nlinc - Vol W. No 1. 2005 14-41 Reproductive BioMedicine Online; www.rhmonline..comJArticle!

1507 on web 23 November 2004

Symposium: Genetic aspects of male (in)fertility

Molecular pathology of the CFTR locus in male
infertility
Professor Mireille Claustres was born in Avignon (Southern France). After a Master's degree
in Psychology in Montpeilier. France in 1969, she moved to Medicine University of Montpetiier
and received her MD degree in 1977, follovwed by degrees in medical biology and
biochemistry at the University of Sciences of Montpellier. She was Assistant and Associate
Professor in Medical Biochemistry, received her PhD degree in 1985, and was named
Professor of Medicine in 1993. Since 1988, she has created and developed a Molecular
Genetics Department devoted to orphan genetic diseases. Now. as head of the Medical
Molecular Genetics Department, she is responsible for genetic testing (including prenatal and
preimplantation genetic diagnosis) and academic teaching in genetics, and leads a research
group in genetics including cystic fibrosis, dystonia and Duchenne muscular dystrophy.

Professor Mireille Ctaustres

Mireille Claustres
Laboratoire de Genetique Moleculaire et Chromosomique, CHU de Montpellier, Institut Universitaire de Recherche
Clinique (lURC), 641 Avenue du Doyen Gaston Giraud, 34093, Montpellier Cedex 5. France
Correspondence: Tel: -H33 4 67415360: Fax: -i-33 4 67415365; e-mail: Mireille.Claustres@igh.cnrs.fr

Abstract
Congenital bilateral absence of the vas cleferens (CBAVD) is a form of inleriiiiiy with an aulosotnal recessive t;enetic
background in otherwise healthy males. CBAVD is caused by cystie fibrosis tnuismembrane conductance regulator [CFTR)
gene mutations on both alleles in approximately 80% of ca.ses. Striking CFTR genotypic differences are observed in cystic
fibrosis (CF) and in CBAVD. ITie 5T allele is a CBAVD mutation with incomplete penetranco. Recent evidence confirmed that
a second polymorphic locus exists and is a major CFTR tnodifier. The development of niinigene models have led to results
suggesting that CFTR exon 9 is skipped in humans liecause of unusual suboplimal 5' splice sites. An extremely rare T.3 allele
has been reported and It has recently been confirmed that the T3 allele dramatically increases exon 9 skipping and should be
considered as a "CF" mutation. Routine testing for the most prevalenl mutations in the CF Caucasian population will miss most
CFTR gene alterations, which can be detected only ihrough exhaustive scanning ol' CFTR sequences. Finally, a higher than
expected frequency of CFTR mutations and/or polymorphisms is now found in a growing number of monosymptomatic
disorders, which creates a dilemma for setting nosologic boundaries between CF and diseases related to CFTR.

Keywords: alternative splicing, congenital bilateral absence of vas deferens. cystic ftbrosis tran.smembrtine conductance
regulator, polyvariant mutant genes, variable penetrance

Introduction similiu-ity between the anatomical characteristics atid semen

Congenital bilateral absence of the vas deferens (CBAVD)
(MIM^277180) accounts for approximately 2 ^ of cases of
male infertility (Dubin and Atnelar. 1971) and is present in
239f of patients with excretory azoospermia. Although the
clinical diagnosis of CBAVD is relatively easy based on
physical exatnination of the scrotum (Figure 1). it can take
years until ihe vasal malformation is recognized, with an
average lime until correct diagnosis of about 4.3 years (Weiske
et at.. 2tKX)). Aetiology of CBAVD has for a long time been
unknown. Several families in which CBAVD was trmismitted
:LS an autosotiial recessive irait have been reported in the
literature (reviewed in OMIM. 2004). leading lo the hypothesis
thai a genetic factor might be responsible for CBAVD.
liifetiility in males wilh cystic fibrosis (CF) (MIM*21970())
was Urst suspected in the 1960s (Le Lannou et al.. iy.'>7) when
it was realized that CF men were childless after several years
or marriage, and Iheir infertility was attributed lo ihe absence
of vas deferens (Kaplan et al.. 1%K). Because of the striking
parameters for CF and CBAVD. these iwo so far unrelaled
disorders were postulated to have a comtiion genetic origin as
early as 1968 (Kaplan et at.. 196«: Holsdaw et al., 1971). The
link between CBAVD and CF was proven after the
identification of the gene responsible for CF. when a Fretich
group tested the presence of the most common CF mutation
(F508del) in 17 men with isolated CBAVD: 42V( wcre tbund
to be heterozygous for the F308 deletion, a frequency much
higher than the expected frequency of CF carriers in the
general population (one in 25-30.4-5%) (Dumur c/ii/., 1990).
Tliis finding led Ui the speculation thai these patients might
have a different, as yet unidentified, cystic fibrosis
transtiiembrane conductance regulator (CFTR) gene tnuiiUion
on the other allele; in this case CBAVD would be a s[Kcific
mild form of CF, Anguiano et al. (1992) identified the first
three compound hetero/.ygotes. leading to the conclusion that
CBAVD mighl be an incomplete (genital) form of CF. which
was conftrmed by several reports (Patrizio et at.. 1993; Culard
et al., 1994; Oates and Amos. 1994J. However, the initial work
 Symposium - Molecular pathology of the CFTR locus - M Claustres

pH Volume (ml) Fru close

{|iml/ejaculate)

9-1 10-1 150-1

5- so-
7-

-so-

1. Seminal pH. volume, and fruclose content in falhers nol tested for CFTR mutations (A), in men with a/oospcrniia
without CHTR mutation (B).aiid in men with azoospermia and CFTR mutaiion (C) (from Von Eckardstein elal.. 2000). Diagnosis
of CBAVD is based on impalpable vas deferens on serotal examination and/or a missing segment of the vas on transreetal
ultrasonography (Oates and Amos. 1994). The leading signsofCB.AVD are total absence of spermatozoa associated with an acidic
ejaculate composed only of prostatic secretions, with low pH (average <6.8). low volume (<t.5 ml) and low concentrations of
fructose of the ejiiculate. as consequence* of dysplasia or absence of the seminal vesicles {which contribute up to 70% of the normal
ejaculate volume). Seminal plasma markers provide an effeeiive method to predict CFTR mutations in men with obstructive
azoospermia: pH <7.4 and fructose levels <2 pmoi/ejaculate had lhe highest sensitivity and specificity for the prediction of the
presence of CFTR mutation in CBAVD (de la Taille ef al.. 1998; Von Eckardstein el at.. 2(XX)). On surgical exploration the
intrascrotal parts of the vasa deterentia are not detectable or are reduced to fibrotic cords. CBAVD is regularly accompanied by
aplasia ofthe epididymal tail and body and various anatomical or functional abnormalities of lhe seminal vesicles including
hypoplasia and aplasia (Goldstein and Schlossberg. I99K). Usually CBAVD patients have a normal or nearly normal lesticuUir
volume, with a tendency towards a lower volume (Ramos et at., 2004). Testicular biopsy demonstrates normal or
hypospermatogenie activity. The simplified and iess invasive PESA (percutaneous epididymal sperm aspiration) procedure has
been recently proven to be an efficient diagnostic tool to confirm an obsiruciive a/oospermia (Ramos ei al.. 2004). Renal
ultrasonography is recominended to all patients to assess renal morphology and organ presence, in about IO-2O'?f ofthe patients,
a renal anomaly is also present. In addition to CFTR genetic testing, sweat testing and clinical evaluation for CF-related signs
should be included in the evaluation of CBAVD.

also revealed that most CBAVD patients of whom the entire
coding sequence had been analysed did nol seem to carry
mutations on both copies of the gene, which was tinexpected
for an autosomal recessive inheritance. A crucial step in the
assessment of a common genetic etiology for CF and
CBAVD was the report from Chillon et at. (1993) that the
.so-called 'normal" a I lele o f many hetcrozygotes was
carrying the same variation in a non-coding DNA sequence.
called the '5T allele'. This variant had been previously
demonstrated to be an intronic splicing variant thai reduces
the amount of functional CFTR protein at the cell membrane
(Chu (•/ at.. 1991. 1992). The frequency of the 5T allele in
CBAVD patients was up to six times (30%) higher than in
the general population (5%). and 34% of men with CBAVD
had inherited a CFTR mutation on one gene and a 5T allele
on the other one. a combination that would not result in CF
but does result in enough of a reduction in CFTR protein to
produce isolated CBAVD (Chillon e/a/.. 1995). For the pa.st
12 years, increasing amounts of data have documented the
link between most cases of CBAVD and alteralions within
the CFTR gene (reviewed in de Braekeeler and Ferec. 1966:
Lissens ft at.. 1996; Patrizio and Zieienski, 1996; Lissens
and Liebaers. 1997; Meschede et«/.. 1998; Phillipson, 1998:
Patrizio and Leonard. 2000; Quinzii and Castellani. 2000:
Stuhrmann and Dork, 2000; Weiske et al.. 2000). The
present report is focused on (he current knowledge of the
molecular basis of CBAVD.
Cystic fibrosis and mutations of the
CFTR gene
CF is the most common lethal, autosomal recessive genetic
disorder among Caucasians, with an estimated incidence
ranging from I in 1700 live births in Nonhem Ireland to I in
lO.O(H) in Mediterranean populations of Europe. The disease
was described in the 1950s when children were dying of
pancreatic insufficiency, failure lo thrive and respiratory
infections, and il was called 'cystic fihrosis of the pancreas'.
The median age of diagnosis is 7 months, with 66% of the
affected individuals diagnosed by I year of age. Without
treatment, CF is typically a fatal disorder in infancy and
childhood, secondary to fat malabsorption due to pancreatic
enzymes deficiency, failure to thrive and progressive
respiratory infections. The concentration of salt in the sweat of
CF patients i.s greatly elevated (>60 mmol/l. 3-5 times
normal), which is used as a diagnostic test for the disease.
Today, improved management of symptoms often preserves
life into adulthood, and the median length of survival has
increased from roughly I year in 1950 lo more than 30 years.
However, as there is still no curative treatment of CF. patients
continue to have a considerable burden of illness and die
prematurely. largely because of chronic pulmonary damage
generated by excessive inllammation and chronic infection. A
better understanding of CFTR mutations will lead to novel
therapeutic strategies. More than 96% of men with CF have
Symposium - Molecular pathology of the CFTR locus - M Claustres
anomalies in the WollTian structures causing obstructive
azoospermia and infertility (Kaplan e\ «/.. I9()8).
Spermatogenesis persists, but the body and tail of the
epididymis, vas deferens and seminal vesicles are atrophic
or absent.
More than 1200 mutations can affect
CFTR function
Cystic fibrosis is caused by mutations in the CFTR gene on
the long arm of chromosome 7. which encodes a
glycosylated transmembrane protein that functions as a
chloride channel, regulating salt and water transport in
plasma membranes oC epithelial cells {Figure 2). CFTR is
also involved in bicarbonate transport (Choi ei al.. 2001)
and the regulation oT other channels (reviewed by
Schwiebert ei al., 1999). Absent or critically low levels of
CFTR lead to viscous secretions that obstruct the lumen of
the pancreatic ducts, biliary tract, airways, sinuses.
gastrointestinal tract and reproductive tissues. The most
common CF mutatit)n worldwide is a deletion of three bases
in exon 10 encoding a phenylalanine residue at position 50S
within the first NBD. named F508de! (or AF5()8), which
impairs the ability of CFTR to fold in the endoplasmic
reticuluiii. thereby enhancing the degradation ofthe protein.
The FSOSdel mutation accounts for approximately 67'7( of
the CFTR genes in CF patients from European descent and
is present in about 89% of all patients with classic CF. The
Irequency of F508del varies considerably between
populations and shows a decreasing northwest-to-southeast
gradient in Europe, being as high as 87% in Danish patients
and as low as 40-60% in Mediterranean countries. It is
postulated that the mutation diffused with the movement of
Neolithic farmers from the Middle East, Based on
assumptions of mutation rate of short tandem repeats and of
the demographic history of the European population, the
age of the F508de! mutation has been estimated to be
300-2500 generations old (10.000-50.000 years) (Kaplan
el al.. 1994; Morral et aL, 1994; Wiuf. 2001), Its high
frequency in Caucasians is explained by a selective
advantage ol' carriers who might have better resistance to
pathogens (as an example, it is postulated that F508del
heterozygotes had an advantage in surviving cholera;
Gabriel ct al.. 1994). although it is still a matter of
controversy. Since the discovery of the CFTR gene in 1989.
reports from many laboratories documented a growing
number of less common mutations (mostly missense or
nonsense mutations). Today more than 1300 alterations in
the CFTR gene are compiled in an electronic database
maintained by Toronto Sick Children's Hospital (Cystic
Pibrosis Mutation Database. 2004). The vast majority of
CFTR mutations are point mutations, changing a few bases
or only one base in the genomic CFTR sequence. The
majority of the mutation.s are rare (less than a dozen have a
frequency above 1%). or have been found in only a few
number of cases acro.ss the world, or are unique to a
particular individual or family. There are relatively few
genomic rearrangements such as large deletions or
insertions within the CF7R gene, however they may be
underestimated as they cannot be detected by standard
polymerase chain reaction (PCR)-based techniques used for
diagnosis (Audrezet a al.. 2004).
Two categories of CF mutations (severe
and mild) contribute to clinical variation
inCF
CFTR mutations express their effects trough a variety of
molecular mechanisms that include either the failure
of production of CFTR protein or the elaboration of a
mutant protein with little or no functional CFTR activity
on the apical membrane (Figure i). The extent to which
various CFTR alleles contribute to ciinicai variation in CF
has been extensively evaluated by genotype-phenotype
studies (reviewed in Estivill. 1996; Kerem and Kerem,
I996a,b: Tsui and Durie. 1997: Zielenski. 2000). The only
symptom that correlates well with the mutational
genotype is the pancreatic funetion. which was found to
be concordant among affected siblings, In CF patients
from the same family, the pancreatic function, whether
sufficient or insufficient, is almost the same, indicating
that the pancreatic status is detertnined primarily by the
genotype at the CFTR locus. Other symptoms, such as
lung disease .may vary considerably among these sibships
and are poorly conelated to CFTR genotype (Zielenski..
2000). In approximately 85% of CF patients, the exocrine
pancreas is profoundly affected (PI. pancreatic
insufficiency). Without sufficient fluid and bicarbonate
due to complete loss of CFTR function, digestive
proenzymes are retained in pancreatic ducts and
prematurely activated, ultimately leading to tissue
destruction and fibrosis. in addition to malabsorption
(Durie. 1998; Choi et al.. 2001; Reddy and Quinton,
2003). In the remaining 15% of CF patients, the exocrine
pancreas is abnormal but functionally adequate and
patients do not need pancreatic en/yme supplementation
(PS. pancreatic sufficiency). Analysis of CF mutations in
patients with CF-Pl or CF-PS revealed two categories of
alleles. severe and mild (Kristidis et at., 1992) (Figure 3).
A severe mutation on a CFTR gene inherited from one
parent confers a PI phenotype only if combined with
another severe mutation on the gene inherited from the
other parent, whereas a mild mutation confers a PS
phenotype in n 'dominant' fashion even if the other
mutation is severe. Mutations that belong to classes I, 2.
and 3 result in the complete functional ioss of CFTR
protein from the epithelial cell surface and Tall in the
category of "severe" alleles. Mutations included in
classes 4 and 5 are referred to as "mild" and provide
enough residual CFTR function to compensate for lack of
function corresponding to a severe allele. so that
compound heterozygotes of a severe and a mild mutation
are. usually, pancreatic sufficient.
Distinct spectrum of CFTR gene
mutations and genotypes In CF
and in CBAVD
From the compilation of six large studies, totalling
1150 CBAVD patients who have been extensively
investigated for CFFR mutations, the three most common
CFTR mutations in Caucasian men with CBAVD are
F5O8del (21.5%' of aileles. versus 67% in the CF
population), the 5T variant \]Wi of alleles. which is an
average 4'fold higher than in the general population (5%)J, and
 Symposium - Molecular pathology of the CFTR locus - M

CFTReenp(I9flkl>)
{ ( ( [ f f f f f ( { ( { {

4 5 611 6b 7 K I4h 15 \b 17u I7h IK If 20 21 22 23 2.1

CrrRiiiRNA(6.5kb)
27 cxoiu

CFTR protein
(1.480 aminu acids)

H2N

COOH

Figure 2. The CFTR gene and protein: the gene responsible for cystic fibrosis was discovered in 1989 by positional cloning (Kerem
etui.. 19S9; Riordan tv<j/., 19S9: Rommensfra/., 1989) and the cDN A sequence was determined in 1991 along with the locations of
intron/exon boundaries (Zielenski et al., 1991). The gene spans -190 kb of genomic DNA on region q31.2 of chromosome 7
(Ellsworth, 2(XK)) and consists of 27 short exonic sequences that code for proteins (exons) interspersed with very long non-coding
intronic sequences. The exons iire numbered 1-24 with subdivisions A and B lor exons 6. 14 and 17. because these cxons were
recognized as separate units after the initial publicafion of the gene (Zielenski ei al.. 1991). The Cl-TR promoter harbours the
characteristic of a "housekeeping'-type gene, and the gene i.s transcribed in freshly isolated nonnal bronchial epithelial cells ai a
relatively low rate (Yoshimura ei al.., 1991), producing about two CFTR mRNA tnuiscripts per cell (Trapnell. 1993), Following
triinseription. pre-mRNA involves the joining logcther of all exons (and discarding the introns) in a continuous sequence lo form a
mature transcript (CFTR mRNA) of 6.5 kb that will be translated into a 14X0 amino acid prolein of approximately 16S kDa which
forms a transmembrane ionic channel ciilled CFTR. cystic fibrosis tninsmembrane conduciance regulator (Rinrdan cl al.. 1989;
Rommens ei al.. 1989). The CFTR gene is also named 'ABCC7' because it enctxies a protein which is a member of the ATP-binding
cassette (ABC) superfamily of membrane transporters thai includes the muUidrug resistance-associated protein (MDR), CFTR is an
integral membrane protein that functions principally as a cAMP-regulaicd chloride channel Ihat controls the ion and water content in
glandular tissues. It consists of two membrane-spanning regions (TM),each comprising six subunits. two nucleotidc binding domains
(NBD) and a cytoplasmic regulatory domain (R). unique within the ABC family, which contains many [Xilential sites tor
phosphoryiation by protein kina.ses (reviewed by Akiibas, 2000). The TM define ihc CFTR chloride channel, while ihe NBD and the
R domain mediate channel gating. Surprisingly, wild-type CFTR is inefficient at its own bio.synthesis, CFTR is subjected to a complex
processing including glycosylation in the Golgi apparatus and ATP-dependent conform ation al maturation in the membranes of
endoplasmic reliculum assisted by chaperones. As a result, only 3O*7c of the immature u ild-iype CFTR molecules transit lo the late
secretory pathway and reach the pkisma membrane. 10% are trapped in the endoplasmic reliculum-assiK'iated degradation pathway:
they are ubiquilinated and retrolranslocated to the cytosol where they undergo proteasomal degradation (Gelman and Kopito. 2(X.)3).
CFTR is expressed in the apical plasma membnme of secretory and reabsorptive epithelia and allows the transepithelial movement of
water and solute by mediating chloride translocation across ihe plasmii membrane. H2N refers to the N-terminal end and COOH lo the
C-tenniniil end ofthe CFTR protein.
Symposium - Molecular patholo^ of the CFTR locus - M Claustres

