BMSolutions PDF

BMSolutions.
indd Page SP-1 11/14/17 3:25 PM user /207/WB01592_ISV/XXXXXXXXXX/bmmatter/text_s
SOLUTIONS TO ALL PROBLEMS

Chapter 1 [G6P]/[G1P] = 17.6
1. Typical prokaryotic cells are 1–10 μm in diameter, so T. namibiensis [G1P]/[G6P] = 0.057
is about 10–300 times larger (or has 1000 to 27 million times the −1)/(8.314 J · K−1 · mol−1)(298 K)
15. Keq = e−ΔG°′/RT = e−(−20,900 J · mol
volume). Typical eukaryotic cells are 10–100 μm in diameter, so
T. namibiensis is about the same size or up to 30 times larger (or has = 4.6 × 103
the same to 27,000 times the volume). 16. The cell membrane must be semipermeable so that the cell can
2. The data indicate that eukaryotes are more similar to the archaea retain essential compounds while allowing nutrients to enter and
than to the eubacteria. wastes to exit.
3. An amino or imino group gives a molecule a positive charge; a car- 17. Membrane-enclosed cellular compartments are typical of eukary-
boxylate or phosphoryl group gives a molecule a negative charge. otic but not prokaryotic cells.
4. A Thiol (sulfhydryl) group 18. Concentration = (number of moles)/(volume)
B Carbonyl group Volume = (4/3)πr3 = (4/3)π(6 × 10−7 m)3
C Amide linkage = 9.04 × 10−19 m3 = 9.04 × 10−16 L
D Phosphoanhydride (pyrophosphoryl) linkage Moles of protein = (2 molecules)/(6.022 × 1023 molecules · mol−1)
E Phosphoryl group (Pi) = 3.32 × 10−24 mol
F Hydroxyl group Concentration = (3.32 × 10−24 mol)/(9.04 × 10−16 L)
= 3.67 × 10−9 M = 3.67 nM
5. Hydrolysis reactions tend to occur with an increase in entropy, be-
cause the highly ordered polymer is broken down into separate units. 19. Number of molecules = (molar conc.)(volume)
6. (a) Liquid water; (b) ice has less entropy at the lower temperature. (6.022 × 1023 molecules · mol−1)
7. (a) Decreases; (b) increases; (c) increases; (d) no change. = (1.5 × 10−3 mol · L−1)(9.04 × 10−16 L)
(6.022 × 1023 molecules · mol−1)
8. (a) False. A spontaneous reaction occurs in only one direction.
= 8.2 × 105 molecules
(b) False. Thermodynamics does not specify the rate of a reaction.
20. In order for ΔG to have a negative value (a spontaneous reaction),
(c) True. (d) True. A reaction is spontaneous as long as ΔS > ΔH/T.
TΔS must be greater than ΔH.
9. Yes, the process is spontaneous at higher temperature, that is when
TΔS > ΔH
the temperature of the reaction is greater than ΔH/ΔS.
T > ΔH/ΔS
10. (a) T = 273 + 70 = 343 K T > 8000 J · mol−1/25 J · K−1 · mol−1
ΔG = ΔH − TΔS T > 320 K or 47°C
ΔG = 16 kJ − (343 K)(0.05 kJ · K−1)
= 16 − 17.15 kJ = –1.15 kJ [R]
ΔG is less than zero, so the reaction is spontaneous. 21. (a) Because Keq = = 15, at equilibrium, the concentration of
[Q]
(b) T = 273 + 5 = 278 K
R is 15 times greater than the concentration of Q. When equal con-
ΔG = ΔH − TΔS
centrations of Q and R are mixed, molecules of Q will be converted
ΔG = 16 kJ − (278 K)(0.05 kJ · K−1)
to molecules of R. Thus, reaction will generate more R.
= 16 − 13.9 kJ = 2.1 kJ
ΔG is more than zero, so the reaction is not spontaneous. (b) Let x = amount of Q converted to R, so that [R] will be
11. ΔG = ΔH − TΔS [R]
60 μM + x and [Q] will be 60 μM − x. Since Keq = = 15
ΔG = −10000 J · mol−1 − (298 K)(−35 J · K−1 · mol−1) [Q]
ΔG = −10000 + 10430 J · mol−1 = 430 J · mol−1 60 + x = 15(60 − x)
The reaction is not spontaneous because ΔG > 0. The temperature 60 + x = 900 − 15x
must be decreased in order to decrease the value of the TΔS term. 16x = 840
x = 52.5
[C] [R] = 60μM + 52.5μM = 112.5μM
12. ΔG° ′ = −RT ln
[A][B] [Q] = 60μM − 52.5μM = 7.5μM
(0.010)
= −(8.314 J · K−1 · mol−1)(298 K) ln 22. This strategy will not work because Reaction 1 has a negative en-
(0.002)(0.004)
= −17,667 J · mol−1 = −17.67 kJ · mol−1 thalpy change, releasing heat, and will therefore become more favor-
13. ΔG° ′ = −RT ln Keq = −RT ln([C][D]/[A][B]) able with decreasing temperature, whereas Reaction 2, which has a
= − (8.314 J · K−1 · mol−1) (298 K) ln[(3 × 10−6) positive enthalpy change, will become less favorable. Thus decreas-
(6 × 10−6)/(9 × 10−6) (15 × 10−6)] ing the temperature will favor Reaction 1, not Reaction 2. To make
= 4992 J · mol−1 = 4.992 kJ · mol−1 Reaction 2 more favorable, the temperature must be raised.
Since ΔG°′ is positive, the reaction is endergonic under standard To calculate the amount that the temperature must be raised,
conditions. Equation 1-18 may be used as follows:
14. From Eq. 1-17, Keq = [G6P]/[G1P] = e−ΔG°′/RT −ΔH° 1 −ΔS°
−1 −1 −1 ln Keq = +
[G6P]/[G1P] = e−(−7100 Jmol )/(8.314 J · K · mol )(298 K) R (T ) R
SP-1
BMSolutions.indd Page SP-2 11/9/17 3:27 PM user /207/WB01592_ISV/XXXXXXXXXX/bmmatter/text_s
SP-2
K T1 1 −ΔH°1 1 1 (c) COO– (d) COO–
ln = − )
K T1 2 R ( T1 T2
H C H H C CH2 COO–
−ΔH °2 1
K T2 1 1
ln =
− ) NH+3 NH+3
R ( T1
K T2 2 T2
On subtraction of the previous two equations, and taking into 8. Distilled water molecules move from outside to inside of the dialysis
bag by osmosis (from a region of high concentration to a region of
K T2 1 low concertation). Ions from the cane sugar solution diffuse from
account that = 1, we get
K2T1 the dialysis bag into the surrounding. At equilibrium, the composi-
K 1T1K T2 2 K T2 2 ΔH °2 − ΔH °1 1 1 tions of the solutions inside and outside the dialysis bag are identi-
ln = ln = − ) cal. If the membrane were solute impermeable, essentially all the
T2 T2
K1 K 2 K1 T2
R ( T1 T2
water would enter inside the dialysis bag.
K T2 2 9. (a) Water will move out of the cell by osmosis, from an area of high
We would like T2 = 10, Substituting in all values and solving for
K1 concentration (low solute concentration) to an area of low concen-
T2 we get
tration (high solute concentration). (b) Salt ions would undergo a
K 2T1 28,000 + 28,000 1 1 net movement by diffusion from the surrounding solution (high salt
ln = ln10 = 2.3 = − )
K2 T2
8.31 ( 298 T2 concentration) into the cell (low salt concentration).
10. pH 3, H2PO−4; pH 6, HPO42−; pH 11, HPO42−
Solving for T2 we get
11. pH 4, NH+4; pH 8, NH+4; pH 12, NH3.
1
T2 = = 332 K 12. (a) At pH 7.0, [H+] = 10−7 M, so 10−7 moles of water molecules
1 2.3 × 8.31 have ionized. This is equivalent to (10−7 mol)(6 × 1023 molecules ·
−
298 56,000 mol−1) = 6 × 1016 molecules.
Hence, to increase K2/K1 from 1 to 10, the temperature must be (b) If the concentration of water is 55.5 M, then there are (55.5 mol)
raised from 298 K to 332 K. (6 ×1023 molecules · mol−1) = 3.3 × 1025 molecules of water in
23. At 10°C = 283 K (1/T = 0.00353), Keq = 100 and ln K = 4.61. 1 L. The fraction of ionized molecules is 6 × 1016 molecules)/
At 30°C = 303 K (1/T = 0.00330), Keq = 10 and ln K = 2.30. (3.3 × 1025 molecules) = 1.8 × 10−9 or 1.8 × 10−7%.
These two points generate a line on a van’t Hoff plot (ln Keq versus 13. The increase in [H+] due to the addition of HCl is (30 mL)(l mM)/
1/T) with a positive slope that is equal to (−ΔH°/R). ΔH must (150 mL) = 0.2 mM = 2 × 10−4 M. Because the [H+] of pure wa-
therefore be negative, indicating that enthalpy decreases during the ter, 10−7 M, is relatively insignificant, the pH of the solution is equal
reaction (heat is given off ). to −log(2 × 10−4) or 3.7.
14. (a) (0.012 L)(4 mol · L−1 NaOH)/(1 L) = 0.048 M NaOH ≡
0.048 M OH−
Chapter 2 [H+] = Kw/[OH−] = (10−14)/(0.048) = 2.1 × 10−13 M
pH = −log[H+] = −log(2.1 × 10−13) = 12.7
1. (a) Donors: NH1, NH2 at C2, NH9; acceptors: N3, O at C6, N7.
(b) (0.050 L)(2 mol · L−1 HCl)/(1 L) = 0.1 M HCl ≡ 0.1 M H+
(b) Donors: NH+, NH2 at C4; acceptors: O at C2, N3.
because HCl is a strong acid and breaks completely into H+ and Cl–
(c) Donors: NH+3 group, OH group; acceptors: COO− group, OH group. ions.
2. From most soluble (most polar) to least soluble (least polar): c, b, e, Because the contribution of 0.0010 L × 100 mM/(1 L) = 0.1 mM
a, d. glycine is insignificant in the presence of 0.1 M HCl,
3. 1.8 mL of water has a mass of about 1.8 g; one mole contains about pH = −log[H+] = −log(0.1) = 1.0
6 × 1023 molecules, and the molecular mass of H2O is about 18 g ·
(c) pH = pK + log([acetate]/[acetic acid])
mol−1. Therefore, the spoon holds (1.8 g) (6 × 1023 molecules · mol−1)/
(18 g · mol−1) = 6 ×1022 molecules. [acetate] = (7 g)(1 mol/82 g)/(1 L) = 0.085 M
[acetic acid] = (0.010 L)(3 mol · L−1)/(1 L) = 0.03 M
4. (a) Micelle, with the polar carboxylate group on the surface; (b) in
pH = 4.76 + log(0.085/0.03) = 4.76 + 0.45 = 5.21
the interior of the micelle.
15. Use the Henderson–Hasselbalch equation (Eq. 2-10) and solve for pK:
5. (a) Water; (b) water.
6. (a) (2.4 × 108 ions)(30 g · mol−1)(1 mol/6 × 1023 ions) = 1.2 × [ A− ]
pH = pK + log
10−14 g. Because the mass of the ions is 1% the mass of the cell, the [ HA ]
mass of the cell is 100 times greater, or about 1.2 × 10−12 g. [ A− ]
pK = pH − log
(b) (2 × 108 molecules)(1 mol/6 × 1023 molecules)(150 g · mol−1) = [ HA ]
5 × 10−14 g 0.6
pK = 6.2 − log
The fraction of the cell’s mass due to carbohydrates is (5 × 10−14 g)/ 0.3
(1.2 ×10−12 g) = 0.04 or about 4%. pK = 6.2 − 0.3 = 5.9
(c) (0.008)(1.2 × 10−12 g)(6 × 1023 molecules · mol−1)(1 mol/5.4 × 16. The pK corresponding to the equilibrium between H2PO−4 (HA)
109 g) = 1 and HPO42− (A−) is 6.82 (Table 2-4). The concentration of A− is
7. (a) COO– (b) COO– (50 mL)(2.0 M)/(200 mL) = 0.5 M, and the concentration of HA is
(25 mL)(2.0 M)/(200 mL) = 0.25 M. Substitute these values into the
CH H C H Henderson–Hasselbalch equation (Eq. 2-10):
HC NH2 [ A− ]
pH = pK + log
COO– [ HA ]
SP-3
0.5 From Eq. 2-10 and Table 2-4,
pH = pK + log
0.25 log([A−]/[HA]) = pH − pK = 6.0 − 5.64 = 0.36
pH = 6.82 + log 2 [A−]/[HA] = 100.36 = 2.29
pH = 6.82 + 0.3 = 7.12 (0.075 M − [HA])/[HA] = 2.29
[HA] = 0.023 M
17. (a) Phosphoric acid; (b) piperidine; (c) HEPES.
[A−] = 0.075 M − 0.023 M = 0.052 M
18. The standard free energy change can be calculated using Eq. 1-16
and the value of K from Table 2-4. grams of sodium succinate = (0.023 mol · L−1)(140 g · mol−1) ×
(1 L) = 3.22 g
ΔG°′ = −RT ln K
= −(8.314 J · K−1 · mol−1) (298 K) ln(3.39 × 10−8) grams of disodium succinate = (0.052 mol · L−1)(162 g · mol−1) ×
= 42,600 J · mol−1 = 42.6 kJ · mol−1 (1 L) = 8.424 g
19. U, the energy of association of two charged particles, is equal to 29. The dissociation of TrisH+ to its basic form and H+ is associated
Kq1q2/Dr. Because D, the dielectric constant, for a hydrocarbon is with a large, positive enthalpy change. Consequently, heat is taken
<3 and D for H2O is 78.5, U is at least 26 times greater (78.5 ÷ 3) up by the reactant on dissociation. When the temperature is lowered,
in benzene than in water. there is less heat available for this process, shifting the equilibrium
20. A protonated (and therefore positively charged) nitrogen would pro- constant toward the associated form (the effect of temperature on the
mote the separation of charge in the adjacent C—H bond so that equilibrium constant of a reaction is given by Eq. 1-18). To avoid
the C would have a partial negative charge and the H would have this problem, the buffer should be prepared at the same temperature
a partial positive charge. This would make the H more likely to be as its planned use.
donated to a hydrogen bond acceptor group. 30. (a) Carboxylic acid groups are stronger acids than ammonium
21. The waxed car is a hydrophobic surface. To minimize its interaction groups and therefore lose their protons at lower pH values. This can
with the hydrophobic molecules (wax), each water drop minimizes be seen in Fig. 2-17, where the carboxylic acid group of CH3COOH
its surface area by becoming a sphere (the geometrical shape is 50% dissociated to CH3COO− + H+ at pH 4.7 while it is not until
with the lowest possible ratio of surface to volume). Water does pH 9.25 that the ammonium ion is 50% dissociated to NH3.
not bead on glass, because the glass presents a hydrophilic surface
(b) H3N + CH2COOH ⇌ H3N + CH2COO− + H+ ⇌
with which the water molecules interact. This allows the water to
H2NCH2COO− + 2H+
spread out.
22. Option 2 would reduce the NaCl concentration more effectively. For (c) The pK values of glycine’s two ionizable groups are sufficiently
option 1, the final NaCl concentration in the sample would be different so that the Henderson Hasselbalch equation (Section 2-2B)
adequately describes the behavior of the solution of the diacid and
initial amount of NaCl (0.005L)(0.5M) the monodissociated species.
= = 0.000624M = 0.624mM
total volume 4.005L
For option 2, the NaCl concentration after the first step would be [ A− ]
pH = pK + log
[ HA ]
(0.005L)(0.5M)
= 0.0025M 0.02
1.005L 2.65 = pK + log
0.01
After the second step, the concentration would be
pK = 2.65 − 0.3 = 2.65
(0.005L)(0.0025M)
= 0.0000124M = 0.012mM pH = 6.82 + 0.3 = 7.12
1.005L
23. Pickles are preserved under high salt. The high salt concentration (d) 12
tends to draw out of microorganisms by osmosis, thereby preventing – +H
+
their growth. O
CO
H2
NC
24. Ammonia (NH3) is a base, so as it accumulates, the pH increases. H2
10 –
Oxalic acid (Table 2-4) releases protons to restore the pH to near pK2 O
+ H 2CO
neutral. Mutant cells that cannot produce the acid cannot neutralize H3
NC
the ammonia and die when the pH rises too high.
8
25. The high concentration of bicarbonate in the dialysate means that
some bicarbonate will diffuse from the dialysate across the dialysis
membrane into the patient’s blood, where it will combine with and
pH 6
neutralize excess protons.
26. With a pK value of 9.25, ammonia exists in the blood (pH 7.4) as
NH+4. The ammonium ion is charged, so it will not easily diff use
4 +
across a hydrophobic membrane. – +H
O
27. At pH 4, essentially all the phosphoric acid is in the H2PO− + H 2CO
4 form, NC
pK1 H
and at pH 9, essentially all is in the HPO42− form (Fig. 2-18). There-
3
2
fore, the concentration of OH− required is equivalent to the con- + H 2CO
OH
centration of the acid: (0.010 mol · L−1 phosphoric acid)(0.01 L) = NC
H3
0.0001 mol NaOH required = (0.0001 mol)(1 L/10 mol · L−1
NaOH) = 0.00001 L = 0.01 mL.
0 0.5 1.0 1.5 2.0
28. Let HA = sodium succinate and A− = disodium succinate. H+ ions dissociated/molecule
[A−] + [HA] = 0.075 M, so [A−] = 0.75 M − [HA]
SP-4
Chapter 3 19. Different cell types express different sets of genes. Therefore,
the populations of mRNA molecules used to construct the cDNA
1. Uridine 5′-diphosphate
libraries also differ.
2. Cyclic guanosine monophosphate (cyclic GMP)
20. The desired clones are colorless when grown in the presence of
3. The resulting base is uracil. ampicillin and X-gal. Nontransformed bacteria cannot grow in the
4. NH2 presence of ampicillin, because they lack the ampR gene carried
CH3 by the plasmid. Clones transformed with the plasmid only are blue,
N since they have an intact lacZ gene and produce β-galactosidase,
which cleaves the chromogenic substrate X-gal. Clones that contain
O the plasmid with the foreign DNA insert are colorless because the
N
insert interrupts the lacZ gene.
H 21. Use of the enzymes NarI, BglI, MstI, PvuI, and PvuII would inter-
5-Methylcytosine fere with β-galactosidase production.
5. (a) No; (b) yes. 22. Use of the enzymes AflIII, HgiEIII, SspI, AatII, EcoO109, and NdeI
6. (a) Yes; (b) no. would not interfere with ampicillin resistance or β-galactosidase
7. The DNA contains 40 bases in all. Since G = C, there are 12 cyto- production.
sine residues. The remainder (40 – 24 = 16) must be adenine and 23. (a) Tautomeric form of thymine
thymine. Since A = T, there are 8 adenine residues. There are no
uracil residues (U is a component of RNA but not DNA). H
O O
8. Since the haploid genome contains 24% G, it must contain 24% C
(because G = C) and 52% A + T (or 26% A and 26% T, because H CH3 CH3
N N
A = T). Each cell is diploid, containing 90,000 kb or 9 × 107
bases.
O N H O N H
Therefore,
A= T = (0.26)(9 × 107) = 2.34 × 107 bases R R
C= G = (0.24)(9 × 107) = 2.16 × 107 bases Thymine Thymine
9. The high pH tends to eliminate the hydrogen-bonding protons be- (keto form) (enol form)
tween bases, making it easier to separate the strands of DNA.
(b) Tautomeric form of guanine
10. According to the central dogma, DNA serves as a template for RNA
H
synthesis. The HIV enzyme, called reverse transcriptase, works in O O
reverse by synthesizing DNA from an RNA template.
H
11. At higher NaCl concentrations, there are more Na+ ions to shield N N N N
the negatively charged DNA backbones, thus reducing electrostatic H H
repulsions and requiring more energy to separate the strands. N N
H2N N H2N N
12. The number of possible sequences of four different nucleotides R R
is 4n where n is the number of nucleotides in the sequence.
Guanine Guanine
Therefore, (keto form) (enol form)
(a) 41 = 4, (b) 42 = 16, (c) 43 = 64, and (d) 44 = 256.
13. The ∼3-billion base human genome differs between two individuals 24. The energy of N1 in a purine ring is lowest when it is in its un-
by 1 nucleotide per 1000. Hence they differ by around 3 × 109/1 × charged trivalent form. Thus, protonated and therefore tetravalent
103 = 3 million nucleotides. and positively charged N1 in adenine readily gives up its proton to
water (has a low pK value) to yield its uncharged trivalent form. In
14. Because each amino acid corresponds to three nucleotides (a
contrast, the trivalent N1 of neutral guanine resists donating its pro-
codon), a minimum of 90 nucleotides are required. The corresponding
ton to water (has a high pK value) to yield a divalent and therefore
gene is likely much larger than that, since it must contain additional
negatively charged ion.
sequences—before and after the coding sequence—to facilitate tran-
scription and translation. 25. Unprotonated N3 in cytosine and protonated N3 in uracil are
both trivalent. Consequently, cytosine has a lower pK value than
15. In O. tauri, the gene density is 8000 genes/13,000 kb = 0.62, uracil.
a value that is somewhat lower than that of the prokaryote E.
coli (4300 genes/4639 kb = 0.93) but more than that of the plant 26. CH3
HN
A. thaliana (25,500 genes/119,200 kb = 0.21).
16. (a) AluI, EcoRV, HaeIII, PvuII; (b) HpaII and MspI; (c) BamHI and N N
BglII; HpaII and TaqI; SalI and XhoI.
17. 5′–ACG–3′ 3′–AATTCAAT–5′ N
+ HO CH2 O N
3′–TGCTTAA–5′ 5′–GTTA–3′
H H
18. The genomic library contains DNA sequences corresponding to H H
all the organism’s DNA, which includes genes and nontranscribed
sequences. A cDNA library represents only the DNA sequences OH OH
that are transcribed into mRNA. N6-methyladenosine
SP-5
27. Methylation at N6 leaves one amino hydrogen atom available to par- (b) Suspect 3, whose alleles exactly match those from the blood
ticipate in hydrogen bonding, so the modified residue would be able stain, is the most likely source of the blood.
to participate in standard base pairing with T or U residues. (c) Analysis of each of the three STR loci in this example shows
28. H a match between the sample and Suspect 3, and no matches with
the other suspects. In practice, however, multiple loci are ana-
N O H N N lyzed in order to minimize the probability of obtaining a match
by chance.
N N H N N (d) The peak heights are higher for Suspect 1 compared to Suspect 4,
H H suggesting that more DNA was available for PCR amplification
N N
from Suspect 1.
Hypoxanthine Adenine
29. O Chapter 4
1. Gly and Ala, Ser and Thr; Val, Leu and Ile; Asn and Gln; Asp and Glu.
N O H N 2. (a) β-alanine +H3N—CH2—CH2—COO–
N (b) γ-aminobutyric acid +H3N—CH2—CH2— CH2—COO–
N N H O 3. Arginine, glutamine, and proline.
4. (a) Taurine lacks a carboxylate group at the carbon atom where the
N
amino group is attached.
30. (a) Newly synthesized chains would be terminated less frequently,
(b) Taurine is derived from cysteine. The sulfhydryl group of the
so the bands representing truncated fragments on the sequencing gel
Cys side chain has been oxidized to a sulfonic acid group, and the
would appear faint.
α-carboxylate group has been removed.
(b) Chain termination would occur more frequently, so longer frag-
5. The first residue can be one of the five residues, the second one of
ments would be less abundant.
the remaining four, etc.
31. (a) The amount of DNA synthesis would decrease and the resulting
N = 5 × 4 × 3 × 2 × 1 = 120
gel bands would appear faint.
6. Hydrogen bond donors: α-amino group, amide nitrogen. Hydrogen
(b) No effect.
bond acceptors: α-carboxylate group, amide carbonyl.
32. Use Equation 3-1 to calculate P, given N = 3000 and
7. The negatively charged aspartate —COO– group helps “pull” a
f = 500 kb/2,500,000 kb = 2 × 10–4.
hydrogen ion from the hydroxyl group of the serine side chain.
P = 1 − (1 − f ) N
= 1 − (1 – 2 × 10−4)3000 8.
N NH
= 1 − (1 – 0.9998)3000
= 0.45 COO–
The probability that you have cloned the desired DNA segment is O CH2 O CH2
about 45%. +H
3N CH2 C NH CH C NH CH COO–
33. The C. elegans genome contains 97,000 kb, so
f = 10/97,000 = 1.0 × 10−4 9. (a) +1; (b) 0; (c) –1; (d) –2.
Using Eq. 3-2, 10. (a) +2; (b) +1; (c) 0; (d) –1.
N = log(1 − P)/log(1 − f ) 11.
N = log(1 − 0.99)/log(1 – 1.0 × 10−4) O O– O O– O O–
N = −2/ (−4.34 × 10−5) = 4.6 × 104 C C C

