DNA FINGERPRINTING

DISCOVERY
Dr. Alec Jeffreys, a geneticist from the University of Leicester in The
Discovery of DNA Fingerprinting. In September 1984, Great Britain was
studying hereditary diseases in families. He was focusing on methods
to resolve paternity and immigration disputes by demonstrating the genetic
links between individuals.

DEFINATION
 DNA fingerprinting is a laboratory technique used to establish a link
betweenbiological evidence and a suspect in a criminal
investigation. A DNA sample taken from a crime scene is compared
with a DNA sample from a suspect
 Medical Definition of DNA fingerprinting. : a technique used
especially foridentification (as for forensic purposes) by extracting
and identifying the base-pair pattern of an individual's DNA — called
also DNA typing, genetic fingerprinting

PRINCIPLE
The entire genetic information of an individual is called genome. Genome
contains the DNA sequence, which has both coding and non coding genes.
The DNA sequences of humans are 99% similar in every individual.
However, the other 1% is what makes each one of us unique. This 1%
sequence mainly has specific codes that repeat itself throughout the
sequence. These are short and varied sequences, and are known
as VNTRs (Variable Number of Tandem Repeats). The frequency and
position of these repeats vary greatly from one individual to the other. DNA
fingerprinting uses such VNTRs from an unknown DNA sample to compare
and match with the known.
METHODS
As time pasted technology has improve the methods of analyzing DNA. One of
the first methods for the analysis of DNA is known as Restriction Fragment Length
Polymorphism (RFLP). This technique analyzed variable number of tandem
repeats which are highly polymorphic within certain regions of each individual.
This technique had a very high power of discrimination per loci however it
required a large amount of high quality DNA sample. As the polymerase chain
reaction (PCR) was developed a new technique known as Short Tandem Repeat
(STR) became the new standard for DNA analysis. PCR/STR has allowed the use or
small and degraded DNA samples which has been a major breakthrough especially
within the field of Forensics. Even though PCR/STR is the most common technique
used today Y‐STR and mitochondrial DNA typing are new technologies that can
often prove to be very valuable when dealing with certain type of cases. The
multiplexing and automation of today’s systems have a reduced the time, cost
and invariably cemented its application in forensic science.

Restriction Fragment Length

Polymorphism (RFLP):
RFLP requires a restriction enzyme which cuts the DNA at a specific location.
These fragments are then separated into their different sizes using an
electrophoresis agarose gel. The smaller fragments travel much faster through the
gel and hence appear further along the gel strip. The fragments are then fixed to a
nylon membrane which is then labeled typically with a P32 probe. This probe
binds to only specific regions on the fragments. It must then be washed and
exposed to X‐ray and photographic film. The result is a barcode like image which
could be compared to known and size standards.

Reference: http://www.ntu.edu.sg/home2004/WONG0172/RFLP.j

Summary of the stepsinvolve in RFLP

Polymerase Chain Reaction (PCR):
PCR or Polymerase Chain Reaction was discovered by Kary Mullis in 1985 and is a
way to copy a DNA molecule. This process is an enzyme type reaction which
revolves around the conditions of the enzyme.
1. Denaturtion This occur with an increase of temperature where the weak
hydrogen bonds are broken and the double strand DNA separates into two
single strands. Temperature may vary according to enzyme and desired result
(usually above 90 degrees)
2. Annealing ‐ Here the primers bind to the separated complement strands due
to lowering of temperature to allow the DNA to recombine. The primers are
added in excess to ensure that the primer binds and not the original DNA( 54
degrees)
3. Extension – The polymerase add dNTP’s in the 5’ to 3’ direction. The primers
are extended by addition of complementary bases (A,T, C, G) read from the 3’
to 5’ direction.(72 degrees).