2 (PI) 3 (PI) 6A{PI) 6B(PI)

Svntheais Maturation Regulation Stability Interaction

CJ- Cl- Cl-

4 (PS) 5 (PS)
Normal Conductance Quantity'
 Symposium - Molecular pathology of the CFTR locus - M Ctaii.stre.\

Figure 3. The molecular consequences of CFTR mutations (adapted from Welsh and SniTih, 1993; Zielenski ;intt Tsui. 1995;
Estiviil. 1996). Although insights into the mechiinism of dysfunction by functional testing of mutants expressed in cell lines has
been obtained Tor only a small proportion of the more than 1300 reported mutations in the CFTR gene, (hey have been classified
into six main different groups according to the mechanism by which they alter CFfR chloride channel funciion. Class I:
mutations interfere wilh CFTR production. These result in the introduction of a premature signal for termination of tr;inslation
(stop codon) in the niRNA. The truncated proteins are unstable and are recognized by chapenine proteins in the endophismic
reticulum and are rapidly degraded. The net effect is no CFTR protein at the apical membrane. Examples include nonsense
(G542X), frameshifl (3659delC) or severe splicing (1717-lG-^A) mutations. Class 2: mutations affect protein maturation. These
lead to the production of a protein that cannot be trafficked to its site of function on the apical membrane. Mutant proteins are
mostly retained in the endophismic reticulum. failing to mature into fully glycosylatcd fomis and immediately targeted for
proteolytic degradation in the proteasome.The end result is absence ol'CFTR protein at the apical membrane ofthe cell. The most
common mutation responsible for CF is a deletion of a single amino acid, F?08del. Another example is the missense mutation
NI3O3K. which substitutes an asparagine residue fora lysine at position 1303. Class 3: mutations affect channel regulation. The
mutated protein is properly trafficked and localized to the plasma membrane but cannot be activated or function as a chloride
channel. Al! mutations so far attributed to this group are located within the NBD, such as missense mutations G55ID in NBDI
or G1349D in NBD2. Class 4: mutations affect chloride conductance. The CFTR protein is correctly trafficked to the cell
membrane and is capable of being activated but generates reduced Cl~ current by altering the rate of ion How or the opening time
ofthe channel. Most of class 4 mutations are located within the membrane-spanning domains, such as missense mutations RI 17H.
R334W or R347P. They confer a milder phenotype. even in combination with a severe allele. Class 5: mutations reduce the levels
of a normally functioning CFTR. Various mutations or sequence variations may be associated with reduced amount of functional
CFTR at the apical membrane, due to partially aberrant splicing (3849+10kbC-*T. 2789H-5G-*A. or the 5T allele) or inefficienl
trafficking (A455E). Mutants in this group are predicted to result in milder or monosymptomatic phenotypes. Class 6: mutations
decrease stability of CFTR present or affect the regulation of other channels. Recently, two new classes of mutants have been
added. Class 6A mutants lack the last residues of CFTR (Q14I2X. SI455X.4279insA.4326delTC). which dramatically reduces
the apical stability of the protein (Haardt. 1999). Class 6B mutants are unable to interact properly with other ion channels, such
as missense mutation G55ID and the ORCC (outwardly rectifying chloride channel) (Fulmer ct al.. 1995). Although they have
been investigated in a few patients, most elass 6 mutants should be considered as severe. Grouping mutations into different classes
is useful for understanding the mechanisms of dysfunction. However a single mutation can cause more than one type of
abnormality, and hence fall into multiple classes (for example, missense P574H is both a class 2 and class 4 mutation, missense
G.'S.'ilD is both a class 3 and 6B mutation). With reference to ihe pancreatic status, mutations that produce no functional CFTR at
llic apieal membrane (1-3 and b) contribute to pancreatic insufficiency (PI) and are classified as 'severe', wheieas mutations with
residual function (4 and 5) tend to sustain pancreatic function (PS) and are classified as 'tTilId'. However, certain missense
mutations (such as G85E) may confer a variable panereatic phenotype.
Symposium - Molecular pathology of the CFTR locus - M Claustres
RM7H (6,4 versus 0.5%) (Table 1), An extensive colleclion of
mutations identified by 19 laboratories in France illustrates the
extreme heterogeneity of CFI'R alleies and the different
distribution of mutations and genotypes in CF and CBAVD
(Claustres ct al..2000) (Figure 4). Almost 987^ of a total of 3710
patients with classic CF had a( least one CF mutanl aliele
identified al Ihe time of the study, including 3312 patients (89'/()
with iwo mutations and 318 patients (9%) with only one
mutation, and 310 different CFTR mutations were recorded. In
the group of 8(X) men with CBAVD. a total of 137 different
mutations scattered over the whole gene were identillcd.
including al least II complex alleles (more th:m one sequence
change on a single gene). Seventy-three (53%) of these
mutations were also present in the CF cohort, while 64 others
(47%) wet^ detected in CBAVD only. In 3303 patients with CF
and 381 men with CBAVD in whom the two mutations had been
identified, we reckoned up to 481 and 131 different mutation
genotypes respectively. Distribution and frequencies of
genotypes were markedly different between CBAVD and CF
(Figure 4). Overall. X87f of patients wilh CF had inherited two
severe mutations :uid 12% had inherited a severe combined to a
mild or vtiriable mutation. None of the CBAVD patients was
homozygote for F508del or compound heterozygote for two
severe mutations; they had either a sevens and a mild (.HS9e) or
two mild (12''/f) mutations. The combination of ihe 5T allele in
one copy of the Cl-TR gene w ith a CF mutation in ihe other copy
was the most eommon cause of CBAVD.
CBAVD in non-Caucasian populations
Cystic fibrosis is presumed to be rare in Asian or Oriental
populations, with incidence estimated as 1 in l(X).0(Xt-30(l.(KX)
live births in Japan (Yamashiro ei at.. 1997) and less than one in
90.000 live births among Orientals. By eontra.st. CBAVD/CFTR
does not seem uncommon in these populations, as illustrated by
recent series of CFTR screening (Tdbic 1). Interestingly, only a
few numlier of AF508 carriers were identiHed. but an exceptional
number of males were found with the 5T allele. which
represented 43.7%' of CBAVD alleies in Egyptian (Lissens ct al..
1999). 44.4'7r in Taiwanese (Wu ei al.. 2004). 30<7f in Japanese
(Anzai et al.. 2(X)3). and 20^/f in Turkish (Dayangac et at.. 2(H)4)
series. The frequency of the 5T allele in these populations, as
calculated from the study of the spouses of CBAVD patients,
does not seem different from that of Caucasian populations. A
notable proportion of CBAVD males have homozygosity for the
5T allele, which has also been reported in a Tamil male from Sri
Lanka (Fokstuen ft al.. 2(KX)). These results show that the 5T
variant is involved in many cases of CBAVD even in populations
where CF is rare, as initially observed by Dork er al. (1997). By
contrast, the frequency and distribution of CFTR mutations are
very different from ihat tound in ELiro|iean populations, with
Q13.'^2H and D1I52H as the most common mutations
respectively in Japanese (13%) or Turkish (14,7%) CBAVD
alleles (Table 1),
The 5T variant as a CBAVD mutation
The CFTR exon 9 is skipped in humans
Analysis of CITR mRNA transcripis in epithelial cells from
normal individuals deiiKinstrated that all had a proportion
(ranging from 9 to 66<3f) of CFTR mRNA transcripts without
exon 9 (Chu et at., 1991). To explore the possible cause of
variable deletion of exon 9 in CFTR mRNA iranscripls. the
region encompassing exon 9 was sequenced. and it was found
thai the degree of CFTR exon 9 skipping was inversely
correlated with the length ofa polymorphie polythymidine tract
(Tn) upstream of the exon (Figure 5). Individuals carrying
common 7T or 9T alleles al this locus produced 9-25% of
U"anscTipts without exon 9. wherea,s individuals carrying a .*>T
aliele produced 62-66% of incomplete mRNAs. Extensive
quantification of CFTR transcripts in large series of individuals
with different combinations of Tn alleles confirmed ihat the
shoner the Tn trad the greater the relative amount of CITR
mRNA transcripts without exon 9 present in respiratory
epithelium, wilh rare individuals homozygous for the 5T allele
predicted to prwluce up to 90% of aberrant mRNAs (Chu et al..
1992). Il was concluded that, in the presence of a ?>T allele. Ihe
polypyrimidine tract is loo short and is under-utili/ed as a splice
acceptor site, resulting in reduced efficiency of exon 9 splicing.
The CFTR mRNA deleted tor exon 9 maintains an ofwn reading
frame iind would etieode a CFTR isofomi that is missing 6()
amino acids (fnim 404 through 4()4) of the llrst NBD, Given the
important role for NBD i, it was suiprising to observe thai normal
individuals can have up to 66% of bronchial CFTR mRNA
iranscripis that are missing exon 9. a region representing 21 % of
the sequence cixling for the critical NBDl, As expected, it was
demonstrated that the protein pnxluced by CFTR mRNA without
exon 9 is not properly processed and is not capable of generating
Cl" conductance in response to cAMP (Delaney et at.. 1993;
Strong ('/«/., 1993).Il was postulated that, since the length ofthe
polypyrimidine loeus Tn in intron 8 directly influences the
efficiency of exon 9 spHeing in CFTR and detennines the
percentage of functional CFTR transcripts produced, this could
cause an effect similar to a 'mild' CFFR inutation. with low
levels of expression of nonnal CFTR, These results also
suggested that only a very small fraction of functional full-length
CFTR is needed to maintain a clinically nonnal phenotype in
bronchial epithelial cells in regard lo CF. iis individuals
homozygous for ihe 5T allele initially desedbed had no clinical
signsof CF. This 'threshold' level varies as !0-2.^% according to
the strategy used for the quantification of CFTR trdnscripts (Chu
ei al.. 1992. 1W3: Mak et al.. 1997; Rave-Harel et al.. 1997).
The 5T allele as a genetic modifier of a CF
mutation
A possible role for the 5T variant in disease was first suspected
by the observation of variable phenoiypes when ii is associated
on a single ChTR gene (/;i vis) with a missense mutation
(R117H) whieh gives rise lo a partially funetional CFTR protein
(Sheppard et at.. 1993). A high frequency of RI I7H mutations
wa-s obsei^ved in CBAVD palienls(Gervais <'/(//,. 1993). Analysis
of Tn alieles co-segregating with RI 17H in groups of patients
with CF and CBAVD revealed a tendency ofthe R117H allele to
be asstxiated wilh the 5T variiint in CF patients, whereas il was
associated with the 7T variant in CBAVD patients (Kiesewetter
et at.. 1993). This suggested thai, when paired in trans with
another CF mutation (carried on the other gene), the RI I7H-5T
allele would cause a classic CF-PS phenotyjx.'. R117H-7T would
cause CBAVD. and R!17H-9r would nol cause any disea.se
(Kiesewetter c/fl/.. 1993). Indeed, the assoeiation Rll7H-9Twas
reported in a single ease so far. in a lO-month-oId
African-American male baby who sweated heavily, presented
wilh a low serum stxlium level, had a borderline sweat test value
and no CF clinical symptom al the time of the report (Friedman
 Symposium - Molecular pathology of the CFTR locus - M Ctoustres

Table 1. Senes review of F5O8del. RI17H and IVS8-Tn frequencies in patients with CBAVD.

Series AF50cV RH7H Others^ Proportion Reference

(%) i%) (%) n(%) of identified
a!tetes(9ci

Caucasian
German (106) 26 13 11.3 43(30) K0.3 Dork etal. (19^7)
Spanish (110) 18 23 4 35(38) 83 Casals ('/ij/. (2()(K))
French (800) 22 19 4.4 134 (34) 79.4 Claustres f? a/. (2000)
Canadian (134) 20 21 6 12(15) 62 Zieienski era/. (1995)
Mak ('/«/. (1999)
Nan-Caucasian
Egyptian (20) 2.5 43.7 0 na na Lissens t'/d/. (1999)
Turkish (51) 2.9 19,6 0 25^(50) 72.5 Dayangae i-r«/. (2004)
Taiwanese (27) 0 44.4 0 1^(50) na Wu et al. (2004)
Japanese (19) 0 29 0 3(18) 47 Anzai et at. (2003)
"Numtwr of oilier dilTerent muialiiins tJentilled anil perceniage ol' lotal alleles.
Mututkin DI 152H wus ihe mow prevalent. ai:ctnjming for \4.1''i of alleles.
*^Muiation Q1-152H was ihe most prevalent, accouming tor H'^i of iilleles.
na = not avuilahlc.

Cystic tibrosifi CBAVD

N=3J03

12%
mild/mild
^K (CF'PS)

^ V 88% 88%
sev/sev Figure 4. Spectrum of CFTR genotypes in CF or CBAVD
sev/mild patients with two mutations identified. In a subset of 3303
patients with CF and 381 patienls with CBAVD in whieh the
two CFTR mutations were identified in France, a total of 481
different mutation genotypes have been generated in CF and
131 in CBAVD (Ctaustres ct at.. 2000). In the group of CF
patients. SS'^/r carried two severe mutations |ineluding
homo/ygosity for F50Hdel (48%) and compound
heterOitygosity for F5O8del and another severe mutaiion
(39%)|, whereas 11.8% had a severe mutant in trans of a mild
or variable mutation and only 0.2''/{: inherited two mild
mutations (including three patients with the eomhination
F508del/5T). By contrast. CBAVD resulted cither from a
combination of a severe mutation (clas.ses 1-3) with a mild
mutation (classes 4 or 5) (88%) or from a combination of two
mild mutations (12%). A total of 22 mutation genotypes were
shared by the two groups of patients. The two most common
compound heterozygous genotype^i found in men with
CBAVD were F5O8del/5T (28%) and F50Sdel/R! 17H (6%).
scv scv ses'mild scv'fT niildmild mildST 5T/5T
Symposium - Molecular pathology of ihe CFTR locus - M Claustres

TGmTTTTTTTTAAACAC 9T(0.ll}
TGinTTTTTTTAA,\CAG 7T (O.M)
TGinr It I lAAACAG 51 t».O5)

Prrcenta^r ar
Normal CFTR
genotype

I
100
CFTR gene 9T/9T
IVS7 ^ ^ IVS8 ^ IVS9
9T/7T

7T/7T

7T/5T
Full-length CFTK mRNA mRNA wiihoul exon 9
• 5T/ST 10
Normal CFTR prolein No CFTRprolein

tnced amount al Uic cell membmne

Figure 5. The 5T allele: a splicing variant that promotes CFTR exon ••) skipping in humiins. A polymorphic site in CFTR inlnm
8 (lVS8-Tn) influences ihe splicing of exon 9 and the level of CFTR protein production. In the general population, ilirec alleles
are found Lit iheTn locus, 5T (5% of alleles). 7T(84%) and 9T(ll%).Tran.scripts derived from genes thai carry five thymidines
{5T) at this UKUS have high levels of exon 9 skipping, whereas those with seven or nine thymidines (7T and 9T respectively) have
successively lower levels of skipping. Thus, humans produce two types o( CFTR mRNA, with or without exon 9. the proportion
of incomplete transcripts being inversely correlated wilh the length of ihe Tn alleles. lndi\ iduals honiozygous for Ihe .'iT alleie
may have 15-90% of mRNA missing exon 9. whereas individuals homozygous for 7T or 9'!'have less than 23 or \5% respectively
of mRNA without exon 9. Other combinations of alleles produce intennediate levels (Chu etal.. 1993; Rave-Harel et at., 1997;
Teng et at.. 1997: Larriba et al.. 1998). Two rare alleles at the Tn locus have been recently reported. A 3T allele was described in
a Gennan male with CF-PS (Buratti et al.. 2(X)I) and in a French patient with CBAVD (Disset et al.. 2004). A6T allele has been
found in a healthy German female carrier (Dork et al.. 2fHH ) and in two patients with CBAVD. one in France (Viel et al.. 2(K)4)
and the other in Turkey (Dayangac ci al., 20()4). IVS8 = intervening sequence (.intron) 8.

et al.. 1997). Thus, the RI i7H mutation on the 7T background
with a severe mutation hi trans affects mostly ihe male
reproductive iraet and produces a sufficient level of partially
functional CFTR in the lung to prevent a classical fonn of disease
(although later onsel mild lung disease may be observed in some
cases), whereas on a 57 backgmund, the 5T variant enhances tlie
deleterious elTect of mutation RI 17H, prodticing a CF-PS tomi
because lower levels of panially functional CFTR are produced
both in the lung and the reproductive tract. The work of
Kiesewetter and colleagues suggested for the tirst time that the
specific |VS8-Tn background on which a CFTR mutation resides
could modulate disease severity in a tissue-specific manner.
Several other mutations have been detected on a 5T background
(Dork (•/ al.. 1997: Claustres et al.. 2t)()0), but they have not been
extensively studied for genotype/phenotype relationship or
functional expression. The F508del in Europeans seems to have
arisen only once on the 9T haplotype and is thus well spliced.
but produces a non-funetional protein
The 5T allele is a CBAVD mutation with
incomplete penetrance
Several independent studies totalling around ,300 CBAVD
patients showed that the frequency of the 5T allele in
individuals with CBAVD (19-24%) was 4-fold significantly
higher than that ofthe general population (4-5%) (Chillon et
al.. 1995; Costes et al.. 1995: Jarvi er al.. 1995: Zielenski et
at.. 1995: Dumur ei at.. 1996). Thus, the 5T allete in
combination with a CFTR mutation on the olher chromosome
appeared to be one of the major causes of CBAVD. The study
of Chillon er at. (1995) about the frequency of 5T allele in
parents of CF children revealed that 9.^3% ofthe mothers and
4.14% of the fathers were heterozygous for the 5T variant,
suggesting that a man could carry both a CF-chromosoinc and
a 5T-chromosome and be normally fertile. Furthermore, if this
variant eould cause CBAVD in all cases, then its frequency
(0.05) combined with that of CF mutations in Europeans (0.04)
wouid predict that approximately I in 222 |( 1/500 carriers of a
CF mutation and a 5T allele) -t- (1/400 .'^T homozygotes)|
Caucasian men could suffer from CBAVD (Zielenski et at.,
1995). which is 4.5-fold higher than the estimaied ineidenee of
CBAVD in the Caucasian population (I/IOOO) (Jequier et al.,
1985). Shin et al. (1997) retrospectively reviewed the fertility
status of 131 brothers of 105 men with CBAVD who attempted
conception and observed that only seven (5%) were found to
have CBAVD themselves. Although it is possible that they
underestimated the true incidence ot brothers with CBAVD by
not defining the fertility status of married brothers who had not
attempted to have children, their data suggested that this
prevalence is five times lower than the 25% expeeted for an
 Symposium - Molecular pathology of the CFTR locus - M Claustres

autosomal recessive inheritance pattern. A discrepancy
between the ratio of observed versus expected number of men
uiih a particular phenotype is termed 'inconiplcie peiieirance".
which reOccls here that inheriiance of two abiinrma! alicles at
the CFTR locus may not be sufficient to produce CBAVD in
every case. It was apparent that the 5T variant could not be a
fully penetrant disease causing allele. By comparing the
frequency of the 5T allele in fathers (2.07) and in mothers
(4.67) of CF palients. the degree of penetrance for (he 5T
variant in combination with a CF mutation with respecl lo
CBAVD was estimated as 0.56 (1-2.07/4.67) (Chillon et al..
1995). a figure .similar to 0.60 calculated from Canadian
families (Zielcnskiff^)/.. 1995).
Tissues are differentially sensitive to exon
9 mis-splicing
Major insighls into potential mechanisms underlying the
phenotypic divergence between CF and CBAVD were gained
from the analysis of CFTR transcripts in the nasal epithelium
and genital tissues in normal individuals with different Tn
genotypes (Mak et al.. 1997: Rave-Harel ct al.. 1997: Teng et
al.. 1997). In two independent studies, a significant higher
proportion of transcript.s without exon 9 were observed in
vasal cells compared with nasal cells from the same individual
(Mak et aL, 1997) t.)r from different individuals (Teng et al..
I997J (Figure 6). Therefore, nasal epithelial cells produced
more functional CFTR than the genital iraet. There is
variability in the efficiency of the splicing mechanism, not
only among different individuals but also between different
organs ofthe same individual. These observations were further
confimied by Rave-Harel et al. {1997). who demonstrated ihat.
in CBAVD mates, the level of normal transcripts (exon 9+)
was lower in the epididymal epithelium than in the nasal
epitheliutii. Furthermore, they also showed ihat Ihe level of
normal CFTR transcripts in nasal epithelial cells coirelated
with the severity of lung disease. The discovery ol dilTerenlial
splicing efficiency between tissues that express CFTR.
provided new insights into the relationship between levels of
normal CFTR and phenotype variation. First, the amount of
CFTR reL|uircti by each organ involved in CF or related
diseases to maintain a normal phenotype may be variable. In
some organs a small reduction in the level of normal
transcripts might lead lo dysfunction while others would not be