+
34. (a) The first cycle of PCR would yield only the new strand that is H3N C H H C H
O
H C H
O
complementary to the intact DNA strand, since DNA synthesis can- H C CH3 H C C H C C plane of
not proceed when the template is broken. However, since the new O– O– symmetry
H C H HO C H H C H
strand has the same sequence as the broken strand, PCR can proceed
normally from the second cycle on. H C H C C
(b) DNA synthesis would terminate at the breaks in the first cycle of O O– O O–
H
PCR.
35. ATATTCATAGGC and CTGACCAGCGCC. 12. (a) chiral; (b) non-chiral; (c) chiral; (d) chiral; (e) non-chiral;
(f) chiral; (g) chiral; (h) chiral
36. (a) Only single DNA strands of variable length extending from the
remaining primer would be obtained. The number of these strands 13. (a) Glutamate; (b) aspartate
would increase linearly with the number of cycles rather than 14. Decarboxylation of L-DOPA yields dopamine (see Fig. 4-15).
geometrically. 15. Glutamate
(b) PCR would yield a mixture of DNA segments whose lengths 16. Isopeptide bonds can form from the side chain amino group of Lys
correspond to the distance between the position of the primer with and from the side chain carboxylate groups of Asp and Glu.
a single binding site and the various sites where the multispecific 17. COO– O O
primer binds. +
H3N CH CH2 CH2 C NH CH C NH CH2 COO–
37. (a) If an individual is homozygous (has two copies of the same
allele) at a locus, then only one peak will appear in the electropho- CH2
retogram (for example, the D3S1358 locus from Suspect 2). SH
SP-6
28.
18. COO– O
H O CH3 O H O CH3 O H O
NH CH CH2 CH2 C
R HN C C N C C N C C N C C N C C R′
19. (a) pI = (2.35 + 9.78)/2 = 6.06 H H H H
H H CH2 H CH
(b) pI = (8.99 + 12.48)/2 = 10.735
CH H3C CH3
(c) pI = (1.99 + 3.90)/2 = 2.945
20. The relevant ionizable groups for the neutral species are the His side H3C CH3
chain (pKR = 6.04) and the Ser amino group (pK2 = 9.21).
pI = (6.04 + 9.21)/2 = 7.62 29. Phosphorylation of Ser, carboxylation of Glu, and acetylation of Lys
would lower the pI. Hydroxylation of Pro and methylation of His
This value is only an estimate because the pK values of ionizable
would not greatly affect the pI.
groups in free amino acids are not the same as the pK values of the
groups in amino acid residues. 30.
N NH
21. The polypeptide would be even less soluble than free Tyr, because
most of the amino and carboxylate groups that interact with water
and make Tyr at least slightly soluble are lost in forming the peptide O CH2
bonds in poly(Tyr). +H N
3 CH2 CH2 C NH CH COO–
22. (a) The net charge is zero (the N-terminus is positively charged and
the C-terminus is negatively charged). (b) The tripeptide has one
31. (a) +2, (b) +1, (c) 0, (d) –1. The N-terminus (amino group) has
positive and one negative charge. Hydrolysis increases the total
a pK of about 8.0, the C-terminus (carboxylate group) has a pK of
number of charges to 6: one positively charged ammonium group
about 4.0, and the imidazole ring has a pK of about 6.0.
and one negatively charged carboxylate group for each of the three
alanines. 32. (a) Threonine (N-acetylthreonine); (b) lysine (5-hydroxylysine);
O O O O O
(c) methionine (N-formylmethionine)
23. +
H3N CH C NH CH C NH CH C NH CH C NH CH C NH CH COO –
CH3 H C OH CH2 CH2 CH3 (CH2)4
CH3 H C CH3 COO– NH+
3
CH3
Chapter 5
(a) The pK’s of the ionizable side chains (Table 4-1) are 3.90 (Asp) 1. There are 812 or about 69 billion possibilities.
and 10.54 (Lys); assume that the C-terminal Lys carboxyl group has 2. Peptide A, because it contains more aromatic residues as compared
a pK of 3.5 and the N-terminal Ala amino group has a pK of 8.0 to B.
(Section 4-1D). The pI is approximately midway between the pK’s 3. Since there are four Cys residues on the A chain and two on the B
of the two ionizations involving the neutral species (the pK of Asp chain, there are 4 × 2 = 8 possible ways to form a single Cys—Cys
and the N-terminal pK): linkage between the two chains. This leaves three unlinked Cys resi-
1 dues on the A chain and one unlinked Cys residue on the B chain,
pI ≈ (3.90 + 8.0) ≈ 5.95
2 so there are 3 × 1 = 3 ways of forming a second Cys—Cys linkage
(b) The net charge at pH 7.0 is 0 (as drawn above). between the two chains. Hence there are 8 × 3 = 24 ways of form-
COO– COO–
ing two disulfide bonds between the two chains. Hence there are a
24.
+ total of 8 + 24 = 32 ways of disulfide-linking the A and B chains.
+
H3N C H H C NH3 4. Since A = εcl, A = (0.5 mL · mg–1 · cm–1)(2.5 mg · mL–1)(1 cm) =
H C HO C
1.25
OH H
5. Blood circulating at the body’s surface experiences lower tempera-
CH3 CH3 tures than blood in the core of the body, so proteins with low solu-
bility at low temperatures tend to precipitate inside vessels in the
skin. The resulting aggregate of insoluble proteins blocks blood flow
COO– COO–
+
through the vessels, which prevents oxygen delivery and kills nearby
+
H3N C H H C NH3 cells.
6. Lowering the pH from 7.5 to 4.0 would promote the precipitation
HO C H H C OH
of protein Q because the protein will be least soluble when its net
CH3 CH3 charge is zero (when pH = pI).
25. At position A8, duck insulin has a Glu residue, whereas human insu- 7. (a) Glu, Ile, His. (b) Lys, Gly, Glu.
lin has a Thr residue. Since Glu is negatively charged at physiologi- 8. At neutral pH, serum albumin (pI = 4.9) is negatively charged, and
cal pH and Thr is neutral, human insulin has a higher pI than duck ribonuclease A (pI = 9.4) is positively charged. Ribonuclease A
insulin. (The other amino acids that differ between the proteins do will therefore flow through a anion exchange column and can be
not affect the pI because they are uncharged.) recovered, while serum albumin will interact with the cationic di-
ethylaminoethyl groups and can be recovered later by increasing the
26. COO–
salt concentration or decreasing the pH.
+ Replace with CH3 to
H3N C H
give D -Ala
9. The protein contains two 60-kD polypeptides and two 140-kD poly-
peptides. Each 140-kD chain is disulfide bonded to a 60-kD chain.
H
The 200-kD units associate non-covalently to form a protein with a
27. (2S,3S)-Isoleucine molecular mass of 400 kD.
SP-7
10. The protein behaves like a larger protein during gel filtration, sug- 22. (a)
gesting that it has an elongated shape. The mass determined by
SDS-PAGE is more accurate since the mobility of a denatured SDS RNA polymerase
cytochrome c
Absorbance at 280 nm
coated protein depends only on its size.
11. The protein appears to be a tetramer of 110-kD subunits. The sub-
units separate under the denaturing conditions of SDS-PAGE (giv-
ing an apparent mass of 110 kD). Both gel filtration and ultracen-
trifugation are performed under non-denaturing conditions, so the
protein behaves as a 440-kD particle.
12. The protein aggregates at the higher salt concentration.
13. (a) Gly; (b) Gly; (c) none (the N-terminal amino group is acetylated
and hence unreactive with Edman’s reagent); (d) Thr. Elution volume
14. Dansyl chloride reacts with primary amino groups, including the
ε-amino group of Lys residues to yield dansylated polypeptides. (b)
The treatment of a dansylated polypeptide with aqueous acid at high –
temperature hydrolyzes its peptide bonds which thus liberates the
dansylated N-terminal residue. RNA polymerase
15. The mass of an asparagine (N) residue is 114 g · mol–1 and the Direction
of
mass of a lysine (K) residue is 128 g · mol–1 (Table 4-1). Since migration
an intact peptide contains an additional O atom at its C-terminus
and two additional H atoms at its N-terminus, the mass of the
cytochrome c
heptapeptide is (5 × 114) + (2 × 128) + 16 + 2 g · mol–1 =
844 g · mol–1.
+
16. Only fragments resulting from a single peptide bond cleavage and
containing the positively-charged K residue will be detected by the
23. (a)
mass spectrometer because the charges at the N- and C-termini resi-
dues of each fragment cancel each other. These fragments have the
mg Specific activity
sequences NNKNN (the unfragmented but still positively charged
Purification total 𝛍mol (𝛍mol Mb/mg Fold
pentapeptide), NNKN, NNK, NKNN, and KNN, which have the re-
step protein Mb total protein) % yield purification
spective masses 602, 488, 374, 488, and 374.
17. Because the side chain of Gly is only an H atom, it often occurs in 1. Crude 1550 0.75 4.8 × 10–4 100 1
a protein at a position where no other residue can fit. Consequently, extract
Gly can take the place of a larger residue more easily than a larger
residue, such as Val, can take the place of Gly. 2. DEAE 475 0.40 8.4 × 10–4 53 1.75
cellulose
18. A C B chromato-
graphy
3. Affinity 6.0 0.26 4.3 × 10–2 65 from 89.6-fold
chromato- affinity overall
graphy chromato- (51.19
19. There are several possibilities, since the lengths of the branches mat- graphy from
ter but not their positions. For example, (35 overall) affinity
B A C chromato-
graphy)
(b) The DEAE chromatography step results in only a 53% yield,

while the affinity chromatography step results in an 865% yield from
the step before it. The DEAE chromatography step therefore results
in the greatest loss of Mb.
20. (a) Position 6 (Gly) and Position 9 (Val) appear to be invariant. (c) The DEAE chromatography step results in a 1.75-fold purifica-
(b) Conservative substitutions occur at Position 1 (Asp and Lys, tion, while the affinity chromatography step results in a 89.6-fold
both charged), Position 10 (Ile and Leu, similar in structure purification from the previous step. The affinity chromatography
and hydrophobicity), and Position 2 (all uncharged bulky side step therefore results in the greatest purification of Mb.
chains). (d) The affinity chromatography step is the best choice for a one-step
Positions 5 and 8 appear to tolerate some substitution. purification of Mb in this example.
(c) The most variable positions are 3, 4, and 7, where a variety of 24. (a) The extract contains 16 mg · mL–1 × 25 mL = 400 mg protein and
residues appear. has a specific activity of (0.14 μmol–1 · min–1) × [25 mL × (1000 μL/
21. Because protein 1 has a greater proportion of hydrophobic residues mL)/10 μL]/400 mg = 0.875 μmol–1 · min–1 · mg–1. The purified frac-
(Ala, Ile, Pro, Val) than do proteins 2 and 3, hydrophobic interaction tion contains 30 mg · mL–1 × 5 mL = 150 mg protein and has a specific
chromatography could be used to isolate it. activity of (0.65 μmol–1 · min–1) × [5 mL × (1000 μL/mL)/10 μL]/
SP-8
150 mg = 2.16 μmol–1 · min–1 · mg–1. The fold purification therefore is 2. The large side chains of the amino acids all project from the side of
(2.16 μmol–1 · min–1 · mg–1)/(0.875 μmol–1 · min–1 · mg–1) = 2.5. the helix but would still sterically interfere with each other.
(b) The total enzyme activity in the crude extract is (0.14 μmol · 3. There are 10 peptide bonds.
min–1/ 0.010 mL–1) × 25 mL = 350 μmol · min–1, and the total en- 4. (120 residues)(1 α-helical turn/3.6 residues)(5.1 A/keratin turn) =
zyme activity in the purified fraction is (0.65 μmol · min–1/0.010 mL–1) 170 Å
× 5 mL = 325 μmol · min–1, so the % yield is (325 μmol · min–1)/ 5. Wool clothing is made up of α-keratin. The reducing conditions of
(350 μmol · min–1) × 100 = 93%. the digestive tract of the clothes moth promote cleavage of the disul-
25. (a) There is one Met, so CNBr, which cleaves polypeptides after fide bonds that cross-link α keratin molecules. This helps the larvae
Met residues, would produce two peptides, unless Met was the digest the wool clothing that they eat.
C-terminal residue, in which case it would yield one peptide. 6. A fibrous protein such as α keratin does not have a discrete globular
(b) There are four possible sites for chymotrypsin to hydrolyze the core. Most of the residues in its coiled coil structure are exposed to
peptide: following Phe, Tyr (twice), and Trp. This would yield five the solvent. The exception is the strip of nonpolar side chains at the
peptides unless one of the residues was at the C-terminus, in which interface of the two coils.
case it would yield four peptides. 7. Collagen’s primary structure is its amino acid sequence, which is a
(c) Four Cys residues form two disulfide bonds. repeating triplet of mostly Gly–Pro–Hyp. Its secondary structure is
(d) Arbitrarily choosing one Cys residue, there are three ways it can the left-handed helical conformation characteristic of its repeating
make a disulfide bond with the remaining three Cys residues. After sequence. Its tertiary structure is essentially the same as its secondary
choosing one of them, there is only one way that the remaining two structure, as most of the protein consists of one type of secondary
Cys residues can form a disulfide bond. Thus there are 3 × 1 = 3 structure, but with the addition of its side chains. Collagen’s qua-
possible arrangements of the disulfide bonds. ternary structure is the arrangement of its three chains in a right-
26. Thermolysin would yield the most fragments (9) and endopeptidase handed triple helix.
V8 would yield the fewest (2). 8. Because collagen has such an unusual amino acid composition (al-
27. (a) From Sample Calculation 5-1 we see that most two-thirds consists of Gly and Pro or Pro derivatives), it con-
M = (p2 − 1)(p1 − 1)/(p2 − p1) tains relatively fewer of the other amino acids and is therefore not as
good a source of amino acids as proteins containing a greater variety
Therefore
of amino acids.
M = (1789.2 − 1) (1590.6 − 1)/(1789.2 − 1590.6)
9. The residues are 5-hydroxylysine (left) and methionine (right).
= (1788.2) (1589.6)/198.6
= 14,312.8 10. Yes, although such irregularity should not be construed as random.
(b) Peak 5 is p1 in our calculation. From Sample Calculation 5-1, 11. (a) Asn; (b) Thr; (c) Cys; (d) Ile. See Table 6-1.
p1 = (M + z)/z 12. (a) α/β; (b) α; (c) β
1590.6 = (14312.8 + z)/z 13. In a protein crystal, the residues at the end of a polypeptide chain
1590.6z − z = 14312.8 may experience fewer intramolecular contacts and therefore tend to
z(1590.6 − 1) = 14312.8 be less ordered (more mobile in the crystal). If their disorder pre-
z = 14312.8/1589.6 = 9.00 vents them from generating a coherent diffraction pattern, it may be
The charge on the fifth peak in the mass spectrum is 9.00. impossible to map their electron density.
28. (a) The positive charges are caused by the protonation of basic 14. (a) Phe. Ala and Phe are both hydrophobic, but Phe is much larger
side chains (H, K, and R) and the N-terminal amino groups of the and might not fit as well in Ile’s place.
protein. (b) Glu. Replacing a positively charged Lys residue with an oppo-
(b) There are 1 H, 6 K, 11 R, and 1 NH2 at the N-terminus. Therefore, sitely charged Glu residue is likely to be more disruptive.
the maximum number of positive charges that can be obtained is 19. (c) Glu. The amide-containing Asn would be a better substitute for
29. Asp–Met–Leu–Phe–Met–Arg–Ala–Tyr–Gly–Asn Gln than the acidic Glu.
30. Gln–Gly–Phe–Val–Lys–Gly–Tyr–Asn–Arg–Leu–Glu (d) His. Pro’s constrained geometry is best approximated by Gly,
31. Arg–Ile–Pro–Lys–Cys–Arg–Lys–Phe–Gln–Gln–Ala–Gln–His– which lacks a side chain, rather than a residue with a bulkier side
Leu–Arg–Ala–Cys–Gln–Gln–Trp–Leu–His–Lys–Gln–Ala–Asn– chain such as His.
Gln–Ser–Gly–Gly–Gly–Pro–Ser 15. A polypeptide synthesized in a living cell has a sequence that has been
32. Ala Val Cys Arg Thr Gly Cys Lys Asn Phe Leu optimized by natural selection so that it folds properly (with hydro-
phobic residues on the inside and polar residues on the outside). The
random sequence of the synthetic peptide cannot direct a coherent
Tyr Lys Cys Phe Arg His Thr Lys Cys Ser folding process, so hydrophobic side chains on different molecules
aggregate, causing the polypeptide to precipitate from solution.
Chapter 6 16. The formation of hydrogen-bonded β strands in and between the
proteins makes it difficult to solubilize individual protein molecules.
1. H R Furthermore, this stable but nonnative structure may not revert
R R
H H Cα H easily to a native or functional structure.
Cα Cα 17. The brains of the Alzheimer’s-prone mice were already burdened
C N H
with accumulated Aβ, so the PrPSc aggregation augmented the
C N O Cα brain damage, leading to earlier onset of symptoms than in mice
O H R whose brains were not already damaged by Aβ accumulation.
Cis peptide bond Trans peptide bond (There is also some evidence that Aβ oligomers may interact
(steric interference) directly with PrP.)
SP-9
18. O Hence the ratio of the volumes of the office and the office worker
is (4 × 4 × 3)/0.072 = 667. These ratios are similar in magnitude,
which you may not have expected.
NH 32. (a) Each codon corresponds to an amino acid. The probability
that the first residue is correct is 1 – 5 × 10–4 = 0.9995. Hence
O the probability that the entire 600-residue polypeptide is cor-
Pyroglutamate rectly synthesized is (0.9995)600 = 0.74, so that the fraction of
polypeptides containing at least one incorrect amino acid is
1 – 0.74 = 0.26.
19. In forming the lactam, the positive charge of the N-terminal amino
group and the negative charge of the glutamate side chain are lost. (b) For a 2500-residue polypeptide the fraction that is correctly syn-
The resulting protein is less soluble and therefore more prone to thesized is (0.9995)2500 = 0.29, so that the fraction of polypeptides
aggregate. containing at least one incorrect residue is 1 – 0.29 = 0.71.
20. (a) C4 and D2; (b) C6 and D3. 33. An α helix can readily form by a local collapse of a folding poly-
peptide because its hydrogen bonding donors (the backbone N—H
21. Peptide c is most likely to form an α helix with its three charged resi-
groups) are in close proximity to their hydrogen bonding acceptors
dues (Lys, Glu, and Arg) aligned on one face of the helix. Peptide a
(the backbone carbonyl oxygen atoms four residues toward the N-
has adjacent basic residues (Arg and Lys), which would destabilize a
terminus). However, β sheets consist of two or more covalently dis-
helix. Peptide b contains Gly and Pro, both of which are helixbreak-
tant polypeptide strands. The probability of such an assembly form-
ing (Table 6-1).
ing at random during the early stages of folding is much less than the
22. The presence of Gly and Pro in peptide b would inhibit the forma- probability that the hydrogen bonding groups of an α helix will find
tion of β strands, so peptide b is least likely to form a β strand. each other in this manner.
23. Each backbone N—H group in an α helix normally forms a hydro- 34. At elevated temperatures, more protein denaturation is likely, so it is
gen bond to the carbonyl oxygen atom four residues back along the advantageous for a cell to increase the rate at which it can eliminate
chain (toward the N-terminus; Fig. 6-7). Pro, which lacks a back- these nonfunctional and possibly toxic proteins.
bone N—H group, cannot do so and hence its presence in an inte-
35. Oxidation can cause a protein to unfold, so cells increase the pro-
rior position of an α helix destabilizes the helix through the loss of
duction of heat shock proteins to help the damaged proteins refold.
hydrogen bonding to the otherwise carbonyl acceptor. However, the
Under the same conditions, the level of reduced glutathione (GSH)
four most N-terminal residues of an α helix cannot donate hydrogen
decreases and the level of oxidized glutathione (GSSG) increases as
bonds within the α helix. In addition, the pyrrolidine ring of a Pro
oxidized proteins are restored to a reduced state.
residue in the interior of an α helix sterically interferes with the resi-
due one turn towards the N-terminus. Pro residues in the N-terminal
turn of an α helix do not have such steric clashes. Hence Pro resi-
Chapter 7
dues can occupy the N-terminal turn of an α helix.
24. (a) 3.613; (b) steeper. 1. Set b describes sigmoidal binding to an oligomeric protein and
25. (a) The first and fourth side chains of the two helices of a coiled coil form hence represents cooperative binding.
buried hydrophobic interacting surfaces, but the remaining side chains
are exposed to the solvent and therefore tend to be polar or charged. 1.0
(b) Although the residues at positions 1 and 4 in both sequences (a) Monomeric protein:
are hydrophobic, Trp and Tyr are much larger than Ile and Val and 0.8 hyperbolic saturation curve
would therefore not fit as well in the area of contact between the two
polypeptides in a coiled coil. 0.6
26. D6 Y
27. Causing a protein solution to foam greatly increases the area of the 0.4
air–solution interface. Protein molecules at this interface have one (b) Cooperative oligomeric
side out of contact with water. Consequently, that side is not stabi- 0.2 protein: sigmoidal
lized by hydrophobic bonding. Such protein molecules are destabi- saturation curve
lized so that they easily denature. 0
0 0.1 0.2 0.3 0.4 0.5 0.6 0.7
No, denatured proteins will not spontaneously renature. [Ligand] (mM)
28. Intrinsically disordered polypeptide segments would contain rela-
tively more hydrophilic residues because such structures would be
extended and exposed to aqueous solution. Hydrophobic groups 2. 1.0
would tend to aggregate with each other or with other hydrophobic
substances in the cell. 0.8
29. At physiological pH, the positively charged Lys side chains repel
each other. Increasing the pH above their pK (>10.5) would neutral- 0.6
ize the side chains and allow an α helix to form. Y
30. Hydrophobic effects, van der Waals interactions, and hydrogen bonds 0.4
K = 0.6 mM
are destroyed during denaturation. Covalent cross-links are retained.
31. The molecular mass of O2 is 32 D. Hence the ratio of the masses of 0.2
hemoglobin and 4O2, which is equal to the ratio of their volumes,
is 65,000/(4 × 32) = 508. The 72-kg office worker has a volume of 0
0 1 2 3 4 5 6 7
72 kg × 1 cm3/g × (1000 g/kg) × (1 m/100 cm)3 = 0.072 m3. [Ligand] (mM)
BMSolutions.indd Page SP-10 11/11/17 4:55 PM f-389 /207/WB01592_ISV/XXXXXXXXXX/bmmatter/text_s
SP-10
3. For hemoglobin, p50 = 26 torr. Let the Hill constant, n, equal 3. 9. The increased BPG helps the remaining erythrocytes deliver O2 to
(pO2 ) n tissues. However, BPG stabilizes the T conformation of hemoglo-
YO2 = bin, so it promotes sickling and therefore aggravates the disease.
(p50 ) n + (pO2 ) n
10. (a) A Lys residue is positively charged and therefore would not bind
(a) in the hydrophobic pocket to which the side chain of Val 6 in hemo-
3
(30) 27000 globin S binds (as is also the case for the negatively charged Glu 6 in
YO2 = = = 0.61
(26) + (30)
3 3
17576 + 27000 normal hemoglobin). Hence, hemoglobin C does not polymerize as
(b) does hemoglobin S. (b) The shorter lifetime of red blood cells con-
taining hemoglobin C would reduce the time that Plasmodium can
(50) 3 125000
YO2 = = = 0.88 spend inside the cell, thereby helping to limit infection by the parasite.
(26) 3 + (30) 3 17576 + 125000
11. Myosin is both fibrous and globular. Its two heads are globular, with
(c) several layers of secondary structure. Its tail, however, consists of a
(70) 3 343000 lengthy, fibrous coiled coil.
YO2 = = = 0.95
(26) + (70)
3 3
17576 + 343000 12. Microfilaments consist entirely of actin subunits that are assembled in
a head-to-tail fashion so the polarity of the subunits is preserved in the
4. Let the Hill constant, n, equal 3 and use Equation 7-8 to solve for p50.
fully assembled fiber. In keratin filaments, however, successive het-
(pO2 ) n erodimers align in an antiparallel fashion, so that in a fully assembled
YO2 =
(p50 ) n + (pO2 ) n intermediate filament, half the molecules are oriented in one direction
and half are oriented in the opposite direction (Fig. 6-16).
(pO2 ) n
(p50)n + (pO2)n = 13. Each cell of striated muscle is a muscle fiber with numerous sar-
YO2
comeres positioned end-to-end. If cytokinesis occurred more fre-
(pO2 ) n quently, individual muscle cells would be much shorter. Sarcomeres
(p50)n = − (pO2)n located in separate small cells would likely not align optimally, and
YO2
the overall shortening of the muscle would be less.
(50) 3 125000 14. In the absence of ATP, each myosin head adopts a conformation that
(p50)n = − (50)3 = − 125000
0.86 0.86 does not allow it to release its bound actin molecule. Consequently,
thick and thin filaments form a rigid cross-linked array.
(p50)n = 20348.8
p50 = 27.3 torr 15. Because many myosin heads bind along a thin filament where it
overlaps a thick filament, and because the myosin molecules do not
5. (a) Lower; (b) higher. The Asp 99β → His mutation of hemoglo-
execute their power strokes simultaneously, the thick and thin fila-
bin Yakima disrupts a hydrogen bond at the α1–β2 interface of the
ments can move past each other by more than 100 Å in the interval
T state (Fig. 7-9a), causing the T⇌R equilibrium to shift toward
between power strokes of an individual myosin molecule.
R state (lower p50). The Asn 102β → Thr of hemoglobin Kansas
causes the opposite shift in the T⇌R equilibrium by abolishing an 16. Because cell volume is constant, the sarcomeres must widen as they
R-state hydrogen bond (Fig. 7-9b). shorten. As a result, the distance from each myosin head to its bind-
6. High-altitude adaptation includes the production of additional red ing site on an actin filament increases, diminishing the ability of the
blood cells, which would increase the oxygen-delivery capacity of myosin heads to pull on the thin filament.
the body at both high and low altitude. The production of red blood 17. Actin is normally sequestered within cells. When an intracellular
cells requires several weeks, so a day or two at high elevation would infection kills the host cell, the actin is released, alerting the immune
not provide much advantage for the runner. system to the presence of the pathogen.
7. (a) Vitamin O is useless because the body’s capacity to absorb oxy- 18. The antigenic site in the native protein usually consists of several
gen is not limited by the amount of oxygen available, but by the abil- peptide segments that are no longer contiguous when the tertiary
ity of hemoglobin to bind and transport O2. Furthermore, oxygen structure of the protein is disrupted.
is normally introduced into the body via the lungs, so it is unlikely 19. (a) 150–200 kD; (b) 150–200 kD; (c) ∼23 kD and 53–75 kD
that the gastrointestinal tract would have an efficient mechanism for
20. The loops are on the surface of the domain, so they can tolerate more
extracting oxygen.
amino acid substitutions. Amino acid changes in the β sheets would
(b) The fact that oxygen delivery in vertebrates requires a dedicated be more likely to destabilize the domain.
O2-binding protein (hemoglobin) indicates that dissolved oxygen by
21. (a) 12; (b) 60
itself cannot attain the high concentrations required. Moreover, a few
drops of vitamin O would make an insignificant contribution to the 22. The fish IgM molecule has the structure (H2L2)4J.
amount of oxygen already present in a much larger volume of blood. Total mass = 4[(2 × 75 kD) + (2 × 25 kD)] + 20 kD = 820 kD
8. (a) Because the mutation destabilizes the T conformation of hemo- 23. According to Eq. 7-6,
globin Rainier, the R (oxy) conformation is more stable. Therefore, pO2
the oxygen affinity of hemoglobin Rainier is greater than normal. YO2 =
K + pO2
(b) The ion pairs that normally form in deoxyhemoglobin absorb
protons. The absence of the ion pairs in hemoglobin Rainier de- When pO2 = 11 torr,
creases the Bohr effect (in fact, the Bohr effect in hemoglobin Rain- 11
ier is about half that of normal hemoglobin). YO2 = = 0.80
2.8 + 11
(c) Because the R conformation of hemoglobin Rainier is more stable When pO2 = 1 torr,
than the T conformation, even when the molecule is not oxygenated,
O2-binding cooperativity is reduced. The Hill constant of hemoglo- 1
YO2 = = 0.26
bin Rainier is therefore less than that for normal hemoglobin. 2.8 + 1
SP-11
The difference in YO2 values is 0.80 – 0.26 = 0.54. Therefore, in ac- 31. Cleaving the IgA molecules into separate Fab fragments destroys
tive muscle cells, myoglobin can transport a significant amount of their ability to cross-link antigens. Although the Fab fragments can
O2 by diffusion from the cell surface to the mitochondria. still bind to the bacteria, the bacteria will not become trapped in a
24. Using Equation 7-8 and a p50 value of 26 torr to calculate a frac- cross-linked network and can still initiate an infection.
tional saturation shows that when pO2 = 11 torr, 32. (a) Normally DNA is intracellular and not accessible to B cells, so no
anti-DNA antibodies are produced. For substances such as phospho-
11
YO2 = = 0.30 lipids, which are present on cell surfaces, the body’s self-tolerance
26 + 11
mechanisms prevent antibody production. (b) In an autoimmune
When pO2 = 1 torr, disease such as SLE, there is an essentially unlimited supply of an-
tigens, so the resulting antigen–antibody complexes overwhelm the
1
YO2 = = 0.03 mechanisms that normally clear the complexes from the body.
26 + 11
The difference in these quantities, 0.30 − 0.03 = 0.27, is relatively
small [about half of the 0.52 difference exhibited by normal myoglo-
Chapter 8
bin (p50 = 2.8 torr) under the same conditions; see Problem 23] and
hence this hypothetical myoglobin would be relatively ineffective in 1. (a), (d)
facilitating the diffusion of O2. 2. (a), (c)
25. (a) Hyperventilation eliminates CO2, but it does not significantly 3. (a) 4; (b) 8; (c) 8; (d) 16
affect the O2 concentration, since the hemoglobin in arterial blood is
4. (a) Yes; (b) no (its symmetric halves are superimposable); (c) no.
already essentially saturated with oxygen.
(b) The removal of CO2 also removes protons, according to the 5. O H
reaction C
H+ + HCO−
3 ⇌ H2O + CO2 HO C H
The resulting increase in blood pH would increase the O2 affinity H C OH

