View Article Online

View Journal

Lab on aChip
Miniaturisation for chemistry, physics, biology, materials science and bioengineering
Accepted Manuscript

This article can be cited before page numbers have been issued, to do this please use: H. Cheng, C. Fu,
W. Kuo, Y. Chen, Y. Chen, Y. Lee, K. Li, C. Chen, H. Ma, P. Huang, Y. Wang and G. Lee, Lab Chip, 2018,
DOI: 10.1039/C8LC00386F.

Volume 16 Number 1 7 January 2016 Pages 1–218 This is an Accepted Manuscript, which has been through the
Royal Society of Chemistry peer review process and has been
accepted for publication.
Lab on aChip
Miniaturisation for chemistry, physics, biology, materials science and bioengineering Accepted Manuscripts are published online shortly after
www.rsc.org/loc

acceptance, before technical editing, formatting and proof reading.

Using this free service, authors can make their results available
to the community, in citable form, before we publish the edited
article. We will replace this Accepted Manuscript with the edited
and formatted Advance Article as soon as it is available.

You can find more information about Accepted Manuscripts in the

author guidelines.

Please note that technical editing may introduce minor changes

to the text and/or graphics, which may alter content. The journal’s
ISSN 1473-0197 standard Terms & Conditions and the ethical guidelines, outlined
PAPER
in our author and reviewer resource centre, still apply. In no
Yong Zhang, Chia-Hung Chen et al.
Real-time modulated nanoparticle separation with an ultra-large
dynamic range
event shall the Royal Society of Chemistry be held responsible
for any errors or omissions in this Accepted Manuscript or any
consequences arising from the use of any information it contains.

rsc.li/loc
 Please do not adjust margins
Page 1 of 9 Lab on a Chip
View Article Online
DOI: 10.1039/C8LC00386F

Lab on a chip

ARTICLE

Detecting miRNA Biomarkers from Extracellular Vesicles for

Cardiovascular Disease with a Microfluidic System†
Received 00th January 20xx,

Lab on a Chip Accepted Manuscript

Accepted 00th January 20xx
DOI: 10.1039/x0xx00000x
Published on 08 August 2018. Downloaded on 8/9/2018 6:30:18 AM.
Hong-Lin Chenga, Chien-Yu Fub, Wen-Che Kuoa, Yen-Wen Chena, Yi-Sin Chenb, Yung-Mao Leed,
Kuang-Hsien Lid, Chihchen Chena,b, Hsi-Pin Mad, Po-Chiun Huangd, Yu-Lin Wanga,b*, and Gwo-Bin
Leea, b, c*

www.rsc.org/
According to World Health Organization reports, cardiovascular diseases (CVDs) are amongst the major
causes of death globally and are responsible for over 18 million deaths every year. Traditional detection
methods for CVDs include cardiac computerized tomography scans, electrocardiography, and myocardial
perfusion imaging scans. Although diagnosis of CVDs through such bio-imaging techniques is common, these
methods are relatively costly and cannot detect CVDs in their earliest stages. In contrast, levels of certain
micro RNAs (miRNAs) biomarkers extracted from extracellular vesicles (EVs) in the bloodstream have been
recognized as promising indicators for early CVDs detection. However, detection and quantification of miRNA
using existing methods are relatively labor-intensive and time-consuming. In this study, a new integrated
microfluidic system equipped with highly sensitive field-effect transistors (FET) was capable of performing EV
extraction, EV lysis, target miRNA isolation and miRNA detection within 5 hrs. The limit of detection was
within physiological range (femtomolar) for two targeted miRNAs, miR-21 and miR-126, meaning that this
integrated microfluidic system has the potential to be used as a tool for early detection of CVDs.

Introduction CVDs through bio-imaging techniques is common practice in

Cardiovascular diseases (CVDs) are a class of physiological
ailments that involve the circulatory system and include coronary
artery disease, angina, myocardial infarction, hypertension, stroke,
cardiomyopathy, rheumatic heart diseases, arrhythmia, aortic
aneurysms, peripheral artery diseases, carditis, and venous
1
thrombosis . Despite significant advances in the diagnosis and
treatment of CVDs, mortality rates remain relatively high, even in
developed countries; based on a report from the World Health
2
Organization , around 18 million people die from CVDs every year,
indicating that CVDs are serious issues for human beings.
Traditional methods for the detection of CVDs include
ultrasound scans, electrocardiograms, electrocardiography, Holter
monitoring, stress tests, cardiac computerized tomography scans,
and myocardial perfusion imaging scans. Although diagnosis of
a
Institute of NanoEngineering and MicroSystems, National Tsing Hua University,
Hsinchu, Taiwan 30013
b
Department of Power Mechanical Engineering, National Tsing Hua University,
Hsinchu, Taiwan 30013
c
Institute of Biomedical Engineering, National Tsing Hua University, Hsinchu,
Taiwan 30013
d
Department of Electrical Engineering, National Tsing Hua University, Hsinchu,
Taiwan 30013
*Co-corresponding authors: Gwo-Bin Lee, E-mail: gwobin@pme.nthu.edu.tw; Fax:
+886-3-5742495; Tel: +886-3-5715131 Ext. 33765 and Yu-Lin Wang, E-mail:
ylwang@mx.nthu.edu.tw; Tel: +886-3-5715131 Ext. 80159.
†Preliminary results presented in t h i s article were presented at the 20 th
International Conference on Miniaturized Systems for Chemistry and Life
Sciences (held in Dublin, Ireland, October 9-13, 2016) and the 31 st IEEE
International Conference on Micro-Electro Mechanical Systems (held in Belfast,
UK, January 21-25, 2018).
hospitals, such tools usually detect CVDs at relatively later stages
due to resolution limitations. Furthermore, most of themare labor-
intensive, time-consuming, and rely on expensive equipment and
well-trained technicians. In contrast, levels of certain blood-born
protein biomarkers, such as troponin, C-reactive protein, N-terminal
3
pro-brain natriuretic peptide, and fibrinogen , can be indicative of
the early stages of CVDs, and concentrations can be assayed in a
relatively simple, rapid, and non-invasive manner. Similarly, micro
RNAs (miRNAs) released from extracellular vesicles (EVs) found in
the bloodstream have been recognized as promising biomarkers for
4
early detection of CVDs , as many are released earlier in response
5
to illness than their protein counterparts .
EVs, which include exosomes, microvesicles, and apoptoic bodies,
are small, membrane-enclosed particles actively released by cells,
6
with sizes ranging from 30 to 200 nm . Release of EVs is one
important means by which cells communicate with each other.
Furthermore, these nano-structures can be found in all tissue types
7,8
and bodily fluids, including urine, spinal fluid, and blood . EVs may
serve as carriers of biologically important molecules, including
miRNAs, non-transcribed RNAs, lipids, and proteins. Because the
composition and biological content of EVs are indicative of
particular physiological states of cells, the potential for EVs to serve
as diagnostic and prognostic biomarkers for CVDs has attracted
4,5
significant interest in recent years .
miRNAs constitute a class of small, noncoding RNAs (with a
9
typical length of 22 nucleotides) that act mainly as post-