50 n
O Nasal epithelial
• Vas deferens
40-

iS 30-

Figure 6. Relationship between full-length CFTR mRNA and

20- phenotype. The efficiency of exon 9 splicing is lower in
WolfHan tissues (adapted from Mak et al.. 1997: Rave-Harel et
al.. 1997: Teng ct al.. 1997). (a) Relationship between CITR
10- IVS8-Tn genotype and proportion of transcripts without exon
9 in different tissues. Correct splicing of exon 9 is less efficient
in the vas deferens (Mak et al.. 1997: Teng *•/ aL. 1997) or in
79 77 95 75 55
epididymal cells (Rave-Harel et al.. 1997) than in nasal tissue,
(b) A typical CBAVD paiient has a severe mutaiion (F5()Kdel)
in one CFTR allele and the variant 5T in the other. Mutation
mBNA mRNA 41%
F508del (associated with a 9T allele in ci.s) will result in full-
E9+ E94. length transcripts but absent CFTR protein al ihe membrane.
From the 5T allele, this individual may produce a sufficient
38% proportion of full-length (exon 9-*-) CITR mRNA in ihe lung
32% (329^ of total CFTR transcripts), which is adequate to maintain
a normal pulmonary phenotype. but an insufficient level (26%)
in the reproductive tract to confer a norma! genital duct

•
phenotype. thus presenting an isolated CBAVD without CF
26% pulmonar;- manifeslaiions. In conirasi. a normal CF carrier
carr>'ing the FSOSdcl mutation in one cop> of the CFTR gene
but the 7T variant in the other allele will produce enough full-
length CFTR mRNA in the reproductive tract (38%) from the
7T allele lo sustain a normal phenotype. The threshold level for
nomial/abnormal phenotype depicted in the figure is arbitrary:
it may var\' between organs and between individuals and also
varies between the published studies, depending on the
Lung Wolffian Lung Wolffian
different methods used in the quantitative analysis of exon 9+
CBAVD CF carrier transcripts (Mak et aL. 1997).
F508dei/5T F508del/7T
Symposium - Molecular pathology of llie CFTR locus - M Claustres
affected. Second, the 5T allele may then become a disease-
causing niutaiion for the vas deferens due to Ehe overall
decrease in full-length CFTR mRNA in ihis ti.ssue. Third.
CB.-WD patienI^ have no puliiiotuiry disease probably because
the amounts of functional niRNA may exceed the necessary
"threshold" transcript levels for a non-CF phenotype in the lung
(Figure 6). Founh. the high frequency of mild CFTR
muiiUions in patients with CBAVD suggested that the vas
deferens was one of the tissues most susceptible to the effects
of changes in CFTR activity.
Another polymorphism, the TG tract,
explains the partial penetrance of the 5T
allele as a CBAVD disease mutation
Cuppen.s et ul. (1998) postulated that another polymorphic
locus based on TG repeats (with alleles ranging from *•) to 13
repeats) placed immediately upsiream of the Tn site, might
affect the efficiency of exon 9 inclusion In the CFTR mRNA.
in combjnalion or independently from the Tn locus. The TG
and T tracts are present in the pre-mRNA(as UG and U) within
ihe y splice site of exon y and hence could have a direct
involvement in exon recognition by the splicing machinery.
They quantified the CFTR transcripts from nasal epithelial
cells and found that, on a 7T background, the TG 11 allele gave
a 2.S-fold increase in the proportion of CFTR transcripts that
lacked exoii 4. and TGI2 gave a 6-fold increase, compared
wilh ihe TG 10 allele. Moreover. 5T CFTR genes derived from
CBAVD patients were found to carry a high number (12-13)
of TG repeats, while 5T CFTR genes derived from healthy CF
fathers harboured a low number (II) of TG repeats, lt was
suggested that a longerTG repeal would piace ihe branchpoint
A nucteotide of the lariat in a less favourable position for
splicing (Cuppens et al.. 1998) (Figure 7a). Thus, both the
alleles at the TGm and Tn loci determine the proportion of full-
length or mis-spliced CFTR transcripts and thereby affect net
chloride transpon activity of CFTR-expressing cells. Cuppens
ei at. (I99K) proposed to name such mutant CFTR genes that
harbour a p.irliculiU' combination of alleles and variants at
polymorphic sites 'potyvariant mulant CFTR f^enes'. This
concept was recently confirmed by the results of an
international collaborative study on the disease penetrance of
the 5T allele. By comparing the TG tract of men with CBAVD.
non-classic CF or fertile men (fathers of patienls with CF). all
carrying a severe mulalion in trans of a .*)T allele. it was found
that longer TG repeats (12 or 13) are more often associated
wilh diseases phenotypes than ."iT alieles adjacent to short TG
tracts (Groman ci ul.. 2(H)4t (Figure 7b). The combination
TG 11-5T was found in 7K% of unaffected individuals, versus
97c of affected individuals, suggesting that TGI1-5T is
generally benign. Conversely. 919if of affected individuals had
12 or 13 repeats, versus 22';^ of unaffected individuals. The
TGI3-5T combination was found exelusively in affected
individuals. When 5T is found in trans with a severe CF
mutation, the (Kids of pathogenicity are 28 and 34 times greater
for TG 12-5T and TG 13-5T. respectively, than for TG 11-5T.
Thus, the determination of TG repeat number is predictive of
pathogenic 5T alleles. The pathogenic role of these
polymorphic repeats is due to iheir effeets on CFTR exon 9 at
the level of pre-mRNA splicing: longer UG repeats increase
exon 9 skipping, which raises the proportion of non-functional
CFTR protein. This is in line with the growing number of
human diseases resulting from mutations or polymorphisms in
ciij-acting elements that disrupt use of altemative splice sites
fFaustino and Cooper, 2003).
Potyvariant mutants and coding SNP
(single nucleotide polymorphisms)
It has been postulated that common polymorphisms so far
considered as 'neulral" might have functional consequences on
the CFTR mRNA or the protein and play a role in the
penetrance ofthe -'iT allele. In contrast with the polymorphic
loci TGm and Tn. the M47OV locus is polymoiphic at the
amino acid level. The two alleles. M and V at position 470,
were transiently expressed in COS cells, and their kinetics of
maturation and degradation were studied by Cuppens et al.
(1998). They have described potential functional differences
for the two CFTR variants M and V47() (A or G at nucleolide
position 1340 respectively), with the V47O variant resulting in
decreased functional CFTR and the M47() maturing more
slowly. We have reported a strong association of the 5T allele
with the valine at position 470 (de Meeus et ul.. I998a,b),
which has been further conlirmed in a Spanish sample (Casals
(7 «/.,20(X)). suggesting that the M470V locus could contribute
to the variable expression of the 5T allele. In the study of
Groman et ul. (2tK)4), TGI1-5T and the highly penctrant
TGI3-5T allele were found on a M470 background in all of
the cases in which phase could be established, whereas
TGI2-5T was found to be mostly as.sociated wilh V47().
Polymorphism M470V thus does not appear lo be a major
modifier of the penetrance of the 5T allele in CBAVD. but its
role cannot be excluded, since combinations TG13-TS-M47O
and TG13-T3-V470 have been observed in CBAVD and CF
patients respectively (Cuppens et ul.. 1998).
It is possible thai some variations considered as neutral
polymorphisms in cystic fibrosis. such as F5()8C. I7I6G>A,
R75Q or the double mutant |G576A+R668Ci may be mild
[nuiants involved in CBAVD cases when no other mutation
is found on the allele despite careful whole coding
sequences scanning. In normal individuals, variable levels
of CFTR transcripts without exon 12 account for 5-30% of
total CFTR mRNA (Bremer et at.. 1992: Slomski et al.,
1992: Hull cf al.. l'>94). .Skipping of exon 12 removes an
important part of the first NBF. rendering the CFTR protein
non functional. Pagani et al. (2003a) analysed the splicing
pattern resulting from several variants in CFTR exon 12,
including G576A (G>C at nucleotide 1859 in exon 12),
which is associated in cis with R668C (C>T at nucleotide
2134 in exon 1.^). and this complex allele produced only
22% and 7% of mRNA with exon 12 in transcripts derived
from nasal epithelial eells or from hybrid minigene
transfection assays respectively. They also evaluated the
effect of several splicing factors on the severity of splicing
defect and suggested that variations in the concentration in
splicing factors may be responsible for tissue phenotypic
expression. Steiner et al. (2004) studied the CFTR mRNA
from epithelial nasal cells of patients aflected with CFTR-
opatliies and demonstrated that several ct»mmon coding SNP
wiUiin the CFTR gene are associated wilh a significant
increase of exon 9 and 12 skipping. Partial penetrance could
be a feature not only ofthe 5T allele, bui also of other CFTR
variants, and further clinical and molecular studies are
required to address this issue.

Molecular basis for the skipping
of exon 9 in humans
Minigenes to replicate CFTR exon 9
alternative splicing
Much attention has been devoted to understanding the
mechanisms that influence the alternative splicing ofexon 9.
To this end, researchers have developed an in-vivo mode!
system ihat replicates exon 9 alternative .splicing consisting
of a reporter minigene by means of which the effect of the
different CFTR alleles can be experimentally analysed. In
particular, minigenes carrying either exon 9 or exons 8.9. 10
with nanking introns (Figure 8a) have been used to isolate
the cis and trans factors, which control the splicing ofexon
9 and modulate its efficiency (Nicksic et al.. 1999; Nlssim-
Rafinia et at.. 2000; Pagani et al.. 2000-. Buratti and Baralle.
2001; Buratti er al.. 2001; Hefferon er al., 2002). By using
transient transfections of minigenes containing different
combinations of TGm and Tn repeats anti studying their
splicing pattern, the group of Baralle was the t'irsl lo confirm
that the longer the {TG)m tract the higher the proportion of
transcripts without exon 9, but only when activated by the
5T allele (in their minigene system). with
TG13T5>TGI2T5>TGI tT5 (Nicksic ef at.. 1999).
A complex network of cis- and trans-
acting factors modulate CFTR exon 9
alternative splicing
The observation ihat identical pre-mRNA transcripts are
processed into alternatively spliced forms in a tissue-
specific manner strongly suggested tissue-specif ie
differences in their splicing environment, that could be due
either to the presence of specific altemalive splicing factors
or to variations in the activities or levels of constitutive
splicing factors (Mak ei al.. 1997; Rave-Harel er al.. 1997:
Teng er al.. 1997). Experiments using minigenes showed
that increasing the intracellular eoneentrations of a variety
of cellular splicing factors including SR (serine-arginine-
rieh) proteins, in particular Ihe splicing factor 2 (SF2/ASF).
and hnRNPs (heterogeneous nuclear rihonucleoproteins)
promoted the skipping of exon 9 from pre-mRNAs (Nissim-
Raffinia er al.. 2000; Pagani et at.. 2000). The group of
Baralle demonstrated that this inhibitory effect of rrans-
aeting factors on exon 9 inclusion was strietly dependent on
the composition of ihe TGm and Tn alleles. and was further
modulated by exonie splicing elements located in exon 9 [a
6-bp exonic splicing enhancer (ESE) and a 10-bp exonic
splicing silencer (ESS)] and, more importantly, by an
intronic splicing silencer (ISS) located in intron 9 (Pagani et
al.. 2000) (Figure 8). The nuclear protein TDP-43 (HIV-1
TAR DNA-binding protein) was identified as the factor
interacting specifically with the (UG)m tract in the CFTR
pre-mRNA (Buratti et al., 2001}. Overexpression of TDP-43
resulted in an increase ofexon 9 skipping, whereas antisense
inhibition of endogenous TDP-43 expression resulted in an
increased inclusion of exon 9. TDP-43 binding to the UG
polymorphic repeat reduces the proper recognition of the
nearby 3' splicing site and, in association with the ISS
element in intron 9. mediates exon skipping (Buratti et al..
2001. 2004). Tbese data were recently confirmed by Wang ei
Symposium - Molecular pathology of [he CFTR locus - M Ctamtre.s
al. (2004). who showed that the mouse homologue of human
TDP-43 inhibit--; human CFTR exon 9 splicing in a minigene
system. Recent studies shitwed that promoter architeclure
also can interfere in the modulation of CFTR exon 9
skipping in minigene experiments, which sugge.sts an
interesting kinetic model in the coupling of transcription and
alternative splicing (Pagani et al.. 2003b). Zuccato et al.
(2004) reported the idenlification of iwo polypyrimidine-
binding proteins, TIA-I (inducing exon 9 inetusion) and
PTB (polypyrimidine tract-binding protein, inducing exon 9
skipping) as novel players in the regulation of CFTR exon 9
splicing. TIA-1 is the first m(/(.s-acling factor with a positive
effect on exon 9 splicing and binds specifically to a
polypyrimidine-rich controlling element (PCE) containing
intronic splicing enhancers (ISE) located between the weak
5' splice site and the ISS in intron 9.
Suboptimal 5' splice sites make exon 9
vulnerable to skipping
Because many exons, both in CFTR and in otber genes, have
short polypyrimidine tracts in iheir 3' splice sites, yet arc not
skipped, other mechanisms of exon 9 skipping have been
investigated by mutating the 5' splice sites both up- and
downstream of exon 9 (Hefferon et al.. 2(K)2). Conversion of
the upstream 5' splice site to consensus by replacing a
pyrimidine at position -i-3 (Shapiro-Senapathy score of 84.3''^ )
with a purine (score of 94%) resulted in increased exon
skipping (50%' exon 9 versus 30%). In contrast, conversion of
the downstream 5' splice site to consensus by insertion of an
adenine at position +4 (score 100% versus 75%) resulted in a
reduction in exon 9 skipping, regardless of whether the
upstream 5' splice site was consensus or nol (Hclferon er al..
2(K)2). These results suggested that human CFTR exon 9 is
skipped beeause of suboptima! splice sites that make it
inherently vulnerable to skipping. The potential role of the
downstream 5' spliec site in exon 9 skipping are further
supported by data from sheep and mouse genomes. Sheep have
upstream and downstream 5' splice site sequences very similar
to those of humans bul have an extensive polypyrimidine tract
in the 3' splice site in tbe intron 8 (Y14) nol accompanied by
an adjacent TG variation. Although this structure would have
predicted retention ofexon 9. sheep skips exon 9 in all tissues
analysed (Hefferon et at.. 21X)2; Broackes-Carter er at.. 2(K)3).
CFTR exon 9 skipping is absent in tbe mouse, which has two
strong splice sites and a very short and non-polymorphic
polypyrimidine iracl (Y5) (Delaney et at.. 1993; Nicsic er al.,
1999: Ellsworth el al.. 2000). Altogether, these observations
led to the conclusion that exon 9 skipping in humans is due to
the unusual composition of ibe Hanking 5' splice sites
(Hefferon ei al.. 2(X)2), Rozmahel et al. (1997) have found tbat
a fragment of CFTR gene spanning exon 9 and its flanking
introns and polymorphic lofi is present in multiple copies in
Ihc huEiian genome, whereas it is present in only a single copy
in different Old World monkeys who bifurcated from the
Homo lineage more than 10 million years ago. They have
suggested that a retrotransposition event followed by an
amplitlcation of the integration site occun'ed in the human
genome. Thus, it is conceivable ihat insertion and
rearrangement events oecurring in intervening sequences
surrounding buman CFTR exon 9 placed fortuitous new cis-
aeting elements in the proximity of its splice junction, which
lowered exon delinition and provided the basis for exon 9
Symposium - IVIolccuiar pathology of the CFTR locus - M Ctaustres

iVS8
exonS exon9
TGm Tn
CFTR AG/gtcaga ttttgagtgtgtgtglgtglgtgtgtmmttaac?iq/G...
TG9-T9 ttttgalgtglgtg!gtgtgtgtgttttmna.icag/G,..
TG10-T9 ttttgalgtgtglgtgl9tgtgtgtgttttmtta.-ji;sy/G...
TG11-T9 , tttgalgtgtgtgtgtgtgtglgtgtgtttttttttadcag/G...
TG10-T7 ' ttttgatgtgtglgtglgtglgtgtgmmtaacag^...
TGn-T7 migatglgtgtgtgIgtglglgtgtgmit(taacag/G...
TG12-T7 ttttgatgtgtgtgtg!gtgtgtgtgtgtgtmma.-i.-,ag/G...
TG11-T5
TG12-T5 ttltg3tgtglgtglgtgtgtglgtgtgtgmtta--i'-.ag/G...
TG13-T5 ttttgatgtgtgtgtgtgtgtgtgtgtgtgtgiilttarirag/G...
Consensus AG/gf agn ..// ....nytray (n)2-21 yyyyyyyyyynydg/G...