This process is repeated about 30 times which produce billions of copies of DNA
which can then be used for STR analysis. For this reaction to take place you must
have the right master mix which include; template DNA,dNTP’s, primers and DNA
polymerase(Taq).
There are six different components that are required for a PCR;
1. dilute inhibitors however may lose rare DNA Template ‐ this must be ‘clean’
DNA that is no inhibitors. This may be cleaned with a gene clean silica matrix.
Microcon 100 can also be used to help clean. May want to dilute sample if too
concentrated to copy genes.
2. Primers ‐ usually 15‐35 bp should be universal so that it binds to the same sites
on the DNA. They should also have a similar %G‐C as the target DNA. The
concentration should be optimized for best results.
3. DNA polymerase‐ this is the enzyme that drives the reaction. Must be chosen
carefully depending on what you want to achieve. Beware of inhibitors which
might degrade the proteases, denature them and block the active sites.
4. Magnesium – This is required to activate the polymerase and must be
optimized to the specific reaction. It is often affected by the template
concentration, chelating agents(EDTA), dNTP’s, proteins and heavy metals. The
magnesium should not be added in excess as it would reduce the fidelity of the
enzyme.
5. Buffer mix & dNTP’s – The buffer is specific to the enzyme that is being used
and is optimized by adding magnesium. The dNTP’s are required for the base
addition and are often present in equal amounts. It may be varied to reduce
base stacking interactions, hydrogen bonding and the strand separation
temperature
6. Enhancing Reagents – these compounds are added to the reaction to help
increase the stability, few base pairs long and directly follow each other. In
field of forensics the use of tetra‐nucleotide repeats are mostly used as it has
significant advantages. Most of these repeat units are part of the non‐coding
or “junk DNA” and is very highly polymorphic. STR works by counting the
number of times each repeat occurs within that specific area on the
chromosome or loci.
 Short Tandem Repeat (STR):
Short Tandem Repeat is the term used to describe when a sequence of DNA
within a specific region is repeated numerous times. These are often referred
to as microsatellites. These repeat units are typically a lower temperatures and
help make the process more selective. Common additives are DMSO, BSA, T4
gene protein32, Glycerol and Acetamide.

Example
TTCCATTTGGAATGAATGAATGAATGAATGAATGATGAGTTTCAA
We can see that the sequence ATGA is repeated six times within this particular
location. These are what we refer to as short tandem repeats.
Today with the ability to perform PCR reactions coupled with STR’s forensic
scientist are able to use very small or degraded DNA samples to obtain a full DNA
or STR profile. Technology has also allowed for the use of different STR loci to be
tested in the same reaction. This is known as multiplex STR analysis and can look
up to 19 different loci at the same time. This provides a very high power of
discrimination when looking at the probably of two same DNA profiles. The
instruments today are mostly automated and most forensic laboratories couple
the PCR‐STR to a capillary electrophoresis device to obtain an electropherogram
or “DNA picture”.

This is an electropherogram or PCR‐ STR profile for an unknown sample. It could

then be compared to known sample for a possible match.
http://www1.qiagen.com/literature/qiagennews/weeklyArticle/May03/e16/imag
es/fig2.gif
Y‐STR :
This technique looks at short tandem repeats located on only the Y‐chromosome
which means that it can only be detected in males. It is inherited from your father
which means that it is not as individual as normal STR analysis. Different members
of your paternal family may have the same profile.
So why use such analysis?
This type of analysis can be most beneficial in cases of multiple male donors and
mixtures (for example gang rapes) where normal STR analysis have difficulty in
separating the multiple male in the sample mixture.

Mitochondrial DNA (mtDNA)

Mitochondrial DNA is the female version of Y‐STR however mtDNA occurs in a
much higher concentration which means that the possibility of obtaining a profile
is much higher. However this is not nucleic DNA and is inherited maternally.
This type of analysis is often done on samples of hair and highly degraded
samples, however is not very discriminative and may only give the maternal side
of a profile.
http://www.jpac.pacom.mil/CIL/images/dna_chart.gif

Example of how mtDNA is inherited within a family tree

 Seven steps to understanding DNA fingerprinting:
 Extracting the DNA from cells-DNA must be recovered from cells and
tissues .only a small amount of blood ,hair or skin.
 The sample collected from tissue of a living or
dead organism is treated with chemicals and enzymes for proper
extraction .
 Cutting up the DNA using an enzyme-Restriction enzymes are used to cut
the DNA at specific sites.
The fragments are separated by length difference ,
the process is called electrophoresis.
 Separating the DNA fragments on a gel-Then DNA pieces are possed
through a gel made of seaweed agarose.
 Transferring the DNA onto paper-The DNA pieces are transferred to a
nylon sheet by placing the sheet on gel and soaking them over night.
This is called Southern Blotting:DNA fragment
transferred from gel to nylon membrane.
 Adding the radioactive probe-Adding radioactive or coloured probes to
xylon sheets produces some pattrens .As it sticks on sheet,it may show
some prints of DNA.
 Setting up the X-ray film.
 Yes - we've got the results.

