 (146) Faust, Lutz and Rugai methods
hemodialysis patients and group two from group one and
attenders of local public health center two, respectively
Contd...

Jan 2016 | Volume 6 | Issue 1 | 18 Tropical Parasitology

 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...

Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Maia et al.[75] Brazil, Amazonas state, children 17.9 (451) NA
0-10 years presenting at outpatient
clinics in Manaus
Merlano et al.[76] Columbia, Atlantico, patients 20.3 (423) NaCl parasite-concentration
compared with wet mount
Moura et al.[77] Brazil, Rio de Janeiro, aids patients 18.2 (95) Four methods: Faust, Kato-Katz,
Baermann-Moraes and Baxby
Navarrete and Chile, province of Valdivia, coastal area, 34.4 (219) NA
Torres[78] primary school children
Rivero-Rodriguez Venezuela, patients with HIV/AIDS 3.9 (56) Direct, formol-ether, Kinyoun-
et al.[79] and fast Gram-Chrornotrope
stain
Silva et al.[80] Brazil, Sao Paulo, neoplastic patients 3.3 (30) Lutz, and Rugai, in triplicate
Torres et al.[81] Chile, Valdivia River Basin 19.7 (970) NA
Urbina et al.[82] Columbia, Cartagena and Sincelejo, 3.2 (253) Direct wet mount
children and infants with acute diarrhea
Valles et al.[83] Venezuela, patients 9.1 (3060) Direct examination with
saline and lugol and Kato’s
concentration technique
Vidal et al.[84] Chile, Talca, preschool and school 26.3 (10,205), 19.7 NA
children, 6 periods divided into 1980-84, (12,010), 18.0
1985-89, 1990-94, 1995-99, 2000-04 and (11,680), 16.7
2005-07 (11,810), 8.6 (12,050)
and 10.1 (10,387)
Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Asia. From articles Abdel-Dayem et al.[85] Jordan, food handlers working at 0.11 (901) Wet mount preparations with
with healthy that luxurious hotels in the dead sea area physiological saline and iodine.
are not older than Formalin-ether concentration
20 years Akdemir and Turkey, older than 15 years 0.44 (675) Native and formalin-ethyl
Helvaci[86] acetate sedimentation
Amin[87] Saudi Arabia, Jeddah, healthy food 0,4 (250) NA
handlers
Azian et al.[88] Malaysia, Pahang, aborigine community 10.8 (130) Samples fixed in polyvinyl
alcohol, Trichrome staining
Ben-Shimol et al.[89] Israel, Southern Israel, children, samples 0.0065 (45,978) Sedimentation based
collected over 5 year period, not unique concentration. Stained with and
samples, but did not include samples without lugol
collected within 30 days of last sample
Börekci and Uzel[90] Turkey, Mersin, Children living in social 2.8 (106) Formol-ether-acetate, native
service child care centre lugol, Kinyoun’s acid fast
staining
Cengiz et al.[91] Turkey, Van, Children attending primary 0.3 (395) Native-lugol, flotation and
school trichrome staining
Cengiz et al.[92] Turkey, Van, Children attending primary 1.8 (2,975) Native-lugol, flotation and
school trichrome staining
Danchaivijitr Thailand, food handlers working at 4.1 (121) and 1.6 Identified by microscopy (does
et al.[93] included hospital, examined twice: 1st time in 2002 (129) from 1st and not specify how)
1st examination in and 2nd time in 2004 after education on 2nd examination,
calculations hand hygiene and treatment of positive respectively
cases
Daryani et al.[94] Iran, Sari, schoolchildren 1.5 (1,100) added Direct and after formalin-ether
both mono- and concentration staining with
polyparasitism Ziehl-Neelsen and trichrome
where E. nana is
included
Degerli Turkey, Alahaci village primary school 1st examination NA
et al.[95] included children in Sivas, examined twice at six 4.2 (189) and 2nd
1st examination in months intervals examination 0 (175)
calculations
Contd...

Tropical Parasitology 19 Jan 2016 | Volume 6 | Issue 1 |

 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...

Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Guducuoglu et al.[96] Turkey, Van province, 1st and 2nd grade 0.5 (195) NA
students
Hamamci et al.[97] Turkey, Kayseri-Hacilar region, Children 1.8 (328) Native-lugol
attending primary school
Kia et al.[98] Iran, Mazandaran province, rural 0.7 (855) Formalin-ethyl-acetate
inhabitants, collected randomly concentration
Kitvatanachai and Thailand, Lak Hok subdistrict, 7.9 (202) Direct examination and after
Rhongbutsri[99] government schools aged 7-12 years, modified formalin-ether
fecal samples requested from 1253 concentration technique
students received 202
Koshak and Zakai[100] Saudi-Arabia, pre-employment workers 16.4 (292) Formalin ether, iodine stain
and their families
Kurtoglu et al.[101] Turkey, Van region, food sector workers 0.27 (739) NA
Lee et al.[102] Philippines, Legaspi city, children and 9.4 (64) Formalin-ether sedimentation
adolescents
Lu and Sung[103] Immigrant population in northeastern 0.7 (144), 1.4 (276), Merthiolate-iodine-
Taiwan tested for residence approval, 0.9 (114) and formaldehyde concentration and
from four countries: China, Indonesia, 1.3 (396) from the direct wet-mount
Vietnam and The Philippines different countries,
respectively
Ngrenngarmlert Thailand, Nakhon Prathom province, 1.0 (1,920) Formalin-ethyl acetate
et al.[104] school children 7-12 years
Oyofo et al.[105] Indonesia, Jakarta, two groups: Group 0 (51) from group Melvin and Brookes method
one patients with diarrhea and group two
two controls not having diarrhea
Prownebon et al.[106] Thailand, Pathum Thani province, 2.2 (137) and 0.7 (145) Simple smear and formalin-
children 1-6 years old, two groups: from group one and ether concentration
Group one children at orphanage and two. respectively
group two hill-tribe children
Sagnuankiat et al.[107] Thailand, Samut Sakhon province, 3.5 (372) Direct smear with normal saline
immigrant children at daycare centers 1 % iodine solution
Saksirisampant Thailand, Pathum Thani province, 3.7 (106) Simple smear preparation and
et al.[108] children in an orphanage (0-7 years) formalin-ether concentration
Saksirisampant Thailand, Chiang Mai Province, school 4.8 (542) Formalin-ether concentration
et al.[109] children 3-19 from the Karen Hill-Tribe
Saksirisampant Thailand, central region, children 0.48 (1,037) Formalin-ether concentration
et al.[110] attending primary school 3-12 years
Tungtrongchitr Thailand, two groups: group one 0 (25) from group Direct smear with saline
et al.[111] IBS patients and group two controls two solution and iodine, trichrome,
without IBS modified trichrome and acid-
fast staining
Tungtrongchitr Thailand, Ubon Ratchathani Province, 0.2 (479) Direct smear and modified Kato
et al.[112] rural communities thick smear
Waikagul et al.[113] Thailand, Nan-province, children from 2.5 (1,010) Formalin-ether sedimentation
primary schools
Warunee et al.[114] Thailand, Nakhon Prathom province, 1.0 (1,920) Formalin-ethyl acetate
schoolchildren 7-12 years old concentration
Wilairatana et al.[115] Thailand, laborers going abroad for 2.5 (362) Formalin-ether concentration
work, asymptomatic
Wongjindanon Thailand, two groups: group one 0 (3,358) and 0.76 Group one simple smear and
et al.[116] volunteers any age from Surin (656) from group one group two saline sedimentation,
province (rural) and group two healthy and two, respectively stained with iodine, all samples
schoolchildren between 5-7 years old were examined in duplicates
from Samut Sakhon province (sub-urban)
Yaicharoen et al.[117] Thailand, Bangkok, asymptomatic 0.27 (1,147) and Direct smear
participants, two groups: Group one 0.65 (1,083) from
participants examined in 1999 and group group one and two,
two participants examined in 2004 respectively
Contd...

Jan 2016 | Volume 6 | Issue 1 | 20 Tropical Parasitology

 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...

Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Yaicharoen et al.[118] Thailand, Nakhon Pathom province, 2.2 (814) Cultured in Jones
children attending public schools medium (48 h), formalin ethyl
acetate concentration
Asia. From articles Akao et al.[119] Japan, Ishikawa, foreign workers from 5.6 (198) NA
with patients or Indonesia and the Philippines
that are older than Akhlaghi et al.[120] Iran, patients referred to three hospitals 3.2 (1,000) Direct smear, formol-ethyl
20 years in Tehran during, random selection of acetate, Ziehl-Neelsen
1000 samples
Arslan et al.[121] Turkey, 2-6 years old children with 4.3 (138) Centrifugal formalin ether, zinc-
gastrointestinal symptoms sulphate flotation and modified
acid fast techniques, Lugols stain
Azami et al.[122] Iran, renal transplant recipients 8.7 (150) Direct smear, formalin-ether
sedimentation, Sheather’s
flotation and modified Ziehl-
Neelsen staining
Carney et al.[123] Indonesia, Central and South Sulawesi, 1 (1,156) NA
remote areas
Carney et al.[124] Philippines, North Bohol, rural areas, 7.1 (1,694) Direct and after formalin-ether
volunteers concentration
Carney et al.[125] Philippines, Bukidnon province, 3.9 (831) Direct and after formalin-ether
volunteers concentration
Carney et al.[126] Philippines, Oriental Mindoro, 4.1 (1,058) Direct and after formalin-ether
volunteers concentration
Chiu et al.[127] Taiwan, Nantou county, Village 2.6 (417) Direct smear and formalin-ether
suspected of Taenia solium outbreak sedimentation
Choi et al.[128] Korea, clinical samples 0.26 (782) Formalin-ether concentration
Kim et al.[129] South Korea, inhabitants in the upper 0.3 (743) Formalin-ether concentration
stream of Taechong Dam, located on the
Kumgang river
Cross et al.[130] Borneo, West Kalimantan, 8 villages, 6 (2,101) NA
based on number of stool samples
examined
Cross et al.[131] Indonesia, North Sumatra, 5 villages, 8 (2,066) NA
based on number of stool samples
examined
Cross et al.[132] Phillippines, North Samar Province, 6 (1,394) NA
persons living in 8 barrios, based on
number of stool samples examined
Cross et al.[133] Indonesia, Irian Jaya (West Irian), based 8 (114) NA
on number of stool samples examined
Dogan et al.[134] Turkey, children with diarrhea 2.2 (225) Formalin-ether sedimentation
Goo et al.[135] Korea, Yondo, remote island, single stool 0.8 (1,011) Formalin-ether centrifugal
samples sedimentation
Hong et al.[136] Korea, Jeonlanam Do province, 4 urban 2.5 (4,116) Formalin-ether sedimentation,
and 7 rural areas Lugol’s iodine stain
Hong[137] Korea, soldiers, from 1983-1985 1.7 (2,643) Formalin-ether concentration
Iqbal et al.[138] Kuwait, patients in two groups: group 15 (3,549) and A single fecal sample
one with gastrointestinal symptoms and 0.2 (500) from concentrated with
group two with complaints other than group one and two, formalin based method
gastrointestinal symptoms respectively (EPC concentrator). Wet
examinations with physiological
saline and with iodine
Kim et al.[139] Korea and Vietnam, single specimens 0.14 (717), 6.1 (1,933), Iodine stain, different
examined twice, four groups: Group one 3.9 (433) and 1.8 concentration techniques
Vietnamese, group two US armed forces, (114) from group
group three Korean troops in South one, two, three and
Vietnam and group four Korean home four, respectively
patients at 1st army hospital in Korea
Kim et al.[140] Korea 10.0 (2250) Direct, zinc sulfate flotation and
formalin-ether sedimentation
Kim et al.[141] Korea, Gyeong-gi Do and Jeonra Bug Do 2.7 (2735) Formalin-ether sedimentation
Contd...
Tropical Parasitology 21 Jan 2016 | Volume 6 | Issue 1 |
 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...

Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Kim et al.[142] Korea, patients attending Samsung 1.2 (12,163), 1.2 NA
medical center, 7 years 2000-2006 (14,194), 1.8 (12,377),
2.0 (9,945), 2.2
(9,685), 1.7 (10,110)
and 2.1 (9,599) from
the consecutive
years, respectively
Kim et al.[143] Korea, all samples submitted to Samsung 2.6 (26,452), 2.1 Formalin-ether sedimentation
medical center for parasitological (43,603), 1.4 (44,514),
investigation, 10 years 2003 - 2012 1.5 (43,347), 1.4
(43,921), 1.5 (56,849),
1.5 (57,607), 1.0
(56,301), 1.0 (57,272)
and 0.97 (56,946)
from the consecutive
years, respectively
Lee et al.[144] Southeast asia, aircrew personal, 2.6 (557) NA
mainly males
Lee et al.[145] Korea, Seoul Paik hospital, 9 years 1984 0.8 (5,353), 0.5 Formalin-ether sedimentation
- 1992 (4,919), 0.4 (4,795), and/or direct smear
0.6 (5,458), 0.9
(5,795), 0.7 (6,895),
0.6 (6,615), 0.7 (7,200)
and 1.7 (5,522) from
the consecutive
years, respectively
Lee et al.[146] Korea, handicapped at an institution 21.4 (112) Formalin-ether sedimentation
Mangali et al.[147] Indonesia, south Sulawesi, Campalagian 12.5 (380) Formalin ether concentration
district, 3 coastal and 2 inland villages
Nasiri et al.[148] Iran, Karaj, refugees 0.05 (13,915) Formalin-ethyl acetate
sedimentation and trichrome
stain
Niyyati et al.[149] Iran, Tehran, people referred to Kashani 0.97 (205) Direct examination and
hospital formalin-ether concentration
Oyofo et al.[105] Indonesia, Jakarta, two groups: Group 0.5 (389) from group Melvin and Brookes method
one patients with diarrhea and group one
two controls not having diarrhea
Purnomo et al.[150] Indonesia, West Flores, Karakuak 1 (198) NA
Sahin et al.[151] Turkey, wrestlers of the national team at 11.1 (18) NA
training camp in Kayseri, majority had
gastrointestinal complaints
Sharif et al.[152] Iran, Mazandaran province, children 3.9 (362) Direct wet mount, formol-ether
who are intellectually disabled, Three concentration, Ziehl-Neelsen
fecal samples collected and trichrome staining
Shokri et al.[153] Iran, mentally retarded 2.3 (133) Direct smear, formalin-ether
concentration and stained with
Trichrome and Ziehl-Neelsen
Stafford and Indonesia, Sumatra, Aceh province, 7 (348) Direct and formalin-ether
Joesoef [154] Bireuen and Takengon, volunteers concentration
Stafford et al.[155] Indonesia, Gorontalo North Sulawesi, 5 (156) Direct and formalin-ether
indigenous mountain people primarily concentration
moslems
Stafford et al.[156] Indonesia, Bali 7 (270) Direct and formalin-ether
concentration
Subbannayya et al.[157] India, Karnataka, south Kanara district, 0.10 (1,020) Direct smear with saline and
apparently healthy people D’Antoni’s iodine, Zinc sulfate
concentration and culture in
modified Boek and Drbolhav
medium
Supanaranond Thailand, Volunteers in cholera vaccine 3.5 (171) NA
et al.[158] trial
Contd...

Jan 2016 | Volume 6 | Issue 1 | 22 Tropical Parasitology

 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...

Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Tanyuksel et al.[159] Turkey, patients with symptomatic 2.3 (380) Fresh, lugol and trichrome stain
diarrhea/dysentery
Tungtrongchitr Thailand, two groups: group one IBS 5.1 (59) from group Direct smear with saline solution
et al.[111] patients and group two controls without one and iodine, trichrome, modified
IBS trichrome and acid-fast staining
Yaman et al.[160] Turkey, samples send to parasitological 1.26 (28911) Flotation/sedimentation
laboratory at Erciyes University between methods, native-Lugol stain
2005-2008
Yazar et al.[161] Turkey, samples send to parasitological 1.4 (34883) Flotation/sedimentation
laboratory at Erciyes University between methods, native-Lugol stain
2000-2004
Yosefi et al.[162] Iran, Ahvaz, AIDS patients 5 (100) Merthiolate-iodine-
formaldehyde, trichrome and
Ziehl-Neelsen staining
Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Africa. From articles Graczyk et al.[163] Zambia, school-age children, half of the 64.3 (93) Direct wet smear, Sheather’s
with healthy that stools diarrheic sugar flotation and stained with
are not older than Lugols iodine
20 years Ikeh et al.[164] Nigeria, single stool specimens, Two 16.2 (111) and Formol-ether and modified
groups: one volunteers in rural village 18.3 (93) from Ziehl-Neelsen technique
and two randomly selected urban group one and two,
dwellers. Study groups unique in being respectively
adults where samples are not sent to
diagnostic facilities due to diarrhea
Ouattara et al.[165] Western Cote d’Ivoire, rural area, pupils 83.8 (4,466) Formol-ether concentration
6-16 years at 57 different schools
Raso et al.[166] Cote d’Ivoire, schoolchildren 82.6 (4,042) Formol-ether concentration
Africa. From articles Chunge et al.[167], Kenya, Kiambu District, Nderu, rural 30.4 (1,129), Direct smear in saline and iodine
with patients or includes only 1st community, 4 cross-sectional surveys, 21.4 (388), 28.9 (401) and a modified formol ether
that are older than study in calculations 2nd, 3rd and 4th based on selected group and 31.1 (363) from concentration method, examined
20 years from the 1st study. Endolimax was more study one, two, three at 10X and 400X magnification
commonly encountered in formed stools and four, respectively
El Shazly et al.[168] Egypt, patients 6.9 (3,180) Direct wet smear, formol-
ether concentration, modified
Sheather’s sugar flotation,
Potassium hydroxide
concentration. Gomori’s
Trichrome stain, and modified
Kinyoun’s acid-fast stain
Goldsmid et al.[169] Rhodesia (Zambia and Zimbabwe), 12.8 (180) Water centrifugation (strained
institution with cases of amoebic stool emulsified in tap water)
dysentery had been recorded and formol-ether concentration
Hunter et al.[170] Zambia, two groups, one patients with 11 (90) and 19 (105) Formol-ether concentration
AIDS and two controls adults recruited from group one and
from a township near Lusaka (only 1 two, respectively
complaining of diarrhea)
Kasssem et al.[171] Libya, Sirt, children and neonates 13.7 (350) NA
admitted to Ibn-Sina hospital, examined
2001-2002
Ogunba[172] Nigeria, Ibadan, two groups: one patients 3.1 (360,000) and Saline and iodine preparation
at University College Hospital in Ibadan 4.6 (4,021) from from fresh stool samples, later
collected from 1967-1977 and two healthy group one and two, formalin-ether concentration
Nigerians in the indigenous areas of respectively
Ibadan mainly children also teachers,
food sellers and parents of the children
Okafor and Nigeria, villagers from rural areas 0.3 (300) Formal-ether centrifugation
Azubike[173] reporting at the parasitological laboratory
Pampiglione et al.[174] Tanzania, Pemba island, collected from 4.3 (392) Modified Ritchie technique
healthy population chosen at random

Contd...

Tropical Parasitology 23 Jan 2016 | Volume 6 | Issue 1 |

 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...

Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Pampiglione et al.[175] Sao Tome and Principe, collected from 7.0 (1,050) Modified Ritchie technique
healthy population chosen at random
Prinz et al.[176] Northeast Zaire, Azande 1.3 (165) NA
Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Australia. From Ashford and Papua New Guinea, Asaro Valley, sing- 41 (995) Wet mount and iodine stained,
articles with Atkinson[177] out sampling, points at sampling bias gomori trichrome and saffranin
patients or that are associated with this method and methylene blue
older than 20 years Sawangjaroen et al.[178] Australia, Brisbane, non-hospital patients 1.2 (260) Unknown if found in routine
with diarrhoea microscopy or when culturing
D. fragilis
Stark et al.[179] Australia, Sydney, Three groups all 10 (618), 12 (628) and One fecal sample from
patients with diarrhea: one homosexual 0.8 (622) from group each, formalin-ethyl acetate
men with HIV, two homosexual men one, two and three, concentration, iron-hematoxylin
without HIV and three heterosexual men respectively stain

SUPPLEMENTARY REFERENCES 14. Mendoza D, Núñez FA, Escobedo A, Pelayo L, Fernández M,

1. Pérez Armengol C, Ariza Astolfi C, Ubeda Ontiveros  JM,
Guevara Benítez DC, de Rojas Alvarez M, Lozano
Serrano C. [Epidemiology of children's intestinal
parasitism in the Guadalquivir Valley, Spain]. Rev Esp
Salud Publica 1997;71:547-52.
2. Sagebiel D, Weitzel T, Stark K, Leitmeyer K. Giardiasis
in kindergartens: Prevalence study in Berlin, Germany,
2006. Parasitol Res 2009;105:681-7.
3. Schlosser O, Grall D, Laurenceau MN. Intestinal parasite
carriage in workers exposed to sewage. Eur J Epidemiol
1999;15:261-5.
4. Cerva L, Kliment V. Contribution to the problem of the
so-called nonpathogenic amoebae in the intestine of man.
Folia Parasitol (Praha) 1978;25:367-70.
5. Chin AT, Gerken A. Carriage of intestinal protozoal cysts
in homosexuals. Br J Vener Dis 1984;60:193-5.
6. Jokipii L, Sargeaunt PG, Jokipii AM. Coincidence of
deficient delayed hypersensitivity and intestinal protozoa
in homosexual men. Scand J Infect Dis 1989;21:563-71.
7. Portús M, Prats G. [Contribution to the knowledge
of intestinal protozoa infestation in the hospital
population of Barcelona (author's transl)]. Med Clin (Barc)
1981;76:203-5.
8. Soriano JM, Domènech G, Martínez MC, Mañes J, Soriano F.
Intestinal parasitic infections in hosted Saharawi children.
Trop Biomed. 2011;28:557-62.
9. Stĕrba J, Ditrich O, Prokopic J, Kadlcík K. Gastrointestinal
parasitoses discovered in agricultural workers in South
Bohemia, Czechoslovakia. Folia Parasitol (Praha)
1988;35:169-73.
10. Stürchler D, Peter R. [Parasitic disease in schoolchildren in
a village in Swiss Jura]. Soz Praventivmed 1981;26:317-9.
11. Aimpun P, Hshieh P. Survey for intestinal parasites in
Belize, Central America. Southeast Asian J Trop Med
Public Health 2004;35:506-11.
12. Faulkner CT, Garcia BB, Logan MH, New JC, Patton S.
Prevalence of endoparasitic infection in children and its
relation with cholera prevention efforts in Mexico. Rev
Panam Salud Publica 2003;14:31-41.
13. Kurup R, Hunjan GS. Epidemiology and control of
Schistosomiasis and other intestinal parasitic infections
among school children in three rural villages of south
Saint Lucia. J Vector Borne Dis 2010;47:228-34.
Torres D, et al. [Intestinal parasitic infections in 4 child day-
care centers located in San Miguel del Padrón municipality,
Havana City, 1998]. Rev Cubana Med Trop 2001;53:189-93.
15. Acuna-Soto R, Samuelson J, De Girolami P, Zarate L,
Millan-Velasco F, Schoolnick G, et al. Application of
the polymerase chain reaction to the epidemiology of
pathogenic and nonpathogenic Entamoeba histolytica.
Am J Trop Med Hyg 1993;48:58-70.
16. Barrett DM, Steel-Duncan J, Christie CD, Eldemire-
Shearer D, Lindo JF. Absence of opportunistic parasitic
infestations in children living with HIV/AIDS in
children's homes in Jamaica: pilot investigations. West
Indian Med J 2008;57:253-6.
17. Bruckner DA, Garcia LS, Voge M. Intestinal parasites in Los
Angeles, California. Am J Med Technol 1979;45:1020-2.
18. Church C, Neill A, Schotthoefer AM. Intestinal infections
in humans in the Rocky Mountain region, United States.
J Parasitol 2010;96:194-6.
19. Church DL, Sutherland LR, Gill MJ, Visser ND, Kelly JK.
Absence of an association between enteric parasites in
the manifestations and pathogenesis of HIV enteropathy
in gay men. The GI/HIV Study Group. Scand J Infect Dis
1992;24:567-75.
20. Edouard A, Edouard S, Desbois N, Plumelle Y, Rat C,
Calès-Quist D, et al. [Evolution in the prevalence of
intestinal parasitosis in the Fort de France University
Hospital (Martinique)]. Presse Med 2004;33:707-9.
21. Elliott S, Long EG, Truant AL, Smith JH. Parasitic
infections encountered on the Texas Gulf Coast. Tex Med
1981;77:45-6.
22. Haddad CG, Agrawal N. Gastrointestinal parasitic
infection: an overlooked entity. South Med J 1982;75:778-9.
PubMed PMID: 7089641.
23. Kabani A, Cadrain G, Trevenen C, Jadavji T, Church DL.
Practice guidelines for ordering stool ova and parasite
testing in a pediatric population. The Alberta Children's
Hospital. Am J Clin Pathol 1995;104:272-8.
24. Kappus KK, Juranek DD, Roberts JM. Results of testing for
intestinal parasites by state diagnostic laboratories, United
States, 1987. MMWR CDC Surveill Summ 1991;40:25-45.
25. Peters C, Kocka F, Chittom A, Sable R, Janda W. High
Carriage of Endolimax-Nana In Diarrheal Specimens
From Homosexual Men. Letters in Applied Microbiology
1987;5:65-6.