This journal is © The Royal Society of Chemistry 20xx Lab on a chip., 2016, 00, 1-3 | 1

Please do not adjust margins

 Please do not adjust margins
Lab on a Chip
ARTICLE
translational repressors of gene expression and play important roles
in proliferation, cardiogenesis, and apoptosis. miRNA dysfunction
10-12
can elicit pathological processes, such as tumorigenesis
Moreover, miRNAs are attractive biomarkers for cardiovascular-
associated therapeutics given their stability, tissue-specific
1 13
expression patterns, and secretion into bodily fluids . For example,
miR-208a, which is a cardiac-specific miRNA, has been used to
13
detect acute myocardial infarction . Similarly, miR-21 levels were
14, 15
increased in fibroblasts in the failing heart and decreased
expression of miR-126 was significantly associated with the onset of
16
acute myocardial infarction symptoms , as well as a higher major
17
adverse cardiovascular event rate . Generally speaking, miRNAs
are readily degraded once released from cells; therefore, they are
18
commonly housed within EVs ; as such, it is normally necessary to
first extract EVs from blood in order to detect the target, CVD-
associated miRNA. Furthermore, miRNAs are typically produced at
Published on 08 August 2018. Downloaded on 8/9/2018 6:30:18 AM.
only femtomolar concentrations, meaning that sensitive tools are
13
necessary for their detection and quantification .
Over the past two decades, microfluidics technologies have
emerged as promising tools for a variety of biomedical
19
applications . Compared to their large-scale counterparts,
microfluidic systems possess several advantages, including faster
detection times, lower reagent and sample consumption, lower
costs, a reduced need for human intervention, and the capacity for
automation. Moreover, microfluidic systems can be designed to
where they carry out the entire analytical process on a single chip.
Such chip-enacted steps may include (non-exhaustively) sample
pretreatment, separation, mixing, dilution, reaction, and detection.
Different approaches have been applied on chip for EV isolation and
characterizations, including
20
immunoaffinity , membrane
21 22
filtration , nanostructures , deterministic lateral displacement
23 24
(DLD) , acoustic nanofiltration , and viscoelastic flow sorting
25,26
Among them, the immunoaffinity-based magnetic bead approach
capable of performing EV isolation and concentration with high
purity and sufficient yield of EVs poses a promise for clinical
applications. For example, an iMER platform integrating immuno-
based EV enrichment, RNA extraction, on-chip RT-QPCR and
fluorescence detection for mRNA analysis, was reported . The
27
fluorescent quantification is still the most common and reliable way
for biomolecule analysis; however, it is usually costly and relatively
bulky, which is challenging to be miniaturized. Furthermore, most
of fluorescent-based RNA/DNA analysis involves a RT-QPCR step to
amplify target RNA/DNA molecules, which requires a specific
temperature control system and PCR reagents, raising the
complexity and cost of an integrated microfluidic system for fast
diagnosis. Alternatively, label-free electrical detection, which
directly senses biomolecules using electrical biosensors, possesses a
high sensitivity and could be suitable for portable apparatus. Given
the aforementioned need to develop proactive diagnostic tools for
diagnosing CVDs in their earliest stages, we hypothesized that we
could 1) develop a CVD biomarker assay and 2) integrate it into a
microfluidic chip. In addition, we also used a specific FET to meet
the sensitivity requirement around femtomolar, fM. We further
hypothesized that such a chip would necessitate lower sample and
reagent volumes than traditional-scale diagnostic approaches, while
also generating health-informative data in a shorter time period.
2 | Lab on a chip., 2016, 00, 1-3
Please do not adjust margins
Page 2 of 9
View Article Online
DOI: 10.1039/C8LC00386F
Lab on a chip
Materials and methods
.
Design concept of the microfluidic chip
Since the quantity of miRNAs released from EVs may be
extremely small , sensitive miRNA detection techniques are
essential. Recently, highly sensitive field-effect transistors (FET)
28
have been used in bio-sensing . For instance, AlGaN/GaN high-
electron-mobility-transistor (HEMT)-based sensors have been
29-33
reported for detecting gases, ions, proteins, and DNAs . There
are many advantages of AlGaN/GaN HEMT-based sensors over
other existing sensors, including higher sensitivity, chemical
34
Lab on a Chip Accepted Manuscript
stability, and the potential for real-time detection . Therefore,
AlGaN/GaN HEMT-based sensors were used for the detection of
miRNAs in this study, representing the first time an integrated
microfluidic system has been equipped with FET sensors. This
microfluidic chip was also designed to possess the capacity to 1)
extract EVs using CD63 antibody-coated magnetic beads since CD63
35
were proven to be specific to EVs , 2) isolate miRNAs with single-
stranded DNA (ssDNA) probes, and 3) detect the target miRNAs
with FET. All details associated with each aforementioned
experimental step are described below.
Preparation of EVs
A breast cancer cell line, MDA-MB-231, was selected for
preparation of EVs because they cells expresses high levels of the
36
CVD miRNA biomarker miR-21 and miR-126 . MDA-MB-231 cells
were cultured in Dulbecco’s modified Eagle’s medium (DMEM,
Gibco, Cat. #:11965092) with 10% EV-depleted fetal bovine serum
(FBS; Gibco, Cat. #:16000044), 100 U/ml penicillin, and 100 μg/ml
. streptomycin (P/S, Gibco, Cat. #:15140122) at 37°C and 5% CO2 in a
humidified incubator (MCO-20AIC, Sanyo, Japan). The EV-depleted
FBS was prepared by removing EVs from FBS (Gibco, Cat.
#:16000044) using ultracentrifugation 100,000 xg for 18 hours at 4°
C and collecting the supernatant. Cells were cultured in 10% EV-
7
depleted FBS and 1% P/S for 5 days in order to reach 10 cells. To
purify EVs, the media containing the cell-secreted EVs was spun at
1000 xg for 20 min and 3000 xg for 20 min at room temperature.
The suspension was then ultracentrifuged twice (CP 80NX, Hitachi,
Japan) at 100,000 xg for 90 min at 4°C, and the EV pellets were
resuspended in 200 μL of 0.22 μm (Finetech, Germany)-filtered
37
(twice) phosphate-buffered saline (PBS; 1x; pH 7.4) . Total protein
TM
concentrations of purified EV were then quantified by using DC
protein assay kit (Cat. #: 5000112, Bio-Rad, USA) as directed by the
manufacturer (using BSA as a standard) for the following utilizations
such that EV could be quantified. Plasma samples were collected
and provided by National Cheng Kung University Hospital (NCKUH),
under approval by the Institutional Review Board (IRB) of NCKUH
(IRB #B-ER-104-116). All methods were performed following the
relevant guidelines and IRB regulations.
Quantification and imaging of purified EVs
Scanning electron microscope (SEM) and fluorescence
microscopic images were used to ensure that EVs were extracted by
7
anti-CD63 coated magnetic beads (10 beads/mL, Cat. #:10606D,
This journal is © The Royal Society of Chemistry 20xx
 Please do not adjust margins
Page 3 of 9 Lab on a Chip
View Article Online
DOI: 10.1039/C8LC00386F
Lab on a chip ARTICLE