of hemoglobin through the Bohr effect. The net result would be
that less oxygen could be delivered to the tissues until the CO2 bal- H C OH
ance was restored. Thus, hyperventilation has the opposite of the HO C H
intended effect (note that since hyperventilation suppresses the urge
to breathe, doing so may cause the diver to lose consciousness due CH3
to lack of O2 and hence drown). L-Fucose
26. 1.0 L-Fucose is the 6-deoxy form of L-galactose.
6. (a) CH2OH CH2OH

CHOH
O OH O OH
OH OH
Y 0.5 HO
OH OH
Pyranose form Furanose form
0 (b) H
pO2
H O H HOH2C O
27. The Hill constant most likely has a value between 1 (no cooperativity) H
H
and 2 (infinite cooperativity between the two subunits). H H H H
HO OH H OH
28. As the crocodile remains under water without breathing, its
metabolism generates CO2 and hence the HCO− 3 content of its blood OH OH OH OH
increases. The HCO− 3 preferentially binds to the crocodile’s deoxy- Pyranose form Furanose form
hemoglobin, which allosterically prompts the hemoglobin to as-
sume the deoxy conformation and thus release its O2. This helps the 7. Tagatose is derived from galactose.
crocodile stay under water long enough to drown its prey. 8. –2O POCH O
3 2 CH2OH
29. The newly synthesized microfilaments would have a higher propor-
H HO
tion of actin subunits that have not yet hydrolyzed their bound ATP.
H OH
Older microfilaments would contain relatively more ADP in the
nucleotide-binding sites of the actin subunits. HO H
30. (a) Fab fragments are monovalent and therefore cannot cross-link 9. CH2OH
antigens to produce a precipitate. (b) A small antigen has only one
antigenic site and therefore cannot bind more than one antibody to H O OH
produce a precipitate. (c) When antibody is in great excess, most H
antibodies that are bound to antigen bind only one per immunoglob- OH H
HO H
ulin molecule. When antigen is in excess, most immunoglobulins
bind to two independent antigens. H SH
SP-12
10. Rhamnose is a deoxy sugar (6-deoxy-L-mannose). 21. 19. C1 of one glucopyranose can form α or β glycosidic linkages with
11. Galactose is linked to fructose by a β(1→6) bond. C1, C2, C3, C4, or C6 of a second glucopyranose, which can also be
12. HOCH2 in the α or β form. However, α-glucose-(1→1)-β-glucose is identical
to β-glucose-(1→1)-α-glucose, so the total is 19 rather than 20.
O
H H H 22. There are 35 in addition to lactose. The first sugar can form α or β
glycosidic bonds with C2, C3, C4, or C6 of the second sugar, which
OH HO
HO can have the α or β form. In this way, glucose can form 16 different
linkages to galactose, and galactose can form 16 different linkages to
HOCH2 H H glucose. In addition, the anomeric carbons can link to each other for
four more options, giving a total of 36: α-glucose-(1→1)-α-galactose,
H
O
H O α-glucose-(1→1)-β-galactose, β-glucose-(1→1)- α-galactose, and
H β-glucose-(1→1)-β-galactose.
OH HO CH2 23. (a) α-D-glucose-(1→1)-α-D-glucose. (b) The numerous hydrogen
HO O
O bonding —OH groups of the disaccharide act as substitutes for
H O water molecules. Because trehalose is a non-reducing sugar, it is
H H H
HO unlikely to participate in oxidation–reduction reactions with other
HO H biomolecules when it is present at high concentrations.
H H 24. CH2OH
13. One Cl O H ClCH2 O H

14. Amylose (it has only one non-reducing end from which glucose can H
be mobilized). OH H H HO
H O CH2Cl
15. Glucosamine is a building block of certain glycosaminoglycan
components of proteoglycans (Fig. 8-12). Boosting the body’s H OH OH H
supply of glucosamine might slow the progression of the disease
osteoarthritis, which is characterized by the degradation of proteo- 25. (a) There are four types of methylated glucose molecules, cor-
glycan-rich articular (relating to a joint) cartilage. [Note, however, responding to (1) the residue at the reducing end of the glycogen
that clinical trials indicate that glucosamine does not affect the molecule, (2) residues at the non-reducing ends, (3) residues at the
progress of osteoarthritis.] α(l→6) branch points, and (4) residues from the linear α(l→4)-linked
segments of glycogen. Type 4 is the most abundant type of residue.
16. COO–
(b) The most abundant structure
O
H CH2OCH3
H
OH H H O H
H O H
H OCH3 H
OH
HO OH
17. −300
18. The growth factor is rich in Lys and Arg. These positively charged H OCH3
groups can interact with the negatively charged groups of glycos-
aminoglycans. 26. COO– H
19. CH2OH CH2OH H O H O H

H COO–
HO O H O OH O
H H OH HO OH HO
HO H OH
O
OH H OH H
H H H H H H H
Gal
H O H NH 27. CH2OH CH2OH
GlcNAc
O C O O
H HO H OH
H H
CH3
H O O
CH3 OH H OH H
H H H
H HO
HO H H O H OH
OH H H
Fuc
H O
20. Each population of glycoprotein molecules is a mixture of glycoforms CH3
that differ slightly in size and possibly charge due to the heterogeneity
H HO
in the number and structure of their oligosaccharide groups. In OH H
contrast, the non-glycosylated protein molecules are all identical and
therefore exhibit no variation in their electrophoretic mobility. OH H
SP-13
28. (a) One 11. O
(b) H3COCH2 OH
O N
H OH H
H
OCH3 H
HO H
12. Eicosanoids synthesized from arachidonic acid are necessary for
H OCH3 intercellular communication. Cultured cells do not need such com-
munication and therefore do not require linoleic acid.
29. The cationic Ca2+ ions shield the negative charges of the glycos-
13. Triacylglycerols lack polar head groups, so they do not orient them-
aminoglycans in the proteoglycans, so that they can be stored in
selves in a bilayer with their acyl chains inward and their glycerol
a relatively small volume inside the cell. When the Ca2+ ions are
moiety toward the surface.
pumped out, the repulsion between the glycosaminoglycan chains
causes them to expand in the extracellular space. 14. The large oligosaccharide head groups of gangliosides would
30. The pores in the peptidoglycan structure allow nutrients to diff use prevent the necessary close packing of the lipids in a bilayer.
through the cell wall to the cell surface, where they can be trans- 15. The branched and ring-containing fatty acids will increase mem-
ported across the plasma membrane into the cell. brane fluidity because they cannot pack next to other lipids as
efficiently as straight-chain fatty acids.
Chapter 9 16. (a) Unsaturated; (b) short-chain. By increasing the proportion of
unsaturated and short-chain fatty acids, which have lower melting
1. trans-Oleic acid has a higher melting point because, in the solid points, the bacteria can maintain constant membrane fluidity at the
state, its hydrocarbon chains pack together more tightly than those lower temperature.
of cis-oleic acid.
17. Yes. The tropical fish have longer and more saturated fatty acids
2. The triacylglycerol containing the stearic acid residues yields more compared to Antarctic icefish in order to maintain membrane fluid-
energy since it is fully reduced. ity at the higher temperature at which they live.
3. 1-palmitoyl-2-myristoleoyl-3-phosphatidylserine 18. (a) (1 turn/5.4 A)(30 A) = 5.6 turns
4. (b) (3.6 residues/turn)(5.6 turns) = 20 residues
O (c) The additional residues form a helix, which partially satisfies
CH2 O C (CH2)16CH3 backbone hydrogen bonding requirements, where the lipid head
O
groups do not offer hydrogen bonding partners.
H3C(CH2)5CH CH(CH2)7 C O CH O
19. No. Although the β strand could span the bilayer, a single strand
CH2 O P O CH2CH2NH3+ would be unstable because its backbone could not form the hydro-
gen bonds it would form with water in aqueous solution.
O–
20. (a) Inner; (b) outer. See Fig. 9-32.
5. Of the 4 × 4 = 16 pairs of fatty acid residues at C1 and C3, only 10 21. Phosphatidylserine is normally present only in the inner leaflet of
are unique because a molecule with different substituents at C1 and the cell membrane (see Fig. 9-32). A damaged cell that is no longer
C3 is identical to the molecule with the reverse substitution order. spending the energy of ATP to maintain lipid asymmetry will dis-
However, C2 may have any of the four substituents for a total of 4 × play PS on its outer surface and will therefore be consumed by the
10 = 40 different triacylglycerols. macrophage.
6. All except choline can form hydrogen bonds. 22. Steroid hormones, which are hydrophobic, can diff use through the
cell membrane to reach their receptors.
7. No; the two acyl chains of the “head group” are buried in the bilayer
interior, leaving a head group of diphosphoglycerol. 23. The sulfatide is a galactocerebroside. It differs from other cerebro-
sides in having a sulfate group covalently linked to C3 of the galac-
8. (a) Stearic acid and 2-palmitoyl-3-phosphatidylcholine; tose group.
(b) Palmitic acid and 1-stearoyl-3-phosphatidylcholine; 24. Both DNA and phospholipids have exposed phosphate groups that
(c) Phosphocholine and 1-stearoyl-2-palmitoyl-glycerol; are recognized by the antibodies.
(d) Choline and 1-stearoyl-2-palmitoyl-phosphatidic acid. 25. The monosaccharide groups are glucosamine-4-phosphate (left)
9. (a) and glucosamine-1-phosphate (right). Four 3-hydroxy-tetradecanoyl
(β-hydroxy-myristoyl) groups are attached via ester or amide bonds
O OH to the glucosamine groups, and two of these chains have additional
– tetradecanoyl (myristoyl) groups esterified to their hydroxyl groups.
O P O CH2 CH CH CH CH (CH2)12 CH3
26. The archaeal lipid includes isoprenoid tails whereas phosphatidylg-
–
O NH3+ lycerol includes fatty acyl tails. The chains are attached to the glyc-
erol backbone by ether linkages in the archaeal lipid, and by ester
(b) To convert sphingomyelin to sphingosine-1-phosphate, a por- linkages in phosphatidylglycerol.
tion of the head group (typically choline or ethanolamine) must be 27. Proteins that are tethered to membranes via N-myristoylation
hydrolytically cleaved, leaving a phosphate group, and the amide would be set free by the action of an enzyme that cleaved away the
linkage to the fatty acyl group must be hydrolyzed. N-terminal glycine to which the fatty acyl group was attached.
10. This lipid is ceramide-1-phosphate, produced by the phosphorylation [This is just one event during infection by Shigella, which produces
of the ceramide derived from a sphingomyelin. ∼20 proteins that interfere with host cell function.]
SP-14
28. The positively charged Arg side chains interact with the two nega- = (8.314 J · K−1 · mol−1) (310 K) ln (10−7/10−3)
tively charged phosphate groups of cardiolipin. + (2)(96,485 J · V−1 · mol−1)(−0.056 V)
29. (a) Both the intra- and extracellular portions will be labeled. (b) = −23,700 J · mol−1 − 10806 J · mol−1
Only the extracellular portion will be labeled. (c) Only the intracel- = −34,506 J · mol−1 = −34.5 kJ · mol−1
lular portion will be labeled.
The negative value of ΔG indicates a thermodynamically favorable
30. For a neuron to repeatedly release neurotransmitters, the compo- process.
nents of its exocytotic machinery must be recycled. Following the
fusion of synaptic vesicles with the plasma membrane, the four helix [ Ca2+ ] in
(b) ΔG = RT ln + ZℱΔΨ
SNARE complex is disassembled so that the Q-SNAREs remain in [ Ca2+ ] out
the plasma membrane while portions of the membrane containing
R-SNAREs can be used to re-form synaptic vesicles. This recycling = (8.314 J · K−1 · mol−1) (310 K) ln (10−7/10−3)
process would not be possible if the R- and Q-SNAREs remained + (2)(96,485 J · V−1 · mol−1)(+0.145 V)
associated, and the neuron would eventually be unable to release = −23,700 J · mol−1 + 27,980 J · mol−1
neurotransmitters. = +4,280 J · mol−1 = +4.2 kJ · mol−1
31. (a) Type O individuals are universal donors because their red cells do The positive value of ΔG indicates a thermodynamically unfavor-
not carry A or B antigens. Hence, the anti-A antibodies in the plasma able process.
of types B and O individuals or the anti-B antibodies in the plasma
4. ΔG = RT ln ([K+]in /[K+]out) + ZℱΔΨ
of types A and O individuals will not agglutinate (cross-link) these
cells. Type AB individuals are the universal recipients because their = (8.314 J · K−1 · mol−1) (310 K) ln (0.16/0.004)
blood plasma contains neither anti-A nor anti-B antibodies so that it + (1) (96,485 J · V−1 · mol−1) (−0.080 V)
will not agglutinate the red cells from donors with other blood types. = 9507 J · mol−1 − 7718 J · mol−1
(b) Blood plasma from type A individuals contains anti-B antibod- = 1789 J · mol−1 = 1.79 kJ · mol−1
ies that agglutinate blood cells from types B and AB individuals.
5. (a) Nonmediated; (b) mediated; (c) nonmediated; (d) mediated.
Likewise, type B blood plasma agglutinates blood cells from types
A and AB individuals. Plasma from type O individuals contains 6. The less polar a substance, the faster it can diff use through the lipid
anti-A and anti-B antibodies and therefore agglutinates blood cells bilayer. From slowest to fastest: A, C, B.
from type A, B and AB individuals. However, plasma from type AB 7. Positively charged Lys and Arg would be relatively abundant at the
individuals lacks both anti-A and anti-B antigens and hence does not entrance of the pore, so as to attract the negatively charged phos-
agglutinate cells from all blood types (A, B, AB, and O). phate ions and repel cations.
(c) Any anti-A and/or anti-B antibodies in blood that is transfused into 8. An eight-stranded β barrel has a solid core. A β barrel with 16 or
a recipient are rapidly diluted in an “incompatible” recipient’s blood 18 strands has a diameter large enough to accommodate a pore for
to the point that they do not agglutinate the recipient’s blood cells. solute transport.
32. The mutant signal peptidase would cleave many preproteins within
9. The presence of a series of K+ ions within the channel prevents
their signal peptides, which often contain Leu–Leu sequences. This
water molecules from forming a hydrogen-bonded chain.
would not affect translocation into the ER, since signal peptidase
acts after the signal peptide enters the ER lumen. Proteins lacking 10. (a) Acetylcholine binding triggers the opening of the channel, an
the Leu–Leu sequence would retain their signal peptides. These pro- example of a ligand-gated transport protein.
teins, and those with abnormally cleaved signal sequences, would be (b) Na+ ions flow into the muscle cell, where their concentration is low.
more likely to fold abnormally and therefore function abnormally. (c) The influx of positive charges causes the membrane potential to
increase.
11. A channel provides an open pore across the membrane, whereas a
Chapter 10
pump operates by changing its conformation in an ATP-dependent
[ glucose] in manner. The additional time required for ATP hydrolysis and protein
1. ΔG = RT ln
[ glucose] out conformation changes causes ion movement through a pump to be
(0.005) slower than through a channel.
= (8.314) J · K−1 · mol−1 (298 K) ln
(0.007) 12. (a) Xylose moves up its gradient; since protons move down their
= −832.46 J · mol−1 = −0.83 kJ · mol−1 gradient into the cell, the xylose also moves into the cell.
2. (a) ΔG = RT ln ([Na+]in/[Na+]out)
= (8.314 J · K−1 · mol−1) (310 K) ln (0.02/0.30) (b) extracellular space
= (8.314) (310) (−2.71) J · mol−1 cytosol