Jan 2016 | Volume 6 | Issue 1 | 24 Tropical Parasitology

 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion
26. Ramírez-Miranda ME, Jiménez-González DE, Rodríguez-
Campa ME, González-Angulo A, Hernández-Castellanos R,
Sara Arroyo-Escalante A, et al. [Irritable bowel syndrome:
frequency and phylogenetic relationship of Blastocystis
sp. from Mexican patients]. Rev Gastroenterol Mex
2011;76:309-15.
27. Ribes JA, Seabolt JP, Overman SB. Point prevalence of
Cryptosporidium, Cyclospora, and Isospora infections in
patients being evaluated for diarrhea. Am J Clin Pathol
2004;122:28-32.
28. Robinson RD, Murphy EL, Wilks RJ, Neva FA, Terry SI,
Hanchard B, et al. Gastrointestinal parasitic infection
in healthy Jamaican carriers of HTLV-I. J Trop Med Hyg
1991;94:411-5.
29. Rojas CL, Angel Núñez CF, Aguiar PH, Silva Ayçaguer CL,
Alvarez D, Martínez R, et al. [Second national survey of
intestinal parasitic infections in Cuba, 2009]. Rev Cubana
Med Trop 2012;64:15-21.
30. Tsaihong JC, Liou MY, Ma PC. Enteric parasites and
antibodies to human immunodeficiency virus in
homosexual men with diarrhea. Gaoxiong Yi Xue Ke Xue
Za Zhi 1993;9:567-71.
31. Ungar BL, Iscoe E, Cutler J, Bartlett JG. Intestinal parasites
in a migrant farmworker population. Arch Intern Med
1986;146:513-5.
32. Wilkins R, Horner N. Human Intestinal Parasitosis In
Northern Chihuahua, Mexico. Texas Journal of Science
1991;43:81-9.
33. Yamamoto-Furusho JK, Torijano-Carrera E. Intestinal
protozoa infections among patients with ulcerative
colitis: Prevalence and impact on clinical disease course.
Digestion 2010;82:18-23.
34. Acurero E, Avila A, Rangel L, Calchi M, Grimaldos R,
Cotiz M. Intestinal Protozoa in School Children at Public
and Private Institutions in the Maracaibo Municipality,
State of Zulia. Kasmera 2013;41:50-8.
35. Alves JR, Macedo HW, Ramos AN, Ferreira LF,
Gonçalves ML, Araújo A. [Intestinal parasite infections in
a semiarid area of Northeast Brazil: Preliminary findings
differ from expected prevalence rates]. Cad Saude Publica
2003;19:667-70.
36. Assis EM, Olivieria RC, Moreira LE, Pena JL, Rodrigues LC,
Machado-Coelho GL. [Prevalence of intestinal parasites
in the Maxakali indigenous community in Minas Gerais,
Brazil, 2009]. Cad Saude Publica 2013;29:681-90.
37. Berbert-Ferreira M, Costa-Cruz JM. [Intestinal parasites
in children aged 4-12 months attending day-care centers
of Federal University-Uberlândia-MG]. J Pediatr (Rio J)
1995;71:219-22.
38. Bermúdez A, Flórez O, Bolaños MV, Medina JJ,
Salcedo-Cifuentes M. [Enteroparasitism, hygiene
and environmental sanitation in under-aged from six
indigenous communities. Cali-Colombia]. Rev Salud
Publica (Bogota) 2013;15:1-11.
39. Biscegli T, Romera J, Candido A, Santos J, Candido E,
Binotto A. Nutritional status and enteroparasitosis
prevalence among children enrolled in a day care center.
Rev Paul Pediatr; 2009. p. 289-95.
40. Bracciaforte R, Diaz M, Pivetta V, Burstein V, Varengo H,
Orsilles M. Enteroparasites in children and adolescents
of a periurban community in the province of Cordoba.
Acta Bioquimica Clinica Latinoamericana 2010;44:353-8.
41. Castro ED, Germini MC, Mascarenhas JD, Gabbay YB,
de Lima IC, Lobo PoS, et al. Enteropathogens detected
in a daycare center, Southeastern Brazil: bacteria, virus,
Tropical Parasitology 25 Jan 2016 | Volume 6 | Issue 1 |
and parasite research. Rev Inst Med Trop Sao Paulo.
2015;57:27-32.
42. Damazio SM, Lima MeS, Soares AR, Souza MA. Intestinal
parasites in a quilombola community of the Northern
State of Espírito Santo, Brazil. Rev Inst Med Trop Sao
Paulo 2013;55.
43. Maco Flores V, Marcos Raymundo LA, Terashima
Iwashita A, Samalvides Cuba F, Gotuzzo Herencia E.
[Distribution of entero-parasitic infections in the Peruvian
Highland: Study carried out in six rural communities of
the department of Puno, Peru]. Rev Gastroenterol Peru
2002;22:304-9.
44. Franke MF, Del Castillo H, Pereda Y, Lecca L, Fuertes J,
Cárdenas L, et al. Parasite infection and tuberculosis
disease among children: A case-control study. Am J Trop
Med Hyg 2014;90:279-82.
45. Freites A, Colmenares D, Pérez M, García M, Díaz de
Suárez O. [Cryptosporidium sp infections and other
intestinal parasites in food handlers from Zulia state,
Venezuela]. Invest Clin 2009;50:13-21.
46. Ibanez H, Jara C, Guerra M, Diaz L. Prevalencia del
enteroparasitismo en escolares de comunidades nativas
del alto Maranon, Amazonas, Peru Rev Peru MEd Exp
Salud Publica; 2004. p. 126-33.
47. Kobayashi J, Hasegawa H, Forli AA, Nishimura NF,
Yamanaka A, Shimabukuro T, et al. Prevalence of
intestinal parasitic infection in five farms in Holambra,
São Paulo, Brazil. Rev Inst Med Trop Sao Paulo.
1995;37:13-8.
48. Korkes F, Kumagai FU, Belfort RN, Szejnfeld D, Abud TG,
Kleinman A, et al. Relationship between intestinal
parasitic infection in children and soil contamination
in an urban slum. J Trop Pediatr 2009;55:42-5.
49. Laugart E, Garcia F, Nunez C, Pena M, Fundora I,
Medina R. Aspects on children epidemiology of intestinal
parasites in Vegon Nutrias, Venezuela. Revista Cubana
de Higiene y Epidemiologia; 2012. p. 330-9.
50. Machado E, Santos D, Costa-Cruz J. Enteroparasites
and commensals among children in four peripheral
districts of Uberlandia, State of Minas Gerais. Revista Da
Sociedade Brasileira De Medicina Tropical 2008;41:581-5.
51. Mercado R, Otto JP, Musleh M, Pérez M. [Human infection
by intestinal protozoa and helminths in Calbuco County,
X Region, Chile, 1997]. Bol Chil Parasitol 1997;52:36-8.
52. Milano AM, Oscherov EB, Palladino AC, Bar AR.
[Children enteroparasitosis in north east Argentine urban
area]. Medicina (B Aires) 2007;67:238-42.
53. Mora L, Martínez I, Figuera L, Segura M, Del Valle G.
[Protozoans in superficial waters and faecal samples
of individuals of rural populations of the Montes
municipality, Sucre state, Venezuela]. Invest Clin
2010;51:457-66.
54. Moura EC, Bragazza LM, Coelho MF, Aun SM. [Prevalence
of intestinal parasitosis in schoolchildren]. J Pediatr
(Rio J) 1997;73:406-10.
55. Munoz-Antoli C, Pavon A, Marcilla A, Toledo R,
Esteban J. Prevalence and risk factors related to
intestinal parasites among children in Department
of Rio San Juan, Nicaragua. Transactions of the
Royal Society of Tropical Medicine and Hygiene
2014;108:774-82.
56. Nascimento SA, Moitinho MaL. Blastocystis hominis
and other intestinal parasites in a community of Pitanga
City, Paraná State, Brazil. Rev Inst Med Trop Sao Paulo
2005;47:213-7.
 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion
57. Rios L, Cutolo S, Giatti L, Castro M, Rocha A, Toledo R,