Fertile men (%) CBAVD {%) nonclassic CF {%)

TG11-5T 78 10 0
TG12-5T 22 78 60
TG13-5T 0 12 40

Figure 7. Polyvarianl mutanls: the alleles al TGiii modulate the partial penetrance ofthe 5T allele. (a) Sequences at the 5' and .V
splice sites in intron 8 {or IVS8, intervening sequence 8). Pre-mRNA splicing is a complex mechanism that relies on the correct
identification on the short protein coding sequences (exons) among the large non-coding .sequences (introns). Sequences in CFTR
intnm S share most oi' ihc canonical features ol' splicing sites, including the 5'-GT splice donor. 3'-AG splice acceptor at the
iniron-eson *•) Junction, branch-point A (in green) and pyriniidine-rich region at the splice acceptor site. However, the
polypyrimidine tract is composed exclusively by thyniidines and is polymorphic for its length. Moreover, it is placed immediately
downstieam of another polymorphic locus made of a variable number of TO repeals. This peculiar architecture ol'the intron 8 3'
splice site modulates lhe alternative splicing of human CFTR exon '•) (Hefferon et al.. 2(K)2). Con.sensus sequences ft)r 5' and 3'
sites are given: y indicates a pyrimidine. and n indicates any nucleotide. Nine haplotyjies TGmTn have been found in Caucasian
populations, with T G I I T 7 the most common combination. Longer alletes at TGni associated wiih shorter allcles at Tn exacerbate
exon y skipping (yellow, decreasing amounts of funciional CFTR from top to bottom), In nasal epithelial cells frt)m normal
individuals.TGl()T7 gives about 5% mi8-splicing.TGnT7 I4%,TG12T7 30%.andTGl2T5 72-89% (Cuppenscf a/.. 1998). (b)
Frequency ol TGm-5T combinations found in fertile or infertile men carrying a CF mutation on a gene and a 5T allele on the
second gene (adapted from Groman el at.. 2004).
 Symposium - Molecular patholog)' of the CFTR locus - M Claustres

Correct splicing

ESE ESS
PCE ISS

branch site 3'-splice site

Eson 9 skipping

^w __

TQ12T3 !1 . ^ 1
TG12T5
i1
TQ12T7
L ' I j

TG11T7 {
J
E»n9- E»<Dn9+
fTfiNAs

TOt2T7

Figure 8.The minigene approach to analyse CFTR exon 9 splicing, (a) A minigene is a genomic fragment ihat includes the exon
of interest and the surrounding introns ;is well as the flanking constitutive!)' spliced exons and is chined in a cukaryotic expression
vector then transfected in appropriate cells. Expression of trunsfected minigenes thus replicates constitutive and altemative
splicing patterns, which are analyzed alter RT-PCR with primers that can detect the inclusion and exclusion ofthe alternative
spliced exon. These constructs are specifically designed to intrtxiucc by site-direcied muiagenesis modifications in either the
length or the sequence of the sites of interest. Minigenes can be cotranstected with putative splicing factors to test /m/(.v-acting
factors or they can be transfected into different cell types to analyse them for their splicing ability. This purt of the figure gives a
schematic representation of the c/.v-acting intronic and exonie elements thai affect the altemative splicing of exon 9. The eletnents
identified so far include the weak upstream and dowstream 5' splice sites (Hefferon et al.. 2002). Ihc TGm and Tn polymorphic
sites at the 3-end of CFTR IVS8. the exonie splicing enhancer (ESE) and silencer (ESS) sequences in exon 9. ihc («ilypyrimidine-
rich controlling element (PCE) and the intronic splicing silencer (ISS) in 1VS9 (Pagani et at., 2000. 2003; Zuccato et ul.. 2004).
(b) Analysis ofthe size and the relative proportions of minigene RT-PCR products containing E9 j4l3 bp) and those lacking E9
(233 bp) by using fluorescent electrophorcsis and Genescan softwares. A strong ptisitive correlation is found between the length
of the T trad and the proportion of mRNA with exon 9, with T7>T5>T3 observed in all cell lines tested (Disset et al.. 2(K)4). (c)
A decrease in the number of Ts in a TGI 2 background determines a cell-type-dependent reduction in transcripts exon 9+. with the
lowest levels observed in epididymis-deHved cell lines (Disset ei al., 2004).
Symposium - Molecular pathology of the CFTR locus - M Ctausires
skipping in CFTR mRNA (Hefteron er at., 2tW2). Recently,
Hefferon er at. f 2(K)4) showed ihal the TG tract affects splicing
through the formation of iriinsieni RNA secondary .structures.
Replacement of the TG traet in the minigene wiih random
.sequence abolished splicing of exon 9. Replacements with
sequences that can self-base-pair resulted in a substantial
increase In exon 9 inclusion, suggesting a role for RNA
secondary structure in the influence of these sequences on
splicing.
Exon 9 alternative splicing is extremely
sensitive to sequence variations
Single base changes in exons may cause pathological splicing
events by inducing exon skipping or inclusion from the mRNA
through disturbance of exonic elements that modulate splieing.
Skipping of constitutive exons can occur for missense
(substitution of amino acid) and silent (change at third position
ofthe codon usage, that does not ehange the amino acid code)
mutations through disruption of ESE or creation of ESS (Liu
et al.. 2001). Pagani et al. (2003c) demonstrated that single
nudeotide substitutions in exon 9 might have a profound effect
on the splieing eflleiency of this exon. inducing exon inclusion
(Q452P) or exclusion (A455E). Overall. 35 substitutions of 47
caused changes in the splicing pattern, this extreme sensitivity
being probably related to the weak definition of the CFTR
exon 9. They also identified at the 3' portion of exon 9 a
composite regulatory element with juxtaposed enhancer and
silencer properties. Another site for 'eomptwite regulatory
elements of splicing' (CERES) had been previously described
by the same group in CFTR exon 12 (Pagani et at.. 2(X)3a).
These studies illustrate that some missense mutations may
exert part of their phenotypie expression and disease
variability through their effect on splieing of mRNA and not
only through CFTR channel dysfunction. This is the case of
missense A455E, which was found in this study to increase
exon 9 skipping {50% in a TGIITO context). Overall, these
results suggest that, in addition to adjacent spliee sites, the
entire sequence of exon 9 is important for exon recognition
and processing.
The rare 3T allele is a CF disease-
causing mutation
T3 is a very rare allele which, so far. has been reported only
twice worldwide. The first case was a Gennan patient
presenting with pulmonary symptoms with recurrent
infections, elevated sweat ehloride concentrations and
pancreatic sufficiency (CF-PS) (Buratti er al., 2001). He
carried a TGI3T3 sequence (no other mutation) in trans with
TG l(JT9-F5()Sdel on the second allele. The proportion ofexon
9 skipping was evaluated by semi-quantitative analysis of RT-
PCR products derived from blood iymphoeytes. indicating that
only 6% of correctly splieed transcripts (with exon 9) were
generated from theTG13T3 allele. In minigene assays, the T3
allele led to a highest degree ofexon 9 .skipping, ranging from
53'^ (TG I 3T5) to Hm (TG 13T3). which was coneordant with
the CF phenotype of the patient (Buratti er al.. 2001). We
reported a novel TG12T3 allele in a CBAVD patient who
carries a TGI 1T7 and the benign variation F5O8C on the other
chromosome (DIsse! er ai. 2tX)4). By using a minigene assay
designed to include all the cn-aeting elements reported so far
in the vicinity of exon 9 (Figure 8a), we have analysed the
splieing patterns derived from minigenes transiently expressed
in six different CFTR-expressing epithelial cell lines,
providing new insights into the ineehanisms by which the
proportion of skipped transeripts may be increased in male
reproductive tissues. We demonstrated that longer TG tract.s
promote exon 9 skipping even in aT7 background, in contrast
with previous minigene studies where this effeet was observed
only on a 5T context (Nieksic et al.. 1999). hut in accordance
with initial observations from the study of endogenous CKFR
transcripts (Cuppcns et al.. 1998), A decrea.se in the number of
Ts in a TGI2 background determined a cell-type-dependent
reduction in exon 9+ transcripts, with the lowest ievels
observed in male genital tissues derived cells (Figure 8b).
Previous studies had postulated that CBAVD could be related
to less efficient splicing mechanisms in the male genital tract
compared with the respiratory tract. However, by comparing
the rate of decrease in exon 9 inclusion expressed in the
different cell lines, we showed that elevated hasic levels of
full-length CFTR transcripts (for example, in the testis derived
cell line) does not prevent a drastic reduction induced by
TG12T5 or TG12T3 aileles. Our results showed that tissue-
specific rran.s-iic\ing splicing factors do nut contribute to the
different patterns of exon 9 splicing found between the cell
lines. The results rather support the concept that the ratio of
general splicing factors plays a role in the tissue variability of
exon 9 alternative splicing (Disset er al.. 2004). An alternative
hypothesis is that deeper intronic /r(//(,v-acting factors might be
involved that are not present in the minigene constructs. We
also confirmed that the 3T allele dramatically increases exon 9
skipping and should be considered as a 'CF' mutation
predicted to be fully penetrant in disease, in contrast with the
51 allele. It is thus conceivable that an individual carrying the
extreme allele TG 13T3 in combination with a severe mutation
(F308del) will have a CF-PS phenotype, whereas an individual
carrying a TGI2T3 in combination with a mild variant
(F50SC) will only express a CBAVD phenotype. The complete
skipping of exon 9 in all CFTR transcripts is predictive of
severe CF. as observed in patients with mutations that destroy
the consensus (AG) dinucleotide of the acceptor splice site in
intron 8 (Cystic Fibrosis Mutation DatabiLse. 2004). which is
expected to block exon 9 pre-mRNA splicing and result in
deleted transcripts.
CFTR mutations and other infertile
phenotypes
Besides CBAVD. a higher than expected frequeney of CF
mutations or polyvariant haplotypes has been observed in
other forms of infertility.
Infertile patients with congenital unilateral
absence of vas deferens (CUAVD)
CUAVD is a rare condition., occurring in less than \l\000
males. Martin et al. (1992). reporting on two brothers, one
with CUAVD and the other with CBAVD. were the first to
point out an assoeiation with the CFTR gene. Men with
CUAVD and an obstructed contralateral vas deferens may be
classified as having CBAVD (Schlegel et al.. 1996). Mickle et
at. (1993) defined CUAVD as palpable absence of one scrotal
vas deferens and were able to subdivide them into clinically
and genetically distinct groups. Patients with CUAVD and a
contralateral obstruction of the seminal tract (at either the

inguinal or pelvic level) had a high frequeney of" CFTR
mutations (SS%). no renal agenesis, und this group is a CFTR-
associateti phenolype. Men wilh CUAVD and a patent
conlralaEeral seminal tract (i.e. they were not azoospermic) had
no CITR mutation, and this group displays a high frequency
(40-80%) of ipsilalcral renal agenesis (Mickle et at.. 1993:
MaAi etat.. 1999: Wclskc £7 <;/.. 2{)(K): McCallum ei al..2()0\:
Kolettis and Sandlow, 2002). CUAVD is a heterogeneous
condition, and the two different forms (with and without renal
anomalies) are probably the result of distinct
pathophysiological processes.
Obstructive azoospermia with intact vas
deferens
Several studies documenled the assumption that non-CBAVD
azoospermia may in some cases be retaied lo ihe CFTR gene,
including Idiopalhic forms of epididymal obstruction (Jarvi er
at.. 1995; Mak et at.. 1999) and bilateral ejaculaiory duct
obstruction (BEDO). where a high frequency of CFTR
mutations has been found and several compound
heterozygotes reported (Meschede er at.. 1991: Mak et at..
1999). In a study involving 16 tnen wilh isolated anomalies of
the seminal vesicles (IASV), only one was found to be
heterozygous for a missense mutation and one for the 5T
allele. which gives a frequency nol different from the general
population, so that IASV is not a CFTR-related entity
(Meschede et al.. 1997). The association of chronic
bronchopulmonary disease with azoospermia due to a
complete bilateral obstruction of the epididyme.s characterize
Young's syndrome, but. in contrast to CBAVD or CF, there is
no anatomical malformation of the seminal ducts. No CF
mutations have been convincingly demonstrated in Young's
syndrome. Despite some clinical common aspects. CF and
Young's syndrome are two distinct entities.
Non-obstructive causes of male infertility
and subfertility
A higher than expected frequency of CFTR mutations or
variants has been reported in olher more common forms of
infertility. A CFTR mutation frequency of 17.5% (versus 5% in
the general population) was detected in 80 infertile men with
reduced sperm quality (Van der Ven et al.. 1996). However,
these observations were not confirmed in larger samples from
southern France (Paltares-Ruiz et al.. 1999). The Netherlands
(Tuerlings er al.. 1998). Germany (Stuhrmann and Dork. 20(X))
or Slovenia (Ravnik-Glavac er al.. 2001). Although it seems
that CFTR mutations do not play a major role in
spermatogenetic failure, a minor effect on speimatogenesis or
sperm maturation is still possible. Since it seems that the male
reproductive tract is the most sensitive system of all CFTR-
affected tissues to even minor CFTR dysfunction, it has been
suggested that, in absence of well-defined CFTR mutations,
poiyvariant mutants producing less functional CFTR. such as
the common single nudeotide polymorphism (SNP) M470V in
exon 10. may predispose to oligospennia and testicular failure
(Cuppens er al.. 1998). The V470 bomozygous genotype was
found to be significantly more frequent among non-CBAVD
Infertile patients (Boucher et al.. 1999: Pallares-Ruiz et al..
1999; Larriba er al.. 2001). it is difficult to compare SNP
frequencies between published studies, partially because ofthe
poor comparability ofthe populations being studied in terms of
Symposium - Molecular pathology of the CFTR locus - M Ctattsrrc!,
sample size, anatomic findings, and extent of genetic
screening.
Infertility may be caused by more than
one genetic defect
Cases where compound genetic defects coexist have been
recently reported. A Chinese patient presenting with CBAVD
and testicular atrophy with late matutation arrest of
spermatogenesis was found to be heterozygous for the 5T
allele and also to carry a pericentric inversion of chromosome
6 (Black (•/ al.. 2()()()). In another male with CBAVD. a
compound heterozygosity for a CF mutation and the 5T allele
was coexisting with a Robcrtsonian translocalion (Drouineaud
er al.. 2003). With extended genetic analysis, a growing
number of men may be found with more than one genetic
defect, such as Klinefcltcr patients (47.XXY) also carrying a
CFfR mutation, or men having both an A'/.V deletion of the Y
chromosome and a CFTR mutation (Doble et al.. 2(X)2).
Uterine CFTR-mediated bicarbonate ion
and sperm capacitation: the female
counterpart?
No female equivalent of CBAVD exists due to the different
embryological origin of the definitive female reproductive
tract. It was thought that the main genclic factor contributing
to the reduced fertility observed in about 507c of women with
cystic fibrosis is the thick dehydrated cervical mucus acting as
a barrier for sperm passage. Intrauterine insemination (lUH
has been used to overcome this, and the first case of successful
pregnancy and birth after IVF in a woman with CF
homozygous for F50Sdel was reported in 2000. after eight
failed attempts at lUi (Rodgers et al.. 2{KX)). Recent findings
suggest that the infertility of women with CF may not be
caused exclusively by ihc failure of spermatozoa to penetrate
cervical mucus, but also from an inability of spermatoz.oa to
capacitate within the uterus and oviduct because of defective
CFTR-mediated bicarbonate secretion (Wang et al., 2(X)3).
Bicarbonate ion is one of the essential components for
mammalian spermatozoa to be capacitated in vitro. Acting in
concert with calcium in spermatozoa. HCO^" elevates
intracellular cAMP levels (Evans and Florman. 2002), which
in tum activate multiple pathways that drive the process of
sperm capacitation. including hyperactivation of tlagellar
motility. In vivo, it is known that CFTR gene expression occurs
in endocervical cells throughout the menstrual cycle (Haysiip
er al.. 1997) and that the fernale reproductive tract can secrete
high concentrations of bicarbonate ion. The study by Wang et
al. (2003) provided for the tirst time a direct link between in-
vitro results and in-vivo observations, on the basis of several
findings: (i) endomctrial epithelial cells possess a CFTR-
mediated bicarbonate transport mechanism, (ii) spermatozoa
are not capacitated efficiently in medium conditioned by cells
in which CFTR expression has been suppressed by antisense
RNA or by cells expressing the F508de! mutation, (iii) the
failure of F50Sdel cells lo capacitate spermatozoa is rescued
by transfection with wild-type CFTR or by addition of HCOi"
to conditioned medium. In cystic fibrosis. attention has been
focused essentially on chloride-channel properties of CFTR.
However, the demonstration ihat CFTR-dependent
bicarbonate secretion can drive sperm capacitation in virro
again stresses the importance of the bicarbonate, "the
Symposium - Molecular pathology of the CFTR locus - M Claustres
neglected ion' (Quimon. 2001). Indeed, CFTR can ininspon
hicarbonme ami L'hlorido by disltiid mechanisms (reviewed by
Hug (•/ at.. 2003) and the severity of CF can be predicted more
jiccurately by biearbonate eonduclatiee than by chloride
conductance (Choi et at.. 2001; Wine. 2(K) I).
Genetic heterogeneity in CBAVD
CBAVD with renal abnormalities
In 12-21% of cases, CBAVD is associated with malformations
or agenesis of the upper urinary tract and in almost all cases.
no CFTR mutation can be detected (Anguianu et at.. 1992;
Gervai&etat., 1993; Augarten c/u/.. 1994; Casals f / a / . , 1995;
Mickle el at., 1995; Schlegcl ef at.. 1996; Dork et at.. 1997: de
la Taille et at., 1998; Claustres et at.. 2000: McCallum et al..
2001). It is thoujiht that CBAVD with concomitant renal
malformations probably does not represent a genital form of
CF but rather a distinct elinical entity, termed 'URA/CBAVD'
by McCallum et at. f2(K)l). These investigators found no
significant differences between the two groups (CF/CBAVD
and URA/CBAVD) of patients in term.s of physical, laboratory
and radiographic findings of the reprtxiuctive derivatives as
well as in fertilization and pregnancy rales, which wa.s also
observed by Robert et al. (2002); by contrast, the percentage
of men with a pelvic kidney was 10-fold higher in the
URA/CBAVD cohort than the CF/CBAVD group. The fact thai
the phenotypic outcome of the renal portion of the
mesoncphrie duct is so different between the two groups
strengthens the hypothesis that URA/CBAVD and CF/CBAVD
have a different genetic basis. During embryonic development.
the vas deferens, seminal vesicle. ejaculaUiry duct aud distal
two-thirds of the epididymis develop from the reproductive
part of (he mesonephric duct, while its ureteric piirt is needed
to induce normal renal development. The head of the
epididymis (which is present in men with CBAVD or CF) and
the testis arise fnini the genital ridge. The physical separation
between Ihe two mesonephric duct derivatives (seminal and
renal) occurs by week 7 of gestation (Oates and Amos, 1994).
It has been postulated that damage at a very early stage in
embryo developmeni (before 7 weeks) will lead to abnormal
development of the entire mesonephric duct with its two
derivatives, resulting in URA/CBAVD (Hall and Oates. 1993:
MeCallum et al.. 2001), or URA/CUAVD (Donohue et at..
1989). By contrast, the genetic defeet in CBAVD-CFTR
appears t() affect the embryo after the division of the
mesonephric parts in the seventh week of gestation, so that
only the seminal tract will be altered.
A few number of patients with CBAVD and URA have now
been reported to be heterozygous for a CFTR mutation (Mak
('/ at.. 1999: Casals et at.. 2000). the significance of which is
unclear as it might be pure coincidence considering the high
frequency of CFTR mutations and 5T carriers in the general
popuiation and the low numbers of URA/CBAVD patients
investigated. Further family studies are required in both the
CBAVD populations and in males with URA to determine the
proportion of eases with genetic causes, the mode of
inheritance and the penetrance of genetic factors in CBAVD
and nephrogenesis.
CBAVD with discordant familial
segregation of alleles
Family studies are another approach to study the possibility of
genetic heterogeneity. In families with CBAVD linked to
CFTR mutations, brothers with CBAVD should inherit the
same CFTR genes from their parents, whereas fertile male
siblings should have at least one CFTR gene different from
their CBAVD brothers. In families with CBAVD not linked to
CFTR defects, the inheritance ofthe CFTR genes should be
random with respect to the CBAVD phenotype. Familial
segregation of CFTR genes ean be assessed by studying
polymorphisms within and around the CFTR gene: the
combination of alleles at the polymorphic sites (haplotypes)
allows one to follow transmission of CFTR genes from parents
to children in the pedigrees. Three families wiih no identified
CFTR mtitations have been reported in which either the
brothers with CBAVD inherited two different alleles frotn one
of their parents (Ritve-Harel et al.. 1995) or in which fertile
brothers inherited the same CFTR alleles as their brothers with
CBAVD (Mercier et al.. 199.^). Such a discordance between
phenotypes and marker haplotypes suggested that CBAVD
was not caused by two mutated CFTR alleles but was rather
the result of mutations at other hypothetic loci (Mercier et cd.,
1995; Rave-Harel el al.. 1995). However, sueh cases could
also be explained by CFTR unidentified mutations that have a
more complex pattern of penetrance. and it would have been
interesting to re-analyse these three families with the 5T allele
and its surrounding modifiers. Moreover, whether CBAVD
was associated with renal anomalies, or not. was not
mentioned in the initial reports. Nevertheless. 15-20% of
patients with CBAVD who have now been extensively
screened and do not have CFTR mutations or the 5T allele may
indicate a subpopulation of men with other genes responsible
for the reproductive anomaly.
CBAVD pathogenesis
The mechanisms by which CFTR mutations contribute to the
palhogenesis of CBAVD are still not fully understood.
CBAVD may resuit from a morphogcnic defect during
development or from obstruction by abnormal secretions.
Timing of CFTR damage in Wolffian
derivatives development
CFTR mRNA is highly expressed in theepitheliumttf the head
of the epididymis by 18 weeks gestation (Tiz/ano ei al.. 1993,
1994; Trezise et at.. 1993). which suggests that CFTR may
play a role in the early development of the reproductive
tissues. An initial report has described a fetus with CF that
showed extensive fibrosis and regression of the epididymis
(Harris and Coleman. 1989). Recently the relationship
between CFTR mutations and the congenital absence of the
uterus and vagine (CAUV) condition which affects I in 5()(M)
females, was examined upon lhe rationale that the
embryological development of the Mlillerian tiucts directly
depends on the prior normal development of the Wolffian
ducts (Timmreck et al.. 2()O3). Samples from 25 patients with
CAUV were tested for the 33 most common CFTR mutations
including the 5T allele. and lhe data suggested that it is
unlikely for CFTR mutations to cause CUAV in females
(Timmreck et al.. 2003). Finding that C I T R mutations are