Invitrogen, USA). For high-resolution, thermal field-emission SEM

(JSM-7610F, JEOL, Japan), EVs bound with anti-CD63 coated
magnetic beads and 1) PBS, 2) pure beads, and 3) purified EVs in
PBS were co-analyzed simultaneously. Under the fluorescent
microscope (BX43, Olympus, Japan), we observed 1) pure beads, 2)
pure beads stained with the CD63 monoclonal antibody (Cat. #:12-
0639-42, Thermo Fisher Scientific), and CD63 magnetic bead-EV-
CD63 antibody particles. After 1 hr of rotation in the dark, samples
were washed with 300 µL of 1×PBS with 0.1% BSA and placed on
DynaMag™-2 Magnet (Thermo Fisher Scientific) for 1 min, and the
supernatant was removed. After fluorescence staining, the samples
were dispensed onto microscopic slides and observed under a BX43

Lab on a Chip Accepted Manuscript

fluorescence microscope.

Quantifying EV extraction efficiency

Published on 08 August 2018. Downloaded on 8/9/2018 6:30:18 AM.

The concentrations of EVs after ultracentrifugation were

measured in both the resuspended EV pellet and the supernatant
by nanoparticle tracking analysis (NTA; NanoSight LM10-HS,
Malvern Instruments, England). First, the EVs were diluted to 25 μg/
100 μL using 1× PBS. Then, 100 μL of magnetic beads coated with
6
anti-CD63 (10 beads) was used for isolation of EVs. The diluted EV
solution and magnetic beads were then mixed by on an RM-2L
mixer (ELMI, Latvia) overnight (16–22 hr) at 2-8°C at 25 rpm. The
capture rate of EVs was calculated as follows:
Quantification about capture rate of the EV-released miRNAs
Magnetic beads coated with miRNA-specific probes were used to
isolate miRNAs from lysed EVs. First, 100 μL of magnetic beads (Cat.
#:65011, diameter = 1.05 μm, 1010 beads/ml, Invitrogen) were
dispensed into a 1.5-ml microcentrifuge tube, and 900 μL of ddH2O
were added. Beads were vortexed for 5 s and pelleted with a
magnetic rack (Cat. #: 12321D, Thermo Fisher Scientific) for 3 min.
Then, magnetic beads were washed again with ddH2O. After
washing, 950 μL of ddH2O, 30 μL of 100 μM amine-modified miRNA
probe (Protech, Taiwan), and 20 μL of 120 mg/ml 1-ethyl-3-(3-
dimethylaminopropyl) carbodiimide (EDAC) solution (Cat. # :E2247
Molecular Probes, USA) were mixed together. The amine-modified
miRNA probes (synthesized by Genomics, Taiwan) were
complementary to the target miRNAs, and their sequences were
TTTTTTTTTTT-CAACATCAGTCTGATAAGCTA for miR-21 and
TTTTTTTTTT-CGCATTATTACTCACGGTACGA for miR-126 (100 μM
final concentration). The mixture was rotated at 20 rpm for 18 hr at
room temperature in the dark. After mixing, the magnetic beads
were separated as above, and the supernatant was decanted. In
order to remove unbound miRNA probes, the mixture was washed
twice with 1 ml of 0.02% Tween-20 (Sigma Aldrich, USA) and 1 ml of
0.1% sodium dodecyl sulfate (SDS) solution (Merck, Germany). After
washing, 1 ml of 0.1 M ethanolamine (Sigma-Aldrich) was added to
block the free, uncoupled sites on the magnetic beads, and the
mixture was rotated at 20 rpm for 1 hr at room temperature. Then,
the magnetic beads were separated as above, washed with ddH2O,
suspended in 1 ml of ddH2O, and stored at 4˚C prior to use. The
Fig. 1: (a) A schematic illustration of the integrated microfluidic
chip for detecting miRNA biomarkers for cardiovascular disease. (b)
Exposed view of the integrated microfluidic chip. (c) A photograph
of the integrated microfluidic chip. The chip was comprised of four
layers: an air control layer, a liquid channel layer, a double-sided
tape layer, and an epoxy substrate equipped with an FET detection
sensor.
TaqmanTM miRNA ABC purification kit was used for miRNA
purification.
The capture rate of the two target miRNAs on chip was
quantified by reverse transcription quantitative real-time
polymerase chain reaction (RT-QPCR) alongside miRNA standards.
Stock miRNA solutions of known starting concentrations were
serially diluted in elution buffer (Cat. #:4473084, Applied
Biosystems) to generate a standard curve. RT-QPCR was carried out
by following the manufacturer’s recommendations (Taqman miRNA
reverse transcription kit; Cat. #:4366596, Applied Biosystems) using
bead-eluted miRNAs as the template (1 µL for each of the two
miRNA targets). The RT reaction was carried out at 16°C for 30 min,
42°C for 30 min, 85°C for 5 min, and the mixture was maintained at
4°C until further use. After RT, QPCR was undertaken with 10 µL of
SensiFast™ SYBR® Hi-ROX Mix (Cat. #:BIO-92005, Bioline, UK), 1 µL
of the miRNA-21 (Assay ID: 000397, Catalog # 4427975, Applied
Biosystems) or miRNA-126 primers (Assay ID: 002228, Catalog #
4427975, Applied Biosystems), 7 µL of sterile water, and 2 µL of RT
products. The QPCR thermal-cycling protocol was as follows: 50°C
for 2 min, 95°C for 10 min, followed by 25 cycles of 95 °C for 15 s
and 60°C for 60 s. After RT-QPCR, threshold cycle (Ct) values were
determined to estimate miRNA capture rate on-chip.
Design of the microfluidic chip
The dimensions of the chip (Fig. 1a) were 68 mm × 48 mm × 5
mm, and it was composed of two normally-closed micropumps38,
two normally-open micromixers39, nine loading chambers, 19