T
= − 6980 J · mol−1 = −7.0 kJ · mol−1
H+
(b) ΔG = RT ln([Na+]in/[Na+]out) + ZℱΔΨ xylose
= −6980 + (1) (96,485 J · V−1 mol−1) (−0.07 V)
= −6980 J · mol−1 − 6754 J · mol−1
= −13,734 J · mol−1 = −13.7 kJ · mol−1
3. Use Equation 10-3 and let Z = 2 and T = 310 K: 13. Overexpression of an MDR transporter would increase the ability of
2+
the cancer cell to excrete anticancer drugs. Higher concentrations of
[ Ca ] in the drugs or different drugs would then be required to kill the drug
(a) ΔG = RT ln 2+
+ ZℱΔΨ
[ Ca ] out resistant cells.
SP-15
14. In the absence of ATP, Na+ extrusion by the (Na+−K+)–ATPase potential predator, after being stung by the scorpion, is more likely
would cease, so no glucose could enter the cell by the Na+–glucose to let it go than to try eating it.
symport. The glucose in the cell would then exit via the passive- 22. (a) The data do not indicate the involvement of a transport protein,
mediated glucose transporter, and the cellular [glucose] would de- since the rate of transport does not approach a maximum as [X]
crease until it matched the extracellular [glucose] (of course, the cell increases. (b) To verify that a transport protein is involved, increase
would probably osmotically burst before this could occur). [X] to demonstrate saturation of the transporter at high [X], or add
15. In order for the protein to function as an antiporter, H+ must move a structural analog of X to compete with X for binding to the trans-
into the cell, down its concentration gradient (which provides the porter, resulting in a lower flux of X.
free energy to drive Na+ export). Therefore, the extracellular space 23. The hyperbolic curve for glucose transport into pericytes indicates a
has a lower pH (higher H+ concentration). protein-mediated sodium-dependent process. The transport protein
16. K+ transport ceases because the ionophore-K+ complex cannot dif- has binding sites for sodium ions. At low [Na+], glucose transport
fuse through the membrane when the lipids are immobilized in a is directly proportional to [Na+]. However, at high [Na+], all Na+
gel-like state. binding sites on the transport protein are occupied, and thus glu-
17. The number of ions to be transported is cose transport reaches a maximum velocity. Glucose transport into
(20 mM) (100 μm3)(N) endothelial cells is not sodium-dependent and occurs at a high rate
= (0.020 mol · L−1)(10−13 L) (6.02 × 1023 ions · mol−1) whether or not Na+ is present. There is not enough information in
the figure to determine whether glucose transport into endothelial
= 1.2 × 109 ions
cells is protein-mediated.
Since there are 1000 ionophores, each must transport 1.2 × 106 ions.
24. (a) pH = −log[H+] = −log(0.15) = 0.82
Since the rate of transport by valinomycin is 104 ions per second, the
time required is (1.2 × 106 ions) (1 s/104 ions) = 120 s = 2 min. The pH of the secreted HCl is more than 6 pH units lower than the
cytosolic pH, which corresponds to a [H+] of ∼4 × 10−8 M.
18. (a) A transporter similar to a porin would be inadequate since even
a large β barrel would be far too small to accommodate the massive (b) CO2 + H2O ⇌ HCO−3 + H+
ribosome. Likewise, a transport protein with alternating conforma- (c)
tions would not be up to the task due to its small size relative to the K+ K+
ribosome. In addition, neither type of protein would be suited for H+ Cl–
transporting a particle across two membranes. (In fact, ribosomes
and other large particles move between the nucleus and cytoplasm
via nuclear pores, which are constructed from many different pro-
H+ Cl–
teins and form a structure that is much larger than the ribosome and
spans both nuclear membranes.)
(b) Ribosomal transport might appear to be a thermodynamically K+
favorable process, since the concentration of ribosomes is greater
in the nucleus, where they are synthesized. However, free energy
would ultimately be required to establish a pore (which would span
two membrane thicknesses) for the ribosome to pass through. (In
fact, the nucleocytoplasmic transport of all but very small substances Chapter 11
requires the activity of GTPases that escort particles through the
nuclear pore assembly and help ensure that transport proceeds in 1. c
one direction.) 2. As shown in Table 11-1, the only relationship between the rates of
19. (a) No; there is no glycerol backbone. catalyzed and uncatalyzed reactions is that the catalyzed reaction
is faster than the uncatalyzed reaction. The absolute rate of an un-
(b) Miltefosine is amphipathic and therefore cannot cross the para-
catalyzed reaction does not correlate with the degree to which it is
site cell membrane by diffusion. Since it is not a normal cell compo-
accelerated by an enzyme.
nent, it probably does not have a dedicated active transporter. It most
likely enters the cell via a passive transport protein. 3. (a) oxidoreductase (lactate dehydrogenase); (b) lyase (pyruvate de-
(c) This amphipathic molecule most likely accumulates in mem- carboxylase).
branes, with its hydrophobic tail buried in the bilayer and its polar 4. (a) isomerase (alanine racemase); (b) ligase (glutamine synthetase).
head group exposed to the solvent. 5. The tighter S binds to the enzyme, the greater the value of ΔGE‡ . As
(d) The protein recognizes the phosphocholine head group, which the value of ΔG ‡E for reaction c approaches that of ΔG ‡N, the
also occurs in some sphingolipids and some glycerophospholipids. rate of the enzyme-catalyzed reaction approaches the rate of the
Since the protein does not bind all phospholipids or triacylglycerols, non-enzymatic reaction.
it does not recognize the hydrocarbon tail.
20. (a) Ammonia is small and uncharged and therefore was expected
to be able to pass across a membrane by simple diffusion. (b) The ‡
ΔGN
ammonia concentration gradient drives ammonia transport (passive a
mediated transport). (c) The proton pump is an ATP-requiring active
G
transport system. The combination of H+ and NH3 outside the cell ‡
ΔGE
b
forms NH4+ , which, because it is ionic, is unable to reenter the cell ΔGE
‡
via the ammonia channel. c

21. By delaying inactivation of the Na+ channels, the action potential
is prolonged, which leads to greater pain signaling. As a result, a Reaction coordinate
SP-16
6. There are three transition states (X‡) and two intermediates (I). The active site can bind at least six monosaccharide units, (NAG)6 would
reaction is not thermodynamically favorable because the free energy be more tightly bound to the enzyme than (NAG)4, and this addi-
of the products is greater than that of the reactants. tional binding free energy would be applied to distorting the D ring
to its half-chair conformation, thereby facilitating the reaction.
‡
X1 16. The mutations would diminish lysozyme’s activity because the re-
moval or addition of a methylene group would move the Glu and Asp
‡
X2 carboxyl groups from their catalytically most effective positions.
17. (a) Little or no effect; (b) catalysis would be much slower because
the mutation disrupts the function of the catalytic triad.
‡
I1 X3
18. Although the polymeric chains of cellulose, which are β(1→4)-
linked glucose residues, have the same overall configuration as the
G
I2 NAG—NAM repeating disaccharide of lysozyme’s primary substrate
peptidoglycan, cellulose chains typically occur in hydrogen-bonded
networks, which would make them unavailable to bind in the surface
groove of the enzyme. In addition, the absence of the N-acetyl and
lactyl groups on the sugar residues would prevent them from fitting
snugly into the active site, a prerequisite for efficient catalysis.
Reaction coordinate 19. O CH3 O
CH3 S NH CH C CH2Cl
7. At 25°C, every 10-fold increase in rate corresponds to a decrease of
about 5.7 kJ · mol−1 in ΔG‡. For the nuclease, with a rate enhance- O
ment on the order of 1014, ΔG‡ is lowered about 14 × 5.7 kJ · mol−1,
Tosyl-L-alanine chloromethylketone or
or about 80 kJ · mol−1. Alternatively, since the rate enhancement, k,
is given by k = eΔΔGcat /RT ,
‡
H3C CH3
ln k = ln (1014 ) = ΔG‡cat/8.3145 × (273 + 25)
O CH O
Hence ΔG‡cat = 80 kJ · mol −1.
8. Assuming that the free energy of a low-barrier hydrogen bond is CH3 S NH CH C CH2Cl
−40 kJ · mol−1, the rate enhancement would be O
Rate enhancement = eΔΔGcat /RT
‡
−1 −1 −1 Tosyl-L-valine chloromethylketone
= e(40,000 J · mol )/(8.314 J · K · mol )(298 K)
= e16.14 20. (a) His
= 107 CH2 Lys
9. As the temperature increases, thermal energy boosts the proportion CH2
of reactants that can achieve the transition state per unit time, so the H N CH2
rate increases. Above an optimal temperature, the enzyme becomes N CH2
denatured and rapidly loses catalytic activity (recall that proteins are H CH2
typically only marginally stable; Section 6-4). N Ser
10. Glu has a pK of ∼4 and, in its ionized form, acts as a base catalyst. Lys H H CH2
has a pK of ∼10 and, in its protonated form, acts as an acid catalyst. O
11. The active form of the enzyme contains the thiolate ion. The increased (b)
pK would increase the nucleophilicity of the thiolate and thereby in- O
Asp
crease the rate of the reaction catalyzed by the active form of the en-
zyme. However, at physiological pH, there would be less of the active O-
form of the enzyme and therefore the overall rate would be decreased.
H O Ser
12. DNA lacks the 2′-OH group required for the formation of the
N N H
2′,3′-cyclic reaction intermediate.
13. Urease was the first enzyme to be crystallized. Inhibition by vari-
ous metal ions suggests that urease requires a metal ion for cataly-
sis, whose replacement by Hg, Co, or Cd inactivates the enzyme.
However, the inhibitory metal ions could also disrupt the enzyme’s His
structure by binding somewhere other than the active site, so this in-
hibitory effect does not prove that urease acts via metal ion catalysis. 21. The observation that subtilisin and chymotrypsin are genetically
(In fact, urease activity requires two catalytic Ni ions.) unrelated indicates that their active site geometries arose by conver-
gent evolution. Assuming that evolution has optimized the catalytic
14. The preferential binding of the transition state to an enzyme is an efficiencies of these enzymes and that there is only one optimal
important (often the most important) part of an enzyme’s catalytic arrangement of catalytic groups, any similarities between the active
mechanism. Hence, the substrate binding site is the catalytic site. sites of subtilisin and chymotrypsin must be of catalytic signifi-
15. The lysozyme active site is arranged to cleave oligosaccharides be- cance. Conversely, any differences are unlikely to be catalytically
tween the fourth and fifth residues. Moreover, since the lysozyme important.
SP-17
22. H R′ Both of these molecules are planar, particularly at the C atom to
R N C O
which the carboxylate is bonded, as is true of the transition state for
the proline racemase reaction.
H R″ 26. Asp 101 and Arg 114 form hydrogen bonds with the substrate mol-
ecule (Fig. 11-19). Ala cannot form these hydrogen bonds, so the
substituted enzyme is less active.
A H
27. Yes. An enzyme decreases the activation energy barrier for both the
forward and the reverse directions of a reaction.
28. If the soybean trypsin inhibitor were not removed from tofu, it
H R′
would inhibit the trypsin in the intestine. At best, this would reduce
R N+ C OH the nutritional value of the meal by rendering its protein indigest-
ible. It might very well also lead to intestinal upset.
H R″
29. As a digestive enzyme, chymotrypsin’s function is to indis-
criminately degrade a wide variety of ingested proteins, so that
–
A their component amino acids can be recovered. Broad substrate
specificity would be dangerous for a protease that functions out-
side of the digestive system, since it might degrade proteins other
than its intended target.
H R′
+ 30. The lysosomal enzymes would be expected to have pH optima of
N C + OH – around 5, corresponding to their environmental pH. Outside the
R R″ lysosome, where the pH is closer to neutral, the enzymes would be
much less catalytically active and therefore unlikely to carry out hy-
A H drolytic reactions in other parts of the cell.
31. Factor IX is part of the intrinsic pathway that helps initiate and
23. H R′ sustain blood clotting, which explains why a factor IX deficiency
R N C O leads to inadequate clotting. Exogenous factor VII can correct
the defect because it bypasses the factor IX–dependent step by
H R″ activating factor X directly, which leads to thrombin activation and
fibrin formation.
B 32. Activated factor IXa leads, via several steps, to the activation of the
final coagulation protease, thrombin. The absence of factor IX there-
fore slows the production of thrombin, delaying clot formation, and
H R′ causing the bleeding of hemophilia. Although activated factor XIa
also leads to thrombin production, factor XI plays no role until it is
–
R N C O activated by thrombin itself. By this point, coagulation is already
well underway, so a deficiency of factor XI does not significantly
R″
delay coagulation.
+
B H
Chapter 12
H R′
+ 1. (a) v = k [A]
N C + OH –
k = v/ [A]
R R″ k = (10 μM · min−1)/(40 mM)
= (0.010 mM · min−1)/(40 mM)
B = 2.5 × 10−4 min−1
24. The ability of RNA molecules to form complex tertiary structures (b) The reaction has a molecularity of 1.
allows them to bind substrates and catalyze reactions through proximity 2. v = k [A]2
and orientation effects as well as by transition state stabilization, even v = (10−6 M−1 · s−1) (0.015 M) (0.015 M)
though RNA lacks a wide variety of functional groups. In addition, the v = 2.25 × 10−10 M · s−1
Mg2+ ions that RNA normally binds may also have catalytic functions. 3. From Eq. 12-7, [A] = [A]o e−kt. Since t1/2 = 0.693/k, k = 0.693/
DNA lacks the 2′-OH functional group that is present in RNA. More- 35 d = 0.02 d−1. (a) 9 μmol; (b) 7.4 μmol; (c) 5 μmol; (d) 2.5 μmol.
over, in its double helical form, DNA is conformationally rigid and is 4. For a second-order reaction,
therefore unable to form the required complex tertiary structures.
t1/2 = 1/k [A]o
25. Two such analogs are = 1/(4.8 × 10−3 M−1 · s−1)(8 × 10−6 M)
= 2.604 × 107 s
_ _ = 2.604 × 107 s (1 h/3600 s) (1 d/24 h) (1 yr/365 d)
COO COO
= 0.83 yr
O S
5. Only a plot of ln[reactant] versus t gives a straight line, so the reaction
Furan-2-carboxylate Thiophene-2-carboxylate is first order. The negative of the slope, k, is 0.17 s−1.
SP-18
0.9 = [S]/(KM + [S] )
Time (s) ln[Reactant] [S] = 0.9 KM + 0.9 [S]
0 1.69 0.1 [S] = 0.9 KM
[S] = (0.9/0.1)KM = 9 KM
1 1.53
10. Enzyme activity is measured as an initial reaction velocity, the ve-
2 1.36 locity before much substrate has been depleted and before much
3 1.16 product has been generated. It is easier to measure the appearance
4 0.99 of a small amount of product from a baseline of zero product than to
measure the disappearance of a small amount of substrate against a
5 0.83
background of a high concentration of substrate.
11.
2.0
1.5 [P] [ES]

ln [Reactant]
1.0
Time Time
0.5
1 2 3 4 5
t (s) vo
6. Only a plot of 1/[reactant] versus t gives a straight line, so the reac-

tion is second order. The slope, k, is 0.15 mM−1 · s−1.
[E] T
Time (s) 1/[reactant](mM−1)

12. Acetylcholinesterase, carbonic anhydrase, catalase, and fumarase.
0 0.16
13. Construct a Lineweaver–Burk plot.
1 0.32
2 0.48
3 0.62 3
4 0.78
vo (mM ⋅s)
5 0.91
–1
2
__
1
1.0 1
1/[Reactant] (mM–1)
0.8
0.6 –5 0 5 10
1
__ (μM –1)
0.4 [S]
0.2 KM = −1/x-intercept = −1/(−4 μM−1) = 0.25 μM

Vmax = 1/y-intercept = 1/(0.8 mM−1 · s) = 1.25 mM · s−1
1 2 3 4 5 14. Set A corresponds to [S] > KM, and set B corresponds to
t (s)
[S] < KM. Ideally, a single data set should include [S] values that are
both larger and smaller than KM.
7. Velocity measurements can be made using any convenient unit of
change per unit of time. KM is, by definition, a substrate concen- Set A Set B
tration (the concentration when vo = Vmax/2), so its value does not
reflect how the velocity is measured. [S](mM) vo(μM · s−1) [S](mM) vo(μM · s−1)
8. (a, b) It is not necessary to know [E]T. The only variables required to 2 0.42 0.12 0.17
determine KM and Vmax (for example, by constructing a Lineweaver–
Burk plot) are [S] and vo. (c) The value of [E]T is required to calcu- 1 0.38 0.10 0.15
late kcat since kcat = Vmax/[E]T. 0.67 0.34 0.08 0.13
9. vo = Vmax[S]/(KM + [S] )
vo /Vmax = [S]/(KM + [S] )
0.50 0.32 0.07 0.11
SP-19
25. Enzyme Y is more efficient at low [S]; enzyme X is more efficient at
0.4 high [S].
26. If an irreversible inhibitor is present, the enzyme solution’s activity
Set A would be exactly 100 times lower when the sample is diluted 100-
0.3
vo (μM⋅s–1) fold. Dilution would not significantly change the enzyme’s degree of
inhibition.
0.2
27. For reversible inhibition, KI = [E][I]/[EI] so that [E]/[EI] = KI/[I].
Set B Hence, if a reversible inhibitor is present, dilution would lower the
0.1
concentrations of both the enzyme and inhibitor so that the degree
of dissociation of the inhibitor from the enzyme would increase. The
enzyme solution’s activity would therefore not be exactly 100 times
0.5 1.0 1.5 2.0
less than the undiluted sample, but would be greater than this value
[S] (mM) because the proportion of uninhibited enzyme would be greater at
the lower concentration.
15. (a) N-Acetyltyrosine ethyl ester, with the lower value of KM, has 28. The lines of the double-reciprocal plots intersect to the left
greater apparent affinity for chymotrypsin. (b) The value of Vmax is of the 1/vo axis (on the 1/[S] axis). Hence, inhibition is mixed
not related to the value of KM, so no conclusion can be drawn. (with α = α′).
16. Product Q will be more abundant because enzyme B has a much
lower KM for the substrate than enzyme A. Because Vmax is approxi- [S] 1/[S] 1/vo 1/vo with I
mately the same for the two enzymes, the relative efficiency of the
1 1.00 0.7692 1.2500
enzymes depends almost entirely on their KM values.
17. In a reaction that has a sequential mechanism, A will not become 2 0.50 0.5000 0.83333
isotopically labeled, because P cannot be converted back to A in the 4 0.25 0.3571 0.5882
absence of Q.
8 0.125 0.2778 0.4545
18. A* will appear if the reaction follows a Ping Pong mechanism, since
a double-displacement reaction can exchange an isotope from P 12 0.083 0.2500 0.4167
back to A in the absence of B.
19. By irreversibly reacting with chymotrypsin’s active site, DIPF would 1.4
decrease [E]T. The apparent Vmax would decrease since Vmax =
kcat[E]T · KM would not be affected since the uninhibited enzyme
1.2
would bind substrate normally.
20. Molecule B is more likely to be a competitive inhibitor because it
more closely resembles the enzyme’s substrate (molecule A). 1
with I
21. From Eq. 12-32, α is 4.
1/vo (mM–1 ∙ min)
α = 4 = 1 + [I]/KI = 1 + 6 mM/KI 0.8

KI = 2 mM
no I
22. Comparing the two data points, since a 100-fold increase in substrate 0.6
concentration only produces a 10-fold increase in reaction velocity,
it appears that when [S] = 100 mM, the velocity is close to Vmax. 0.4
Therefore, assume that Vmax ≈ 40 μM · s−1 and use the other data
point to estimate KM using the Michaelis–Menten equation:
0.2
Vmax [S ]
vo =
KM + [S ] 0
– 0.4 – 0.2 0 0.2 0.4 0.6 0.8 1 1.2
Vmax [S ] 1/[S] (mM – 1)
KM + [S ] =
vo
29. (a) Inhibition is most likely mixed (noncompetitive) with α = α′
Vmax [S ] since it is reversible and only Vmax is affected.
KM = − [S ] app
vo (b) Since V max = 0.85 Vmax, 85% of the enzyme remains uninhib-
ited. Therefore, 15% of the enzyme molecules have bound inhibitor.
(40 μM · s−1 ) (1 μM) app
KM = − (1 μM) = 9 μM (c) As indicated in Table 12-2 for mixed inhibition, V max = Vmax/α′.
(4 μM · s−1 )
Thus,
Vmax 1
The true Vmax must be greater than the estimated value, so the value α′ = app = = 1.18
of KM is an underestimate of the true KM. V max 0.85
23. The enzyme concentration is comparable to the lowest substrate From Eq. 12-32,
concentration and therefore does not meet the requirement that [I]
[E] ≪ [S]. You could fix this problem by decreasing the amount 1.18 = 1 +
K′I
of enzyme used for each measurement.
24. The experimentally determined KM would be greater than the true 5 nM
K′I = = 27.8 nM
KM because the actual substrate concentration is less than expected. 1.18 − 1
SP-20
30. 4.0
0.12
vo (mg ⋅min)
0.10 3.0
0.08 B
2.0
F
–1
Threo-sphingosine
0.06
__
1
1.0
0.04
No inhibitor
0
0.02 0 2 4 6 8 10
B (mM)
6. A plot of fractional saturation (Y) versus [L] yields a hyperbola