iissoL-iatod with S{)% of cases of CBAVD. a Wolffian duct
iuiomaly. but are nol associated with CAUV. a Miilleriiin duct
anomaly, provides further evidence on the liming of CFTR
damage in CBAVD. The effects ofthe CFTR mutations on the
Wolffian duct derivatives must occur after ihc ninth week of
embryological development, at a time when the Wolffian and
Mullcriiin ducts have completely separated and are developing
independently.
CBAVD as the result of progressive
regression
Several findings favour the hypothesis Uut, in contr;ist wilh
CBAVD not linked to CFTR where Ihe absence of vas deferens
may originate in fetal life as a defect during organogenesis.
CFTR mutations do not affect the embryological development
of the Wolffian duel. The fact that normal jxirtions of the
genital tract are seen more frequently in CF newborns than in
older patients (Oppenheimer and Esterly, 1969) suggests thai
Wolffian derivatives are present at some stages of fetal life but
may degenerate later. Gaillard et al. (\991) examined two
fetuses with iwo severe CFTR mutations after abortion at 12
and IS weeks respectively, and determined that their vas
deferens were normal wilh no obsiruction or stenosis. This
observation and the high proportion of normal ducts reported
in prepubertal male CF patients (Valman and France. 1969)
favour the hypothesis of degenerative lesions secondary to
luminal obstruction, probably caused by thick secretions, as
ihe cause of definite post-natal ductal regression (Patrizio and
Salameh. 1998). The first study describing ultrasonic features
in male CF children confimied intact kidneys and ureters, and
suggested the possibility that ductal genital abnormalities
progress with time (Blau (Va/..2(K)2).1 he luminal fluid ofthe
epididymis contains a high protein load and has a low How
rate, and the epididymis and the vas deferens form a tortuous
ductaJ system that is several meters long but has a diameter
<i).5 mm. It is possible that the absence or dysfunction of
CFTR would make these organs very vulnerable lo luminal
concentration defects, especially in the distal portion of the vas
deferens. where CFTR expression level is low (Tizzano er at..
1993, 1994; Trezise et at., 1993). and lead to progressive
obstruction and obliteration, as described for other ducts inCF.
Gaiiiard er al. (1997) propo.sed that the tenii "atresia" should be
u.'icd in cases of CBAVD associated with CF mutations,
whereas the tenn "agenesis" should be used for cases of
CBAVD associated with urogenkal abnormalities in which
defects occur during organogenesis.
CFTR mutations and spermatogenesis
It is generally a.ssumed that azoospermia and infertility in men
with CBAVD are due simply to anatomical obstacle and that
the sperm production Is nonnal. The histological examination
of the testis (Silber et al.. 1990a) revealed either normal
spermatogenesis (Goldstein and Schlossberg. 19S8; Okada et
at.. 1999) or hypospermatogenesis (15-30% in CBAVD. 45%
in CUAVD) (Weiske et al.. 2000; Meng er al.. 2(H)I). Some
degree ol' hypospermatogenesis is expected because absence of
the vas deferens acts as an obstruction of the testicular
epididymal system (Weiske er al.. 2000). lt has been suggested
that the CFTR protein may play a role not only in the
development of structures derived from the Wolffian ducts but
aho in ihe process of spermatogenesis or sperm maturation
Symposium - Molecular pathology of the CFTR locus • M Ctaustres
(Trezise et al.. 1993). A number of cytological abnormalities
preferentially occurring in the spermatid stage have been
observed in CF and CBAVD men (Gottlieb et at., I99i).
Larriba et al. (1998) studied exon 9 splieing in testicular
tissues and found that the presence of the 5T allele (but not the
presence of one or two mutations) was associated with a
significant reduction in mature (elongated) spermatids per
tubule in CBAVD males. A recent study reported that testicular
volumes were significantly lower in men with CBAVD
without renal abnormalities that carried the 5T allelc only
(without another CFTR mutation) (Robert et al.. 2(X)2). CFTR
is expressed in rat spermatids. and may be involved in volume
reduction that occurs in spenniogenesis (differentiation of
spennatid.s into spermatozoa) (Wong et al., 1998; Gong et al.,
2001). lt is possible that CFTR plays an important role in the
formation ofthe epididymai Huid micr(wnvironment through a
synergistie effect with the water channel aquaporin (Cheung et
al..2OU3).
Spectrum of diseases caused by
CFTR mutations: from classic CF
to CFTR-opathies
Recent advances in mutation detection technology have led to
the extensive screening of patients with monosymptomatic
diseases with similarity to CF (Figure 9).
CFTR carrier status as predisposing to
disease?
In addition to classic forms of cystic fibrosis. there is now a
growing recognition of 'non-classic' or 'atypical' cases of CF
presenting in adolescence or adulthood, that manifest
symptoms in only one or two organ systems, .such as isolated
pancreatitis (Boyle, 2003). Furthermore, there is growing
evidence of an association between CF mutations and other
diseases including allergic bronchopulmonary aspergillosis
(ABPA), chronic sinusitis or idiopathic bronchiectasis (an
irreversible dilatation of proximal subsegmental bronchi). CF
is an autosomal recessive inherited disorder that results when
both alleles carry a disease-causing mutation. Carriers of a
single mutation are asymptomatic, suggesting that a 50% level
of funetional CFTR protein is sufficient. This widely accepted
notion has been recently challenged by the detection of an
increased proportion of carriers for CF mutations or
polyvariant mutants in several conditions, such as
rhinosinusitis (Wang et at.. 20(K)), idiopathic pancreatitis,
idiopathic bronchiectasis (Casals er al.. 2(H)4) or primary
sclerosing cholangitis (Girodon et al.. 2002; Sheth et al.,
2003). It is possible that the reduction of CFTR function by
50% by a heterozygous mutation be not compensated in cases
where modifiers (genetic or environmental) play additive
effects, and it is now postulated that CFTR mutations may be
factors of genetic predisposition forthedevelopment of certain
disea.ses. The increasing number of CFTR-a.ssociated diseases
raises considerable debate about where to draw the line
between CF and other diseases with molecular defects in the
CFTR gene (Zielenski. 20(10: Boyle. 2003). Moreover, recent
studies suggest that even coding SNP niay be predisposing
factors (Steiner et at.. 2(KI4). Casals et al. (2004) found a
M470 ailele in 90% of patients with idiopathic bronchiectasis
heterozygous lor a CFTR mutation, versus 63% in the general
population or 40% in bronchiectasis patients without CFTR
Symposium - Molecular pathology of tlic CFfR locus - M Claustres

*- Pr

SEVI
GENOTYPE
wiktiype pDlyvarlant hapbtypa mid mkl mk) mid severe
Ciier* oSief* OtWf* CfflW* mid sewrv

100*/. 50% 10% -0%

'Some hclcrozygdiffi may have incicosed niKccplibitity (o allciSK bltnchqwlmomry dironic sinusitis, idiopaihic
brunL*hicc[as).s ur prinurv selcrosing chotongHis.
*Othcr =ntild at severe inutatmn
Tbe pcicentBgcs of rcsvlual normal CFTRfiinctionare appianmalc. and conelations a e not dKoluic,

Fijjure 9. Spectrum of phenotypes associated with the CFTR gene (from Zielenski, 2000; Stem, 1997; Mickle and Cutting, 2000).
The spectrum of diseases caused by mutations in the CFTR gene as well as the criteria useful to distinguish fhe phenotypes have
been recently reviewed (Boyle. 2003). Classic CF: this phenotype represents those individuals with a complete loss of CFTR
function. Since severe mutations (including F.'iOSdel) account for about 929i of mutated chromosomes in this category, roughly
KS'TJ of patients (i.e. 0.92 x 0.92) have two severe mutations (class I -3 or 6) in trans, either identical {homozygote) or different
I com poll ml tiererozygote). They have severe pancreatic exocrine insufficiency (CF-Pl) appearing early in life, chronic obstructive
pulnn)nary disease, abnormal concentrations of sweat electrolytes and the males are infertile beeause of obstructive az(Kis|x*rmia
due lo the absence t)f the vas deferens. Fifteen percent of patients have inherited one severe mutation in rraii.s to one mild, or two
mild mutations (class 4-5) and ;u'e pancreatic sufficient (CF-PS). Non-classic (atypical) CF; in this group are individuals with a
CF phenotype in at least one organ system and normal (<40 mmol/l) or borderline (40-60 mmol/1) sweat chloride values. They
are usually CF-P5.haveat least one mild mutation and are diagnosed after childhood. Males can occasionally demonstrate fertility
(ex. mutation 3849+H)kbC-»T). An example t)f non-classic CF is recurrent idiopathic pancreatitis (which occurs in patients with
functional pancreatic acinar tissue) where a high frequency of CFTR mutations is observed and 10-209r of affected individuals
Larry two mutations (Castellani et al..2001). CFTR-rclated diseases or 'CFTR-opathies' (Noone and Knowles. 2rM)I): they do
not fit the criteria for CF and do not follow a Mendelian inheritance pattern as they are associated with a 'significantly higher-
than-expected frequeney of CFTR mutations' (10-30%) in the heterozygote state, and are mostly influenced by other genes and/or
environmental factors. CFTR mutations and polyvariant mutants (including the 5T allele and several coding SNP) appear as
•predisposing alleles'. Examples include primary sclerosing choiangitis (l3-37'?( of affected individuals carry one CFTR
niLitalion). allergic bronchopulmonary apergillosis (ABPA) (10-30*''?^). chronie rhinosinusilis (7-12%) and idiopathic
bronchiecta.sis (20-36%). CBAVD: a much milder phenotype of only CBAVD without lung or pancreatic disease is associated
wilh mild mutations (missense or partial mis-splicing) in CFTR. Most individuals in this group have normal or borderline sweat
chloride values, a significant proportion have mild sinopulmonary di.sease and nasal ion transport abnorinalities. Whether they
should be included in the group of non-classic CF or in the group of CFTR-rclated disease remains a subject of controversy
(Boyic. 2(K)3); perhaps they could be separated into their own clinical category. Although the CF genotype does not absolutely
predict the phenotype. the phenotype is determined by a gradient of CFTR dysfunction dependent on the type of CFTR mutations
as well as organ sensitivity (Stern. 1997: Davis «r a/., 1996; Mickle and Cutting. 2(H)0). Patients with genotypes resulting in about
sl%i CFTR activity have classic CF with pulmonary disease, pancreatic insufficiency. CBAVD. and abnormal sweat chloride
concentrations. Patients with approximately 5-iO% CFTR function aie pancreatic sufficient. Those with about 10-25% CITR
function have CBAVD alone and may also be at risk for monosymptomatic diseases such as pancreatitis. There is an overlap
between atypical CF und monosymptomatic disorders.

mulations. Sheth ei al. (2003) iilso observed that 89% of
piiiicnis with primary sclerosing cholangitis tarried a V47n
variant.
CF with male fertility
Not all male CF patients are inlerlile. a few of them (2-39f)
having fathered children (Taussig ci a!.. 1972). Most of these
men are compound heterozygous for Ihe splicing mutation
3849+IOkbC-»T (Stem ei al., 1995; Stuhrmann and Dork.
20()0). The presence of this mutation is usually associated with
mild CF forms wilh borderline or normal sweat chloride,
pancrealic sufficiency and variable inale genital phenotype
(fertility or infertility). This mutation generates an aberrant 5'
splice site deep in intron 19 of CFTR pre-niRNAand activates
a cryptic 3' .splice site, resulting in the insertion of a 'new
e.xon" of 84 bp containing a premature in-frame stop codon.
Both correctly spliced and aberrant transcripts are produced
simultaneously, the relative proponions of which contribule to
the presence or absence of the genital lrac( (Nissim-Raffinia et
al., 20(X)).
Is CBAVD a (mild) form of CF?
There is increasing evidence thai the majority of patients with
isolated CBAVD (i.e. presenting for evaluation of infertility
but without pulmonary symptoms) also display features of
mild respiratory disease (such as sinusitis, nasal polyps,
chronic cough, raised levels of Pseudomonas aeruginosa
antibodies) when carefully examined by clinicians with
expertise in incomplete forms of CF in aduli (Osbome et al.,
l993:Durieu<'f(//.. 199.*;; Castellani cr «/.. 1999). They have
intermediate or elevated sweai chloride levels but normal
chest radiographs and spirometry. Moreover, recenl data
suggest that, even in patients who do nol manifest any
clinical respiratory symptom.s. early subclinical bacterial
pulmonary infection and inflammation may occur.
Bronchoalveolar lavage samples rc\ealed the presence of
pathogens and inflammatory mediators in the lower airways
of subjects with CBAVD who presented with laboratory
evidence of mild CF {Gilljam et aL. 2004). Oniy
observation for a prolonged period of time (several years)
will help determine their risk of developing symptomatic
pulmonary disease over time. Some CBAVD patients who
have elevated sweat electrolytes and iwo CF-causing
mutations or abnormal nasal potential difference should be
considered as having CF according lo the recent consensus
statement on diagnosis (Rosensiein and Cutting. 1998).
However, there has been no consensus to make a diagnosis
of CF (a severe, potenliaily lethal disease, diagnosed in
children) in patients wilh CBAVD (a benign condition
diagnosed in adull males presenting with an infertility
problem), probably because ofthe psychological and social
impact of such diagnosis. In CBAVD there is a normal
sodium transport across the nasal epithelium (in CF, there is
an increased sodium absorption), but an impaired chloride
conductance that is intermediate between CF heterozygoies
and CF patienls (Osborne ei al.. 199.^). Perhaps defining the
exact value of measuring nasal poieniial difference in men
with CBAVD could help to better understand the
consequences of CFTR dysfunction in Ihe airways and
anticipate the long-term prognosis (Pradal and Piacentini.
2004).
Symposium - Molecular pathology of the CFTR locus - M Claii.sirc\
Homozygosity for the 5T allele
The .'^T aliele alone is nol sufficient to induce a typical CF: it
appears as a lypical allele for CBAVD. However, there are
occasional reports on patienls wiihout CF mutations who are
homozygous for the 5T alleie and demonstrate clinical lung
features suggestive of CF, such as the homo/ygous for TG 12T3
described by Noone et al. (20(.)0). Although it is impossible to
claim wilh certainty thai homozygosity for the 5T allele is
completely benign, any potential risk appears to be most likely
limited to infertility in males. In a report on CF screening at a
nationwide scale (Strom cl al., 2(.X)4). there were 219 patients
compound heterozygotes for F.'>08del and 3T: there were 184
females, of whom 177 had no CF symptoms and si.\ with asthma
or sinus surgery: there were i5 males, ol" whom 50%
experienced CF-like symptoms including 12 with CBAVD;
(349f), three with pulmonary symploms. Of the 20 remaining
males, only 10 had fathered children and none of the 20 had
pulmonary disease.
CFTR genetic analysis In
obstructive azoospermia
It is important to make the association with CF clear (Figure
10). as it helps to stress the importance of genetic counselling
for the CBAVD couple and also for their relatives.
Furthermore, as men with CBAVD may be at risk for
expression of CV disease later in life, they will bcnefil Irom
thorough evaluation and subsequent monitoring of lung health
by clinicians witli expertise in CF. The biggest obstacle to
implementing CF testing is the extreme mutational
heterogeneity ofthe CFTR gene, boasting perhaps the greatest
number of catalogued individual inherited nucleolide
alterations of any gene yet described, so that the technical
demands are very arduous. Because the complete scanning of
coding sequences is so technically challenging and costly, an
initial assessment of correct clinical diagnosis of CBAVD.
CUAVD or BEDO is essential prior to the genetic testing.
including assessment of ihc absence of renal abnormalities.
Unlike patients with classic CF. who are more likely to have
common, homozygous or compound heterozygous mutations,
azoospermic patients are more likely to exhibit rare or private
mutations, so that detection with routine "CF mutation panels".
especially commercial tests, will miss mosl CFTR mutations
(Figures 10 and 11). Although an interesting assay using mass
spectrometry and primer oligonucleotide base extension for
100 mutations increased detection (Wang et al.. 2(N)2). optimal
detection of CFTR mutations in CBAVD can be reached only
by the application of costly scanning methods able to detect
any subtle sequence change in the coding regions of the getie,
such as DGGE (denaturing gradient gel electrophoresis)
(Costes ei al.. 1995: de Meeus et al.. 1996: Bienvenu et al.,
1997: Claustres et a!., 2000). SSCP (single strand
conformation analysis) (Dork et al.. 1997). HET (multiplex
heteroduplex analysis) (Mak ct al., 1999). or by sequencing
(Danziger ('/«/.. 2004). A disadvantage of scanning melhtxJs is
the finding of mutants or variants of unknown clinical
significance. It is likely that some of the CFfR mutants
described in patienls may not be true disease-causing
alterations (Ciaustres ei al.. 2004), and, conversely, .some of
the 250 polymorphisms reporled to the CF Consortium (half
resulting in amino acid substitutions) may play a role in
Symposium - Molecular pathology of the CFTR locus - M Claustres