This journal is © The Royal Society of Chemistry 20xx Lab on a chip., 2016, 00, 1-3 | 3

Please do not adjust margins

 Please do not adjust margins
Lab on a Chip Page 4 of 9
View Article Online
DOI: 10.1039/C8LC00386F
ARTICLE Lab on a chip
38
normally-closed microvalves and two waste chambers. It featured
an air control layer and a liquid channel layer (Figs. 1b-c), and the
thickness of the air control layer was 4 mm; the pneumatic devices
were formed within this layer. The liquid channel layer (~ 0.8-mm
thick) was for liquid transport. The air control layer and the liquid
channel layer were made of polydimethylsiloxane (PDMS; Sylgard
184A/B, Sil-More Industrial Ltd., USA), and they were bonded with
the FET sensors by double-sided tape (Supplementary Figure S1).
This integrated microfluidic chip also contained modules for EV
extraction, miRNA extraction, and miRNA detection by FET such
that the whole process could be automated by pneumatically
controlling the aforementioned micro-components (Supplementary

Lab on a Chip Accepted Manuscript

Figure S2).

Fabrication of FET sensor

Published on 08 August 2018. Downloaded on 8/9/2018 6:30:18 AM.

AlGaN/GaN HEMT was used in this study as the FET sensor.

The AlGaN/GaN epi-wafer on SI substrate was formed using MOCVD
(Metal-organic Chemical Vapor Deposition) process and active
regions were defined using mesa isolations by inductively coupled
plasma etch. Ohmic contacts (Ti/Al/Ni/Au) were deposited using
electron-beam (e-beam) evaporator and rapid thermal annealing
was performed at 850°C in N2 environment. Metal interconnects
(Ti/Au) were deposited using an e-beam evaporator. Gate electrode
separated from the channel region by a short distance was used to
provide pulsed gate bias voltage. The entire FET device was
passivated using photoresist and openings on the channel region
2 2
(10x60 µm ) and gate electrode (100x120 µm ) were made using
photolithography such that the distance between the channel and
the gate electrode was defined to be 65 µm. The structure of the
FET sensor is detailed in supplementary Figure S3. The FET
packaging technology used for the integrated microfluidic system is
40
detailed in a previous work . Briefly, the FET device was embedded
in a thermo-curable epoxy resin and cured at 125°C and 165°C for 1
and 1.5 hours respectively. Metal interconnects were then
deposited using an e-beam evaporator. In order to specifically
capture targeted miRNA on FET biosensors, RNA probes were thiol
modified and conjugated on the gold surface of the FET devices.
Here, 1 μL of 100 μM Tris(2-carboxyethyl)phosphine hydrochloride
(TCEP), 1 μL of 100 μM thiol modified RNA probes (TTTTTTTTTTT-
CAACATCAGTCTGATAAGCTA for miR-21 and TTTTTTTTTT-
CGCATTATTACTCACGGTACGA for miR-126) were premixed and then
mixed with TE buffer to a final volume of 100 μL. The mixture was
heated up to 95°C for 5 minutes and cooled to room temperature
before loaded on the gold surface of FET biosensors for 24 hr (avoid
light). After 24 hr, the unreactive mixtures were removed and the
gold surface were washed by PBS, blocked with ethanolamine for
30 minutes, removed blocking solution and washed by 1X PBS. The
modified FET biosensors were stored in PBS at 4℃ and avoid to
light before use.
FET sensor measurement
Agilent semiconductor parameter analyzer (B1530/B1500)
was used for FET sensor measurement and data collection. The
AlGaN/GaN HEMT sensor was biased with a constant DC voltage of
2V to the drain terminal and the separated gate electrode was
supplied with a short pulse voltage of 1.5 V, with duration of 100
Fig. 2: Schematic diagram of the chip-based process for detecting
miRNA biomarkers for CVD, including extracellular vesicle (EV)
extraction, EV lysis, miRNA isolation, and FET detection.
TE=thermoelectric.
µs. A schematic of the typical drain current response is depicted in
Supplementary Figure S4. During the first 0-10 µs, the drain current
with a gate voltage of 0 V and a drain voltage of 2 V was measured.
Then the gate pulse voltage (1.5 V) was turned on and FET drain
current peaked and then relaxed to a steady-state current from 20-
100 µs. The difference in drain currents before and after applying
the gate voltage, called the current gain or simply ‘gain’ was
regarded as the sensor signal. It is noted that gain is comparatively
more stable sensor index than the absolute drain current.
Experimental setup and procedure
The experimental setup was composed of a personal computer, a
control circuit, a thermal control module, electro-magnetic valves
(EMVs), an air compressor, a FET-sensing module (with two FET
sensors), and an integrated microfluidic chip (Figure S1). The
control circuits provided digital signals to regulate the EMVs such
that PDMS membranes on the micropumps, microvalves, and
micromixers could be activated pneumatically under the application
of compressed air from the compressor. The thermal control
module provided the required temperature for EV extraction,
miRNA isolation, and miRNA probe hybridization. The FET sensing
module detected the signals from FET, which was biased at a
constant DC voltage of 2 V provided at the drain terminal and a
pulsed voltage of 1.5 V at the gate terminal.