–0.2 –0.1 0 0.1 0.2 0.3 0.4
1
where the estimated value of 0.5Y corresponds to a ligand concen-
__ (μM –1)
[S] tration, or KL, of about 3.5 μM.
1.0
(a) KM is determined from the x-intercept (= −1/KM). In the ab-
sence of inhibitor, KM = 1/0.14 μM−1 = 7 μM. In the presence
of inhibitor, KM = 1/0.04 μM−1 = 25 μM. Vmax is determined
app 0.8
from the y-intercept (= 1/Vmax). In the absence of inhibitor, Vmax =
1/0.008 mg−1 · min = 125 mg · min−1. In the presence of inhibitor, 0.6
V max = 1/0.01 mg−1 · min = 100 mg · min−1.
app
Y
(b) The lines in the double-reciprocal plots intersect very close 0.4
to the 1/vo axis. Hence, threo-sphingosine is most likely a com-
petitive inhibitor. Competitive inhibition is likely also because 0.2
of the structural similarity between the inhibitor and the sub-
strate, which allows them to compete for binding to the enzyme 0
active site. 0 2 4 6 8
[L] (μM)
31. The effects of competitive inhibitors can be diluted out by substrate
whereas those of uncompetitive and mixed inhibitors cannot.
7. ADP is a product of the kinase-catalyzed reaction, so a compound
with a similar structure might bind in the kinase active site to act as
a competitive inhibitor.
Chapter 13
8. N
1. Glucagon is a 29-residue peptide hormone and is not lipid soluble, CH2
so it would require a cell-surface receptor. N
2. Yes. Because retinoic acid is an acid, so it can diffuse across the 2–
PO3
plasma membrane to interact with an intracellular receptor.
3. (a) Norepinephrine is synthesized by the decarboxylation of Tyr and 9. The SH2 domain allows the enzyme to bind to phospho-Tyr residues
by hydroxylation of its β carbon and its phenyl group. (b) Epineph- on its target proteins. Because targets typically contain more than
rine is derived from norepinephrine by N-methylation. one phospho-Tyr group, the phosphatase can recognize and bind to
4. (a) Methandrostenolone is formed from testosterone by methylation one site on the target protein while dephosphorylating another site
of C17 and desaturation of the C1—C2 bond. on the same protein.
10. In the presence of the viral protein, the cell would undergo more
H3C OH cycles of cell division in response to the growth factor.
H 3C
11. Transformation to the cancerous state results from several genetic
changes in a cell. Thus, a single oncogene supplied to an otherwise
H 3C normal cell will be insufficient to transform it. However, an immortal-
ized cell already has some of the genetic changes necessary for transfor-
mation (malignant cells are also immortal). In such cells, the additional
oncogene may be all they require to complete their transformation.
O
12. The antibody might bind to the receptor such that growth factor bind-
(b) Anabolic steroids promote cell growth, a necessary part of ing is blocked. Alternatively, antibody binding could generate steric
wound healing. interference that prevents dimerization of the receptor, a necessary
5. A Scatchard plot (B/F versus B) has a slope of −0.33 mM−1. Since step for signal transduction. In either case, growth-promoting signals
slope = −1/KL, KL = 3 mM. would be diminished, thereby slowing the growth of cancerous cells.
SP-21
13. GTPγS analog of GTP has an S atom in place of an O atom on the activated following insulin binding to its receptor. The phospho-Tyr
terminal phosphate. Since it cannot be hydrolyzed, Gα remains ac- residues on the IRS itself are recognition points for SH2-containing
tive. Analog binding to Gs therefore increases cAMP production. proteins, which can thereby become activated.
Thus, analog binding to Gi decreases cAMP production. 24. (a) Yes, because the binding of Src’s SH3 domain to the linker that
14. In order to survive intracellularly, M. tuberculosis must interfere connects its SH2 domain to the N-terminal lobe of its PTK domain is
with the host cell’s normal activities, for example, by disrupting the required for Src to maintain its autoinhibited conformation. Hence,
cell’s signal transduction pathways. In this case, the overproduction the deletion of this SH3 domain would constitutively activate Src,
of cAMP and the prolonged presence of the second messenger pre- thereby driving the cell with this mutation to a state of unrestrained
vent infected cells from responding normally to the presence of the proliferation.
infecting bacteria. (b) No, because the phosphorylation of Tyr 416 is required for the
15. Like cholera toxin, B. anthracis EF leads to the overproduction of activation of Src and hence the Y416F mutation would inhibit the
cAMP which triggers the release of fluid from cells. The result is mutant cell’s proliferation.
edema. 25. Because Sos functions as a guanine nucleotide exchange factor, it
16. By preventing MAPK kinases from activating MAPK, LF interferes promotes the activity of Ras. The mutation will diminish Ras activ-
with the signaling pathway required for white blood cells to become ity and therefore slow cell growth.
activated and respond to infections. 26. (a) Yes, because the phosphorylation of Tyr 527 is required for the
17. Diacylglycerol kinase converts DAG to phosphatidic acid (Section autoinhibition of Src via the binding of its SH2 domain and hence
9-1C). the Y527F mutant Src would be constitutively activated.
18. Activation of the kinase converts the nonpolar DAG to a more am- (b) No, because replacing the wild-type sequence (one Pro) with a
phiphilic molecule that can no longer activate protein kinase C. In sequence containing two Pro residues would make the 250 to 253
effect, the kinase limits the activity of one of the second messengers segment of Src a better binding target for the SH3 domain, thereby
produced during signaling by the phosphoinositide pathway. stabilizing Src’s autoinhibited conformation.
19. Lithium ion interferes with the phosphoinositide signaling pathway 27. Cholera toxin does not cause cancer because the Gsα it ADPribo-
by inhibiting enzymes such as inositol monophosphatase and ino- sylates only mediates the intestinal cell’s secretion of digestive
sitol polyphosphate 1-phosphatase. Li+ blocks the conversion of fluid, not its rate of proliferation. Moreover, cholera toxin does
phosphorylated inositol species to inositol, thereby preventing the not pass through the intestine to the other tissues and hence does
recycling of IP3 and its degradation products back to inositol. This not affect other cells. However, even if it did so, its effect would
in turn prevents the synthesis of phosphatidylinositol and PIP2, the only last as long as the cholera infection, whereas a mutation
precursor of the IP3 second messenger. permanently affects the cell in which it has occurred and all its
20. Insulin binding to its receptor triggers a signaling cascade that progeny.
begins with the tyrosine kinase activity of the insulin receptor. 28. When Gsα catalyzes the hydrolysis of its bound GTP to GDP + Pi ,
However, as in all signaling pathways, intracellular responses are the Arg side chain that cholera toxin ADP-ribosylates functions
eventually shut down. Activation of a phosphatase such as SHP-2, to stabilize the transition state’s developing negative charge. The
which participates in transducing the insulin signal by activating the ADPribosylated Gsα therefore hydrolyzes its bound GTP at a
MAPK pathway, can also act to limit the cellular response, by de- greatly reduced rate and hence remains activated far longer than
phosphorylating phospho-Tyr groups. normal Gsα. Mutating this Arg will have a similar effect. Con-
21. Use Equation 13-8, letting [L] = 2 μM and [B] = [I50] = 5 μM, sequently, in cells in which a Gsα. GTP functions to induce cell
[ I50 ] proliferation, mutating this Arg will drive the cell into a state of
KI = unrestrained proliferation, a requirement for the malignant trans-
[L]
(1 + KL )
formation of the cell. The gene encoding such a Gsα subunit is a
proto-oncogene and the mutation of its Arg residue converts it to
[ 5 × 10−6 ] an oncogene.
=
(2 × 10−6 ) 29. Pertussis toxin ADP ribosylates Giα so as to prevent it from exchang-
1 +
( (10 × 10−6 ) ) ing its bound GDP for GTP and hence from releasing Gβγ on in-
teracting with its cognate activated GPCRs. The resulting decrease
5 × 10−6 in active Gβγ inhibits PLC, which is normally activated through its
= = 4.2 μM
1.2 association with free Gβγs.
22. Rearranging Equation 13-8 gives 30. Although the diacylglycerol second messengers are identical, phos-
[L] phatidylethanolamine does not generate an IP3 second messenger
[I50] = KI(1 + that triggers the release of Ca2+, which in turn alters protein kinase
KL )
C activity.
(2.0 × 10−8 ) 31. (a) The positively charged Ca2+ ions bind to negatively charged lip-
= (9.1 × 10−9) (1 +
(4.8 × 10−8 ) ) ids at the membrane surface. This disrupts the electrostatic interac-
tions between CD3 and the membrane so that the proteins dissociate
= (9.1 × 10−9)(1 + 0.417) = 1.3 × 10−8 M
from the membrane and expose their Tyr side chains to the NRTKs
for phosphorylation.
23. The PH domain allows the IRS to be localized to the intracellu-
(b) This is an example of feed-forward activation: the binding of
lar leaflet of the cell membrane, close to the insulin receptor and
antigen initiates signaling that leads to Ca2+ influx, which in turn
ready to participate in signal transduction. The PTB domain, like
promotes additional events (phosphorylation of the CD3 proteins);
an SH2 domain, recognizes phospho-Tyr residues, in this case on
the two-step mechanism means a stronger cellular response to the
the autophosphorylated insulin receptor. As a result, the IRS can be
antigen.
SP-22
Chapter 14 14. The more positive the reduction potential, the greater the oxidizing
power. From Table 14-4,
1. A heterotroph relies on other organisms for food, which may include
substances the heterotroph cannot synthesize (including vitamins).
An autotroph can produce all the molecules it needs. Compound °′(V)
2. (a) The prokaryotic methanogens that produce methane from inor-
ganic precursors, are autotrophic. The net equation involved is SO2−
4 −0.515
H2 + CO2 → CH 4 + 2 H2O Acetoacetate –0.346
The methane consumers rely on the product of the methanogens and +
NAD −0.315
so are heterotrophic. It can be depicted by net equation:
CH4 + SO42− → HCO−3 + HS− + H2O Pyruvate −0.185
(b) The organisms associate so that the methanotrophs can consume 3+
Cytochrome b (Fe ) 0.077
the methane that is released by the methanogens.
3. Arsenic, which resembles phosphorus, is incorporated into nucleic
15. Cytochrome a has a higher standard reduction potential (0.29 V)
acids and other compounds that ordinarily contain phosphate
than cytochrome c1 (0.22 V), so electrons will tend to flow from cy-
groups.
tochrome c1 to cytochrome a. Under standard conditions, electrons
4. Ions of Cd and Hg, which are below Zn in the periodic table, take will not flow from cytochrome c1 to cytochrome b, whose standard
the place of Zn2+ ions that serve as cofactors for essential cellular reduction potential (0.077 V) is less than that of cytochrome c1.
enzymes.
16. No. Here,
5. (a) Reduction; (b) reduction.
6. D, E, B, A, C Δℰ°′ = ℰ°(e− acceptor) − ℰ°(e− donor) = ℰ°(cyto b (Fe3 + )) − ℰ°(cyto a (Fe2 + ))
7. c Because Δℰ°′ < 0, ΔG°′ > 0 and the reaction will spontaneously
8. (a) K = e−ΔG°′/RT proceed in the opposite direction from that written.
−1 −1 −1
K = e−(−31,500 J·mol )/(8.3145 J·K ·mol )(298 K) 17. Using the data in Table 14-4:
K = 3.3 × 105 Δℰ°′ = ℰ°(e− acceptor) − ℰ°(e− donor) = ℰ°(fumarate) − ℰ°(NAD +)
(b) The large change in free energy makes the citrate synthase reac-
tion irreversible, so it could (and does; Section 17-4B) serve as a = 0.031 V − (−0.315 V) = 0.346 V
control point for the citric acid cycle. Because Δℰ°′ > 0, ΔG°′ < 0 and the reaction will spontaneously
9. Although the plus sign suggests a positive charge, all four dinucleo- proceed as written.
tides are negatively charged. The oxidized nicotinamide group has 18. Only a small portion (∼1.2%) of the human genome consists of
a charge of +1 and the reduced group is neutral. NAD+/NADH has protein-coding sequences. Building a gene chip with DNA sequences
two phosphoryl groups, and NADP+/NADPH has three phosphoryl corresponding to genes that are transcribed increases the likelihood
groups, so the net charges are NAD+ −1, NADH −2, NADP+ −2, of “capturing” complementary segments derived from the mRNA
and NADPH −3. population of the cells under study.
10. (a) The theoretical maximum yield of ATP from 1 mol of palmitate 19. Probably not. Although all cells carry out a similar set of basic
is equivalent to (ΔG°′ for fuel oxidation)/(ΔG°′ for ATP synthesis) = metabolic reactions, the enzymes that catalyze the reactions have
(−9781 kJ · mol−1)/(−30.5 kJ · mol−1) ≈ 320 ATP different amino acid sequences and hence different gene sequences.
(b) The theoretical maximum yield of ATP from 1 mol of glucose is cDNAs produced from mammalian mRNAs would be unlikely to
equivalent to (ΔG°′ for fuel oxidation)/(ΔG°′ for ATP synthesis) = hybridize with bacterial DNA segments.
(−2850 kJ · mol−1)/(−30.5 kJ · mol−1) ≈ 93 ATP 20. The researchers could look at the expression of genes in response to
11. At pH 6, the phosphate groups are more ionized than they are statins: even in the absence of gene sequence differences, the level
at pH 5, which increases their electrostatic repulsion and there- of mRNA and protein generated from the genes could vary among
fore increases the magnitude of ΔG for hydrolysis (makes it more patients.
negative). 21. (a) For enzymes that catalyze near-equilibrium reactions, ΔG ≈ 0
12. (a) Because the ΔG°′ value for the reaction is greater than 0, the and the direction of flux depends on the relative concentrations of
reaction will not occur under standard conditions. It could occur substrates and products. Consequently, these enzymes can cata-
under cellular conditions, depending on the actual concentrations of lyze both the forward (e.g., anabolic) and reverse (e.g., catabolic)
the reactants and products. reactions.
(b) The malate dehydrogenase and citrate synthase reactions are (b) For a metabolic pathway to proceed in the forward direction,
coupled through their common intermediate oxaloacetate ΔG must be less than zero. The reverse process, involving the
Malate + NAD+ → Oxaloacetate + NADH + H+ same reactions, must therefore have ΔG > 0. However, if the
Oxaloacetate + Acetyl-CoA → Citrate + HS-CoA opposing pathways involve different reactions, catalyzed by dif-
so the overall ΔG°′ is the sum of the ΔG°′ values for the two reac- ferent enzymes, then both pathways can proceed with favorable
tions: 29.7 kJ · mol−1 + (−31.5 kJ · mol−1) = −1.8 kJ · mol−1. The changes in free energy.
citrate synthase reaction helps “pull” the malate dehydrogenase 22. (a) Since ΔG°′ = −RT ln K,
reaction forward by consuming the oxaloacetate produced from
K = e−ΔG°′/RT
malate. −1
)/(8.3145 J·K−1 ·mol−1)(298 K)
13. The exergonic hydrolysis of PPi by pyrophosphatase (ΔG°′ = K = e−(−8500 J·mol
−19.2 kJ · mol−1) drives fatty acid activation. K = 0.032
SP-23
[B] (b) The ester and amide reaction products
(b) ΔG = ΔG°′ + RT ln
[A]
Gln Gln
ΔG = 8500 J · mol−1
CH2 CH2
0.0001
+ (8.3145 J · K−1 · mol−1 )(310 K) ln
0.0005 CH2 CH2
−1 −1
ΔG = 8500 J · mol − 4150 J · mol C O C O
ΔG = 4350 J · mol−1 = 4.35 kJ · mol−1
O NH
The reaction is not spontaneous since ΔG > 0.
(c) The reaction can proceed in the cell if the product B is the substrate R R
for a second reaction such that the second reaction continually draws
off B, causing the first reaction to continually produce more B from A. 27. The cytochrome c (Fe3+) half-reaction has a higher reduction poten-
23. Removing a phosphoryl group from ATP has a large change in free tial (0.235 V) than the NAD+ half-reaction (−0.315 V). Therefore,
energy because there is a large difference in resonance and electrostatic electrons will flow from NADH (which becomes oxidized) to cyto-
stabilization between the reactants and products. Removing a phos- chrome c (Fe3+) (which becomes reduced).
phoryl group from AMP has a smaller change in free energy because 28. The O2 ⇌ H2O half-reaction has a standard reduction potential of
the difference in resonance and electrostatic stabilization between 0.815 V, whereas the nitrate ⇌ nitrite half-reaction has a standard
AMP (which has only one phosphate group) and Pi is not as large. reduction potential of only 0.42 V. Because the free energy change
24. Calculating ΔG for the reaction ATP + Creatine ⇌ Phosphocreatine for a redox reaction is proportional to the change in reduction
+ ADP, using Eq. 14-1: potential, ΔG°′ = −nℱΔℰ°′, transferring electrons from the fuel
molecule to O2 will have a larger free energy change than transfer-
[ phosphocreatine] [ ADP] ring the electrons from the fuel molecule to nitrate.
ΔG = ΔG°′ + RT ln (
[creatine] [ATP] )
29. Using the data in Table 14-4, for the oxidation of free FADH2
= 12.6 kJ · mol−1 + (8.3145 J · K−1 · mol−1 )(298 K) · (ℰ°′ = −0.219 V) by ubiquinone (ℰ°′ = 0.045 V),
(3.5 mM)(0.25 mM)
ln ( Δℰ = ℰ°′(ubiquinone) − ℰ°′(FADH2) = (0.045 V) − ( − 0.219 V)
(1.5 mM)(6 mM) )
= 0.264 V
= 12.6 kJ · mol−1 − 5.8 kJ · mol−1 = 6.8 kJ · mol−1
ΔG°′ = −nℱΔℰ°′ = −(2)(96,485 J · V−1 · mol−1 )(0.264 V)
Since ΔG > 0, the reaction will proceed in the opposite direction as = −50.9 kJ · mol−1
written above, that is, in the direction of ATP synthesis.
This is more than enough free energy to drive the synthesis of ATP
25. Using the data in Table 14-3, we calculate ΔG°′ for the adenylate
from ADP + Pi (ΔG°′ = +30.5 kJ · mol−1 ; Table 14-3).
kinase reaction.
30. The balanced equation is
ΔG°′ 2 Cyto c (Fe3+) + Succinate → 2 Cyto c (Fe2+) + Fumarate + 2H+
ATP + H2O → AMP + PPi −45.6 kJ · mol−1 Using the data in Table 14-4,
2 ADP + 2 Pi → 2 ATP + 2 H2O 2 × 30.5 kJ · mol−1
Δℰ°′ = ℰ°(e− acceptor) − ℰ°(e− donor) = 0.235 V − 0.031 V
= 61.0 kJ · mol−1
PPi + H2O → 2 Pi −19.2 kJ · mol−1 = 0.204 V
2 ADP → ATP + AMP −3.8 kJ · mol−1 ΔG°′ = −n ℱΔℰ°′ = −(2)(96,485 J · V−1 · mol−1)(0.204V)
= −39.37 kJ · mol−1
Since ΔG for a reaction at equilibrium is zero, Eq. 14-1 becomes
31. (a) The step catalyzed by enzyme Y is likely to be the major flux-
ΔG°′ = −RT ln Keq so that control point, since this step operates farthest from equilibrium (it
is an irreversible step). (b) Inhibition of enzyme Z would cause the
Keq = e − ΔG°′/RT
concentration of D, the reaction’s product, to decrease, and it would
[ATP] [ AMP] −ΔG°′/RT cause C, the reaction’s substrate, to accumulate. The concentra-
Keq = e tions of A and B would not change because the steps catalyzed by
[ ADP]
enzymes X and Y would not be affected. The accumulated C would
(6 × 10 −4 M) 2 −1
)/(8.3145 J·K − 1 ·mol − 1)(298 K) not be transformed back to B since the step catalyzed by enzyme Y
[ AMP] = e −(−3800 J·mol
(6 × 10 −3 M) 2 is irreversible.
[ AMP ] = 2.7 × 10−4 M = 0.27 mM
B C A
32. Z ⟶ W ⟶ Y ⟶ X
26. (a) Cys .... Gln Chapter 15