et al. Prevalence of intestinal parasites and social-
environmental aspects in an indigenous community
in the lauarete district, municipality of Sao Gabriel
da Cachoeira (AM), Brasil. Saude Soc Sao Paulo;
2007. p. 76-86.
58. Rivero-Rodríguez Z, Chourio-Lozano G, Diaz I, Cheng R,
Rucsón G. [Intestinal parasites in school children at a
public institution in Maracaibo municipality, Venezuela].
Invest Clin 2000;41:37-57.
59. Saldiva SR, Silveira AS, Philippi ST, Torres DM,
Mangini AC, Dias RM, et al. Ascaris-Trichuris association
and malnutrition in Brazilian children. Paediatr Perinat
Epidemiol 1999;13:89-98.
60. Santos SA, Merlini LS. [Prevalence of enteroparasitosis
in the population of Maria Helena, Paraná State]. Cien
Saude Colet 2010;15:899-905.
61. Silva L, da Silva E, da Silva R. Parasitological diagnosis
of horticulturist in monitoring parasitic contamination in
rural environments. Bioscience Journal 2010;26:648-52.
62. Tabares L, Gonzalez L. Prevalence of intestinal parasites
in children under 12 years of age, hygienic habits,
characteristics of the houses and presence of bacteria in
the drinking water of a locality of Sabaneta, Columbia.
Iatreia 2008;21:253-9.
63. Takizawa M, Falavigna DL, Gomes ML. Enteroparasitosis
and their ethnographic relationship to food handlers in a
tourist and economic center in Paraná, Southern Brazil.
Rev Inst Med Trop Sao Paulo 2009;51:31-5.
64. Tashimi N, Simoes M, Leite C, Fluminhan A, Nogueira M,
Malaspina A. Classic and molecular study of Giardia
doudenalis in children from a daycare center in the region
of presidente prudente, Sao Paulo, Brazil Rev Inst Med
trop S Paulo; 2009. p. 19-24.
65. Amancio F, Pascotto V, Souza L, Calvi S, Pereira P.
Intestinal parasitic infections in HIV/AIDS patients:
Epidemiological, nutritional and immunological aspects.
Journal of Venomous Animals and Toxins Including
Tropical Diseases 2012;18:225-35.
66. Bourée P, David P, Basset D, Coco O, Beauvais B,
David-Julien MC, et al. [Epidemiologic survey of intestinal
parasitoses in Peruvian Amazonia]. Bull Soc Pathol Exot
Filiales 1984;77:690-8.
67. Cancrini G, Bartoloni A, Nuñez L, Paradisi F. Intestinal
parasites in the Camiri, Gutierrez and Boyuibe areas, Santa
Cruz Department, Bolivia. Parassitologia 1988;30:263-9.
68. Carvalho-Costa FA, Gonçalves AQ, Lassance SL,
de Albuquerque CP, Leite JP, Bóia MN. Detection of
Cryptosporidium spp and other intestinal parasites in
children with acute diarrhea and severe dehydration in
Rio de Janeiro Rev Soc Bras Med Trop 2007;40:346-8.
69. Cho SY, Kim JH, Park SH. Status of intestinal parasite
infections in inhabitants of Palmar, Guayas Province,
Ecuador. Kisaengchunghak Chapchi 1990;28:109-13.
70. Cimerman S, Cimerman B, Lewi DS. Prevalence of
intestinal parasitic infections in patients with acquired
immunodeficiency syndrome in Brazil. Int J Infect Dis
1999;3:203-6.
71. Garibaldi R, Muñoz N, Neira P, Subercaseaux B, Villalón L.
[Intestinal parasites and ectoparasites in the V region,
Chile: study in the Psychiatric Hospital of Putaendo]. Bol
Chil Parasitol. 1990;45(3-4):83-5. PubMed PMID: 2152365.
72. Goldin AJ, Apt W, Aguilera X, Zulantay I, Warhurst DC,
Miles MA. Efficient diagnosis of giardiasis among nursery
and primary school children in Santiago, Chile by capture
Jan 2016 | Volume 6 | Issue 1 | 26 Tropical Parasitology
ELISA for the detection of fecal Giardia antigens. Am J
Trop Med Hyg 1990;42:538-45.
73. Guignard S, Arienti H, Freyre L, Lujan H, Rubinstein H.
Prevalence of enteroparasites in a residence for children
in the Córdoba Province, Argentina. Eur J Epidemiol
2000;16:287-93.
74. Kulik RA, Falavigna DL, Nishi L, Araujo SM. Blastocystis
sp. and other intestinal parasites in hemodialysis
patients. Braz J Infect Dis 2008;12:338-41.
75. Maia MM, Fausto MA, Vieira EL, Benetton ML,
Carneiro M. Intestinal parasitic infection and associated
risk factors, among children presenting at outpatient
clinics in Manaus, Amazonas state, Brazil. Ann Trop
Med Parasitol 2009;103:583-91.
76. Merlano N, Falconar A, Solano H, Vivas C. Clinical
manifestations and risk factors associated with
Cryptosporidium spp. infections in patients from
Barranquilla and three "municipios" of Atlantico
(Columbia). Salud Uninorte Barranquilla; 2007. p. 19-31.
77. Moura H, Fernandes O, Viola JP, Silva SP, Passos RH,
Lima DB. Enteric parasites and HIV infection: occurrence
in AIDS patients in Rio de Janeiro, Brazil. Mem Inst
Oswaldo Cruz. 1989;84:527-33.
78. Navarrete N, Torres P. [Prevalence of infection by
intestinal helminths and protozoa in school children from
a coastal locality in the province of Valdivia, Chile]. Bol
Chil Parasitol 1994;49:79-80.
79. Rivero-Rodríguez Z, Hernández A, Bracho Á, Salazar S,
Villalobos R. [Prevalence of intestinal microsporidia and
other intestinal parasites in hiv positive patients from
Maracaibo, Venezuela]. Biomedica 2013;33:538-45.
80. Silva L, da Silva R, Fernandes N, de Oliveira J.
Parasitic And Intestinal Commensals In The Neoplastic
Patients Undergoing Chemotherapy. Bioscience Journal
2011;27:170-7.
81. Torres P, Miranda JC, Flores L, Riquelme J, Franjola R,
Pérez J, et al. [Blastocystosis and other intestinal
protozoan infections in human riverside communities of
the Valdivia River basin, Chile]. Rev Inst Med Trop Sao
Paulo 1992;34:557-64.
82. Urbina D, Arzuza O, Young G, Parra E, Castro R, Puello M.
Rotavirus type A and other enteric pathogens in stool
samples from children with acute diarrhea on the
Colombian northern coast. Int Microbiol 2003;6:27-32.
83. Valles L, Mieses M, Agobian G. Predominance of
Blastocystis hominis over other enteroparasites in
patients from Palavecino municipality, State of Lara,
Venezuela; Rev Cubana Med Trop; 2006. p. 14-8.
84. Vidal S, Toloza L, Cancino B. [Evolution of the prevalence
the enteroparasitoses in Talca-Chile]. Rev Chilena Infectol
2010;27:336-40.
85. Abdel-Dayem M, Al Zou'bi R, Hani RB, Amr ZS.
Microbiological and parasitological investigation among
food handlers in hotels in the Dead Sea area, Jordan;
J Microbiol Immunol Infect 2014;47:377-80.
86. Akdemir C, Helvaci R. [Evaluation of parasitological
laboratory results of a group of people older than 15 years
of age in Kutahya]. Turkiye Parazitol Derg 2007;31:37-40.
87. Amin AM. Blastocystis hominis among apparently
healthy food handlers in Jeddah, Saudi Arabia. J Egypt
Soc Parasitol 1997;27:817-23.
88. Azian M, San Y, Gan C, Yusri M, Nurulsyamzawaty Y,
Zuhaizarn A, et al. Prevalence of intestinal protozoa in
an aborigine community in Pahang, Malaysia; Tropical
Biomedicine 2007;24:55-62.