4 | Lab on a chip., 2016, 00, 1-3 This journal is © The Royal Society of Chemistry 20xx

Please do not adjust margins

 Please do not adjust margins
Page 5 of 9 Lab on a Chip
View Article Online
DOI: 10.1039/C8LC00386F
Lab on a chip ARTICLE

Before experimentation, the surfaces of the microchannels

were treated with Pluronic P-123 (Cat. #:435465, Sigma-Aldrich,
2.5% [wt/vol]) for 40 min and washed with 1×PBS to reduce protein
and nucleic acid adhesion. Then, 100 μL of magnetic beads coated
with the CD63 antibody, 100 μL of samples (purified EVs), 150 μL of
wash buffer (0.1% BSA in 1xPBS), 150 μL of lysis buffer (Cat.
9
#:4473077, Applied Biosystems), and 100 μL of magnetic beads (10
beads/ml) coated with probes specific to the target miRNAs were
loaded into the corresponding chambers (Fig. 2). Upon transporting
the samples to the micromixer chamber and activating the
normally-open micromixer, the samples and magnetic beads were
mixed for 240 min at 4˚C (Fig. 2a). After mixing, the magnetic bead-

Lab on a Chip Accepted Manuscript

bound EVs were collected at the bottom of the chip with an
external magnet (Fig. 2b). Then, the unbound materials were
washed away to the waste chamber. Simultaneously, 150 μL of
0.1% BSA in 1xPBS solution were transported to the mixing
Published on 08 August 2018. Downloaded on 8/9/2018 6:30:18 AM.

chamber by activating the micropump, and the chamber was

washed for 10 s (Fig. 2c). Next, the EV lysis buffer (Cat. #:4473077,
Applied Biosystems) was transported to the mixing chamber and
incubated with the EV-bead complexes at 4˚C for 10 min (Fig, 2d).
Afterwards, magnetic beads were collected at the bottom of the
chip as above, and the miRNA-containing supernatant was
transported to another micromixer by the pneumatic micropump
(Fig. 2e). Fig. 3: Scanning electron micrograph images of extracellular
vesicles (EVs) captured on magnetic beads with the integrated
After EV lysis and transport, 100 μL of the magnetic beads microfluidic system. (a) Pure magnetic beads. (b) 1x PBS buffer
9
coated with microRNA probes (10 beads/ml) were incubated with only. (c) and (d): EVs in 1x PBS buffer after ultracentrifugation.
released miRNAs by activating the micromixer at 30˚C (Fig. 2f). The Red boxes in (c) have been magnified in panel (d). (e) and (f): EVs
magnetic bead-bound miRNAs were then collected at the bottom of captured by magnetic beads. The red boxes in (e)-(f) encapsulate
the chip with an external magnet (Fig. 2g). Then, the unbound the captured EVs.
materials were washed to the waste chamber. Simultaneously, 150
μL of wash buffers 1 and 2 (Cat. #:4473077, Applied Biosystems)
were used to wash the micromixer for 10 s and 30 s (thrice),
respectively, by activating the pneumatic micropump (Fig. 2h).
Next, 100 μL of elution buffer (Cat. #:4473081, Applied Biosystems)
was transported to the micromixer, and miRNAs were eluted from
the beads at 70°C for 3 min (Fig, 2i). The eluted miRNAs were
transported to the FET’s detection region and hybridized with
complimentary probes immobilized on the FET (Figs. 2j-k).
The hybridization of target miRNAs onto the corresponding
probe immobilized on the gate electrode was carried out at 43°C for
5 minutes on chip. Slightly elevated hybridization temperature was
used to increase the selectivity of the probe to the target miRNAs.
After 5 minutes, the unbound materials were washed away in 1X
PBS and electrical measurements were performed in 1X PBS
environment. After each sample measurement, the target
molecules were dehybridized from the probe at 95°C in TE buffer
for 10 minutes and washed away from the FET sensor surface.
Details of the whole procedure were listed in Supplement Table 1,
which lists information about materials, volumes, times etc. Fig. 4: Microscopic images of extracellular vesicles (EVs) captured
on magnetic beads with the integrated microfluidic system.
Optical images of magnetic beads (a) and magnetic beads bound
Results and Discussion to EVs (d, g). Fluorescent images of magnetic beads (b) and beads
EV captured on anti-CD63 coated magnetic beads bound to EVs stained with fluorescently-labeled CD63 antibody (e,
h). Merged images (c, f, i). Note that all images were acquired
To confirm that EVs were extracted by magnetic beads coated under the same conditions (exposure time: 4 s).
with the CD63 antibody, scanning electron microscopy was used
(Fig. 3, Supplementary Figure S5), and vesicle-shaped structures