CH2 CH2 1. (a) Reactions 1, 3, 7, and 10; (b) Reactions 2, 5, and 8; (c) Reaction 6;
(d) Reaction 9; (e) Reaction 4.
S CH2
C 2. This reaction resembles Step 4 of pentose phosphate pathway (the
conversion of a ketose to an aldose) and is catalyzed by an isomer-
O ase, which in this case converts an aldose to a ketose.
SP-24
3. This reaction resembles Step 4 of glycolysis and is carried out by an 11. Yes. The same in vivo conditions that decrease the value of ΔG rela-
aldolase, which links dihydroxyacetone phosphate to an aldehyde tive to ΔG°′ may also decrease ΔG for ATP synthesis.
(erythrose-4-phosphate). 12. ΔG values differ from ΔG°′ values because ΔG = ΔG°′ + RT
4. Proteolysis of enzymes such as aldolase and enolase destroys their ln[products]/[reactants] and cellular reactants and products are not
activity, thereby inhibiting glycolytic flux. As a result, the cell would in their standard states.
be unable to generate ATP from glucose and would die. The advan- 13. Pyruvate kinase regulation is important for controlling the flux of
tage of this response would be the elimination of the infected cell, metabolites, such as fructose (in liver), which enter glycolysis after
which would help limit the growth and dissemination of Salmonella. the PFK step.
5. The Zn2+ polarizes the carbonyl oxygen of the substrate to stabilize 14. FBP is the product of the third reaction of glycolysis, so it acts as
the enolate intermediate of the reaction. a feed-forward activator of the enzyme that catalyzes Step 10. This
regulatory mechanism helps ensure that once metabolites pass the
CH2OPO23 – CH2OPO23 – PFK step of glycolysis, they will continue through the pathway.
– 15. The high glycolytic flux rapidly generates the ATP needed for cell
C O . . . Zn2+ Enzyme C O . . . Zn2+ Enzyme
growth and division.
–
C C 16. The three glucose molecules that proceed through glycolysis yield 6
HO H HO H ATP. The bypass through the pentose phosphate pathway results in
a yield of 5 ATP.
6. C1 of DHAP and C1 of GAP are achiral but become chiral in FBP 17. The label will appear at C1 and C3 of F6P (see Fig. 15-30).
(as C3 and C4). There are four stereoisomeric products that differ in 18. H
configuration at C3 and C4: fructose-1,6-bisphosphate, psicose-1,6-
bisphosphate, tagatose-1,6-bisphosphate, and sorbose-1,6-bisphos- H C OH
phate (see Fig. 8-2). C O–
7. The reaction intermediate is glucose-1,6-bisphosphate (G1,6P).
C OH
8. (a) G1,6P activates PFK to increase the flux of phosphorylated sug-
ars through the rest of the glycolytic pathway. (b) G1,6P inhibits H C OH
hexokinase. Production of G1, 6P indicates that G1P (derived from CH2OPO23 –
glycogen or from other sugars such as galactose) is already present
and the cell does not need to initiate glycolysis with glucose. 2,3-Enediolate
9. No. Alcoholic fermentation, unlike homolactic fermentation, in- intermediate
cludes a step (the pyruvate decarboxylase reaction) in which a car- 19. H OH
bon is lost as CO2. Because the CO2 diffuses (bubbles) away, the
C
reaction cannot proceed in reverse.
10. For the coupled reaction –
C O
Pyruvate + NADH + H+ → Lactate + NAD+ H C OH
Δℰ°′ = (−0.185 V) − (−0.315 V) = 0.130 V
H C OH
According to Eq. 14-8,
RT [ lactate] [ NAD + ] CH2OPO23 –
Δℰ = Δℰ°′ − ln(
nℱ [ pyruvate] [ NADH ] ) 1,2-Enediolate
and ΔG = −nℱΔℰ (Eq. 14-7). Since two electrons are transferred intermediate
in the above reaction, n = 2. 20. The products are a 4-carbon and a 7-carbon sugar. The order
RT of binding does matter. The ketose binds first and transfers the
(a) Δℰ = 0.130 V − ln(0.5 × 0.5) = 0.15V 2-carbon unit to the TPP on the enzyme. The aldose then binds and
nℱ
ΔG = −(2)(96,485 J · V−1 · mol−1)(0.15 V) = −28.52 kJ · mol−1 accepts the 2-carbon unit.
(b) RT/nℱ = 18.3145 J · K−1 · mol−1)(298 K) / 21. Transketolase transfers 2-carbon units from a ketose to an aldose, so
(2)(96,485 J · V−1 · mol−1) = 0.01284 V the products are a 3-carbon sugar and a 7-carbon sugar.
Δℰ = 0.130 V − 0.01284 V ln(160 × 160) 22. (a) The volume of the balloon would increase as the yeast produce
CO2 by fermenting the sugar. (b) The balloon would not inflate
Δℰ = 0.130 V− 0.130 V = 0
because iodoacetate inhibits the activity of GAPDH and prevents
ΔG = 0 fermentation. (c) Because yeast do not normally metabolize lactose
(c) Δℰ = 0.130 V − 0.01284 V ln(1200 × 1200) (milk sugar), the balloon would inflate much more slowly than if
Δℰ = 0.130 V − 0.18207 V = −0.052 V sucrose were present.
ΔG = −(2)(96,485 J · V−1 mol−1)(−0.052 V) 23. Like phosphoglycerate mutase, phosphoglucomutase catalyzes a
= 10.03 kJ · mol−1 phosphoryl group transfer in which a phosphorylated group in the
(d) At the concentration ratios of Part a, ΔG is negative and the reac- enzyme active site donates its phosphoryl group to the substrate and
tion proceeds as written. As [lactate]/[pyruvate] increases, the reaction then receives a second phosphoryl group from the substrate. The
ΔG increases even though [NAD+]/[NADH] also increases so that in active site Ser can undergo reversible phosphorylation.
Part b the reaction is at equilibrium (ΔG = 0) and in Part c ΔG is posi- 24. Galactokinase, which catalyzes a highly exergonic reaction, is a pos-
tive and the reaction proceeds spontaneously in the opposite direction. sible control point. Because galactose enters the glycolytic pathway
SP-25
as glucose-6-phosphate, the PFK reaction is also likely to be a major (b) The pyruvate product of the aldolase reaction is not further mod-
control point. ified. The GAP product is converted to pyruvate by the actions of
25. The inhibition of phosphoglucomutase, which catalyzes Step 4 of the glycolytic enzymes glyceraldehyde-3-phosphate dehydrogenase,
the galactose-metabolizing pathway, would slow the production phosphoglycerate kinase, phosphoglycerate mutase, enolase, and
of G6P from galactose and thereby slow the rate at which galac- pyruvate kinase.
tose is catabolized. Because glucose enters glycolysis without the (c) One ATP is consumed when glucose is converted to glucose-
phosphoglucomutase-catalyzed step, its flux through glycolysis is 6-phosphate. One ATP is generated by the phosphoglycerate kinase
faster. reaction and one by the pyruvate kinase reaction (these quantities
are not doubled because only one three-carbon fragment of glucose
26. (a) Glucose + 2 NAD+ + 2 ADP + 2 Pi →
follows this route), for a net yield of one ATP per glucose. The stan-
2 Pyruvate + 2 NADH + 2 ATP + 2 H2O
dard glycolytic pathway generates two ATP per glucose.
(b) Glucose + 2 NAD+ + 2 ADP + 2AsO3− 4 →
33. (a) Reaction 8, (b) Reaction 5, (c) Reaction 1, (d) Reaction 2,
2 Pyruvate + 2 NADH + 2 ADP—AsO2− 3 + 2 H2O
(e) Reaction 3.
2 ADP—AsO2− 3 + 2 H2O → 2 ADP + AsO4
3−
34. (a) Glucose-6-phosphate dehydrogenase (pentose phosphate path-
Overall: Glucose + 2 NAD+ → 2 pyruvate + 2 NADH way, Reaction 1 of Fig. 15-30).
(c) Arsenate is a poison because it uncouples ATP generation from (b) UDP–galactose-4-epimerase (galactose metabolism, Reaction 3
glycolysis. Consequently, glycolytic energy generation cannot of Fig. 15-28).
occur. (c) Phosphoglucose isomerase (glycolysis, Reaction 2 of Fig. 15-1).
27. When [GAP] = 10−4 M, [DHAP] = 5.5 × 10−4 M. According to (d) Phosphomannose isomerase (mannose metabolism, Section 15-5C).
Eq. 1-17, (e) Phosphoglycerate mutase (glycolysis, Reaction 8 of Fig. 15-1)
or phosphoglucomutase (galactose metabolism, Reaction 4 of
K = e−ΔG°′/RT
Fig. 15-28).
[ GAP] [ DHAP] −1 −1
= e−(22,800 J · mol )/(8.314 J · K · mol)(310 K)
[ FBP]
Chapter 16
(10 −4 )(5.5 × 10 −4 )
= 1.4 × 10 −4 1. As we know, glycogen is broken down when the cell needs to catabo-
[ FBP]
lize glucose to produce ATP. The G1P generated by the glycogen
[ FBP] = 3.8 × 10 −4 M phosphorylase reaction is quickly isomerized to G6P and enters gly-
[ FBP] [ GAP] = (3.8 × 10 −4 M)(10 −4 M) = 3.8 colysis. The continual consumption of G1P “pulls” the phosphorylase
reaction forward, making it thermodynamically favorable.
28. The liver enzyme is far more sensitive than the brain enzyme to the 2. This mechanism allows glycogen phosphorylase activity to be regu-
three activators. It is possible that liver PFK-1 is subject to a greater lated by the concentration of glucose so that glycogen is not broken
degree of regulation than brain PFK-1. Fuel must be supplied to down when glucose is already plentiful.
the brain continuously and thus glycolysis is always active, but the 3. Phosphoglucokinase catalyzes the phosphorylation of the C6-OH
liver has a wide variety of physiological roles and is more likely to group of G1P that generates G1,6P, which is necessary to
regulate cellular pathways. “prime” phosphoglucomutase that has become dephosphorylated
29. (a) Glycerol can be converted to the glycolytic intermediate and thereby inactivated through the loss of its G1,6P reaction
DHAP by the activity of glycerol kinase and glycerol phosphate intermediate.
dehydrogenase (Fig. 15-27). (b) One ATP is consumed by the glyc- 4. A defect in G6P transport would have the symptoms of glucose-6-
erol kinase reaction, but two ATP are produced (by the PGK and phosphatase deficiency: accumulation of glycogen and hypoglycemia.
PK reactions), for a net yield of one ATP per glycerol (this does 5. The conversion of circulating glucose to lactate in the muscle gen-
not count the ATP that might be generated through oxidative phos- erates 2 ATP. If muscle glycogen could be mobilized, the energy
phorylation from the NADH produced in the glycerol phosphate yield would be 3 ATP, since phosphorolysis of glycogen bypasses
dehydrogenase reaction). the hexokinase-catalyzed step that consumes ATP in the first stage
30. Fermentation pathways regenerate one NAD+ needed for the of glycolysis.
GAPDH reaction of glycolysis. The catabolism of glycerol includes 6. A glycogen molecule with 28 tiers would represent the most effi-
the GAPDH reaction, but it also includes the glycerol phosphate cient arrangement for storing glucose, and its outermost tier would
dehydrogenase reaction, which also generates NADH. Therefore, contain considerably more glucose residues than a glycogen mol-
homolactic or alcoholic fermentation could only regenerate half the ecule with only 12 tiers. However, densely packed glucose residues
NAD+ required for glycerol catabolism. would be inaccessible to phosphorylase. In fact, such a dense glyco-
31. Even when the flux of glucose through glycolysis and hence the cit- gen molecule could not be synthesized because glycogen synthase
ric acid cycle is blocked, glucose can be oxidized by the pentose and branching enzyme would have no room to operate (see Box 16-3
phosphate pathway, with the generation of CO2. for a discussion of glycogen structure).
7. The deficiency is in branching enzyme (Type IV glycogen storage
– disease). The high ratio of G1P to glucose indicates abnormally long
32. (a) COO H O
C chains of α(1→4)-linked residues with few α(1→6)-linked branch
C O
points (the normal ratio is ∼10).
CH3
+ H C OH
8. Group A will show higher glucose levels in blood. Amylopectin, a
CH2OPO23 – branched form of starch, can release glucose from each of its branch-
Pyruvate GAP es, whereas amylose is a linear form of starch, so during digestion,
BMSolutions.indd Page SP-26 11/11/17 6:05 PM f-389 /207/WB01592_ISV/XXXXXXXXXX/bmmatter/text_s
SP-26
glucose monomers can be released only one at a time from the end 19. (a) The mice do not produce normal amounts of fucosyltransferase, the
of the molecule. Consequently, the rate of glucose release from amy- enzyme that adds fucose to the growing oligosaccharide. (b) Instead,
lose is slower than from amylopectin, and less glucose appears in the the oligosaccharide chains end with galactose and sialic acid.
blood. 20. In the course of glucose catabolism, a detour through glycogen
9. The two tissues perform different physiological functions and synthesis and glycogen breakdown begins and ends with G6P. The
therefore respond differently to the same hormone. Liver responds energy cost of this detour is 1 ATP equivalent, consumed in the
by promoting glycogenolysis and gluconeogenesis to produce glu- UDP–glucose pyrophosphorylase step. The overall energy lost is
cose that can be released for use by other tissues. Muscles respond therefore 1/32 or ∼3%.
to the hormone by increasing the flux of glycogen-derived glucose 21. The overall free energy change for debranching is
through glycolysis in order to generate ATP to power muscle
contraction. Breaking α(1→4) bond ΔG°′ = −15.5 kJ · mol−1
10. (a) Circulating [glucose] is high because cells do not respond to the Forming α(1→4) bond +15.5 kJ · mol−1
insulin signal to take up glucose. Hydrolyzing α(1→6) bond −7.1 kJ · mol−1
(b) Insulin is unable to activate phosphoprotein phosphatase-1 in mus- Total ΔG°′ = −7.1 kJ · mol−1
cle, so glycogen synthesis is not stimulated. Moreover, glycogen syn-
thesis is much reduced by the lack of available glucose in the cell. The overall free energy change for branching is
11. The enzyme activities catalyze sequential steps of gluconeogen- Breaking α(1→4) bond ΔG°′ = −15.5 kJ · mol−1
esis (aldol condensation followed by dephosphorylation), so in- Forming α(1→6) bond +7.1 kJ · mol−1
cluding both in one protein means that the reactions can proceed Total ΔG°′ = −8.4 kJ · mol−1
efficiently with no loss of the intermediate product (fructose-1,
6-bisphosphate). Assuming that ΔG°′ is close to ΔG, the sum of the two reactions
12. The equation for catabolism of 6 G6P by the pentose phosphate of branching has ΔG < 0, but debranching would be endergonic
pathway is (ΔG > 0) without the additional step of hydrolyzing the α(1→6)
bond to form glucose.
6 G6P + 12 NADP+ + 6 H2O →
6 Ru5P + 12 NADPH + 12 H+ + 6 CO2 22. (a) The reactions catalyzed by pyruvate carboxylase and phospho-
enolpyruvate carboxykinase are phosphate transfer reactions.
Ru5P can be converted to G6P by transaldolase, transketolase, and
gluconeogenesis: (b) The reaction catalyzed by UDP–glucose pyrophosphorylase in-
volves cleavage of UTP but is not a phosphoryl group transfer reac-
6 Ru5P + H2O → 5 G6P + Pi tion (the UMP group is transferred).
The net equation is therefore 23. (a) Aspartate can be transaminated to produce oxaloacetate, a
G6P + 12 NADP+ + 7 H2O → 12 NADPH + 12 H+ + 6 CO2 + Pi gluconeogenic precursor. (b) To convert 2 aspartate to glucose,
13. The equation for glycolysis is 2 GTP are consumed in the PEPCK reaction and 2 ATP are con-
Glucose + 2 NAD+ + 2 ADP + 2 Pi → sumed in the phosphoglycerate kinase reaction, for a total of
2 pyruvate + 2 NADH + 4 H+ + 2 ATP + 2 H2O 4 ATP equivalents.
The equation for gluconeogenesis is 24. (a) In alcoholic fermentation (Section 15-3B), pyruvate decarboxylase
converts pyruvate to acetaldehyde and CO2. In gluconeogenesis
2 Pyruvate + 2 NADH + 4 H+ + 4 ATP + 2 GTP + 6 H2O →
(Section 16-4A), pyruvate carboxylase transfers a bicarbonate group to
glucose + 2 NAD+ + 4 ADP + 2 GDP + 6 Pi
pyruvate to form oxaloacetate. (b) Pyruvate decarboxylase uses a thiamine
For the two processes operating sequentially, pyrophosphate cofactor; pyruvate carboxylase uses a biotin cofactor.
2 ATP + 2 GTP + 4 H2O → 2 ADP + 2 GDP + 4 Pi
25. A high level of AMP results from a high rate of ATP consumption
14. (a) Lactate dehydrogenase, pyruvate carboxylase, PEPCK, enolase, in the cell, so it would act to promote flux through ATP-generating
phosphoglycerate mutase, phosphoglycerate kinase, GAPDH, triose pathways such as glycolysis. Therefore, AMP would be expected
phosphate isomerase, aldolase, fructose-1,6-bisphosphatase, phos- to inhibit the activity of the gluconeogenic enzyme fructose-1,
phoglucose isomerase, and glucose-6-phosphatase. (b) Two ATP are 6-bisphosphatase.
produced by glycolysis, and 6 ATP are consumed by gluconeogen-
26. A high level of acetyl-CoA, the product of fatty acid catabolism (it is
esis, so there is a net loss of 4 ATP.
also generated from pyruvate and amino acid catabolism), indicates
15. (a) –18 ATP, (b) +6 ATP, (c) +9 ATP. that the cell has adequate metabolic fuel available. The stimulation
16. (a) At the beginning of a fast, blood glucose levels are normal, of pyruvate carboxylase, the first enzyme of gluconeogenesis, allows
because dietary sources or glycogenolysis can supply glucose. the cell to direct resources toward glucose synthesis, a mechanism
(b) After a fast, the blood glucose levels are very low, because for stockpiling fuel for later use.
dietary glucose and glycogen have been depleted and gluconeogen-
esis is impaired due to the fructose-1,6-bisphosphatase deficiency. 27. UDP–Glucose + fructose-6-phosphate
17. Pyruvate, a substrate for gluconeogenesis, cannot be converted to
glucose and instead accumulates, because the gluconeogenic en- UDP
zyme fructose-1,6-bisphosphatase is deficient.
sucrose-6-phosphate
18. (a) Microorganisms that produce fucosidase can cleave fucose
residues from the glycoproteins, thereby obtaining a source of H2O
free energy from the host. (b) The pathogens cannot use this food
Pi
source and therefore are less likely to survive when no other food
is available. sucrose
SP-27
28. In starch synthesis, α(1→4)-linked glucose residues are added one 8. Although both processes generate acetyl-CoA for the citric acid
by one. In cellulose, as indicated in Fig. 8-9, each successive glucose cycle, they differ in their redox properties. The pyruvate formate
residue is flipped by 180° to form the β(1→4)-linked polymer. This lyase reaction is not a redox reaction, so no NADH is generated.
geometry would require an enzyme with a single active site to reorient In contrast, the pyruvate dehydrogenase reaction generates NADH,
by 180° with every residue added. By simultaneously accommodating which drives ATP synthesis through oxidative phosphorylation.
two ADP–glucose substrates, one flipped 180° relative to the other, 9. OH
and catalyzing two glucosyl transfer reactions, the synthase can build |
–
OOC—CH—CH2—CH2—COO–
cellulose two residues at a time without having to be repositioned.
29. The first tier has 21 − 1 = 1 branch; the 2nd tier has 22 − 1 = 2 10. Inhibition of glutamate transamination to α-ketoglutarate would
branches for a total of 2 + 1 = 3 = 22 − 1 branches through that tier; prevent the increase in citric acid cycle intermediates that would
the 3rd tier has 23−1 = 4 branches for a total of 4 + 3 = 7 = 23 − 1 allow increased flux of acetyl carbons through the cycle.
branches through that tier; etc. Hence in n tiers, there are a total of 2n − 11. Malonate competes with succinate in the succinate dehydroge-
1 branches. The particle therefore has a total of 212 – 1 branches of 13 nase reaction, thus inhibiting the reaction and accumulation of
residues each for a total of (212 − 1) × 13 = 53,235 glucose residues. substrate succinate. Since the succinyl-CoA synthetase reaction
30. Muscle uses glycogen breakdown for the rapid acquisition of meta- operates near equilibrium, its substrate succinyl-CoA would also
bolic energy. Since muscle only stores a few seconds worth of ATP accumulate.
and creatine (an ATP buffer; Section 14-2C), glycogen must be rap- 12. Competitive inhibition can be overcome by adding more substrate—in
idly mobilized when there is a need for it. Liver, on the other hand, this case, succinate. Oxaloacetate overcomes malonate inhibition be-
functions to maintain a steady level of blood glucose, a quantity cause it is converted to succinate by the reactions of the citric acid cycle.
that fluctuates over minutes and hours rather than seconds. Muscle 13. The ΔG°′ value is the sum of the ΔG°′ values for the malate dehydro-
glycogen phosphorylase is therefore better adapted to its function if genase reaction (29.7 kJ · mol−1) and the citrate synthase reaction
it responds more quickly to external stimuli. (−31.5 kJ · mol−1): −1.8 kJ · mol−1.
14. For the reaction isocitrate + NAD+⇌α-ketoglutarate + NADH +
Chapter 17
CO2 + H+, we assume [H+] = 1 and [CO2] = 1. According to
1. In mammals, there are four possible ways of pyruvate metabolism. It Eq. 14-1,
can be converted to lactate (reduction), to alanine (transamination),
to acetyl-CoA (oxidative decarboxylation), and to oxaloacetate (car- [ NADH ] [ α-ketoglutarate]
boxylation). In yeast, pyruvate is also converted to acetaldehyde (de- [ NAD + ] [ isocitrate] )
carboxylation).
[1] [ 0.2]
2. The labeled carbon becomes C4 of the succinyl moiety of succinyl- = −21 kJ · mol−1 + (8.3145 J · K · mol−1)(298 K) ln (
[ 9] [ 0.04] )
CoA. Because succinate is symmetrical, the label appears at C1 and C4
of succinate. When the resulting oxaloacetate begins the second round, = −21 kJ · mol−1 − 1.45 kJ · mol−1 = −22.45 kJ · mol−1
the labeled carbons appear as 14CO2 in the isocitrate dehydrogenase and With such a large negative free energy of reaction under physiologi-
the α-ketoglutarate dehydrogenase reactions (see Fig. 17-2). cal conditions, isocitrate dehydrogenase is likely to be a metabolic
3. The labeled carbon becomes C3 of the succinyl moiety of succinyl- control point.
CoA and hence appears at C2 and C3 of succinate, fumarate, malate, 15. (a) From Table 17-2, for the succinate dehydrogenase reaction,
and oxaloacetate. Neither C2 nor C3 of oxaloacetate is released as ΔG°′ = 6 kJ · mol−1 and ΔG = ∼0.
CO2 in the second round of the cycle. However, the 14C label appears [ fumarate]
at C1 and C2 of the succinyl moiety of succinyl-CoA in the second ΔG = ΔG°′ + RT ln(
[ succinate] )
round and therefore appears at all four positions of the resulting
[ fumarate]
oxalo acetate. Thus, in the third round, 14C is released as 14CO2. ΔG°′ = −RT ln (
[ succinate] )
4. The first step of decarboxylation is most likely to be metabolically
irreversible since the CO2 product is rapidly hydrated to bicarbon- [ fumarate] −ΔG°′/RT
ate. The reverse reaction, a carboxylation, requires the input of free ( [ succinate] ) = e
energy to become favorable (Section 16-4A). The other four reac- −1 −1 −1
= e −(6000 J · mol )/(8.3145 J · K ·mol )(310 K)
tions are transfer reactions or oxidation–reduction reactions (trans-
fer of electrons) that are more easily reversed. = e−2.33 = 0.10
5. PDP removes the phosphate group that inactivates the pyruvate de- (b) From Table 17-2, the ΔG°′ value of the aconitase reaction is
hydrogenase complex. A deficiency of PDP leads to less pyruvate ∼5 kJ · mol−1 and the ΔG value is ∼0.
dehydrogenase activity in muscle cells, making it difficult for the [ isocitrate]
muscle to increase flux through the citric acid cycle in order to meet [ citrate] )
the energy demands of exercise.
[ isocitrate]
6. Accumulation of citric acid cycle intermediates can cause metabolic ΔG°′ = −RT ln(
[ citrate] )
acidosis. As all citric acid intermediates are acids and as such repre-
[ isocitrate] −ΔG°′/RT
( [ citrate] ) = e
sent a source of hydrogen ions, hence it lead to a decrease in blood
pH (acidosis).
−1 −1 −1
7. Unlike the CO2 generated by the pyruvate dehydrogenase complex, = e −(5000 J · mol )/(8.3145 J · k ·mol )(310K)
the formate produced in the reaction is a charged molecule and = e−1.9 = 0.14
therefore does not diffuse out of the cell. Instead, it can be used for 16. Deficiency of pyruvate dehydrogenase leads to lactic acidosis.
other biosynthetic reactions. When pyruvate concentrations rise, indicating a need for increased
SP-28
flux through the citric acid cycle, some of the pyruvate is carboxyl- way, so the production of acetyl-CoA by glycolysis followed by the
ated by pyruvate dehydrogenase to produce oxaloacetate to boost pyruvate dehydrogenase complex can be decreased when the citric
the cycle’s capacity. During deficiency of pyruvate dehydrogenase, acid cycle is operating at maximum capacity and the citrate concen-
this step cannot occur, and then excess pyruvate is converted to lac- tration is high. As citric acid cycle intermediates are consumed in
tate instead. synthetic pathways, the citrate concentration drops, relieving phos-
17. (a) Because citric acid cycle intermediates such as citrate and suc- phofructokinase inhibition and allowing glycolysis to proceed in
cinyl-CoA are precursors for the biosynthesis of other compounds, order to replenish the citric acid cycle intermediates.
anaerobes must be able to synthesize them. 30. Succinyl-CoA
(b) These organisms do not need a complete citric acid cycle, which succinyl-CoA synthetase
would yield reduced coenzymes that must be reoxidized.
18. Citrate can be cleaved to generate an acetyl group and oxaloacetate. The Succinate
oxaloacetate can then be converted to succinate to complete the cycle.
succinate dehydrogenase
19. (a) α-Ketoglutarate + NAD+ + GDP + Pi → succinate + CO2 +
NADH + H+ + GTP Fumarate
(b) α-Ketoglutarate + CO2 + 2 NADH + 2 H+ + CoASH +
fumarase
FADH2 → succinate + acetyl-CoA + 2 NAD+ + 2H2O + FAD
20. Oxaloacetate + FADH2 + NADH + H+ → succinate + FAD +
Malate (mitochondrial)
NAD+ + H2O
21. First, the six-carbon isocitrate is decarboxylated to α-ketoglutarate. malate transporter
Next, glutamate dehydrogenase catalyzes reductive amination to
produce glutamate. Finally, glutamate is isomerized to methylaspar- Malate (cytosolic)
tate.
malate dehydrogenase
22. Thiamine pyrophosphate is a cofactor for the pyruvate dehydroge-
nase and α-ketoglutarate dehydrogenase complexes. In beriberi, the Oxaloacetate
substrates for these enzymes, pyruvate and α-ketoglutarate, would
accumulate. 31. (a) The citric acid cycle is a multistep catalyst. Degrading an amino
acid to a citric acid cycle intermediate boosts the catalytic activity of
23. NAD+ (ℰ°′ = −0.315 V) does not have a high enough reduction
the cycle but does not alter the stoichiometry of the overall reaction
potential to support oxidation of succinate to fumarate (ℰ°′ = +0.031
(acetyl-CoA → 2 CO2). To undergo oxidation, the citric acid cycle
V); that is, the succinate dehydrogenase reaction has insufficient
intermediate must exit the cycle and be converted to acetyl-CoA to
free energy to reduce NAD+. Enzyme-bound FAD (ℰ°′ ≈ 0) is more
re-enter the cycle as a substrate.
suitable for oxidizing succinate.