Detection of CFTK muUtioiis in CB.\\'U
« CF kit» Scanaing
31 mutations +5T DGGE,dHPLC
2 mulslinns
47% 71%
71%
1 mutation
14% 16%
0 mutation 29% 13%
p{!GE. Denaturing Gradienr delhJeirmphDre.iL^
C. Pfiiaiwing High /terformaiux- liquui Chnmiatiigraphy
Figure 10, Detection ol' CFTR inuiations in CBAVD.
Identifying CFTR mulations allows: (i) establishing a diagnosis
- CFTR Tiuiiaiioiis would confimi diagnosis and be ati
e.xplanalion for obstructive azoospermia; (il) establishing a
lK)s.sib!e genetic origin - one mutated allele will always be
inherited from the affected male by the offspring; {iii)
clarifying the paltem of inheritance - dtxuimentation of the
specific familial CI^R mutations: (iv) offering adequate
genetic counselling - if the panner of a nuile with CBAVD is a
healthy can ier of a CF mutation, there is up to 257c risk of CF
to all children, and prenatal or preimplantation genetic testing
is offered. Genetic tests: genomic DNA extracted from
peripheral blood then amplified by PCR is the usual staiiiny
material for CFTR mutation analysi.s. Most laboratories search
only a limited numlicr of known (common) mutations (from 30
to 100. including the three common alleles at the Tn site) by
using commercially available mutation detection kits. (Girodon
et ill.. 2000). A few laboratories have developed scanning
techniques that are able to detect any subtle sequence
anomaly in the coding sequence. Genomic DNA scanning of
CFTR gene is considered a 'htgh-comple.vily' test, as exons
with their intron boundaries have to be amplified and
analysed. Whole-gene scanning methods include SSCP
(single strand conformation analysis). DGGE (denaturing
gradient gel eleetrophore.sis) and DHPLC (denaturing high
87«
performance liquid chromatography). These methods rely on
DNA conformation changes or heteroduplex formation of Ihe
PCR product if the sample is different from the wild-lype
control DNA. If an alteration is detected, the corresponding
portion of the gene is .sequenced to confirm and identify the
sequence change. The reported sensitivity of these methods
ranges from 75-80'/f (SSCP) to 95-9ii9r (DGGE. DHPLC).
Most CBAVD inulations are not detected by routine
panels designed for common CF mutations: in a sample of
800 French men with CBAVD without renal agenesis, testing
for the 50 most eommon mutations associated with the
classic CF phenotype CCF" panel) in addition to assessment
for 1VS8-.ST (allelc .'iT in the intervening .sequence or intron
8) detected 959 of 1600 (60%) CBAVD alleles. wiih two
mutations in 47%, one in 24%, and no mutation in 29% of
CBAVD patients. In a subset of 327 CBAVD men who were
more extensively re-analysed by using a scanning method
(DGGE) that delects unknown mutations scattered all over
the gene, 516 of 654 {19%) alleles were identified, with 71
and 16% of patients carrying two mutations or one
respectively, and only 13% remaining with out any
detectable CFTR abnormality. Of 137 mutations identil'ied in
this sample. 105 (76%) would have been missed by using a
kit detecting only the 31 mo.st common mutations found in
the European population affected with cy.stic fibrosis in
addition to the 5T allele (Claustres et al.. 2000).

TG T M470V
• T
....TCTCTGTGTGTGTG..T 1TTTJ ex 9 ex 10

5T
AF508

5T
11
5
M
10
9
M
AF
u
m
AF508
•
CBAVD
M V codon 470
AF - c mutation
•
CBA VD
Figure II. A highernumberofTG repeats is predictive of a pathogenic 5T allele. The individual with CBAVD presents the same
mutation genotype as his fertile father (F508del (/( rrans with a 5T allete). However, further investigation of the familial
.segregation of CFTR polymorphisms reveals that he has inherited from his mother a 5T-hap!otype different from the one he has
inherited from his father. Haplotype TG 12-5T is more detrimental than haplotype TG 11 -'Y5.

disease by interfering with .splicing signals, causing some
degree of mis-splicing of the gene (Sleiner e! til., 2004). Up
to 80-877f of men with isolated CBAVD have at least one
CFFR mutation (Anguianof7fl/.. 1992; Putrizio c/fl/.. 1993:
Oates and Amos. 1994; Mercier et iiL. 1995; Dork el al.,
1997; Clauslres el al.. 2000). The inability to identify a
CFTR mutation in a fraction (I3-20'?f) of CBAVD males
without renal abnormality, even after the entire coding
region ofthe C/-7'/f gene is analysed, could indicate a failure
lo detect ali possible CFTR mutations, as the techniques
based on genomic DNA scanning do not detect deep
mutations wiihin the introns or large deletions ofthe gene.
As in CF, the analysis of mature mRNA could reveal the
presence of splicing anomalies or complex gene
rearrangements (Audrezet a al.. 2004). However, it is
unlikely that so many CBAVD alleles be caused by such
mutations. Alternatively, these cases might represent a
distinct clinical aetiology perhaps due to the involvement of
other gene (.s).
Genetic counselling
CBAVD males and reproduction
The failure to reproduce for men with CBAVD is thought to
be primarily due to the lack of normal anatomic transport
(because of absent vas deferens) of spermatozoa from the
testes. Most patients with CBAVD have normal or
subnormal spermatogenesis, and as the caput portion of Ihe
epididymis is invariably present, microsurgical .sperm
retrieval can be undertaken from the epididymis to allow
men with azoospermia to father their t)wn biological
children. The first pregnancy for a couple in whom the man
had CBAVD was reported in 1987 (Silber ef al.. 1988). The
initial IVF cycles yielded poor oocyte fertilization rates.
Since 1993, couples have been offered intracytoplasmic
sperm injection (ICSI. in which a single sperm is injected
into the cytoplasm of a mature oocyte lo obtain a viable
embryo) with a considerably improved outlook, resulting in
many pregnancies with live births (Tournaye ef a!.. 1994:
Silber el al.. 1995). Although lower fertilization (Patrizio ei
al.. 1993) or embryo implantation {Hirsh et al., 1994) rates
have occasionally been reported in couples with CBAVD.
the presence of CFTR mutations in men with CBAVD does
not seem to affect sperm function during IVF with
micromanipulation (Schlegel el al.. 1995; Silber ei at..
1995). The chanee of conception has been estimated as
about 3K'f- per cycle with a 'take-home-baby-rate' of 23%
(Silber el al.. [99()b). A recent meta-:inalysis ofthe outcome
of ICSI showed that outcome is not affected by whether the
retrieved spermatozoon is fresh, frozen, epididymal or
testicular, but suggested a trend to lower fertilization rate and
higher miscarriage rate in CBAVD-CFTR than acquired
causes of obstmctive a/oospermia (Nicopoutlos e! al.. 2004).
The first successful PGD performed for a couple with
CBAVD. where both partners were heterozygous for mutation
F50Sdel. was reported by Liu el al. (1994): three carrier
embryos were transferred and a healthy boy was bom. The
presence of CF or CBAVD mutations in Ihe male partner does
n{)t appear so far to significantly compromise in-vitro (K)cyte
fertilization, embryo implantation rates, or the successful
delivery of asymptomatic children after PGD (McCallum ei
al.. 2000; Phillipson ef al.. 2000).
Symposium - Molecular pathology of the CFTR locus • M Cluusins
Risk of CF, CBAVD or CFTR-opathies for
offspring
For a couple with CBAVD associated with CFTR defects,
planning to have their own genetic children, the risk for both
male and female offspring to have CF or related diseases and
for male offspring to have CBAVD depends on whether or nol
the female partner is a carrier, since one mutated allele will
always be inherited from the male. As the carrier frequency of
CFTR mutations in many Caucasian populations is in the order
of 1/22-1/30. it is highly recommended ihat genelic testing for
CFTR mutations be offered to the couple prior to ICSI. The
genetic counsellor should determine whether lliere is a family
history of CF and the couple's ethnicity, as this wili affect their
carrier risk. The genetic of CBAVD is more complex than in
CF. as (i) genetic analysis is able to prove but not lu exclude
the diagnosis of a genital ft)rm of CF. and (ii) the risk of CF or
CBAVD in the offspring may be. unpredictable when rare
mutations are identified in the male or the female. The couple
should be informed thai the lest cannot detect all mutations
within the gene; therefore, a negative mutation screen reduces.
but does nol eliminate, the risk of being a carrier (Figure 12).
The most plausible phent)types supposed to result from
combinations of CFTR mutant alleles in CBAVD males and
their partners have been described (Lissens ef al.. 1996). If
both male and female carry a severe mutation, ihen ihe risk of
a child with a severe CF is 1/4. bul there is also an additional
1/4 risk of 'mild' CF or CBAVD conferred by the inheritance
ofthe severe mutation ofthe female and the mild ofthe male.
If the CBAVD male is a carrier of one severe mutalion. and his
partner screens negative, ihen the risk of having a CF child can
be calculated as 1/964 (0.1%) if the sensitivity of the lest is
90% [tbi.s risk would increase up to 1/324 (0.3%) if the test
detects only 70% of mutations in the ethnic background of ihe
partner]. While these couples are al increased risk over ihe
general untested population, they are not suitable candidates
for prenatal diagnosis. A proportion of heterozygote females
will be missed by using only a C\- niuiaiion panel: on the other
hand, using a scanning melhod cannot be offered in all couples
and may introduce new dilemmas for genetic counselling, by
identifying previously uncharacterized .sequence alteration.s.
the clinical significance of which is unclear. Some
combinations of CFTR mutations or variations in the couple
imply an impossible prediction of the phenotypic
consequences for their offspring: a rare missense mutation
combined with a severe CF mutation may result in either a
normal phenotype. or CBAVD or even CF. Furthennore,
incomplete penetrance of CFTR mutation combinations may
lower the risk of having a child with CBAVD w CFTR-
opathies for couples undergoing sperm retrieval and ICSI. In
most countries, the risk of CF is the only one that i.s ethically
sufficient lo justify assisted reproductitm and treatment by
prenatal diagnosis (PND. performed on DNA extracted fR)ni
chorionic villuj. sampling or amniotic tluid puncture) or PGD.
Because these couples have to undergo assisted reproduction.
PGD seems an advantage over PND. as Ihe genetic status of
the embryos obtained after ICSI with epididymal spermatozoa
can be assessed for CFTK mutations before they are replaced
in the uterus. PGD is usually performed to avoid the transfer of
embryos carrying two severe mutations (Liu et at.. 1994).
although it may also be performed to avoid the transfer of
embryos carrying combinations tor which il is impossible to
Symposium - Molecular pathology of the CFTR locus - M Ctaustres

Mali* v> ith CBAVD Fcmule partmr OfTsprint; gcnuiype (MTspiing Phcnot>pcs(c5Unuitedrisks)

1 sewere/l mild I scwrc/I normal 1/4 scvcrc/scwrc # 25% CF-Pf

IM scwrc/nomial or 1/4 mildirtormal 4 Si)% no disease
1/4 niild/scwrc • 25V. CBA\D.CF-RS, nodisca.se, other?

I scvcre/l mild) negative

(detection rate 90%) 1/4 scvcre/Z i> 25% Z'4
(Z= 1/241) 1/4 severe/normal or 1/4 mtld/normaj 4 50% normal phenotype
• 25% Z/4 X pcncirancc
nskofCT =1/964

Figure 12. Risk Ciilculiilion and phenotype prediction (risk is calculated with un assumption iif a CF carrier fretjuency of 1 in 25).
(i) Female partner is iiegaiive Ibr Ihe lesi: ihe residual risk Tor a panner from the general population of being a carrier after a
negative screening for a fraction u of CFTR mutations in her ethnic background will hcZ = q(t - a)/(I - aq). with </ the prior
carrier risk (ten Kate. 1990). The risk for this couple for having a CF child is calculated as follows: I (he carries a severe mutation)
X I/24I (her test is negative. '^W< sensitivity) x 1/4 = 1/964. (ii) Female partner is a CF carrier: in this case, the inheritance will
follow classical Mendelian rules for autosomal recessive inheritance, and lhe couple has a one in four risk for having a child
affected with CF. Background information on calculation above: Because CF is an autosomal recessive di.sorder, individuals who
are heterozygous carriers (frequency around 1/25 in Caucasian populations) are not clinically distinguishable from individuals
with two normal alleles. The Hardy-Wei nberg law states that the sum of the normal allele frequency (p) and the mutant allele
frequency dy) equals \ [p + q ~ I). Since the frequency of the CF disease (individuals with two mutant CF alleles) in the
population is known (y- = 112500). the mutant allele frequency, which is the square root of the CF disease frequency, is <:/ = 1 in
50 or0.02. Therefore, the CFTR carrier frequency, which is defined as 2pq. is 0.039 (2 x 49/50 x 1/50). The probability fora man
to inherit both the .^T alleie from one parent and a CFTR gene mutation from the other parent is 1 in 4 or 25'?'f. Therefore, it can
he estimated that approximately one male in 1666 should have a CBAVD due to inheritance of a 5T allele in tram of a CF
mutation 10.102 (5T carrier frequeney) x 0.04 (CFTR carrier frequency) x 0.25 (chance of inheriting both 5T allele and a
mutation) x 0.60 (penelrance ofthe 5T allele) = 0.06% (1/1666)1.

predict the phenotype (for instance, couples with only one
muiation detected in the CBAVD male and one or two
mutations present in the female) (Lissens. 1997; Phillipson vi
ill.. 2000). Methods for deteeting point mutations are
continuously improved, and, recently, two powerful
approaches have been demonstrated to detect mutation
F50Sdel at the single cell level, the dHPLC (denaturing high
pertormanee liquid chromatography; Girardet ei at.. 2003) and
the microarray technology (Salvado fl at.. 2003). A major
advantage of the microarray approach is that it will allow
testing for the relevant mutations and. simultaneously,
monitoring for the two main technical difnculties in PGD.
ADO (allele drop-oul) and contamination through the
detection of SNP that are linked to disea.se-speciFic mutations.
The elinical examination and follow-up of children bom to
couples with CBAVD will be essential to understand the
variable phenotypic expression of CF gene inutations.
particularly in cases of homozygosity for the 5T allele or
compound heterozygosity for a severe mutation and the 5T
allele or a .severe mutation and R1I7H-7T.
The identification of CFTR mutations in a CBAVD male has
imponant implications nol only for himself but also for his
family. Healthy siblings of a CBAVD male have a 509r chance
of being CF carriers. The possibility of testing and counselling
should also be offered to family members, who should be
informed about their increased risk of having CF children if
they have inherited a CF mutation and their partner Is also a
carrier.
If no mutation is found in the male, the presence of an
undetected mutation cannot be definitely excluded but the risk
for a CF cliild is probably lower than 1/1000. It is important to
know if the CBAVD patient has brothers with or without
CBAVD. as the study of familial segregation of CFTR
polymorphisms could also contribute to the discrimination of
CFTR-linked and unlinked conditions of CBAVD.
In couples with male infertility not related to CF. the risk of
having children with CF is not different from the risk lor
couples in the general population. The risk of infertility in their
male offspring is unknown.
In conclusion, even with the cunent stale of knowledge,
genetic counselling of couples with CBAVD remains very
difficult. It is time to initiate collaborative studies to update
data on the distribution and frequency of CFTR mutants and
variants that have been found after exhaustive screening of
both CBAVD patients and their partner, and to determine their
prevalence in the general population of differenl ethnic groups.
Risk assessment is an essential component of genetic
counselling and testing, and we need consensus risk
calculations thai are adequate in the context of particular
CBAVD clinical scenarios encountered in genetics practice.
These calculations should take into account not only CFTR
geneiies but also relevant Information resulting from clinieal
and bioeleclrie data specific to CBAVD patients. We also need
consensus guidelines for the number of mutations and/or the
extent of CFTR genetic analysis to be performed, as well as the
choice in PND versus PGD to be offered to CBAVD eouples.