 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion
89. Ben-Shimol S, Sagi O, Greenberg D. Differences in
prevalence of parasites in stool samples between three
distinct ethnic pediatric populations in southern Israel,
2007-2011. Parasitol Int 2014;63:456-62.
90. Börekçi G, Uzel A. [The determination of intestinal
parasites, physical growth and hygiene behaviors of
children in the Mersin City Social Service Child Care
Centre]. Turkiye Parazitol Derg 2009;33:63-72.
91. Taş Cengiz Z, Ciçek M, Akbayram S, Yilmaz H. [Intestinal
parasites detected in Süphan Primary schoolchildren in
Van]. Turkiye Parazitol Derg 2009;33:294-7.
92. Taş Cengiz Z, Akbayram S, Ciçek M, Yilmaz H. [Intestinal
parasitoses detected in primary schoolchildren in the Van
province]. Turkiye Parazitol Derg 2009;33:289-93.
93. Danchaivijitr S, Rongrungruang Y, Kachintorn U,
Techasathit V, Pakaworavuthi S, Kachintorn K. Prevalence
and effectiveness of an education program on intestinal
pathogens in food handlers. J Med Assoc Thai 2005;88
Suppl 10:S31-5.
94. Daryani A, Sharif M, Nasrolahei M, Khalilian A,
Mohammadi A, Barzegar G. Epidemiological survey of the
prevalence of intestinal parasites among schoolchildren
in Sari, northern Iran. Trans R Soc Trop Med Hyg
2012;106:455-9.
95. Değerli S, Celiksöz A, Aslan A, Aciöz M, Ozçelik S.
[Comparison of the results of examination of fecal
samples from students at six months intervals in the
Alahaci village primary school in Sivas]. Turkiye Parazitol
Derg. 2006;30:305-7.
96. Güdücüoğlu H, Parlak M, Cıçek M, Yaman G, Oztürk O,
Cikman A, et al. [Investigation of intestinal parasites
in students of Mustafa Cengiz primary school in Van].
Turkiye Parazitol Derg 2010;34:172-5.
97. Hamamcı B, Cetinkaya U, Delice S, Erçal BD, Gücüyetmez
S, Yazar S. [Investigation of intestinal parasites among
primary school students in Kayseri-Hacılar]. Turkiye
Parazitol Derg 2011;35:96-9.
98. Kia E, Hosseini M, Nilforoushan M, Meamar A,
Rezaeian M. Study of intestinal protozoan parasites in
rural inhabitants of Mazandaran Province, northern Iran.
Iranian Journal of Parasitology 2008;3:21-5.
99. Kitvatanachai S, Rhongbutsri P. Intestinal parasitic
infections in suburban government schools, Lak Hok
subdistrict, Muang Pathum Thani, Thailand. Asian Pac
J Trop Med 2013;6:699-702.
100. Koshak EA, Zakai HA. A spectrum of pathogenic and
non-pathogenic intestinal parasites in pre-employment
medical check-up for workers and their families. J Family
Community Med 2003;10:47-53.
101. Kurtoğlu MG, Körkoca H, Ciçek M, Cengiz ZT. [Prevalence
of intestinal parasites among workers in food sector in
Van region]. Turkiye Parazitol Derg 2007;31:309-12.
102. Lee KJ, Ahn YK, Yong TS. A small-scale survey of
intestinal parasite infections among children and
adolescents in Legaspi city, the Philippines. Korean J
Parasitol 2000;38:183-5.
103. Lu CT, Sung YJ. Epidemiology of Blastocystis hominis
and other intestinal parasites among the immigrant
population in northeastern Taiwan by routine physical
examination for residence approval. J Microbiol Immunol
Infect 2009;42:505-9.
104. Ngrenngarmlert W, Lamom C, Pasuralertsakul S,
Yaicharoen R, Wongjindanon N, Sripochang S, et al.
Intestinal parasitic infections among school children in
Thailand. Tropical Biomedicine 2007;24:83-8.
Tropical Parasitology 27 Jan 2016 | Volume 6 | Issue 1 |
105. Oyofo BA, Subekti D, Tjaniadi P, Machpud N, Komalarini S,
Setiawan B, et al. Enteropathogens associated with
acute diarrhea in community and hospital patients
in Jakarta, Indonesia; FEMS Immunol Med Microbiol
2002;34:139-46.
106. Prownebon J, Charupoonphol P, Saksirisampant P,
Limvorapitak T, Seepongpun U, Saksirisampant W.
Intestinal parasitic infections: high prevalence of Giardia
intestinalis in children living in an orphanage compared
with hill-tribe children as detected by microscopy and
ELISA. Asian Biomedicine 2013;7:855-63.
107. Sagnuankiat S, Wanichsuwan M, Bhunnachet E,
Jungarat N, Panraksa K, Komalamisra C, et al. Health
Status of Immigrant Children and Environmental Survey
of Child Daycare Centers in Samut Sakhon Province,
Thailand; J Immigr Minor Health 2014.
108. Saksirisampant W, Nuchprayoon S, Wiwanitkit V,
Yenthakam S, Ampavasiri A. Intestinal parasitic infestations
among children in an orphanage in Pathum Thani province.
J Med Assoc Thai 2003;86 Suppl 2:S263-70.
109. Saksirisampant W, Prownebon J, Kanmarnee P, Thaisom S,
Yenthakam S, Nuchprayoon S. Prevalence of parasitism
among students of the Karen hill-tribe in Mae Chame
district, Chiang Mai province, Thailand; J Med Assoc
Thai 2004;87 Suppl 2:S278-83.
110. Saksirisampant W, Prownebon J, Kulkumthorn M,
Yenthakam S, Janpla S, Nuchprayoon S. Prevalence of
intestinal parasitic infections among school children
in the central region of Thailand; J Med Assoc Thai
2006;89:1928-33.
111. Tungtrongchitr A, Manatsathit S, Kositchaiwat C,
Ongrotchanakun J, Munkong N, Chinabutr P, et al.
Blastocystis hominis infection in irritable bowel
syndrome patients. Southeast Asian J Trop Med Public
Health 2004;35:705-10.
112. Tungtrongchitr A, Chiworaporn C, Praewanich R,
Radomyos P, Boitano JJ. The potential usefulness of the
modified Kato thick smear technique in the detection of
intestinal sarcocystosis during field surveys. Southeast
Asian J Trop Med Public Health 2007;38:232-8.
113. Waikagul J, Krudsood S, Radomyos P, Radomyos B,
Chalemrut K, Jonsuksuntigul P, et al. A cross-sectional study
of intestinal parasitic infections among schoolchildren in
Nan Province, Northern Thailand. Southeast Asian J Trop
Med Public Health. 2002;33:218-23.
114. Warunee N, Choomanee L, Sataporn P, Rapeeporn Y,
Nuttapong W, Sompong S, et al. Intestinal parasitic
infections among school children in Thailand Trop
Biomed 2007;24:83-8.
115. Wilairatana P, Radomyos P, Radomyos B, Phraevanich R,
Plooksawasdi W, Chanthavanich P, et al. Intestinal
sarcocystosis in Thai laborers; Southeast Asian J Trop
Med Public Health 1996;27:43-6.
116. Wongjindanon N, Suksrichavalit T, Subsutti W,
Sarachart T, Worapisuttiwong U, Norramatha P. Current
infection rate of Giardia lamblia in two provinces of
Thailand; Southeast Asian J Trop Med Public Health
2005;36 Suppl 4:21-5.
117. Yaicharoen R, Sripochang S, Sermsart B, Pidetcha P.
Prevalence of Blastocystis hominis infection in
asymptomatic individuals from Bangkok, Thailand.
Southeast Asian J Trop Med Public Health 2005;36 Suppl
4:17-20.
118. Yaicharoen R, Ngrenngarmlert W, Wongjindanon N,
Sripochang S, Kiatfuengfoo R. Infection of Blastocystis
hominis in primary schoolchildren from Nakhon Pathom