(b) Pyruvate derived from the degradation of an amino acid can be
24. O
H 3C converted to acetyl-CoA by the pyruvate dehydrogenase complex;
CH C S CoA these amino acid carbons can then be completely oxidized by the
H3C citric acid cycle.
25. The malic enzyme reaction yields reducing power in the form of 32. To synthesize citrate, pyruvate must be converted to oxaloacetate by
NADPH, which is required for many biosynthetic processes (Sec- pyruvate carboxylase:
tion 15-6). Pyruvate + CO2 + ATP + H2O → oxaloacetate + ADP + Pi
26. Animals cannot carry out the net synthesis of glucose from acetyl- A second pyruvate is converted to acetyl-CoA by pyruvate
CoA (to which acetate is converted). However, 14C-labeled acetyl- dehydrogenase:
CoA enters the citric acid cycle and is converted to oxaloacetate. Pyruvate + CoASH + NAD+ → acetyl-CoA + CO2 + NADH
Some of this oxaloacetate may exchange with the cellular pool of The acetyl-CoA then combines with oxaloacetate to produce citrate:
oxaloacetate to be converted to glucose through gluconeogenesis and Oxaloacetate + acetyl-CoA + H2O → citrate + CoASH + H+
subsequently taken up by muscle and incorporated into glycogen.
The net reaction is
27. The alternate pathway bypasses the succinyl-CoA synthetase
2 Pyruvate + ATP + NAD+ + 2 H2O →
reaction of the standard citric acid cycle, a step that is accom-
panied by the phosphorylation of ADP. The alternate pathway citrate + ADP + Pi + NADH + H+
therefore generates one less ATP than the standard citric acid 33. (a)
cycle. There is no difference in the number of reduced cofactors NAD+ malate
generated.
28. No. When glucose is abundant, a cell generates ATP through gly-
colysis followed by the citric acid cycle. The insulin-stimulated NADP+
increase in pyruvate dehydrogenase activity does not function to NADH
increase the number of acetyl groups that enter the citric acid cycle, oxaloacetate
since the cell’s energy needs are already being met. Instead, the ace-
tyl groups are destined for fatty acid synthesis, a mechanism that
ADP + Pi NADPH + CO2
helps the cell store metabolic fuel as triacylglycerols (in addition to
glycogen).
29. The phosphofructokinase reaction is the major flux-control point pyruvate
for glycolysis. Inhibiting phosphofructokinase slows the entire path- ATP + CO2
SP-29
(b) ATP + NADH + NADP+ → ADP +Pi + NAD+ + NADPH Fumarate + 2 H+ + 2 e− ⇌ succinate ℰ°′ = −0.031 V
The net result is that NADH reducing equivalents are converted to CoQ + 2 H+ + 2 e− ⇌ CoQH2 ℰ°′ = 0.045 V
NADPH reducing equivalents, at the expense of 1 ATP. Δℰ°′ = ℰ°′ (e − acceptor) − ℰ°′ (e − donor)
= (0.045 V) − (0.031 V) = 0.014 V
Chapter 18 ΔG = −nℱΔℰ
1. Mitochondria with more cristae have more surface area and there- = −(2)(96,485 J · V−1 · mol−1)(0.014 V)
fore more proteins for electron transport and oxidative phosphoryla- = 2700 J · mol−1 = 2.7 kJ · mol−1
tion. Tissues with a high demand for ATP synthesis (such as heart) This reaction does not supply enough free energy for the synthesis
contain mitochondria with more cristae than tissues with lower of ATP, which requires ∼30.5 kJ · mol−1.
demand for oxidative phosphorylation (such as liver). 11. S is the electron acceptor and acetate is the electron donor. Their
2. Maternally inherited mitochondrial diseases result from mutations standard reduction potentials are listed in Table 14-4.
in mitochondrial rather than nuclear DNA. A mother provides Δℰ°′ = ℰ°′(S) − ℰ°′(acetate)
mitochondria to her off spring via eggs; a father’s mitochondria are = (−0.23 V) − (−0.581 V) = 0.351 V
not passed to his off spring. The phenomenon is known as maternal
ΔG = −nℱΔℰ
inheritance.
= −(2)(96,485 J · V−1 · mol−1)(0.351 V)
3. About 2.5 ATP per NADH are produced when NADH participates
in the malate–aspartate shuttle. = −68,000 J · mol−1 = −68 kJ · mol−1
4. When NADH participates in the glycerophosphate shuttle, the elec- Since the standard free energy change for ATP synthesis is 30.5 kJ ·
trons of NADH flow to FAD and then to CoQ, bypassing Complex mol−1, approximately 68/30.5 = 2.2 ATP could be synthesized.
I. Thus, about 1.5 ATP are synthesized per NADH. 12. Denitrification is the utilization of nitrate as terminal electron
5. Most of the electrons that enter the electron transport chain and acceptor. NO3− is the electron acceptor and NADH is the electron
that ultimately drive ATP production derive from NADH gen- donor. Their standard reduction potentials are listed in Table 14-4.
erated by a large number of enzymes (in glycolysis, the citric Δℰ°′ = ℰ°′(NO−3 ) − ℰ°′(NADH)
acid cycle, and fatty acid oxidation). Any defect in this path- = (0.42 V) − (−0.315 V) = 0.735 V
way (Complex I → Complex III → Complex IV) would severely
ΔG = −nℱΔℰ
impact the mitochondrion’s ability to generate ATP. In contrast,
electrons that enter the chain at Complex II (the succinate de- = −(2)(96,485 J · V−1 · mol−1 )(0.735 V)
hydrogenase reaction of the citric acid cycle) make a relatively = −142,000 J · mol−1 = −142 kJ · mol−1
minor contribution to the cell’s energy budget, so a defect in Since the standard free energy change for ATP synthesis is 30.5 kJ ·
Complex II would have a smaller effect. mol−1, approximately 142/30.5 = 4.6 ATP could be synthesized.
6. Defect in mitochondrial genes may cause lactic acidosis. If the
13. ℰ may differ from ℰ°′, depending on the redox center’s microenviron-
mitochondrial electron-transport chain cannot function normally,
ment and the concentrations of reactants and products. In addition, the
then cells cannot rely on oxidative phosphorylation to meet their
tight coupling between successive electron transfers within a complex
ATP needs. Instead, glycolysis occurs at a high rate, which helps
may “pull” electrons so that the overall process is spontaneous.
generate the necessary ATP but also produces lactate as an end
product. 14. The range of reduction potentials associated with the Cu ion suggests
that the surrounding protein, not just the immediate ligands for the Cu
7. Vitamin K resembles ubiquinone and is likely to play a similar role
ion, play a major role in determining the affinity of the Cu for electrons.
as a membrane-soluble carrier that delivers electrons from Com-
plexes I and II to Complex III. 15. O H O
2 2
8. Cytochrome c has several positively charged lysine residues on its Electron
surface (Fig. 18-16), which would allow it to interact electrostati- transporting IV
cally with cardiolipin, which has a net charge of −2 (Table 9-2). complexes ADP + Pi
9. The relevant half-reactions (Table 14-4) are III H+ H+
FAD + 2 H+ + 2e− ⇌ FADH2 ℰ°′ = −0.219 V ATP
+ − ATP synthase
2 O2 + 2 H + 2e ⇌ H2O ℰ°′ = 0.815 V
1
e– I
Since the O2 /H2O half-reaction has the more positive Δℰ°′, the FAD
half-reaction is reversed and the overall reaction is
2 O2 + FADH2 ⇌ H2O + FAD
1
16. An increase in external pH (decrease in [H+]) increases the electro-
Δℰ°′ = 0.815 V − (−0.219 V) = 1.034 V chemical potential across the mitochondrial membrane and therefore
Since ΔG°′ = −nℱΔℰ°′, leads to an increase in ATP synthesis.
ΔG°′ = −(2)(96,485 J · V−1 · mol−1)(1.034 V) = −200 kJ · mol−1 17. The protonation and subsequent deprotonation of Asp 61 of the
F1F0-ATPase’s c subunits induces the rotation of the c-ring, which
The maximum number of ATPs that could be synthesized under
in turn, mechanically drives the synthesis of ATP. DCCD reacts
standard conditions is therefore 200 kJ · mol−l/30.5 kJ · mol−1 = 6.6
with Asp 61 in a manner that prevents it from binding a proton and
mol ATP/mol FADH2 oxidized by O2.
thereby prevents the synthesis of ATP.
10. The reaction for Complex II is succinate + CoQ → fumarate +
18. The import of ADP (net charge −3) and the export of ATP (net
CoQH2.
charge −4) represents a loss of negative charge from inside the
The relevant half-reactions and their standard reduction potentials mitochondrion. This decreases the difference in electrical charge
are given in Table 14-4. across the membrane, since the outside is positive due to the
SP-30
translocation of protons during electron transport. Consequently, (b) Electrons from succinate bypass the amytal block by entering the
the electrochemical gradient is diminished by the activity of the electron-transport chain at Complex II and thereby restore electron
ADP–ATP translocator. The activity of the Pi –H+ symport protein transport through Complexes III and IV.
diminishes the proton gradient by allowing protons from the inter- 28. (a) (b)
membrane space to re-enter the matrix.
19. The transport of both ADP and Pi is driven by the free energy of
the electrochemical proton gradient, since the transport systems for
ADP and Pi both dissipate the proton gradient. [O2] [O2]
20. DNP and related compounds dissipate the proton gradient required
for ATP synthesis. The dissipation of the gradient decreases the rate
of synthesis of ATP, decreasing the ATP mass action ratio. Decreas-
ing this ratio relieves the inhibition of the electron transport chain, 1 2 1 2
causing an increase in metabolic rate. t t
21. Inhibition of proton transport in ATP synthase prevents ATP (a) CN− blocks electron transport in Complex IV, after the point of
production by oxidative phosphorylation. The resulting buildup entry of succinate.
of the proton gradient causes electron transport to slow, thereby
(b) Oligomycin blocks oxidative phosphorylation and hence O2 con-
slowing the reoxidation of reduced cofactors produced by processes
sumption. DNP uncouples electron transport from oxidative phos-
such as the citric acid cycle. In this situation, continued produc-
phorylation and thereby permits O2 consumption to resume.
tion of ATP depends on anaerobic glycolysis. Because pyruvate-
derived acetyl-CoA cannot be processed by the citric acid cycle 29. For the transport of a proton from outside to inside (Eq. 18-1),
and because NAD+ for glycolysis cannot be regenerated by the ΔG = 2.3 RT [pH (side 1) − pH (side 2)] + Z ℱΔΨ
electron transport chain, homolactic fermentation converts pyru- The difference in pH is −1.6. Since an ion is transported from the
vate to lactate, which accumulates. positive to the negative side of the membrane, ΔΨ is negative.
22. Hormones stimulate the release of fatty acids from stored ΔG = (2.3)(8.314 J · K−1 · mol−1)(298 K)(−1.6) + (1)(96,485 J ·
triacylglycerols, which activates UCP1 and also provides the fuel V−1 · mol−1)(−0.08 V)
whose oxidation yields electrons for the heat-generating electron ΔG = −9117.46 J · mol−1 – 7718.8 J · mol−1 = −16.8 kJ · mol−1
transfer process. This cascade also amplifies the effect of the
30. Proton transport has a free energy change of −16.8 kJ · mol−1
hormone.
(Problem 29). Since ΔG°′ for ATP synthesis is 30.5 kJ · mol−1 and
23. The switch to aerobic metabolism allows ATP to be produced by 30.5/16.8 = 1.8, between two and three moles of protons must be
oxidative phosphorylation. The phosphorylation of ADP increases transported to provide the free energy to synthesize one mole of
the [ATP]/[ADP] ratio, which then increases the [NADH]/[NAD+] ATP under standard biochemical conditions.
ratio because a high ATP mass action ratio slows electron transport.
31. (a) Since one ATP is synthesized for every one-third turn of the c-ring,
The increases in [ATP] and [NADH] inhibit their target enzymes in
8/3 or 2.6 protons are required to synthesize 1 ATP. (b) 12/3 = 4
glycolysis and the citric acid cycle (Fig. 18-30) and thereby slow
protons are required to synthesize 1 ATP.
these processes.
32. In an ATP synthase with more c subunits, more proton translocation
24. (a) If the channels allowed the transit of ions other than Ca2+, they
events are required to drive one complete rotation of the c-ring. Con-
would dissipate the proton gradient across the inner mitochondrial
sequently, more substrate oxidation (O2 consumption) is required to
membrane and prevent ATP synthesis. (b) Because Ca2+ ions stimu-
synthesize three ATP (the yield of one cycle of the rotary engine),
late several citric acid cycle enzymes (Fig. 18-30), the effect would
and the P/O ratio is lower.
be an increase in production of reduced cofactors that would in-
crease electron transport and oxidative phosphorylation. 33. The NNT reaction reduces the efficiency of oxidative phosphoryla-
tion by consuming NADH that could otherwise pass electrons to the
25. Glucose is shunted through the pentose phosphate pathway to pro-
electron-transport chain, and by translocating a proton that could
vide NADPH, whose electrons are required to reduce O2 to O2− · .
otherwise help drive the rotation of ATP synthase.
26. Because SOD apparently protects cells from oxidative damage,
34. Oxygen consumption will decrease when α-ketoglutarate levels in-
cells with defective SOD would be expected to be more susceptible
crease because the activity of ATP synthase is coupled to the activ-
to such damage. (In fact, the mutant SOD retains its enzymatic
ity of the electron transport chain, which includes the O2-consuming
activity but may misfold or aggregate so as to disrupt normal
Complex IV.
cellular activities.)
27. (a) Yes; dietary restriction increases the production of α-ketoglutarate,
(b)
which leads to a decrease in the generation of reactive oxygen spe-
cies that are believed to be partly responsible for the damage that
occurs during aging.
35. The dead algae are a source of food for aerobic microorganisms
[O2] [O2]
lower in the water column. As the growth of these organisms
increases, the rate of respiration and O2 consumption increase to the
point where the concentration of O2 in the water becomes too low to
sustain larger aerobic organisms.
1 2 1 2
36. The molasses and oil are food for microorganisms. As the food is con-
t t
sumed, the rate of respiration and oxygen consumption increase. Even-
(a) O2 consumption ceases because amytal blocks electron transport tually, the depletion of oxygen creates a more reducing environment
in Complex I. that favors the reduction of Cr(VI) compounds to Cr(III) compounds.
SP-31
Chapter 19 12. The relevant half-reactions are (Table 14-4):
1. The “red tide” is a massive proliferation of certain algal species that O2 + 4 H+ + 4 e− ⇌ 2 H2O ℰ °′ = 0.815 V
causes seawater to become visibly red. The red color of the seawater NADP+ + H+ + 2 e− ⇌ NADPH ℰ °′ = −0.320 V
indicates that the photosynthetic pigments of those algae absorb all The overall reaction is
colors of visible light other than red. 2 NADP+ + 2 H2O → 2 NADPH + O2 + 2 H+
2. 2 H2O + 2 NADP+ → 2 NADPH + 2 H+ + O2 Δℰ°′ = −0.320 V − (0.815 V) = −1.135 V
3. 6 CO2 + 12 H2S + light energy → C6H12O6 + 6 S2 + 6 H2O ΔG°′ = −n ℱΔ ℰ°′
4. The light-harvesting complexes absorb light energy of a variety of = −(4)(96,485 J × V−1 mol−1)(−1.135 V)
wavelengths and then pass the energy to the special pair. In order
= 438 kJ · mol−1
for the excitation to remain on the special pair—that is, not be trans-
ferred back to the light-harvesting complex—the special pair must 13. Use the data provided in Table 14-4.
have a lower excitation energy than the components of the light Q + 2 H+ + 2 e− → QH2 ℰ°′ = 0.045 V
+
harvesting complex. Thus the special pair absorbs light at a longer 2 cyt c2(ox) + 2 H + 2 e− → 2 cyt c2(red) ℰ°′ = 0.230 V
wavelength than do the antenna chromophores. The overall reaction is
5. The order of action is water–plastoquinone oxidoreductase (Photo- QH2 + cyt c2(ox) → 2 Q2 + 2 cyt c2(red)
system II), plastoquinone plastocyanin oxidoreductase (cytochrome ℰ°′ = 0.230 V − (0.045 V) = 0.185 V
b6 f ), and plastocyanin–ferredoxin oxidoreductase (Photosystem I).
ΔG°′ = −n ℱΔℰ°′
6. (a) The energy per photon is E = hc/λ, so the energy per mole of
= −(2)(96,485 J · V−1 · mol−1)(0.185 V)
photons (λ = 700 nm) is
= 36,000 J · mol−1 = 36 kJ · mol−1
E = Nhc/λ
14. When cyclic electron flow occurs, photoactivation of PSI drives
= (6.022 × 1023 mol−1)(6.626 × 10−34 J · s)
electron transport independently of the flow of electrons derived
(2.998 × 108 m · s−1)/(7 × 10−7 m)
from water. Thus, the oxidation of H2O by PSII is not linked to the
= 1.71 × 105 J · mol−1 number of photons consumed by PSI.
= 171 kJ · mol−1
15. At 40°C, membrane fluidity is increased such that protons may leak
(b) The energy per photon is E = hc/λ, so the energy per mole of across the membrane, thereby preventing the synthesis of the ATP
photons (λ = 510 nm) is required for the Calvin cycle, thus impairing the rate of photosyn-
E = Nhc/λ thesis. Without the desaturase, the chloroplast would be unable to
= (6.022 × 1023 mol−1)(6.626 × 10−34 J · s) synthesize membrane lipids with highly unsaturated tails. As a re-
(2.998 × 108 m · s−1)/(5.1 × 10−7 m) sult, the membrane would be less fluid and therefore less likely to
= 2.4 × 105 J · mol−1 become leaky at higher temperatures.
= 240 kJ · mol−1 16. Because chloroplast cytochrome b6 f is functionally and structur-
ally similar to mitochondrial Complex III, myxothiazol would be
7. (a) (171 kJ · mol−1)/(30.5 kJ · mol−1) = 5.6
expected to block electron transport in the chloroplast. As a result,
Thus 5 mol of ATP could theoretically be synthesized. the Q cycle would not function and no proton gradient would be
(b) (240 kJ · mol−1)/(30.5 kJ · mol−1) = 7.8 generated. No ATP would be produced and no electrons would reach
Thus 7 mol of ATP could theoretically be synthesized. NADP+.
8. Both systems mediate cyclic electron flows. The photooxidized bac- 17. Because 3 ATP are produced for each complete rotation of the ATP
terial reaction center passes electrons through a series of electron synthase c-ring, and one proton is translocated for each c subunit,
carriers so that electrons return to the reaction center (e.g., P960+) 14/3 = 4.7 protons must be translocated to synthesize 1 ATP.
and restore it to its original state. During cyclic electron flow in PSI, 18. Using Equation 18-1,
electrons from photooxidized P700 are transferred to cytochrome
ΔG = 2.3 RT [pH (side 1) − pH (side 2) ]
b6 f and, via plastoquinone and plastocyanin, back to P700. In both
cases, there is no net change in the redox state of the reaction cen- ΔG = 2.3(8.3145 J · K−1 · mol−1)(298 K)(−4.4)
ter, but the light-driven electron movements are accompanied by the = −25,074 J · mol−1 = −25.1 kJ · mol−1
transmembrane movement of protons. 19. By allowing K+ ions to cross the thylakoid membrane from the
9. The label appears as 18O2: lumen to the stroma, the channel would dissipate a portion of the
light membrane potential (ΔΨ) without affecting ΔpH. This would help
H 218O + CO2 ⟶ (CH2O) + 18O2 maintain electrical neutrality and fine-tune the protonmotive force
10. The change in reduction potential is about −1.5 V (Fig. 19-10). needed for ATP synthesis.
Since ΔG°′ = −nℱΔℰ °′, 20. The protonmotive force depends on a lower pH (higher [H+]) in the
lumen. A decrease in lumenal pH would indicate a strong protonmo-
ΔG = −(1)(96,485 J · V−1 · mol−1)(−1.5 V)
tive force, which would increase the activity of the K+ channel.
= 140,000 J · mol−1 = 140 kJ · mol−1
21. An uncoupler dissipates the transmembrane proton gradient by pro-
11. Because the light-dependent reactions (measured as O2 produced viding a route for proton translocation other than ATP synthase.
by PSII) and the light-independent reactions (measured as CO2 Therefore, chloroplast ATP production would decrease.
fixed by the Calvin cycle) are only indirectly linked via ATP and
22. The uncoupler would not affect NADP+ reduction since light-driven
NADPH, they may vary. Cyclic electron flow, which increases ATP
electron transfer reactions would continue regardless of the state of
production without increasing NADPH production, may increase
the proton gradient.
the amount of O2 produced without increasing CO2 fixation.
SP-32
23. After the light is turned off, ATP and NADPH levels fall as these photoprotective activity to prevent further photooxidation when the
substances are used up in the Calvin cycle without being replaced proton-translocating machinery is operating at maximal capacity.
by the light reactions. The RuBP level drops because it is consumed 37. Photooxidation would not be a good protective mechanism since it
by the RuBP carboxylase reaction (which requires neither ATP nor might interfere with the normal redox balance among the electron
NADPH) and its replenishment is blocked by the lack of ATP for the carrying groups in the thylakoid membrane. Releasing the energy by
phosphoribulokinase reaction. exciton transfer or fluorescence (emitting light of a longer wavelength)
24. 3PG builds up because it cannot pass through the phosphoglycerate could potentially funnel light energy back to the overactive photosys-
kinase reaction in the absence of ATP. tems. Dissipation of the excess energy via internal conversion to heat
25. The carbonic anhydrase catalyzes the conversion of bicarbonate to would be the safest mechanism, since the photosystems do not have
CO2, which is the substrate for RuBP carboxylase. any way to harvest thermal energy to drive chemical reactions.
26. O2 competes with CO2 for the active site of the carboxylase. By mini- 38. (a) Glycolysis generates pyruvate, which is decarboxylated to yield
mizing the presence of O2, the carboxysome minimizes the frequency acetyl-CoA for fatty acid synthesis and CO2, which diff uses out of
of photooxidation and improves the efficiency of carbon fixation. the cell. In order not to waste this CO2, the seed’s RuBP carboxylase
27. An increase in [O2] increases the oxygenase activity of RuBP combines the CO2 with RuBP to incorporate it back into carbohy-
carboxylase–oxygenase and therefore lowers the efficiency of CO2 drates that can be broken down to yield more acetyl-CoA to support
fixation. fatty acid synthesis.
28. The increased concentration of CO2 would mean that plants would (b) Photons absorbed by PSII and transferred to cytochrome b6 f
need to open their stomata less to obtain the CO2 needed for the could drive the synthesis of ATP to support carbon fixation by RuBP
Calvin cycle. Consequently, less water would be lost through the carboxylase. Because the entire Calvin cycle does not function, the
stomata and the plants’ water consumption would decrease. RuBP must be regenerated by other mechanisms (in this case, it is
derived from glycolytic intermediates).
29. The C4 plants are able to open their stomata to collect CO2 without
losing much water, which is concentrated near the bundle-sheath 39. The net synthesis of 2 GAP from 6 CO2 in the initial stage of the Cal-
cells. C3 plants lack this specialization of function and so are at risk vin cycle (Fig. 19-26) consumes 18 ATP and 12 NADPH (equivalent
of losing too much water while collecting CO2 for the Calvin cycle. to 30 ATP). The conversion of 2 GAP to glucose-6-phosphate (G6P)
by gluconeogenesis does not require energy input (Section 16-4B),
30. The partial pressure of CO2 at which a C4 plant can photosynthesize
nor does the isomerization of G6P to glucose-1-phosphate (G1P).
is much lower than that of a C3 plant. Moreover, at very low partial
The activation of G1P to its nucleotide derivative consumes 2 ATP
pressures of CO2, the C3 plant reverses the effects of photosynthesis
equivalents (Section 16-5), but ADP is released when the glucose
by photorespiration. In the sealed box, the C4 plant maintains the
residue is incorporated into starch. These steps represent an overall
CO2 partial pressure so low that the C3 plant wastes away through
energy investment of 18 + 30 + 1 = 49 ATP. Starch breakdown by
photorespiration. In effect, the C4 plant devours the C3 plant.
phosphorolysis yields G1P, whose subsequent degradation by gly-
31. These plants store CO2 by CAM. At night, CO2 reacts with PEP to colysis yields 3 ATP, 2 NADH (equivalent to 5 ATP), and 2 pyruvate.
form malate. By morning, so much malate (malic acid) has accumu- Complete oxidation of 2 pyruvate to 6 CO2 by the pyruvate dehy-
lated that the leaves have a sour taste (the taste of H+). During the drogenase reaction and the citric acid cycle (Section 17-1) yields
day, the malate is converted to pyruvate + CO2. The leaves therefore 8 NADH (equivalent to 20 ATP), 2 FADH2 (equivalent to 3 ATP),
become less acidic and hence tasteless. Late in the day, when all the and 2 GTP (equivalent to 2 ATP). The overall ATP yield is therefore
malate is consumed, the leaves become slightly basic; that is, bitter. 3 + 5 + 20 + 3 + 2 = 33 ATP. The ratio of energy spent to energy
32. The increased availability of the substrate CO2 would increase the recovered is 49/33 = 1.5.
rate of photosynthesis. Because C4 plants spend relatively more en-
ergy to acquire CO2 for the Calvin cycle, C3 plants might have the
advantage when CO2 is more accessible. Chapter 20
33. The cyanobacteria adapt to the light conditions by altering the
1. (a) The various bile acids bear carboxylic acid or sulfonic acid
production of different pigments so that their color (indicating the
groups that are ionized at neutral pH, so they have a net negative
wavelengths not absorbed) is complementary to the light used for
charge. (b) The bile acids are amphiphilic and act as detergents that
photosynthesis. Under medium-energy green light, the bacteria are
solubilize bacterial cell membranes, killing the cells.
relatively rich in pigments that capture high-energy wavelengths
(the blue end of the spectrum) but not low-energy (red) light. Under 2. CH2OH ATP ADP CH2OH
low-energy red light, the bacteria are relatively rich in pigments that HO C H HO C H
capture the low-energy light and absorb less blue light. glycerol
CH2OH kinase CH2 O PO32–
34. The energy of a mole of photons of UV light (λ = 220 nm) is
E = Nhc/λ L-Glycerol L-Glycerol-3-phosphate
= (6.022 × 1023 mol−1)(6.626 × 10−34 J · s)
(2.998 × 108 m · s−1)/(2.2 × 10−7 m) NAD+ glycerol-3-
= 544 kJ · mol−1 phosphate
dehydrogenase
35. One mole of photons of red light (λ = 700 nm) has an energy of 171 kJ. NADH + H+
Therefore, 438/171 = 2.6 moles of photons are theoretically required to
drive the oxidation of H2O by NADP+ to form one mole of O2. CH2OH
The number of moles of 220-nm photons required to produce one C O