This journal is © The Royal Society of Chemistry 20xx Lab on a chip., 2016, 00, 1-3 | 5

Please do not adjust margins

 Please do not adjust margins
Lab on a Chip
ARTICLE
with an expected size ranging from 50–200 nm were observed (Figs.
3c-d); they were presumed to be EVs. These observations were
corroborated by immunofluorescent microscopy (Fig. 4); upon
observing the negative (Figs. 4a-c) and positive (Figs. d-i) controls, it
is evident that EVs could be successfully captured with antibody-
labeled beads.
To optimize the efficiency of EV extraction, the applied gauge
pressure for the micromixer was explored in an attempt to improve
the binding efficiency. It is speculated that a higher gauge pressure
could result in breaking the interaction between the anti-CD63
antibody and CD63 antigen on the surface of EVs. Purified EVs
(post-ultracentrifugation) diluted to a final concentration of 25
μg/100 μL were used, and the micromixer was operated at various
applied gauge pressures. The results were measured by using a flow
Published on 08 August 2018. Downloaded on 8/9/2018 6:30:18 AM.
TM
cytometer (Accuri C6, BD Biosciences, USA). As depicted in Fig. 5,
the fluorescence intensity contributed from the fluorescent dye
(Fluorescein (FITC)) on captured EVs increased from an applied
gauge pressure of 0 kPa and saturated at around -6.7 kPa to -13.3
kPa. It indicated that the mixing flow induced by the micromixer did
enhance the EVs capturing; however, higher mixing flow induced by
an applied gauge pressure over -26.7 kPa decreased the EVs
capture efficiency since the binding between the anti-CD63
antibody and EV may be broken due to the high shear force. The
efficiency of EVs capture was later quantified by NTA
(Supplementary Figure S6). A maximum capture efficiency of 32.4%
was measured at an applied gauge pressure of -6.7 kPa for 40 min.
It could be further increased to 54.3% for 240 min.
Therefore, the yield of EVs extracted at different incubation
times and operating frequencies were quantified at the optimal
gauge pressure of -6.7 kPa. The EVs extracted by magnetic beads
were stained with fluorescence dyes (PE) and detected by a flow
TM
cytometer (Accuri C6, BD Biosciences, USA). Optimal EV
extraction occurred at 240 mins of incubation at an operating
frequency of 2.0 Hz (Fig. 6). This duration was 4-folds lower than
the time required for capture in a benchtop process (16 hrs).
Magnetic-bead-extracted EVs have also been analyzed using
Bioanalyzer (Agilent Technologies, USA) and RT-PCR with agarose
Fig. 5: The efficiency of EV extraction using a micromixer under
various applied gauge pressures including 0, 4.0, 6.7, 13.3, 26.7,
and 40.0 (-kPa); NC: negative control using beads without EV
incubation.
6 | Lab on a chip., 2016, 00, 1-3
Please do not adjust margins
Page 6 of 9
View Article Online
DOI: 10.1039/C8LC00386F
Lab on a chip
gel (Supplementary Figures S7 and S8)
miRNA extraction at different operating frequencies
For miRNA isolation, different micromixer operating
8
frequencies were tested while incubating magnetic beads (10
beads/100 μL) with miRNAs (volume=100 μL, concentration=300
nM), and, as expected, the RT-QPCR-derived Ct values decreased
with increasing miRNA concentrations (Fig. 7). The miRNA capture
rate was 50% at an operating frequency of 0.5 Hz. A maximum
concentration of about 150 nM could be isolated at 0.5 Hz, -6.7 kPa,
and 40 min. Also, the miRNA capture rate decreased with increasing
Lab on a Chip Accepted Manuscript
operating frequency; therefore 0.5 Hz was used for all subsequent
experiments. When using an initial miRNA concentration of 400 pM
41
(the physiological concentration in human blood) , a recovery rate
of 82% (the maximum observed) was documented at an incubation
time of 20 min (Fig. 8), half the time required for the benchtop
approach, which follows the manufacturer's instruction of TaqMan®
miRNA ABC Purification Kit (Cat. #: 4473087).
FET detection without microfluidics
FET based biosensors were previously used to detect
Fig. 6: Extracellular vesicle (EV) extraction at different incubation
times under different operating frequencies, as estimated by
fluorescence intensity (due to conjugation of EVs with antibody-
coated magnetic beads); the optimal EV extraction was at 240
min and 2.0 Hz, respectively. Error bars represent standard
deviation (n=3).
Figure 7: miRNA isolation performed on the microfluidic chip at
different operating frequencies. The isolated miRNAs were
quantified by RT-QPCR, and the threshold cycle (Ct) values have
been reported. The miRNA capture rate was 50% at an operating
frequency of 0.5 Hz.
This journal is © The Royal Society of Chemistry 20xx
 Please do not adjust margins
Page 7 of 9 Lab on a Chip
View Article Online
DOI: 10.1039/C8LC00386F
Lab on a chip ARTICLE

biomolecules directly from physiological salt environment with high
42-47
sensitivity and selectivity . The sensing methodology which relies
on the high field operation of the FET overcomes the charge
screening issue in high ionic strength solutions such as 1X PBS and
short sample incubation periods facilitate high selectivity even in
physiological fluids. In this study, serial dilutions of synthesized
miRNA were off-chip prepared. Then, on-chip FET sensors were
used to detect serially diluted, synthesized miRNAs, and a
calibration curve of current gains (defined as difference in drain
currents before and after the gate voltage was applied) (output
signals from FET) against miRNA (miR-126) concentrations was
obtained (Fig. 9). The FET sensor could detect miRNA
from the negative control (ddH2O), and the concentrations of miR-
21 and miR-126 were calculated to be 15.8 fM and 250 fM for
purified EVs, and 62.57 fM of miR-21 for plasma samples,
respectively, based on the standard curve (Table 1). Furthermore,
purified miRNAs (stock miRNA concentration determined using
standard laboratory instrument) serially diluted to different
concentrations of 0, 10, 50, 100, 250, 500, 1000 fM (miR-21) and 0,
1, 10, 100, 500 and 1000 fM (miR-126) were detected by the FET
sensor integrated with the microfluidic system (Fig. 10). The drain
currents of the FET sensors increased as the miRNA concentration
increased. This change in FET sensor signal is similar to the response
curves in Fig. 9, which depicts miRNA detection without