 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion
province, Thailand; Trop Biomed 2006;23:117-22.
119. Akao N, Ohyama T, Ohkawa T, Kondo K, Hirokawa Y,
Ito S, et al. [A survey of intestinal parasites of the
foreign laborers (Indonesians and Filipinos) in Ishikawa
Prefecture]. Kansenshogaku Zasshi. 1992;66:1256-61.
120. Akhlaghi L, Shamseddin J, Meamar A, Razmjou E,
Oormazdi H. Frequency of Intestinal Parasites in Tehran.
Iranian Journal of Parasitology. 2009;4:44-7.
121. Arslan MO, Sari B, Kulu B, Mor N. [The prevalence
of intestinal parasites in children brought to the Kars
Maternal and Children's Hospital with complaints of
gastrointestinal symptoms]. Turkiye Parazitol Derg
2008;32:253-6.
122. Azami M, Sharifi M, Hejazi SH, Tazhibi M. Intestinal
parasitic infections in renal transplant recipients. Braz J
Infect Dis 2010;14:15-8.
123. Carney WP, Van Peenen PF, See R, Hagelstein E, Lima B.
Parasites of man in remote areas of Central and South
Sulawesi, Indonesia; Southeast Asian J Trop Med Public
Health 1977;8:380-9.
124. Carney WP, Banzon T, De Veyra V, Daña E, Cross
JH. Intestinal parasites of man in Northern Bohol,
Philippines, with emphasis on schistosomiasis. Southeast
Asian J Trop Med Public Health 1980;11:473-9.
125. Carney WP, de Veyra VU, Cala EM, Cross JH. Intestinal
parasites of man in Bukidnon, Philippines, with emphasis
on schistosomiasis. Southeast Asian J Trop Med Public
Health 1981;12:24-9.
126. Carney WP, Banzon T, de Veyra V, Papasin MC, Cross JH.
Intestinal parasites of man in Oriental Mindoro, Philippines,
with emphasis on schistosomiasis. Southeast Asian J Trop
Med Public Health 1981;12:12-8.
127. Chiu JK, Chiu PC, Tseng PT. Prevalence of intestinal
parasitic infections among inhabitants of Tan-nan village,
Nantou County, Taiwan. Zhonghua Min Guo Wei Sheng
Wu Xue Za Zhi 1979;12:155-9.
128. Choi SC, Lee SY, Song HO, Ryu JS, Ahn MH. Parasitic
infections based on 320 clinical samples submitted to
Hanyang University, Korea (2004-2011). Korean J Parasitol
2014;52:215-20.
129. Kim CH, Na YE, Kim NM, Shin DW, Chang DY. [Intestinal
parasite and Clonorchis sinensis infection among the
inhabitants in the upper stream of Taechong Dam,
Kumgang (River)]. Korean J Parasitol 1994;32:207-14.
130. Cross JH, Clarke MD, Cole WC, Lien JC, Partono F,
Djakaria, et al. Parasitic infections in humans in West
Kalimantan (Borneo), Indonesia; Trop Geogr Med
1976;28:121-30.
131. Cross JH, Clarke MD, Cole WC, Lien JC, Partono F,
Joesoef A, et al. Parasitology survey in northern Sumatra,
Indonesia. J Trop Med Hyg 1976;79:123-31.
132. Cross JH, Banzon T, Wheeling CH, Cometa H, Lien JC,
Clarke R, et al. Biomedical survey in North Samar
Province, Philippine Islands. Southeast Asian J Trop Med
Public Health 1977;8:464-75.
133. Cross JH, Irving GS, Anderson KE, Gunawan S, Saroso JS.
Biomedical survey in Irian Jaya (West Irian), Indonesia.
Southeast Asian J Trop Med Public Health 1977;8:532-6.
134. Doğan N, Oz Y, Koçman NU, Nursal AF. [Comparison
of individual differences in the direct microscopic
examination in the diagnosis of intestinal parasites].
Turkiye Parazitol Derg 2012;36:211-4.
135. Goo GS, Min DY, Ahn MH, Kim KM, Leem MH, Yoon HS.
Status of intestinal parasitic infections in a remote island,
Jan 2016 | Volume 6 | Issue 1 | 28 Tropical Parasitology
Yondo, Jeonranam-do: Province. Kisaengchunghak
Chapchi 1988;26:275-84.
136. Hong SJ, Hong ST, Chai JY, Lee SH, Seo BS, Cho SH, et al.
[A Survey On The Prevalence Of Intestinal Protozoan
Cysts In Jeonlanam Do, Korea]. Kisaengchunghak
Chapchi 1982;20:43-8.
137. Hong ST. [A survey on intestinal parasites of soldiers in
Korea]. Kisaengchunghak Chapchi 1986;24:213-5.
138. Iqbal J, Hira PR, Al-Ali F, Philip R. Cryptosporidiosis
in Kuwaiti children: Seasonality and endemicity. Clin
Microbiol Infect 2001;7:261-6.
139. Kim JH, Yoon JJ, Lee SH, Seo BS. Parasitologial Studies
Of Korean Forces In South Vietnam: II. A Comparative
Study On The Incidences Of Intestinal Parasites.
Kisaengchunghak Chapchi 1970;8:30-5.
140. Kim CH, Park CH, Kim HJ, Chun HB, Min HK, Koh TY,
et al. [Prevalence Of Intestinal Parasites In Korea].
Kisaengchunghak Chapchi 1971;9:25-38.
141. Kim SC, Kim JJ, Lee KT. [Epidemiological Studies On
Protozoan Infection In Gyeong-Gi Do And Jeonra Bug
Do]. Kisaengchunghak Chapchi. 1984;22:116-26.
142. Kim H, Lee J, Choi Y, Kim J, Son H, Rhee P, et al.
Examination for helminth eggs and protozoan cysts in
fecal samples from healthy Korean adults, 2000~2006.
The Korean Journal of Medicine 2009. p. 741-9.
143. Kim Y, Huh H, Hwang Y, Lee N. A survey of intestinal
parasite infection during a 10-year period (2003-2012).
Ann Clin Microbiol; 2013. p. 134-9.
144. Lee R, Cross JH, Irving GS, Lane C, Watten RH. Surveillance
of some infectious diseases among aircrew personnel in
Southeast Asia. Aviat Space Environ Med 1975;46:1152-4.
145. Lee SK, Shin BM, Chung NS, Chai JY, Lee SH. [Second
report on intestinal parasites among the patients of Seoul
Paik Hospital (1984-1992)]. Korean J Parasitol 1994;32:27-33.
146. Lee J, Park GM, Lee DH, Park SJ, Yong TS. Intestinal
parasite infections at an institution for the handicapped
in Korea. Korean J Parasitol 2000;38:179-81.
147. Mangali A, Sasabone P, Syafruddin, Abadi K, Hasegawa H,
Toma T, et al. Intestinal parasitic infections in Campalagian
district, south Sulawesi, Indonesia. Southeast Asian J Trop
Med Public Health 1993;24:313-20.
148. Nasiri V, Esmailnia K, Karim G, Nasir M, Akhavan O.
Intestinal parasitic infections among inhabitants of
Karaj City, Tehran province, Iran in 2006-2008. Korean J
Parasitol 2009;47:265-8.
149. Niyyati M, Rezaeian M, Zahabion F, Hajarzadeh R, Kia E.
A Survey On Intestinal Parasitic Infections In Patients
Referred To A Hospital In Tehran. Pakistan Journal of
Medical Sciences 2009;25:87-90.
150. Purnomo, Partono F, Soewarta A. Human intestinal
parasites in Karakuak, West Flores, Indonesia and the
effect of treatment with mebendazole and pyrantel
pamoate. Southeast Asian J Trop Med Public Health.
1980;11:324-31.
151. Sahin I, Kiliç H, Ozcan M, Orhan R. [A copro-
parasitological study on the wrestlers of the national
team]. Mikrobiyol Bul 1984;18:114-8.
152. Sharif M, Daryani A, Asgarian F, Nasrolahei M. Intestinal
parasitic infections among intellectual disability children
in rehabilitation centers of northern Iran. Res Dev Disabil
2010;31:924-8.
153. Shokri A, Sarasiabi KS, Teshnizi SH, Mahmoodi H.
Prevalence of Strongyloides stercoralis and other
intestinal parasitic infections among mentally retarded
 Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