References
Akabas MH 2()00 Cystic fibrosis transmembrane conductance
regulator. Siructure and function of an epithelial chloride channel.
Jourmil of Bioloi-iciil Chcmislry 275. 3724-1732.
Anguiano A. Outes RD. Amos J A el til. 1 y<J2 Congeniml biiaier.il
ubsence of the vos dei'erens. A primarily genital form of cystic
fibrosis. Journal of The Amfrictin Medical As.wciation 267.
Anzai C. M<imfc;iw;i N. Okada 11 et ni. 2()C)3 CFTR gene mutations
in Japanese indiviijual.s wilh congenital biliiEcral absence of the
va.s deferens. Jourmil of Cystic Fihro.us 2. 14-18.
Audrezet MP, Chen JM, Raguenes O et al. 2004 Genomic
rearranaenienls in ihe CFTR gene: extensive allelic hcierogeneity
and diverse mulalionai mechanisms, litinum Mutation 23.
.^3-35 7.
Augarten A. Yahav Y. Kerem BS c/ tii. 1994 Congeniial bilateral
absence of vas deferens in the absence of cystic fibrosis. Umcet
344. 147.1-1474.
Bien venu T. Adjiman M.Thiounn N et ul. mQ7 Molecular diagnosis
of congenital bilait-ral absence of ihe vas deferens: analyses of
the CFTR gene in f>4 French palients. Annals of Human Genetics
40.5-9.
Black LD. Nudeil DM. Cha I ei til. 2(XK) Compound genetic factors
as a cause of male infertility: case repon. Hiimmi Rcprodmiion
IS. 449^31.
Blau H. Freud E, Mussaffi H ff al. 2002 Lrrogenital abnormalities in
male children with cystic fibrosLs. Archives of Disease in
Childhood %1, 135-138.
Boucher D.Creveaux I.Grizard G ei al. 1999 Screening for cystic
fibrosis iransmembrane conductance regulator gene mulations in
men included in an inlracyloplasmic sperm injection programme.
Molecular Human Repriniuciion 5. 3S7-5*J3.
Boyle MP 200.1 Nonclassic cyslic tibrosis and CFTR-related
diseases. Current Opiniim in Pulmonary Medicine 9.498-503.
Bremer S, Hoof T. Wilke M ft al. 1992 Qnanlilalive expre.ssion
patterns of miillidmg-resisiance P-glycoprok*in (MDR I) anil
differentially spliced cyslic-fibrosis transmembrane-conductance
regulalor mRN.-\ iranscripis in human epilhelia. European
Journal of Biochemi.stry 206. 137-149.
Broackes-Caner FC. Williams SH. Wong PL et at. 2(.H.i3 Alternative
splicing or the ovine CFTR gene. Maininatian Genome 14,
778-787.
Biiralti E. Baralle FE 2001 Characicri/alion and functional
implications of the RNA binding properties of nuclear factor
TDP-43. a novel splicing regulator of CFTR exon 9. Journal of
Biohfiical Chemistry lift. 36337-36343.
Buratti E. Dork T. Ziiccato E ei al. 2tX) 1 Nuclear factor TDP-43 and
SR pnneins promote in vitro and in vivo CFTR exon 9 skipping.
EMBO Jouniii! 20. 1774-17K4.
Buratti E. Brindisi A. Pagani F. Baralle FE 2(K)4 Nuclear factor TDP-
43 binds to the polymorphic TG repeats in CFTR intron 8 and
causes skipping of exon 9: a functional iink with disease
penetrance. American Journal of Human Genetics 74.
1322-1325.
Casals T, Bassas L. Ruiz-Romero J ei al. 1995 Extensive analysis of
40 infertile patients with congeniial absence of the vas deferens:
in 50*!^: of cases only one CFTR iillele coukl lie delected. Human
Generics95. 2{)5-2'n.
Casals T. Bassas L. Egozcue S et al. 2000 Heterogeneity for
mutalions in Ihe CFTR gene and clinical correlations in patients
with congenital absence of ihe vas deferens. Human
Reproduction 15. 1476-1483.
Casals T. De-Gracia J. Gallego M et al. 2004 Bronchieclasis in adult
patients: an expression of hetero/ygosily for CFTR gene
mutalions? Clinical Genetics 65. 490—495.
Castellani C. Bonizzato A. Pradal U et al. 1999 Evidence of mild
respiratory disease in men with congenital absence of ihe vas
deferens. Respiratory Medicine 93. 869-875.
Casteliani C. Gomez Lira M. Fruiloni L c/«/. 2(K)I Analysis of the
entire coiling region of the cystic fibrosis transmembrane
Symposium - Molecular pathology of the CFTR locus - M Clau.stres
regulator gene in idiopathic pancreatitis. Human Mutation 18,
166.
Cheung KH. Leung CT. Leung GP. Wong PY 2003 Synergistic
effecis of cystic fibrosis transmembrane conductance regulator
and aquaporin-*) in the rat epidiilymis. Biolui^y of Reproduction
68.1505-1510.
Chillon M. Casals T. Mercier B et al. 1995 Mulations in the cystic
fibrosis geno in patienis wilh congenital absence of the vas
deferens. New Itni^lancl Journal oj Medicine 332. 1475-1480.
Choi JY. Lee MG. Ko S. Muallem S 2001 Cl -dependeni HCO3-
iransport by cystic flbrosls Iransmembranc conductance i-egulaior.
Journal of the Pancreas 2. 243-246.
Chu CS. Trapnell BC. Munagh JJ Jr et al. 1991 Variable deletion of
exon 9 coding sequences in cyslic fibrosis transmembrane
conduclance regulalor gene mRNA iranscripis in normal
bronchial epithelium. EMHO Journal 10. 1355-1363.
Chu CS. Trapnell BC.Currisiin SM c/w/. 1992 Extensive
postlranscriptional deletion of Ihe coding sequences for part of
nudeotide-bind ing fold I in respiratory epithelial mRNA
transcripts of the cystic fibrosis iransmembrane conductance
regulator gene is not associated with the clinical manifestations of
cystic fibrosis. Journal of Clinical Investii^aiion 90, 785-790.
Chu CS,Trapnell BC.Ctirristin S etal. 1993 Genetic basis of
variable exon 9 skipping in cy.stic tibrosis transmembrane
conductance regulator mRNA. Nature Genetics 3, 151-156.
Clauslres M.Guillard C. Bo/on D :(HK) Spectrum of CFTR
mutations in cyslic ("ibrosis and in congenital absence of ihe vas
deferens in France. Human Mutation 16, 143-156.
Claustres M. Altieri JP. Guittard C et al. 2(H)4 Are p.! 148T. p.R74W
and p.DI 270N cystic fibrosis causing mutalions? BMC Medieal
Genetics 5. 19-24.
Costes B, Girodon E. Ghanem N et al. 1995 F-Ycquenl ix'currence of
the CFTR iniron 8 (TG)n 5T allele in men with congenital
bilateral absence of ihe vas deferens. European Journal of Human
Ccm'/it.v 3. 285-293.
Culard JF. Desgeorges M, Costa P et al. 1994 Analysis of the whole
CFTR coding regions and splice junctions in azoospermic men
with congenital bilateral aplasia of epididymis w vas deferens.
Human Genetics 93. 4()7—470.
Cuppens H. Lin W. J;ispers M et al. 199S Polyvariani muiani cystic
Hbrosis Iransmembrane conductance regulalor genes. The
polymorphic (Tgtm locus explains ihe pariial [jenetrance of the
T5 polymorphism as a disease mutation. Jounuil of Clinical
Investif-ation 101.487-496.
Cystic Fibrosis Mutation Database 2(HJ4 Available al
http://www.genet.sickkids.on.ca/cftr [accesseJ 23 November
20041.
Danziger KL. Black LD. Keiles SB et al. 2(H)4 Improved detection
of cystic (Ibrosis mtitations in infertility paiienis with DNA
sequence analysis. Human Reproduction 19. 540-546.
Davis PB, Drumm M. Konstan MW 1996 Cystic llbiosis. Americtm
Journal of Respiratory and Critical Care Medicine 154.
1229-1256.
Dayangac D. Brdcm H. Yilma/ E et al. 2004 Mutations of the CFTR
gene in Turkish paiienis wilh congeniial bilateral absence of ihe
vSiS, dc\'cfcn->^. Human Reproduction 19. 1094-1100.
De Braekeleer M. Ferec C 1996 Mutations in Ihe cyslic Tibrosis gene
in men wiih congenital bilateral absence of the va,s deferens.
Molecular Human Reproduction 2. 669-677.
Delaney SJ. Rich DP. Thomson SA et al. 1993 Cystic fibrosis
iransmembrane conduclance regulalor splice variants are not
conserved and fail 10 pnxiuce chloride channels. Nature Geneties
4,426-431.
de la Taille A. RigotJM.MaheP £•/«/. 1998 Correlalion beiween
gen ito-urinary anomalies, semen analysis anil CFTR genotype in
patients with congenital bilateral absence of Ihe vas deferens.
British Journal of Urology 81. 614-619.
de Meeus A. Guiltard C. Desgeorges M et al. 1998a Geneiic findings
in congeniial bilaleral aplasia of vas deferens palients and
identification of six novel mutaiaiions. Human Mutation I I .
480^85.
Sympcsium - Molecuiar palhology of the CFTR locus - M Claitstres
tk- Meeus A, Guillard C. Desgeorgcs M cl al. 1998b Linkage
disequilibriutn lietwecn the M47()V viiriani and the IVS8 polyT
alleles of Ihe CFTR geno in CBAVD. Jounuil of Medical
Disscl A. Michol C. H;irris A el ul. ICAH A T3 ailele in ihe CFTR
gene exacerbates exoii 9 skipping in va.-. deferens and (."pididymal
cell lines and is iissDcialed wiih congcnilal hilateral absence of
vas dcfcrens (CBAVDI. Hiiimm Muiiiiion. in press.
Dohle OR. Hallcy DJ. Van Homel JO ei al. imi Genelic risk Taciors
in inlerlile men with SCVLTC olijjo/oospermia and azoospermia.
Human Reimhliiciion 17, 1.1-16.
Donohuc RE. Fauver HE 1989 Unilaleral absence of ihe vas
deferens. \ useful clinical sign. Journal of the American Medical
A.s.wciiiiion 261. I1S0-1IK2.
Dork T. Dwomiczak B. Aulehla-Scholz C t'l al. 1997 Distinct
spectrum of CFTR gene muEaiions in congenital absence of vas
deferens. Human Gcneiiis 100. 365-377.
DorkT. Glascr D.Smhnnann M £'f«/. 2tH)l Novel, rare splice site
variants of 1VS8 in the cystic tlbrosis gene. European Jouinol of
Human Genetics 9 (Suppl. I). 405.
Drouineaud V. Sago! P. Faivrc I. ei al. 21)0.1 Binh afler
intracyiopliisniit" injeciinn of epididymal speim fnim a man with
congenital bilateral absence of Ihe vas deferens who had a
robertsonian traiisliK-alion. Ft'rtiliiy ami Slerility 79 (Suppl. 3),
1649-1651.
Dubin L. Amelar RD 1'->7I Eliologic factors in 1294 conseculive
cases of male infenilily. Feriitily and .Sleriliry 11.469^74.
Dumur V. Gervais R. Rigot JM et at. 1990 Abnormal distribution of
CF delia F5()8 allele in azoospermic men with congenital aplasia
of epididymis and vas deferens. Umcel iif>. 512.
Durie PR 1998 Pancreatitis and mutations ofthe cystic fibrosis gene.
.Veil' EnKhuui Jotirnal of Meiliciru- 339. 6H7-68X.
Durieu I. Bey-Omar F, Rollel J cr al. 1995 Diagnostic erileria for
cystic Hbrosis in men with congenital absence ofthe vas
deferens. Medicine 74.42—17.
Ellsworth RF., .laniison DC, Toiichman JW vi til. 2(KHI Comparative
genomic sequenee analysis of Ihe human and mouse cyslic
dbrosis transmembrane conductance regulator genes. Proceedini^.s
of tin- Natiomil .Xcailemy af Sciences of the USA 97. 1 172- 1177.
Estivill X 19% Complexity in a monogenic disease. Naiure Geneiics
12.348-350.
Evans JI', Florman IIM 20(12 The state of the union: the cell biology
of fertilization. Nature Medicine 8. S57-fi3.
Faustino N A. Cooper TA 2(H)3 Pre-mRNA splicing and human
disease. Genes and Dfvclopmeni 17.419-437.
Fokstuen S. Hobi C. Balakrishnun J c/ al. KHK) Homozygosity of the
cystic fibrosis )CF( gene allele IVS8-(5T) in a Tamil male with
congenital bilateral absence of the vas lieferens (CBAVD).
Molecular Hunum Reproduction 6. 669-670.
Friedman KJ. Heim RA. Knowles MR. W ul 1997 Rapid
characterisation of the variable length polyihyminc tract in ihe
cystic nbrosisjCFTR) gene: asswiation ofthe I VS8-.ST allele
with selected CFTR muiations and ils incidence in atypical
sinopulmonary ijisea.se. Human Mutation 10, lOS-l 15.
Fulmer SB, Schwjebeii EM. Morales MM ci al. 1995 Two cystic
tlbrosis iransnienibrane conductance regulator mutations have
different effects on both pulmonary phenotype and regulation of
outwardly reclilled chloride currents. Proceedint-s of ihc Natioruil
Academy of Sciences of ihe USA 92. 68.12-6836.
Gabriel SE. Brigman KN. Koller BH ft at. 1994 Cystic llbrosis
hetero/ygole resistance to cholera toxin in the cystie fibrosis
mouse model. Science 1. 107-109.
Gaillard DA. Carre-Pigeon F, Laliemand A 1997 Normal vas
deferens in fetuses with cystic llbrosis. .louriutl of Urology 158,
Gelman MS, Kopitu RR 2003 Cystic fibrosis: premalure degradation
of mulanl proteins as a molecular disease mechanism. Methods iti
Molecular liiolouy 232. 27-37.
Gervais R. Dumur V\ Rigot JM *•/ al. 1993 High frequency of the
Rl I7H cystic fibrosis mutations in palients wiih congenital
absence of the vas deferens. New Enf^land Jmirnal of Medicine
328,328-329.
Gilljam M. Moltyaner Y, Downey Q? ei al. 2004 Airway
intlammation and infection in congenital bilateral absence o\ tlic
vas deferens. American Journal of Hi-spiralory ami Critical Care
Medicine 169, 174-179.
Girardet A, Calhala P. Claustres 2003 Rapid deleclion of the
deitaF5O8 mutation in sitigic cells using DHPLC: implications for
preimplantation genelic diagnosis. Jourmil of Assi.\fed
Rc/iroduclion and Genetics 20. 153-1.^6,
Girodon-Boulandcl F,.Ca/eneuve CGoossens M 2000 Screening
practices for [nutations in the CFTR gene .\BCC7. Human
Muiiili.'ii 15. 1.15-14').
Girodon E, Sternberg D. Chazouilleres O el al. 2tHI2 Cystic fibrosis
transmembvane conductance regulator (CFTR) gene defects in
palients with primary sclerosing cholangitis. .loiirnal of
Hepiilolof-y37.\92-\91.
Goldstein M, Schlossberg S 1988 Men with congenital absence of
the vas deferens often have seminal vesicles. Journal of Urology
140.85-86.
Gong XD, Li JC. Cheung KH ei al. 2fK) I Expression of the cystic
fibrosis transmembrane condticlance regulafor in rat spermatids:
implication for ihe siie of action of aniispermaiogenic agents.
Molecular Human Reproduction 7. 705-713.
Gottlieb C. Ploen 1.. Kvist U. Strandvik B 1991 The fertility potential
of male cystic fibrosis patients. International Jotirmil of
Androhf-y 14, 437-440.
Groman JD, Hefferon TW, Casals T ff al. 2(XW Variation in a repeat
sequence determines whether a common variant of the cystic
fibrosis transmembrane conductance regulator gene is pathogenic
or benign. American Journal of Human Genetics 74. I Hy-179.
Haardt M. Benharouga M. Lechardeur D et al. 1999 C-terminal
iruneations destabilize the cystic tlbrosis Iransmembrane
conductance regulator without impairing its biogenesis. A novel
class of mutation. Journal of liiological Chemistry 274.
21873-21877.
Hall S. Oates RD 1993 Linilateral absence of ihescnital vas deferens
associated with conlralaterai mesonephric duel anomalies
resulting in infertility: laboratory, physical and radiographic
findings, and iherapeutic aliematives. Journal of UroloKy ISO.
1161-1164.
Harris A.Coleman L 1989 Ductal epithelial cells cultured from
human fi>etal epididymis and vas deferens: relevance to sterility
in cystie fibrosis. Journal of Cell Science 92. 687-690,
Hayslip CC. Hao E, Usala SJ 1997 The eystie fibrosis
iransmembrane regulator gene is expressed in the human
endtK-ervix ihn)ughoul the menstrual cycle. Fertility and Sterility
67. 636-(>40.
Hcffenn TW, Broackes-Cartcr FC. Harris A. Cutting GR 2002
Atypical 5' splice sites cause CFTR exon 9 to be vulnerable to
skipping. .American Journal of Human Geneiics 71. 294-30.1.
Hefferon TW, Groman JD. Yurk CE. Cutting GR 2004 A variable
dinueleotide repeal in the CFTR gene contributes to pbenotype
diversity by forming RNA secondary structures that alter splicing.
Proceedinfi.-. of the National .'\cadi-my ol .Sciences of the United
Stales of America 101, 3504-3509.
Hirsh AV. Mills C, Bekir J. <•( ul. 1994 Factors inlluencing the
outcome of in-vitro fertilization wiih epididymal spermatozoa in
irreversible obstructive azoospermia. Human Reproduction 9,
1710-1716.
Holsclaw DS, Perlnuitter AD. Jockin H,Shwachman H 1971 Genital
abnormalities in male patienis with cystic fibrosis. Journal of
Urology 106, .=^68-574.
Hug MJ. Tamada T. Bridges RJ 2003 CFTR and bicarbonate
secretion by epithelial eells. News in Pliysiofikal Sciences 18.
38-12.
Hull J, Shackieton S. Harris A 1994 Analysis of muiaiions and
alternative splicing paitems in ihe CFTR gene using mRNA
derived from nasal epithelial cells. Human Molecular Genetics 3,
1141-1146.
Jarvi K, Zielenski J. Wilschanski M et til. 1995 Cystic fibrosis
transmembrane conductance regulator and obstructive