Lab on a Chip Accepted Manuscript

concentrations down to the fM level, a sufficient sensitivity for
41
detecting physiological concentrations of miR-21 and miR-126 .
Figure 9 depicts the different FET sensor response against purified
miR-126 concentrations, without using microfludics. The sensor
Published on 08 August 2018. Downloaded on 8/9/2018 6:30:18 AM.
microfluidics. However, upon integrating with microfluidics, the
sensor response curves denote a remarkable improvement in noise
characteristics and sensitivity. The detection limits (calculated as
3*standard deviation of blank/slope) of FET sensor for miR-21 and

response has different linearity in the order of fM and nM of miRNA
concentrations (represented by red lines in Fig. 9).
miRNA detection using the integrated microfluidic system
Purified EVs diluted to 500 μg/mL and the plasma samples were
miR-126 were experimentally found to be 6.069 fM and 23.817 fM,
respectively.
48
When compared with RT-QPCR quantification of miRNAs , the
electronic signals of the FET detection system could directly
measure miRNA concentration, which is much easier for practical
applications. Based on the physiological concentration of EVs (10
11

tested on the microfluidic chip featuring probes for the target 41

miRNAs. After EV extraction and miRNA isolation, samples were
then quantified by RT-QPCR (Table 1). The Ct value of the purified
EVs and EVs from plasma were observed to be obviously different
particles/ml) in human plasma and miRNA quantities in EVs , the
detectable concentrations of miR-21 and miR-126 in an individual
with CVD may reach 35 and 1 pM, respectively. Therefore, 2-5 ml of
plasma would be required to detect these biomarkers using the
microfluidic system.

40 16

35 14

Current gain (µA)

Current gain (µA)

30 12

25 10

20 8

15 6

10 4

5 2

0 0
0 50 100 150 200 250 300 350 0 20 40 60 80 100

miRNA concentration (nM) miRNA concentration (fM)

(a) (b)
Fig. 8: miRNA extraction performed on the microfluidic chip at Fig. 9: FET detection (as change in current gains with respect to
different incubation times. The isolated miRNAs were quantified zero target concentration) across miRNA concentrations in the (a)
by RT-QPCR, and the threshold cycle (Ct) values were converted nM and (b) fM ranges. Error bars represent standard deviation
to miRNA concentrations (pM) from the standard curve (not (n=3).
shown). The capture rate was 82% at an incubation time of 20
140
min and an operation frequency 0.5 Hz. Error bars represent miR-21
200
miR-126
130 190
standard deviation (n=3). 120 180
Current Gain (µΑ )

Current Gain (µΑ )

110 170
160
Table 1. The RT-QPCR-derived threshold cycle (Ct) values of 100
150
90
products after extracellular vesicle (EV) extraction and miRNA-21 140
80
130
and miRNA-126 isolation. P100nM=positive control (P); the negative 70
120
controls (N). Note that plasma samples were used. 60 110
50 100
miR-21 miR-126 0 200 400 600 800 1000 0 200 400 600 800 1000
miR-21 Concentration (fM) miR-126 concentration (fM)
Ct value
EVs from purified samples 32.99 31.94 Fig. 10: The FET sensor response against miRNA concentrations.
EVs from plasma samples 31.99 - The graphs represent current gain versus miRNA concentrations.
P100nM 20.97 25.00 Error bars represent standard deviation (n=3). The FET sensor
N 37.02 37.09 was integrated with microfluidics.
- : the Ct value for miR-126 has not been determined.

This journal is © The Royal Society of Chemistry 20xx Lab on a chip., 2016, 00, 1-3 | 7