residents in central institution of southern Iran. Asian
Pac J Trop Biomed 2012;2:88-91.
154. Stafford EE, Joesoef A. Intestinal and blood parasites of
man in Bireuen and Takengon, Aceh Province, Sumatra,
Indonesia. Southeast Asian J Trop Med Public Health.
1976;7:518-22.
155. Stafford EE, Masri S, Sorensen K. Parasitological survey
in Gorontalo North Sulawesi, Indonesia. Southeast Asian
J Trop Med Public Health 1976;7:405-10.
156. Stafford EE, Sudomo M, Masri S, Brown RJ. Human
parasitoses in Bali, Indonesia. Southeast Asian J Trop
Med Public Health 1980;11:319-23.
157. Subbannayya K, Babu MH, Kumar A, Rao TS, Shivananda
PG. Entamoeba histolytica and other parasitic infections
in south Kanara district, Karnataka; J Commun Dis.
1989;21:207-13.
158. Supanaranond W, Migasena S, Pitisuttitham P,
Suntharasamai P. Health status of Thai volunteers in a
cholera vaccine trial. J Med Assoc Thai 1990;73:548-51.
159. Tanyuksel M, Yilmaz H, Ulukanligil M, Araz E, Cicek M,
Koru O, et al. Comparison of two methods (microscopy
and enzyme-linked immunosorbent assay) for the
diagnosis of amebiasis. Exp Parasitol 2005;110:322-6.
160. Yaman O, Yazar S, Ozcan H, Cetinkaya U, Gözkenç N,
Ateş  S, et al. [Distribution of intestinal parasites in
patients presenting at the parasitology laboratory of the
medical school of Erciyes University between the years
of 2005 and 2008]. Turkiye Parazitol Derg 2008;32:266-70.
161. Yazar S, Yaman O, Gözkenç N, Sahın I. [Distribution of
intestinal parasites among patients who presented at
the Department of Parasitology of the Erciyes University
Medical School.]. Turkiye Parazitol Derg 2005;29:261-3.
162. Yosefi F, Randar M, Alavi S, Samany A. A study on
Prevalence of Gastrointestinal Parasitic Infections in HIV
(+) Patients Referred to Ahvaz Razi Hospital in 2008-
2009. Jundishapur Journal of Microbiology 2012;5:424-6.
163. Graczyk TK, Shiff CK, Tamang L, Munsaka F, Beitin AM,
Moss WJ. The association of Blastocystis hominis and
Endolimax nana with diarrheal stools in Zambian school-
age children. Parasitol Res 2005;98:38-43.
164. Ikeh EI, Obadofin MO, Brindeiro B, Baugherb C, Frost F,
Vanderjagt D, et al. Intestinal parasitism in Magama
Gumau rural village and Jos township in north central
Nigeria. Niger Postgrad Med J 2007;14:290-5.
165. Ouattara M, Silué KD, N'Guéssan AN, Yapi A, Barbara M,
Raso G, et al. [Prevalence and polyparasitism of intestinal
protozoa and spatial distribution of Entamoeba histolytica,
E. dispar and Giardia intestinalis from pupils in the rural
zone of Man in Côte d'Ivoire]. Sante 2008;18:215-22.
166. Raso G, Utzinger J, Silué KD, Ouattara M, Yapi A, Toty A,
et al. Disparities in parasitic infections, perceived ill
health and access to health care among poorer and less
poor schoolchildren of rural Côte d'Ivoire. Trop Med Int
Health 2005;10:42-57.
167. Chunge RN, Karumba PN, Nagelkerke N, Kaleli N,
Wamwea M, Mutiso N, et al. Intestinal parasites in a
rural community in Kenya: cross-sectional surveys with
emphasis on prevalence, incidence, duration of infection,
and polyparasitism. East Afr Med J 1991;68:112-23.
168. El Shazly AM, Awad SE, Sultan DM, Sadek GS, Khalil HH,
Morsy TA. Intestinal parasites in Dakahlia governorate,
with different techniques in diagnosing protozoa. J Egypt
Soc Parasitol 2006;36:1023-34.
169. Goldsmid JM, Rogers S, Mahomed K. Observations on
the intestinal protozoa infecting man in Rhodesia. S Afr
Med J 1976;50:1547-50.
170. Hunter G, Bagshawe AF, Baboo KS, Luke R, Prociv P.
Intestinal parasites in Zambian patients with AIDS. Trans
R Soc Trop Med Hyg 1992;86:543-5.
171. Kasssem HH, Zaed HA, Sadaga GA. Intestinal parasitic
infection among children and neonatus admitted to
Ibn-Sina Hospital, Sirt, Libya; J Egypt Soc Parasitol
2007;37:371-80.
172. Ogunba EO. The prevalence of human intestinal protozoa
in Ibadan, Nigeria. J Trop Med Hyg. 1977;80:187-91.
173. Okafor CN, Azubike CN. Studies in intestinal parasitic
disease agents in stools of people in a rural area of Nigeria.
West Afr J Med 1992;11:106-11.
174. Pampiglione S, Visconti S, Stefanini A. [Human intestinal
parasites in Subsaharan Africa. III. Pemba Island
(Zanzibar-Tanzania)]. Parassitologia 1987;29:27-35.
175. Pampiglione S, Visconti S, Pezzino G. [Human intestinal
parasites in Subsaharan Africa. II. Sao Tomé and
Principe]. Parassitologia 1987;29:15-25.
176. Prinz A, Hinrainer-Wilfing C, Renoldner K. [Parasitological
results of a medico-anthropological research-work at the
Azande in northeast-Zaire (author's transl)]. Wien Med
Wochenschr 1979;129:674-8.
177. Ashford RW, Atkinson EA. Epidemiology of Blastocystis
hominis infection in Papua New Guinea: Age-prevalence
and associations with other parasites. Ann Trop Med
Parasitol 1992;86:129-36.
178. Sawangjaroen N, Luke R, Prociv P. Diagnosis by faecal
culture of Dientamoeba fragilis infections in Australian
patients with diarrhoea. Trans R Soc Trop Med Hyg
1993;87:163-5.
179. Stark D, Fotedar R, van Hal S, Beebe N, Marriott D,
Ellis JT, et al. Prevalence of enteric protozoa in human
immunodeficiency virus (HIV)-positive and HIV-negative
men who have sex with men from Sydney, Australia. Am
J Trop Med Hyg 2007;76:549-52.

“Quick Response Code” link for full text articles

The journal issue has a unique new feature for reaching to the journal’s website without typing a single letter. Each article on its first page has
a “Quick Response Code”. Using any mobile or other hand-held device with camera and GPRS/other internet source, one can reach to the full
text of that particular article on the journal’s website. Start a QR-code reading software (see list of free applications from http://tinyurl.com/
yzlh2tc) and point the camera to the QR-code printed in the journal. It will automatically take you to the HTML full text of that article. One can
also use a desktop or laptop with web camera for similar functionality. See http://tinyurl.com/2bw7fn3 or http://tinyurl.com/3ysr3me for the free
applications.

Tropical Parasitology 29 Jan 2016 | Volume 6 | Issue 1 |

View publication stats