Human Applications of DNA Fingerprinting

· Paternity and Maternity Tests- DNA fingerprinting can be used to determine the
father or a mother of a child because a person inherits his or her VNTRs from his
or her parents. The banding patterns of a child are very specific that a parental
VNTR pattern can be recreated even if only the child’s VNTRs are known. DNA
fingerprinting can be used to determine who the father is in identification cases,
confirming legal nationality, adoption and biological parenthood.

· Crime Identification and Forensics- DNA that is taken from blood, skin, hair
cells or any other DNA evidence left at the scene of the crime can be compared
through the banding patterns of DNA. With the DNA of the culprit and the DNA
fingerprints (banding patterns) of a criminal suspect, the authorities are able to
determine whether the suspect is guilty or innocence. It can also be used to
determine the identity of a homicide victim from DNA found or from the body

· Personal Identity- There has been talk throughout the world as using DNA
fingerprints as a person’s individual/genetic bar code to identify people in the
world, however it may not be put into place in the foreseeable future. For example,
the iPhone 5S is an example where DNA fingerprints are used to unlock the
phone.

· Organ Donation- it allows scientists and doctors to figure out the best possible
match for an organ transplant operation, so the foreign organ is not rejected by the
host body.

· To identify victims in a disaster

· Using genetics in population to analyze variation within a population or ethnic

group

· DNA fingerprint technology can be used as a diagnosis for inherited disorders in

children, unborn babies and adults. For example, a bloodstained clothing of
Abraham Lincoln was analyzed after his death. This showed evidence of a genetic
disorder called Marfan’s Syndrome. Some disorders that can be determined
through DNA fingerprinting are cystic fibrosis, hemophilia, Huntington’s disease,
familial Alzheimer’s, sickle cell anemia and many more. Early detection of these
disorders allows medical staff to prepare themselves and the parents on what
should be done in order help the child.

· Developing cures for inherited disorders- by looking at the information

contained in DNA fingerprints of relatives who have a history of some particular
disorder, or comparing it to a large amount of people with and without the
disorder, you are able to identify DNA patterns that are related with the disease.

· DNA fingerprinting can be used to trace ancestors and create a family tree.

 DNA fingerprinting has a variety of different uses that range from

identification of GMO products to determining the mother of a child. Below
is a list of a number of different ways DNA fingerprinting has been used

DNA Fingerprinting is not only used for humans but

can also be used for animals and plant.

 To study the genetic variability of endangered species in conservation

biology

To test for certain pathogens in food sources

· To determine whether or not something is a genetically modified

organism (within plants or food products)
ADVANTAGES OF DNA FINGERPRINTING
.DNA profiling is an ideal method for confirming an ideality with absolute
certainity.

.It is easy and painless for testing.

.A thorough scientific test can be contucted in as little as 48 hrs.

.It is less time taken.

DISADVANTAGES OF DNA FINGER PRINTING

.Misuse of results may lead to privacy concerns.DNA people diagnostics
guarantees complete confidentity.

.The lab tests upto 29 markers to produce highest possible probability indicators.

.Sample can be easily ruined.

REFRENCES
1. Murphy, Erin (2017-10-13). "Forensic DNA Typing". Annual Review of
Criminology. doi:10.1146/annurev-criminol-032317-092127. ISSN 2572-4568.
2. Petersen, K., J.. Handbook of Surveillance Technologies. 3rd ed. Boca Raton ,FL. CRC Press, 2012.
p815
3. DNA pioneer's 'eureka' moment BBC. Retrieved 14 October 2011
4. Chambers, Geoffrey K.; Curtis, Caitlin; Millar, Craig D.; Huynen, Leon; Lambert, David M. (2014-01-
01). "DNA fingerprinting in zoology: past, present, future". Investigative Genetics. 5:
3. doi:10.1186/2041-2223-5-3. ISSN 2041-2223. PMC 3909909  . PMID 24490906.
5. "Eureka moment that led to the discovery of DNA fingerprinting". The Observer. 24 May 2009.
6. Tautz D (1989). "Hypervariability of simple sequences as a general source for polymorphic DNA
markers". Nucleic Acids Research. 17: 6463–6471. doi:10.1093/nar/17.16.6463.
7. Patent Jäckle H & Tautz D (1989) "Process For Analyzing Length Polymorphisms in DNA Regions"
europäische Patent Nr. 0 438 512
8. Eureka moment that led to the discovery of DNA fingerprinting | Science | The Guardian