Please do not adjust margins

 Please do not adjust margins
Lab on a Chip
ARTICLE
Conclusions
In this study, an integrated microfluidic system capable of
automatically performing EV extraction followed by miRNA isolation
and detection was developed. This microfluidic system featured 1)
an EV extraction module featuring CD63-coated magnetic beads, 2)
a miRNA extraction module reliant on magnetic beads coated with
two miRNA-specific probes, and 3) a miRNA detection module for
quantification of EV miRNAs using a highly sensitive FET sensor. For
on-chip EV extraction, only four hours were required, and a capture
efficiency of 54.3 % was obtained (240 min for a sample with a
volume of 100 μL). For the miRNA extraction module, the capture
rates were determined to be 50% for miR-126 and 82% for miR-21.
The miRNA isolation steps removed most of non-miRNA
biomolecules existing in EVs and concentrated the targeted miRNA
for the next step of FET detection. When compared with the
Published on 08 August 2018. Downloaded on 8/9/2018 6:30:18 AM.
conventional fluorescent-based detection methods, which normally
required amplification processes to detect biomolecules with very
low concentrations, the detection limit of the FET sensor was
measured to be in the order of 1 fM, sensitive enough to detect
physiological concentrations of miR-21 and miR-126. These results
demonstrate the feasibility of the developed integrated microfluidic
platform for detecting and quantifying CV biomarkers in only 5 hr
(including 240 min EV extraction, 20 min for miRNA isolation and 5
min FET-based microRNA detection, 10 min EVs lysis and several
beads collecting/wash processes totally for 15 min), 4-fold shorter
than using conventional benchtop protocols. This novel, integrated
microfluidic system may, then, have great potential for point-of-
care applications for early detection of CVDs.
Acknowledgements
The authors would like to acknowledge financial support from
the Ministry of Science and Technology (MOST) of Taiwan
(MOST 106-2221-E-007-001 and MOST 105-2119-M-007-009
to GBL), as well as Hsing-Yu Lin and Xi Chen for providing
reagents.
Conflicts of interest
There are no conflicts of interest to declare.
References
1. N. Nouraee and S. J. Mowla, Front. Genet., 2015, 6, 232.
2. A. Al-Mawali, Oman Med. J, 2015, 30, 227-228.
3. I. Ikonomidis , et al.. Atherosclerosis., 2008, 199, 3-11.
4. A. J. Tijsen and Y. M. Pinto, Cardiovasc. Res., 2012, 93, 573-582.
5. W. Wang, et al., Eur. Heart J., 2010, 31, 659-666.
6. Y. Wan, et al., Nat. Biomed. Eng., 2017, 1, 0058.
7. R. J. Berckmans, et al., Arthritis Rheum., 2002, 46, 2857-2866.
8 K. W. Witwer, et al., J. Extracell. Vesicles, 2013, 2, 20360.
9. N.C. Lau, L.P. Lim, E.G. Weinstein and D.P. Bartel, Science, 2001,
294, 858-862
10. V. Ambros, Nature, 2004, 431, 350-355.
11. A. Esquela-Kerscher and F.J. Slack, Nat. Rev. Cancer, 2006, 6,
259-269.
12. J. Li, et al., Anal. Chem., 2009, 81, 5446-5451.
13. G.K. Wang, et al., Eur. Heart J., 2010, 31, 659-666.
8 | Lab on a chip., 2016, 00, 1-3
Please do not adjust margins
Page 8 of 9
View Article Online
DOI: 10.1039/C8LC00386F
Lab on a chip
14. T. Thum, et al., Nature, 2008. 456, 980-U83.
15. S. Roy, et al., Cardiovasc. Res., 2009, 82, 21-29.
16. G.W. Long, et al., Int. J. Biol. Sci., 2012, 8, 811-818.
17. F. Jansen, et al., J. Am. Heart Assoc., 2014, 3.
18. E.E Creemers, A.J.Tijsen and Y.M Pinto, Circ. Res., 2012, 110,
483-495.
19. L.R. Volpatti and A.K. Yetisen, Trends Biotech., 2014, 32, 347-
350.
20. M. He, et al., Lab Chip, 2014, 14, 3773–3780.
21. H.K. Woo, et al., ACS Nano, 2017, 11, 1360–1370.
22. Z. Wang, et al., Lab Chip, 2013, 13, 2879–2882.
23. B. H. Wunsch, et al., Nat. Nanotechnol., 2016, 11, 936–940.
24. K. Lee, et al., ACS Nano, 2015, 9, 2321–2327.
25. C. Liu, et al., ACS Nano, 2017, 11, 6968–6976.
Lab on a Chip Accepted Manuscript
26. J.C. Contreras-Naranjo, H.J. Wu, and V.M. Ugaz, Lab Chip, 2017,
17, 3558-3577.
27. H. Shao, et al., Nat. Commun., 2015, 6, 6999.
28. A.P Turner, Biosens. Bioelectron., 2015, 65, A1.
29. C.C. Cheng, et al., Sens. Actuators, B, 2006, 113, 29-35.
30. B.H. Chu, et al., Ieee Sens. J., 2010, 10, 64-70.
31. B.S. Kang and S.J. Pearton, Appl. Phys. Lett., 2006, 89, 122102.
32. B.S. Kang, et al., Appl. Phys. Lett., 2007, 91, 112106.
33. S.J. Pearton, et al., J. Phys. Condens. Matter, 2004, 16, R961-
R994.
34. U.K. Mishra, P. Parikh and Y.F. Wu, Proc. IEEE, 2002, 90, 1022-
1031
35. M. Logozzi, et al., PLoS ONE, 2009, 4, e5219.
36. S. Zhu, et al., Cell Res., 2008, 18, 350-359.
37. C. Théry, S. Amigorena, G. Raposo and A. Clayton, Curr. Protoc.
Cell. Biol., 2006, 30, 3.22.1-3.22.29.
38. W.B. Lee, et al., Biosens. Bioelectron., 2017, 87, 669-678
39. C.J. Huang, et al., Biosens. Bioelectron., 2012, 35, 50-55
40. C.P. Hsu, et al., ECS J. Solid State Sci. Technol., 2017, 6, Q63-
Q67.
41. J.C. Akers, et al.. PLoS ONE, 2013, 8, e78115.
42. C.H. Chu, et al., Sci Rep., 2017, 7, 5256.
43. A. Regmi, et al., Appl. Phys. Lett., 2017, 111, 082106.
44. P.C. Chen, et al., ECS J. Solid State Sci. Technol., 2017, 6, Q71-
Q76.
45. I. Sarangadharan, et al., Biosens. Bioelectron., 2018, 100, 282-
289.
46. Y.W. Chen, et al., Sens. Actuators, B, 2018, 262, 365-370.
47. A.K. Pulikkathodi, et al., Sens. Actuators, B, 2018, 257, 96-104.
48. S.K. Patnaik, et al., PLoS ONE, 2017, 12, e0181926.
This journal is © The Royal Society of Chemistry 20xx
 Page 9 of 9 Lab on a Chip
View Article Online
DOI: 10.1039/C8LC00386F

A new integrated microfluidic system equipped with highly sensitive field-effect

transistors (FET) was reported for performing extracellular vesicles (EV) extraction,

EV lysis, target microRNA (miRNA) extraction and miRNA detection within 5 hrs.

The limit of detection was within physiological range (femtomolar) for two targeted

miRNAs, miR-21 and miR-126, indicating that this integrated microfluidic system has

Lab on a Chip Accepted Manuscript

the potential to be used as a tool for early detection of cardiovascular diseases.
Published on 08 August 2018. Downloaded on 8/9/2018 6:30:18 AM.