Li/;oaspcrmia- tjincet 345, 1578.
Jcquicr A M 198.^ Obstructive a/.oospermia: a study ol' 102 patient.s.
Clinical Reproduction atid Fertility 3, 21-36.
Kaplan E, Shwuchman H. Perlmutter A D et al. 1968 Reproductive
failure in m;iles with cystii.- Hhrosis. yVpM' England Journal of
Medicine 279, 63-69.
Kaplan N L . Lewis PO. Weir BS 1994 Age ofthe delta F5O8 cyslic
I'ibmsis miitaiion. .Mature Genetics 8. 216-218.
Kerem E. Kereni B 199f)a Gcnotypc-phetinlype correlations in oyslif
fibrosis. Pediairic Puhmmolofiy 22, 3X7-395.
Kerem B. Kerem E 1996b The molecular basis for disea.sc variability
in cyslic fibrosis. European Journal of Htiman Genetics 4. 65-73.
Kerem BS. Rommens J M , Buchanan JA et al. 1989 Identification of
the cystic fibmsis gene: getietie analysis, Seienie 245,
1073-1080.
Kie.sewelter S. Macek M Jr, Davis C ff al. 1993 A mutation in CFTR
produces different phenotypes depending on chromosomal
background. Nature Genetics 5. 27-1—27H.
Kolettis PN. Sandlow JI 2002 Clinical and genetic features of
patients wiili congeniial unilateral absence of ihe vas deferens.
Urology (M. 1073-1076.
Kristidis P. Bo/on D. Corey M et al. 1992 Genetic detetmination of
exocrine panerealic function in cystic fibrosis. American Journal
n/Hutnan Genetics 50. 117S-1184.
Larriba S. Bas.sas L. Gimenez J cl al. 1998 Teslicular CFTR splice
variants in palients with congenital absence of the vas deforens.
Human Molecular Geneties 7, 1739-1743.
Larriba S. Bassas L. Egozcue S et al. 2001 Adenosine triphosphate-
binding cassette supertamily transporter gene expression in
severe male infertility, liiology of Reproduction 65. 394-4(Kt.
Le Lannou D. JezequcI P. Blayau M et al. 1995 Obstructive
azoospermia with agenesis of vas deferens or with bronchieetasia
(Young's syndrome): a genetic approach. Human Reproduction
10.338-341.
Li,ssens W, Liebaers I 1997 The genetics of male infertihty in relation
[o cystic fibrosis. Bailliere's Clinical Obstetrics and Gynaecology
11.797-817.
Lissens W, Mercier B. Touniaye H ei al. 1996 Cyslic Hbrosis and
inlenility caused by congenital bilaleral absence of the vas
deferens and related clinical eniilies. Human Reprodmiion 4.
55-78; discussion 79-HO.
Lissens W. Mahmnud KZ. Bl-Gindi t et al. 1999 Molecular analysis
of ihe cyslic Hbrosis gene reveals a high frequency of Ihe iniron 8
spliee variant 5T in Egyptian males with congenital bilateral
absence of the vas deferens. Molecular Htitnan Reprnduction 5.
Liu J. Lissens W. Silber SJ ei al. 1994 Birlh after preimpluntalion
diagnosis of the cystic fibrosis delta F508 mutaiion by
polymerase chain reaction in human embryos resulling from
iniracyioplasmic spenn injection with epididymal sperm. Jourtial
ofthe .American Medieal Association 272. 1858-1860.
Liu HX, Cartegni L, Zhang MQ. Krainer AR 2001 A mechanism for
exon skipping caused by nonsense t)r missense mutalions in
BRCAI and other genes. Nature Genetics 21. 55-58.
Mak V. Jarvi K A . Zielenski J et al. 1997 Higher proponion of intact
exon 9 CFTR mRNA in nasal epithelium compared wiih vas
deferens. Human Molecular Gem-tirs 6. 2099-2107.
Mak V, Zielenski J.Tsui LC et al. 1999 Proportion ofcystie fibrosis
gene mutations not detecied by rouiine tesiing in men wilh
obstructive azoosperinia. Journal of ihe American Medical
A.ssociation 281, 2217-2224.
Martin RA. Lyons Jones K. Downey EC 1992 Congenital absence of
the vas deferens: recurrence in a family. American Journal of
Medical Genetics 42.,!\4-7\5.
McCallumTJ.MilunskyJM, Cunningham DL cf (W. 20IKI Fenility in
men with cyslic fibrosis: an update on curreni surgical practices
and outcomes. Clie.u US. 1059-1062.
McCallum T. Milunsky J, Munarri/ R et at. 2(H)l Unilateral renal
agenesis associated with congenital bilateral absence of the vas
deferens: phenolypic findings and genetic considcraiions. Human
Reprodtution 16. 282-288.
Symposium - Molecular pathology of Ihe CFTR locus - M Claustres
Meng MV, Black L D , Cha I ei al. 2001 Impaired sjiermatogenesis in
men with congenital absence of the vas deferens. Human
Reproduction 16.529-533.
Mercier B. Verlingue C. Lissens W el al. 1995 Is congenital bilateral
absence of vas deferens a primary form of cystic fibrosis?
Analyses of the CFTR gene in 67 patients. American Journal of
Human Getietics 56,112-211.
Meschede D. Dwomic/ak B. Behre H M cf al. 1997 CFTR gene
mutalions in men wilh bilaleral ejaculaiory-duct obstniclion and
anomalies of ihe seminal vesicles. American Journal oJ Human
Genetics6l. 1200-1202.
Meschede D. Dwomic/ak B. Niesciilag E. H I H M J 1998 Geneiic
diseases of ihe seminal ducts. Biomedicine and Pharmacotlierapy
52,197-203.
Mickle J, Cutting OR 2(KK) Genotype-phenotype relationships in
cystic fibrosis. Medical Clinics of North America S4, 597-607.
Mickle J, Milunsky A, Amos JA. Oates RD 1995 Congenital
unilateral absence of the vas deferens: a helemgeneous disorder
with two distinct subpopulations based upon aetiology and
niulational status of the cystic fibrosis gene. Human Reproduction
10. 1728-17.^5.
Morral N, Bertranpeiit J. Eslivill X et al. 1994 The origin of ihe
major cystic tibrosis mutation (della F508t in European
populations. Nature Genetics 7. 169-175.
Nicopotiilos JD. GiMing-Sniilh C, Almeida PA. Ramsay JW 20<)4 The
results of 154 ICSi cycles using surgic;iliy retrieved sperm from
azoospeiTnic men. Human Reproduction 19, 579-585.
Niksic M . Romano M, Buratli E et al. 1999 Functional analysis of
eis-acling elements regulating the altemalive splicing of human
CFTR exon 9. Human Molecular Genetics 8, 2339-2349.
Nissim-Rafinia M , Chiba-Faiek O, Sharon G t-t ol. 21HHI Cellular and
viral splicing factors can modify the splicing paitcm ol' CFTR
transcripts carrying splicing mutations. Human Molecular
Genetics9. 1771-1778.
Noone PG. Knowies MR 2(X)I "CFTR-opaihies : disease phenotypes
associated with cystic fibrosis transmembrane regulator gene
mutations. Re.spiratory Re.iearch 2. 328-332.
Noone PG. Pue CA. Zhou Z et al. 2(HH) Lung disease associuied wilh
the IVS8 5T ailele of the CFTR gene. American Journal of
Respiratory and Critical Care Medicine 162. 1919-1924.
Oales RD, Amos JA 1994 The genetic basis of congenital bilaleral
absence of ihe vas deferens and cyslic fibrosi^. Journal of
Andrology 15. 1-8.
Okada H, Yoshimura K, Fujioka H (7 al. 1999 Assisted reproduction
lechnology for palients with congenital bilaleral abseni-e of vas
iieicrens. Journal of Urolof-y 161, I [57-1162.
Online Mendelian Inheritance of Man ( O M I M ) 2004 Available at
http://www3.ncbi.nlm.nih.gov/0mim [accessed 23 November
20041.
Oppenheimer EH, Esterly JR 19A9 Observations on cystic llbrosis of
the pancreas. V, Developmental changes in the male genital
system. Journal of Pediatrics 75, 806-811.
Osbt>iTie LR. Lynch M , Middleton PG ft al. 1993 Nasal epithelial ion
transport and genetic analysis of infenile men wilh congenital
bilaleral absence of ihe vas deferens. Human Molecular Genetics
2. 1605-1609.
Pagani F, Buratli E, Stuani C et al. 2(X)() Splicing faclors induce
cystic fibrosis transmembrane regulalor extin 9 skipping through
a nonevolutionary conserved intronic element. Journal of
Biological Chemistry 275, 21041-21047.
Pagani F, Stuani C, Tzelis M et al. 2O0.^a New lype of disease
causing mulalions: the example of the composite exonic
regulalory elemenis of splicing in CFTR exon 12. Human
Molecular Genetics 12, 1111-1120.
Pagani F. Stuani C, Zuccato E et al. 2003b Promoter architecture
modulates CFTR exon 9 skipping. Journal tif Biological
Chemi.stry 27H. 1511-1517.
Pagani Y-. Buraiti E, Stuani C. Baralle FE 2(H)3c Missense, nonsense.
and neutrai mutations define juxlapt>sed regulatory elemenis of
splicing in cystic fibrosis transmembrane regulator exon 9.
Journal of Biological Chemistry 27K, 26580-26588.
Symposium - Molecular pathology of the CFTR locus - M Claustres
N. Carlos S, Dcs Georges M ,•; al. IWQ Complete
mututional screening of the cystic fihrosis Iransmembrane
conductance regulator gene: cystic fihrosi.-i mulatioiih arc not
involved in healthy men wilh reduced sperm quality. Hunuin
Repmdiiaiou 14. 30.^5-3(140.
Palrizio P. Leuiuird 0GB 2(HKt Mutations of the cystic Ilbrosis gene
and congenital iibsence ol' the vas deferens. Rt'stilis uiul Problems
in Cell Diffei-cmUuion 28. 175-lSft.
Patri/io P. Saliimeh WA IW8 Expression of Ihe cystic fibrosis
transmembrane condticlanct' regulator (CFTR) mRNA in normal
and pathological adult human epididymis. Jounuil uf
Reprixluction iiiul Fertility Supplement Si. 261-270.
Patrii^io P, Zie!enski J IW6 Congenital absence of the vas deferen.'*: a
mild form of cysiic fibrosis. Mulcnilur MedUine Today 2, 24—31,
Pairi/jo P. Asch RH. Mandolin B. Silber SJ 1993 Aetiology of
congenital absence of vas deferens; genetic study of three
generations, Human Reproduction 8, 215-220.
Phillipson G 199H Cystic Ilbrosis and reproduction. Rq'ioduaioii.
Fertility, and DeveUipmeiit 10. 1 1 3 - 1 1 9 .
Phillipson GT. Petrucco OM, Matthews CD 20()0 Congenital
bilateral absence ofthe vas Jeferons. cystic tibrosis mutation
analysis and intracytoplasmic sperm injection. Hiniuiii
Reproiltiftioii 15,431—43.'^.
Pradal U. Piaconlini GL 2004 Cystic fibrosis patient^^. infertile men.
and their noses. American Journal of Respiratory tind Critical
Care Medicine J69. 141-142.
Quinton PM 2001 The neglected ion: HCO3". Nature Medicine 7,
293.
Quin/.ii C Castellani C 2(KHI The cysiic Ilbrosis transmembrane
regulator gene and mate infertility, .lournal of Endociino^ical
Invc.stifiution 23. 6K4-689.
Ramos L. Wetzcls AMM, Hendricks JCM et cl 2(H)4 Percutaneous
epididymal sperm aspiration: a diagnostic tool for the prediction
of complete spermatogenesis. Reproductive BioMedicine Online
Rave-Harel N. Madgar I.Goshen R etal. 1995 CFTR haplotype
analysis reveals gcnoiic heteroj;encity in the etiology of
congenital bilateral aplasia of the vas deferens. American Journal
ofHiunan Genetics S6. 1.^59-1366.
Rave-Harel N. Kerem Ei. Nis.sim-Rafinia M et al. I9y7 The
molecular basis of partial })enetrani;e of splicing mutations in
cystic Tibrosi.s. .American Journal of Human Genetics 60. 87-94.
Ra\nik-Glavac M. Svetina N. Zorn B et al, 2001 involvement of
CFTR gene alterations in obstructive and nonobstructive
infertility in men. Genetic Te.stin); 5. 243-247.
Roddy MM. Quinton PM 200.3 Control ol' dynamic CFTR selectivity
by glutamate and ATP in epithelial cells. Nuiure 423. 756-760.
Riordan JR. Romnicns JM. Kerein B cf al. 1989 Identification of the
cystic tibrosis gene: cloning and characterization of
cojiiplemetitary ON A..Science 245. 1066-1073.
Robert T. Bey-Omar F. Rollet J ct at. 2002 Relation between the
anaiomical genital phenotype and cystic fibrosis iransmembranc
conductance regulator gene mutations in the absence of the vas
deferens. Fertility and Sterility 77. 88»)-S96.
Rwigers HC. Knox AJ. Toptis PJ. Thomlon SJ 2000 Successful
pregnancy and birth after IVF in a woman with cystic fibrosis.
Human Re/irodnctitm 15. 2152-2153.
Rommens JM. lannu//i MC. Kerem B et al. 1989 Idenlillcation of
the cystic Ilbrosis gene: chromosome walking and jumping.
Science 24S. 1059-1065.
Rosenstein BJ. Cutting GR 199S The diagnosis of cystic fibrosis: a
consensus statement. Cystic h'ibrosis l-'oundation Consensus
Panel. Journal ,if Peiliaincs 132. 589-595.
Rozmahel R, Heng HH. Duncan AM et al. 1997 Amplification of
CFTR exon 9 sequences to multiple locations in the human
genome. Genomics 45. 554-561.
Salvado CS, Trounson AO. Cram DS 2003 Towards preimpiantation
diagnosis of cystic fibrosis using microarrays. Reproductive
BioMedicine Online 8. I07-114.
Schlegel PN, Cohen J. Goldstein M et al. 199? Cystic tibrosis gene
mutations do nol atlecl sperm function during in vitro fertilization
with micromanipulation for men with bilateral congenital absence
of vas deferens. Fertility and Sterility 64.421-426.
Schlegel PN, Shin D. Goldstein M 1996 Urogenital anomalies in
men wilh congenital absence of the vas deferens. Journal of
Urohfty 155, U'M~]MK.
Schwietwrt EM. Benos DJ. Egan ME et al. 1999 C H R is a
conductance regulator as well as a chloride channel.
Physioh^ical Review.'i 79, S145-166.
Sheppard DN. Rich DP. Ostedgaard LS et al. 1993 Mutations in
CFTR associated with niitd-discase-form CV channels with
altered pore properties. Nature 362, 1('>O-I64.
Slielh S. Shea JC. Bishop MD et al. 2003 Increased prevalence of
CrTR mutations and variants and decreased chloride secretion in
primary sclerosing cholangitis. Human Genetics 113, 286-292.
Shin D. Gilbert F.Goldstein M, Schlegol PN 1997 Congenital
absence of the vas deferens: incomplete penetrance of cystic
tibrosis gene mutations. Journal of Urology 158. 1794-1799.
.Silber SJ, Balmaccda J, Borrero C et at 1988 Pregnancy with sperm
a.spiration from the proximal head of the epididymis: a new
treatment for congenital absence of the vas deferens. Fertility and
Sterility 50, 525-528.
Silber SJ.PatrizioP, Asch RH I99()a Quantitative evaluation of
.spermatogenesis by teslicular histology in men with congenital
absence of the vas deferens undergoing epidldymul sperm
aspiration. Human Reprodtution 5. 89-93.
Silber SJ. Ord T. Balinaceda J et al. 1990b Congenital absence of the
vas deferens. The fertilizing capacity of human epididymal
sperm. New Enf-land Journal of Medicine 323. 1788-1792.
Silber SJ. Nagy Z, Liu J et al. i 995 The use of epididytnal and
testicular spermatozoa lor intracytopla.smic s[x:rm injection: the
genetic implication.s for male infertility. Hutnan Reproduction 10,
2031-2043.
Slomski R, SchJoesser M. Berg LPet al 1992 Omission of exon 12in
cystie (Ibrosis transmembrane conductance regulator {CFTR)
gene transcripts. Human Genetics 89. 615-619.
Steiner B. Truninger K, San/ J et al. 2004 The role of common
single-nucleotide polymorphisms on exon 9 and exon 12 skipping
in nonmutated CFTR alletes. Human Mutation 24. 120-129.
Stem RC 1997 The tliagnosis of cystic tibrosis. New Fnalond
Journal of Medicine 336.487--f91.
Stem RC, Docrshuk CF. Drumm ML 1995 3849+10 kb C - T
mutation and disease severity in cystic tibrosis. Uuicet 346,
274-276.
Strom CM. Crossley B. Redman J et al. 2(KM Cystic tibrosis
screening: lessons learned from the first 320.000 patients.
Genetics in Medicine 6. 136-140.
Strong TV. Wilkinson DJ.MansouraMK etal. 1993 Expression of
an abundant alternatively spliced form of the cystic tibrosis
transmeinbrane conductance regulator (CFTRl gene is not
associated with a cAMP-aclivated chloride citnductance. tltuiian
Molectdar Genetics 2. 225-230.
Stuhrmann M. Dork T 2()(M) CFTR gene mutations and male
infertility, Androlofiia 32. 71-83.
Taussig LM. Lobeck CC, Kattwinkel J, Di Sanl'Agnese PA 1972
Fertility in males with cystic ilbrosis. Latwet 1, 850.
Ten Kate LP 1990 Carrier screening for cystic fibrosis and other
autosomal recessive diseases. American Journal of Hiutian
Teng H. Jorissen M. Van Poppel ei al. l9'-)7 Increased proportion of
eKon 9 alternatively spliced CFTR transcripts in vas deferens
compared with nasal epithelial cells. Human Molecular Genetics
6, 85-90.
Timmreck LS, Gray MR. Hiindelin B et al. 2003 Analysis of eystie
tibrosis transmembrane conductance regulator gene mutations in
patients with congenital absence of the uterus and vagina.
American Journal of Medical Genetics 120, ll-ld.
Tizzano EF. Chitayat D, Buchwald M 1993 Cell-specific localization
of CFTR mRNA show-i developmentally regulated expression in
human total tissues. Htiman Molecular Genetics 2. 219-224.
Tizzano EF. Silver MM. Chitayat D et al. 1994 Differential cellular
expression of cystic tibrosis iransmembrane regulator in human
 Symposium - Molecular palhology of the CFTR locus - M Ckmstres

reprotluctive tissues. Clues for the infenility in patients with variations. Annual Review nfGenetiis 29.777-807,
cystic fibrosis, American .lournal of Pathology 144,906-914, Zielenski J, Rozmahel R. Bozon D et al. 1991 Genomic DNA
Toumaye H. Devroey P. Liu J ef at. 1994 Microsurgical epididymal sequence of the cystic fibrosis transmembrane conductance
sperm aspiration and intracytoplasmic sperm injection: a new regulator (CFTR) gene. Gf;mwK\v 10.214-228.
effective approach to infertility as a result of congenital bilateral Zielenski J. Patrizio P. Corey M ei al. 1995 CFTR gene variant for
absence of the vas deferens. Fertility und Sterility 61. 1045-1051. patients w ith congenital absence of vas deferens, American
Trapnell BC )993 Quantitative evaluation of gene expre.ssion in Jotinial of Human Genetics 57. 958-960,
freshly isolated human respiratory epithelial cells. Atncrlcan Zuccato E. Buratti E. Stuani C et al. 2004 An intronic
Journal of Rliysioloi-y 264, LI99-212, polypyrimidine-rich element downstream ol the donor site
Trezise AE. Chambers JA. Wardle CJ et ul. 1993 Expression ofthe modulates cystic fibrosis transmembrane conductance regulator
eystic fibrosis gene in hutnan foetal tissues. Human Molecular exon 9 altemative splicing. Journat of Biological Chemistry 279,
0>Hrt(c-s 2.213-218. I69HO-16988,
Tsui LC. Durie P 1997 Genotype and phenotype in cyslic fibrosis.
Hospital Practice 32. 115-134. Received 17 August 2004; refereed 7 October 2004: acceptfti
Tuerlings JH. Moi B. Kremer JA et al. 1998 Mutation frequency of 2 November 2004.
cystic fibrosis Ininsmembrane regulator is not increased in
oligozoospermic male candidates for intracytoplasmic sperm
injection. Fenility und Sterility 69. 899-903.
Valman HB. France NE 1969 The vas deferens in cystic fibrosis.
Uuicei 2. 566,
van der Ven K. Messer L. van der Ven H ei al. 1996 Cystic llbrosis
mutation screening in heallhy men with reduced sperm quality.
Hunum Reproduction 11. 513-517,
Viel M, Leroy C. Des Georges M ci al. 2004 Novel length variant of
the polypyrimidine trad within the splice acceptor site in intron 8
of the CFTR gene: consequences for genetic testing using
standard assays, Furo/iean Journal of Human Genetics, in press,
von Eckardstein S. Cooper TG. Rutscha K et ctL. 2(HK) Seminal
plasma characteristics as indicators of cyslic fibrosis
transmembrane conductance regulator (CFTR) gene mutations in
men with obstructive azoospermia. Fertility and Sterility 73,
1226-1231.
Wang X, Moylan B, I.£opold DA et ul. 2(}00 Mutation in the gene
responsible for cystic tlbrosis and predisposition to chronic
rhinosinusitis in the general population. ./(K»7W/ ofthe Aniericun
Medical Association 284, 1814-1819.
Wang Z. Milunsky J. Yamin M ei al. 2(K)2 Analysis by mass
spectrometry of HH) cy.siic llbrosis gene mutations in 92 patients
with congenital bilateral absence ofthe vas deferens. Human
Reproduction 17. 2066-2072,
Wang XF. Zhou CX. Shi QX et al. 2003 Involvement of CFTR in
uterine bicarbonate secretion and the fertilizing capacity of
sperm. Nature Cell Biology 5. 902-906.
Wang HY.Wang IP, Bose J. Shen CK 2(Ht4 Stmctural diversity and
functional implications of the eukaryotic TDP gene family.
Gemmics^i. 130-139.
Weiske WH. Salzler N. Schroeder-Printzen I. Weidner W 2aX)
Clinical findings in congenital absence ofthe vasa deferentia.
Androloiiiail, 13-18.
Welsh MJ. Smith AE 1993 Molecular mechanisms of CFTR chloride
channel dysfunction in cystic fibrosis. Cellli. 1251-1254,
Wine JJ 2001 Cystie fibmsis: ihe "biciu^bonate before chloride'
hypothesis. Current Biology 11. R463-466,
Wiiif C 2iM)l Do delta F50S heterozygotes have a selective
advantage? Gcm-iic Research 78.41-47.
Wong PY 1998 CFTR gene and male fertility. Molecular Human
Reproduction 4. 107-110,
Wu CC. Hsieh-Li HM. Lin YM. Chiang HS 2004 Cystic fibrosis
transmembrane conductance regulator gene screening and clinical
correlation in Taiwanese males with congenital bilateral absence
of the vas deferens. Hitman Reproduction 19. 2,SO-253.
Yamashiro Y". Shimizii T. Oguchi S ct al. 1997 The estimated
incidetice of cystic llbrosis in Japan, Journal of Pediairic
GustroenteroU'ny and Nutrition 24,544-547,
Yoshimura K. Nakamura H. Trapnell BC et ul. 1991 Expression of
the cystic fibrosis transmembrane conductance regulator gene in
eells of non-epithelial origin. Nucleic Acids Re.search 19.
5417-5423.
Zielenski J 2000 Genotype and phenotype in cystic fibnjsis.
Respiration 61. 117-33.
Zielenski J, Tsui LC 1995 Cystic llbrosis; genotypic and phenotypic