mole of O2 is 438/544 = 0.8.
CH2 O PO32–
36. The buildup of the proton gradient is indicative of a high level of ac-
tivity of the photosystems. A steep gradient could therefore trigger Dihydroxyacetone phosphate
SP-33
3. The reaction products are palmitate, oleate, and 2-oleoylglycerol. oxidation of fatty acids containing double bonds yields fewer reduced
4. (a) Perilipin likely resembles the water-soluble apolipoproteins, coenzymes whose oxidation drives the synthesis of ATP. In the oxi-
since it is able to interact with the phospholipid surface of a lipid dation of fatty acids with a double bond at an odd-numbered carbon,
droplet. Perilipin likely contains amphipathic α helices. the enoyl-CoA isomerase reaction bypasses the acyl-CoA dehydroge-
nase reaction and therefore does not generate FADH2 (equivalent to 1.5
(b) Phosphorylation of perilipin likely interferes with perilipin–
ATP). A double bond at an even-numbered carbon must be reduced by
phospholipid interactions, because the negatively charged phos-
NADPH (equivalent to the loss of 2.5 ATP).
phate groups would repel the phospholipid head groups. As a result,
perilipin would associate less tightly with the lipid droplet, allowing 14. Oxidation of odd-chain fatty acids generates succinyl-CoA, an in-
access to lipases. termediate of the citric acid cycle. Because the citric acid cycle
operates as a multistep catalyst to convert acetyl groups to CO2, in-
5. Lipoprotein B with a greater proportion of protein, has higher density.
creasing the concentration of a cycle intermediate can increase the
6. The symptoms become more sever during fasting, because other fuels, catalytic activity of the cycle.
such as dietary glucose, are not readily available at this time.
15. Conversion of propionyl-CoA to succinyl-CoA consumes 1 ATP.
7. A defect in carnitine palmitoyl transferase II prevents normal trans- Conversion of succinyl-CoA to malate by the citric acid cycle produces
port of activated fatty acids into the mitochondria for β oxidation. 1 GTP (equivalent to 1 ATP) and 1 FADH2 (equivalent to 1.5 ATP).
Tissues such as muscle that use fatty acids as metabolic fuels there- The conversion of malate to pyruvate produces 1 NADPH (equivalent
fore cannot generate ATP as needed. to 2.5 ATP, assuming NADPH is energetically equivalent to NADH).
8. The three steps of β oxidation resemble the reactions that convert Conversion of pyruvate to acetyl-CoA produces 1 NADH (equivalent
succinate to oxaloacetate (Sections 17-3F–17-3H). to 2.5 ATP). Each acetyl-CoA that enters the citric acid cycle yields
10 ATP equivalents. Consequently, catabolism of propionyl-CoA
CO–2 CO–2 yields 16.5 ATP, 6.5 more than for acetyl-CoA.
FAD FADH2 H2O
CH2 C H 16. 3-Ketoacyl-CoA transferase is required to convert ketone bodies to
acetyl-CoA. If the liver contained this enzyme, it would be unable to
CH2 succinate H C fumarase
dehydrogenase supply ketone bodies as fuels for other tissues.
CO–2 CO–2 17. The label does not appear in palmitate because 14CO2 is released in
Reaction 2b of fatty acid synthesis (Fig. 20-26).
Succinate Fumarate
18. See Fig. 20-21.
CO–2 CO–2
NAD+
+ O O
NADH + H
HO C H C O 14 14
H3C C CH2 C O–
CH2 malate CH2
dehydrogenase Acetoacetate
CO–2 CO–2
19. See Fig. 20-35.
L-Malate Oxaloacetate OH
9. Palmitate oxidation produces 106 ATP and glucose catabolism 14
CH (CH2)14 CH3
produces 32 ATP (Section 17-4). The standard free energy of ATP
synthesis from ADP + Pi is 30.5 kJ · mol−1. Palmitate catabolism H2N C H
therefore has an efficiency of
CH2OH
106 × 30.5/9781 × 100 = 33%
Likewise, glucose catabolism has an efficiency of Sphinganine
32 × 30.5/2850 × 100 = 34% 20. Enoyl-CoA reductase catalyzes step 5 of fatty acid synthesis. In-
Thus, the two processes have very nearly the same overall efficiency. hibiting this reaction would kill bacteria by preventing them from
10. The Glu side chains create a patch of negative charge on ACP. The producing essential lipids.
E. coli dehydrase must have a positively charged surface in order to 21. The breakdown of glucose by glycolysis generates the dihydroxyac-
dock with ACP, which delivers the intermediates of fatty acid syn- etone phosphate that becomes the glycerol backbone of triacylglyc-
thesis, so it is likely to be rich in Lys and Arg side chains. erols (Fig. 20-29).
11. One round of β oxidation of butyrate produces 1 NADH and 22. Glycerol kinase converts glycerol to glycerol-3-phosphate, a precursor
1 FADH2, which are used to produce 4 ATP by oxidative phos- for triacylglycerol synthesis. By promoting triacylglycerol synthesis, the
phorylation. The 2 acetyl-CoA derived from butyrate enter the citric drug decreases the concentration of unesterified fatty acids in the body.
acid cycle and generate 20 ATP. Since butyryl-CoA formation costs 23. Dietary fatty acids may be abundant in an obese individual, so that
2 ATP equivalents, the net yield is 22 ATP. fatty acid synthesis occurs at a low rate. Inhibition of ACC might
12. The β oxidation of a saturated C18 fatty acid would yield 120 ATP: therefore have little effect on fat metabolism.
8 cycles of β oxidation = 32 ATP; 9 acetyl-CoA yield 90 ATP via 24. ACC catalyzes the first committed step of fatty acid synthesis, so
the citric acid cycle and oxidative phosphorylation; and 2 ATP are blocking this step might decrease the fatty acids available for stor-
consumed in activating the fatty acid. During β oxidation of ole- age as triacylglycerols (fat). The malonyl-CoA produced in the ACC
ate, the presence of the double bond allows the FADH2-generating reaction inhibits import of fatty acyl-CoA into the mitochondria, so
acyl-CoA dehydrogenase step to be skipped, at a cost of 1.5 ATP lowering the level of malonyl-CoA might help promote fatty acid
equivalents. Therefore, the ATP yield from oleate is 118.5. oxidation and reduce fat accumulation.
13. There are not as many usable nutritional calories per gram in unsatu- 25. (a) Yes; the egg phosphatidylcholine is a source of choline that is
rated fatty acids as there are in saturated fatty acids. This is because eventually converted to TMAO. (b) No; excess phosphatidylcholine
SP-34
would increase the concentration of TMAO and promote athero- This represents only about half of the energy consumed in synthe-
sclerosis. Atherosclerosis is a progressive disease that often accom- sizing stearate (30 ATP versus 56 ATP).
panies aging, so this condition would only worsen with increased 34. The synthesis of stearate from acetyl-CoA costs 56 ATP and its
intake of phosphatidylcholine. β oxidation yields 30 ATP (Problem 37). The complete oxidation
26. This molecule consists of palmitate that has been esterified to of the 9 acetyl-CoA to CO2 by the citric acid cycle yields an ad-
12-hydroxy stearate. ditional 9 GTP (equivalent to 9 ATP), 27 NADH (equivalent to
27. The products are one palmitoyl methyl ester, two oleoyl methyl es- 67.5 ATP), and 9 FADH2 (equivalent to 13.5 ATP) for a total of
ters, and one glycerol: 30 + 9 + 67.5 + 13.5 = 120 ATP. Thus, more than twice the
O energy investment of synthesizing stearate is recovered (120 ATP
versus 56 ATP).
H3C (CH2)14 C O CH3
35. Palmitate biosynthesis consumes 7 ATP and 14 NADPH (equivalent
O to 35 ATP). The addition of four more 2-carbon units as acetyl-CoA
in the mitochondrion (Fig. 20-28) consumes 4 NADH (equivalent
H3C (CH2)7 CH CH (CH2)7 C O CH3
to 10 ATP) and 4 NADPH (equivalent to 10 ATP), so that a total of
H2C CH CH2 62 ATP are consumed.
36. Palmitate biosynthesis consumes 7 ATP and 14 NADPH (equivalent
HO OH OH to 35 ATP). The addition of four more 2-carbon units, initially in the
28. The products are heptadecane (C17H36) and pentadecane (C15H32). form of acetyl-CoA, in the endoplasmic reticulum consumes 4 ATP
29. (a) Phytanate can be esterified to CoA, but the methyl group at the β (in converting acetyl-CoA to malonyl-CoA). The steps of fatty acid
position prevents the dehydrogenation catalyzed by hydroxyacyl-CoA synthesis consume 8 NADPH (equivalent to 20 ATP), so a total of
dehydrogenase (reaction 3 of the β oxidation pathway). 66 ATP are consumed.
(a) 37. Statins inhibit the HMG-CoA reductase reaction, which produces
O mevalonate, a precursor of cholesterol. Although lower cholesterol
levels induce the synthesis of HMG-CoA reductase to make up for
SCoA the loss in activity, some decrease in activity may still be present.
Because mevalonate is also the precursor of ubiquinone (coenzyme Q),
OH
2-Hydroxyphytanoyl-CoA supplementary ubiquinone may be necessary.
(b) 38. At the very low pH of the stomach, atorvastatin’s carboxylate group
is protonated and neutral, which enhances the drug’s hydrophobicity,
making it less soluble. At the neutral pH of the intestine, the drug is
more soluble because the carboxylate group is ionized.
O
Pristanal
30. Pristanate has a methyl group at the α position, which does not in- Chapter 21
terfere with the reactions of β oxidation. 1. Proteasome-dependent proteolysis requires ATP to activate ubiquitin
in the first step of linking ubiquitin to the target protein (Fig. 21-2)
O– and for denaturing the protein as it enters the proteasome.
2. The proteasome would facilitate the degradation of intracellular
O proteins that have been damaged or denatured by heat or oxidation
Pristanate and would therefore help the cell eliminate these nonfunctional
The products of β oxidation of pristanate are three acetyl-CoA, three and possibly toxic proteins so that they could be replaced by newly
propionyl-CoA, and one methylpropionyl-CoA. synthesized proteins.
31. Palmitate (C16) synthesis requires 14 NADPH. The transport of 3. The structure of the inhibitor suggests that the archaebacterial prote-
8 acetyl-CoA to the cytosol by the tricarboxylate transport system asome cleaves polypeptide substrates at hydrophobic residues such
supplies 8 NADPH (Fig. 20-23), which represents 8/14 × 100 = as Leu.
57% of the required NADPH. 4. By interfering with normal cellular protein turnover by the protea-
32. This fatty acid (linolenate) cannot be synthesized by animals be- some, ritonavir could promote the accumulation of damaged or un-
cause it contains a double bond closer than 6 carbons from its non- needed proteins. Such protein accumulation is particularly problem-
carboxylate end. atic in long-lived cells such as neurons (see Section 6-5C).
33. The synthesis of stearate (18:0) from mitochondrial acetyl-CoA 5. As a result of this reaction we get an α-keto acid, hydrogen peroxide
requires 9 ATP to transport 9 acetyl-CoA from the mitochondria to and ammonia.
the cytosol. Seven rounds of fatty acid synthesis consume 7 ATP (in Amino acid + H2O + O2 → α-keto acid + NH3 + H2O2
the acetyl-CoA carboxylase reaction) and 14 NADPH (equivalent to
6. A glutamate receptor would have helped human ancestors recognize
35 ATP). Elongation of palmitate to stearate requires 1 NADH and
protein-rich foods, because foods containing significant amounts of
1 NADPH (equivalent to 5 ATP). The energy cost is therefore 9 + 7 +
protein also contain relatively large amounts of glutamate, one of
35 + 5 = 56 ATP.
the most abundant amino acids.
The degradation of stearate to 9 acetyl-CoA consumes 2 ATP (in the
7. (a) Leu and Lys
acyl-CoA synthetase reaction) but generates, in eight rounds of β
oxidation, 8 FADH2 (equivalent to 12 ATP) and 8 NADH (equiva- (b) Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Met, Pro, Ser, and Val
lent to 20 ATP). Thus, the energy yield is 12 + 20 − 2 = 30 ATP. (c) Ile, Phe, Thr, Trp, and Tyr
SP-35
8. Tryptophan can be considered a member of this group since one of 14. In the absence of uridylyl-removing enzyme, adenylyltransferase ·
its degradation products is alanine, which is converted to pyruvate PII will be fully uridylylated, since there is no mechanism for re-
by deamination. moving the uridylyl groups once they are attached. Uridylylated
9. bond to be cleaved adenylyltransferase · PII adenylylates glutamine synthetase, which
activates it. Hence, the defective E. coli cells will have a hyperac-
O H tive glutamine synthetase and thus a higher than normal glutamine
concentration. Reactions requiring glutamine will therefore be
C CH2 C COO– accelerated, thereby depleting glutamate and the citric acid cycle
intermediate α-ketoglutarate. Consequently, biosynthetic reactions
N requiring transamination, as well as energy metabolism, will be sup-
NH2 +
H pressed.
OH 15. Glutamate dehydrogenase, glutamine synthetase, and carbamoyl
–
O phosphate synthetase.
–2
O3PO
16. Since only plants and microorganisms synthesize aromatic amino
+ acids, herbicides that inhibit these pathways do not affect amino
N CH3
H acid metabolism in animals. Thus, they are safe to be used near
them.
10. Since the three reactions converting tiglyl-CoA to acetyl-CoA and
17. The MAO inhibitors help block degradation of epinephrine, which
propionyl-CoA are analogous to those of fatty acid oxidation (β oxi-
functions as neurotransmitter in the brain.
dation; Fig. 20-12), the reactions are
18. The reaction is a transamination that removes the tryptophan
O
α-amino group, reduces the kynurenine carbonyl group, and con-
CH3 CH C C SCoA nects the α carbon to the amino group that was originally part of the
tryptophan side chain.
CH3
19. (a) Agmatine is derived by decarboxylation from arginine.
Tiglyl-CoA (b) Tyramine is decarboxylated tyrosine.
H2O 20. The compound resembles the urea cycle intermediate ornithine
(a hydratase) (with a CHF2 group at its Cα atom).
21. (a) Melatonin is derived from tryptophan, which undergoes decar-
H O boxylation, N-acetylation, hydroxylation, and O-methylation.
(b) 2-Phenylethanol is derived from phenylalanine by removal of the
CH3 C CH C SCoA
amino group and reduction of the carboxylate group to a hydroxide
OH CH3 group.
22. The pigment coloring skin and hair is melanin, which is synthesized
NAD+
from tyrosine. When tyrosine is in short supply, as when dietary
(a dehydrogenase)
protein is not available, melanin cannot be synthesized in normal
NADH amounts, and the skin and hair become depigmented.
23. The standard nitrogenase reaction, N2 → NH3, also produces H2.
O O This H2 is used to reduce CO to C2H6 and C3H8.
CH3 C CH C SCoA 24. The oxidation of ammonia to nitrite is an exergonic process that
yields the ATP and reduced NADPH required for the Calvin cycle.
CH3
25. An individual consuming a high-protein diet uses amino acids as
CoASH metabolic fuels. As the amino acid skeletons are converted to glu-
(a thiolase)
cogenic or ketogenic compounds, the amino groups are disposed
of as urea, leading to increased flux through the urea cycle. During
O O starvation, proteins (primarily from muscle) are degraded to provide
precursors for gluconeogenesis. Nitrogen from the protein-derived
CH3 C SCoA + CH3 CH2 C SCoA amino acids must be eliminated, which demands a high level of urea
Acetyl-CoA Propionyl-CoA cycle activity.
26. The urea cycle transforms excess nitrogen from protein breakdown
11. The grain protein contains little Lys, whereas the bean protein con- to an excretable form, urea. In a deficiency of a urea cycle enzyme,
tains little Met; together, the foods provide a balanced complement the preceding urea cycle intermediates may build up to a toxic level.
of essential amino acids. A low protein diet minimizes the amount of nitrogen that enters the
12. Tyrosine is derived from the essential amino acid phenylalanine, urea cycle and therefore reduces the concentrations of the toxic in-
and cysteine is derived from the essential amino acid methionine. termediates.
A diet lacking sufficient phenylalanine and methionine will lead to 27. (a) Three ATP are converted to 2 ADP and AMP + PPi, for a total
shortages of tyrosine and cysteine also. of 4 ATP equivalents.
13. The γ-carboxylate group of glutamate is reduced to form (b) The fumarate produced in the urea cycle can be converted to
glutamate-5-semialdehyde. An aminotransferase then transfers malate and then to pyruvate by malic enzyme, generating NADPH
an amino group (from glutamate or another amino acid) to yield (equivalent to 2.5 ATP). Conversion of pyruvate to acetyl-CoA
ornithine. generates NADH (2.5 ATP equivalents), and the oxidation of the
SP-36
acetyl-CoA by the citric acid cycle yields another 10 ATP, for a the conversion of pyruvate to acetyl-CoA. Complete oxidation of the
total of 15 ATP. acetyl-CoA by the citric acid cycle generates 10 more ATP equiva-
28. (a) O lents, for a total of 15 ATP. The ATP yield from 1 mol of lactate is
15 mol.
H2N C NH2 + H2O 2 NH3 + CO2 3. The pentose phosphate pathway supplies ribose as well as NADPH
(b) The NH3 produced by the action of urease can combine with to support the biosynthetic processes, including nucleotide synthe-
protons in gastric fluid to form NH4+. This could reduce the concen- sis, that are necessary for cell growth and division.
tration of protons and therefore increase the pH. 4. GLUT2 has a higher KM than GLUT1 so that the rate of glucose
29. Glutamate is converted to α-ketoglutarate by glutamate dehydroge- entry into liver cells can vary directly with the concentration of glu-
nase, producing 1 NADPH (equivalent to 2.5 ATP). The conver- cose in the blood. A transporter with a high KM is less likely to be
sion of α-ketoglutarate to malate by the citric acid cycle produces saturated with its ligand and therefore would not limit the rate of
1 NADH, 1 GTP, and 1 FADH2 (equivalent to 5 ATP). Malic en- transport.
zyme converts malate to pyruvate and generates 1 NADH (2.5 ATP 5. Type 1 glycogen storage disease results from a deficiency of
equivalents). The conversion of pyruvate to acetyl-CoA also pro- glucose-6-phosphatase so that glucose-6-phosphate produced
duces 1 NADH (2.5 ATP). The complete oxidation of acetyl-CoA by glycogenolysis cannot exit the cell as glucose. A defect in the
by the citric acid cycle generates 10 ATP, for a total of 22.5 ATP. glucose- transport protein GLUT2 would similarly prevent the exit
The conversion of methionine to homocysteine costs 3 ATP equiva- of glucose (a passive transporter can operate in either direction).
lents. The conversion of homocysteine to propionyl-CoA generates In both cases, the buildup of intracellular glucose-6-phosphate pre-
1 NADH (2.5 ATP equivalents). Conversion of propionyl-CoA to vents glycogen breakdown, and glycogen accumulates.
succinyl-CoA consumes 1 ATP. Converting succinyl-CoA to ma- 6. (a) Glutamate dehydrogenase converts glutamate to α-ketoglutarate
late by the citric acid cycle generates 1 GTP and 1 FADH2 (1.5 and NH4+ (Section 21-2B). Glutaminase converts glutamine to glu-
ATP equivalents). The remaining steps are the same as described for tamate and NH3 (Section 21-4C).
glutamate. The net yield of ATP from methionine breakdown is 16,
(b) α-Ketoglutarate → succinyl-CoA → succinate → fumarate →
significantly less than from glutamate.
malate → oxaloacetate → PEP → 2PG → 3PG → 1,3BPG → DHAP/
30. The ε-amino group is removed by the addition of α-ketoglutarate GAP → F1,6BP → F6P → G6P → glucose.
followed by the departure of glutamate (Fig. 21-22, Reactions 1 and
7. The portal vein delivers NH+4-rich blood from the intestine di-
2). The α-amino group is eliminated when α-aminoadipate under-
rectly to the liver, which can convert it to urea (only the liver carries
goes transamination with α-ketoglutarate (Fig. 21-22, Reaction 4).
out the urea cycle; Section 21-3). The remaining NH4+ is carried
31. a bond cleavage: transaminases (Fig. 21-8) and serine–threonine de- through the circulation to other tissues, where glutamine synthetase
hydratase (Fig. 21-15). b bond cleavage: amino acid decarboxylases converts glutamate to glutamine (Section 21-5A).
(Section 21-6B). c bond cleavage: serine hydroxymethyltransferase
8. Probiotics are food containing live micro-organisms that are be-
(Fig. 21-14).
lieved to provide health benefits when consumed. However, an in-
32. Biotin, conversion of pyruvate to oxaloacetate by pyruvate car- dividual’s microbiome consists of hundreds of species of microbes
boxylase (Fig. 16-18); coenzyme B12, conversion of (S)-methyl- that exist in a stable community. Ingested probiotic species are un-
malonyl-CoA to (R)-methylmalonyl-CoA (Fig. 20-19); S-adeno- likely to find an available niche in an already established ecosystem
sylmethionine, the conversion of norepinephrine to epinephrine by and therefore cannot change the overall makeup or function of the
phenylethanolamine N-methyltransferase (Fig. 21-39); tetrahydrofo- microbiome. Thus the health benefits of probiotics cannot be scien-
late, the conversion of glycine to serine by serine hydroxymethyl- tifically backed.
transferase (Fig. 21-14); thiamine pyrophosphate, the decarboxyl-
9. The availability of nutrients in the colon is limited, so organisms
ation of pyruvate by pyruvate dehydrogenase (Fig. 17-6).
that can extract more free energy from metabolic fuels through
33. Yes; one product of the glycine cleavage system is N5, N10-methylene- nitrate-based respiration have an advantage over organisms that are
THF, which provide the one-carbon group for converting dUMP to strictly limited to fermentation.
dTMP.
10. Yes. Insulin promotes the uptake of glucose via the increase in GLUT4
34. The oxidation of methylene-tetrahydrofolate (Fig. 21-20) generates receptors on the adipocyte surface. A source of glucose is necessary to
NADPH that could be used for biosynthetic reactions. supply the glycerol-3-phosphate backbone of triacylglycerols.
35. Fertilizer provides nitrogen in the form of ammonia or nitrate, which 11. Hyperinsulinemia would result in a decrease in blood glucose. The
must be taken up by plants and assimilated. The experimental re- decrease in [glucose] for the brain would cause loss of brain func-
sults suggest that the allocation of amino groups in the plant, rather tion (leading to coma and death).
than the uptake of nitrogen from fertilizer, is the limiting step. The
12. Insulin activates ATP-citrate lyase, which is the enzyme that con-
increased alanine aminotransferase activity permits assimilated ni-
verts citrate to oxaloacetate and acetyl-CoA (Section 20-4A). The
trogen to more rapidly be distributed among amino acids through
activity of this enzyme is essential for making acetyl units available
transamination reactions.
for fatty acid biosynthesis in the cytosol. The acetyl units, generated
from pyruvate in the mitochondria, combine with oxaloacetate to
Chapter 22 form citrate, which can then be transported from the mitochondria
1. At high altitude, less oxygen is available for aerobic metabolism, so to the cytosol for reconversion to acetyl-CoA.
glycolysis, an anaerobic pathway, would become relatively more im- 13. (a) Decrease; (b) decrease; (c) increase; (d) increase.
portant in active muscles. An increase in GLUT1 would increase the 14. Adipose tissue synthesizes and releases the polypeptide hormones
intracellular glucose concentration, and an increase in PFK would adiponectin, leptin, and resistin.
increase the flux of glucose through the pathway. 15. Since PYY3–36 is a peptide hormone, it would be digested if
2. Lactate must be converted back to pyruvate, which generates NADH taken orally. Introducing it directly into the bloodstream avoids
(equivalent to 2.5 ATP). Another NADH (2.5 ATP) is generated by degradation.
SP-37
Yes; PYY3–36 signals the hypothalamus to reduce secretion of the 28. The short-chain fatty acids, which are produced by the fermentation
appetite-stimulating neuropeptide Y. A feeling of nausea would also of indigestible polysaccharides by intestinal microbes, represent re-
make a person averse to eating. cent food intake and therefore help diminish appetite by triggering
16. The leptin produced by the normal mouse will enter the circulation leptin release.
of the ob/ob mouse, resulting in decreases in its appetite and weight. 29. During starvation, the synthesis of glucose from liver oxaloacetate
17. Mice lacking UCP1 are unable to dissipate excess fat through ther- depletes the supply of citric acid cycle intermediates and thus de-
mogenesis and therefore store the fat, becoming obese. At lower creases the ability of the liver to metabolize acetyl-CoA via the cit-
temperatures, the mice burn fat to generate heat (by mechanisms ric acid cycle.
that do not involve UCP1) and do not become obese. 30. Ingesting glucose before a race is not a good practice since it will
18. The test measures circulating glucose, which is abnormally high in gear the runner’s metabolism for resting rather than for running. In
diabetics. In nondiabetic individuals, blood glucose concentrations the resting state glucose causes the pancreas to release insulin. This
remain relatively low, even after a glucose “challenge” because in- stimulates the liver, muscle, and adipose tissue to synthesize glyco-
sulin signaling promotes tissue uptake of glucose. gen, fat, and protein from the excess nutrients while inhibiting the
19. Type 1 diabetics lack β cells that produce insulin, so providing the breakdown of these metabolic fuels.
hormone is an effective treatment for the disorder. In type 2 diabetes, 31. An intermediate in the biosynthesis of triacylglycerols is diacylglyc-
cells do not respond efficiently to insulin. Increasing the availability erol (DAG), a second messenger responsible for activating PKC.
of the hormone may boost its signaling activity in some patients, but 32. (a) Amylin helps insulin maintain a constant level of glucose in the
in the majority of type 2 diabetics, insulin levels are already elevated blood by slowing the movement of food from the stomach to the
and further increases are ineffective. intestine and by slowing digestion, both of which decrease the rate
20. PFK-2 catalyzes the production of fructose-2,6-bisphosphate, so in- of entry of food-derived glucose into the blood. (b) In hypoglyce-
creasing PFK-2 activity would increase the concentration of this ac- mia, the brain does not respond to amylin, which allows food to
tivator of phosphofructokinase. The effect would be increased flux be digested and absorbed quickly in order to restore normal blood
of glucose through glycolysis, which would help lower the concen- glucose levels.
tration of glucose in the blood. 33. Cells that lack asparagine synthetase cannot synthesize asparagine
21. Severely underweight individuals are at a higher risk of dying from from aspartate (which is easily made by transamination of oxaloace-
malnutrition-related causes, while severely overweight individuals tate) and must obtain asparagine from the circulation. Asparaginase,
are at higher risk of dying from obesity-related diseases such as dia- which catalyzes removal of asparagine’s amino group to generate
betes and atherosclerosis. Both these groups are more likely to die aspartate, reduces the availability of asparagine to the point where
than individuals of intermediate weight. leukemic cells cannot survive.
22. 3-Phosphoglycerate is an intermediate of glycolysis; its concentra- 34. Physical inactivity would lead to a decreased need for ATP in
tion increases when glycolytic flux slows. By inhibiting 6-phospho- muscle, which would be reflected by a decreased AMP to ATP
gluconate dehydrogenase, 3PG slows pentose phosphate pathway ratio. A decrease in the ratio would lead to a decrease in AMPK
activity also. Slower consumption of glucose would tend to slow the activity.
growth of the cancer cell. AMPK activity is positively associated with glucose uptake by cells
23. ATP generating pathways such as glycolysis and fatty acid oxidation due to an increase in GLUT4 activity. GLUT4 activity is also in-
require an initial investment of ATP (the hexokinase and phospho- creased by insulin. A decrease in AMPK activity causes a decrease
fructokinase steps of glycolysis and the acyl-CoA synthetase activa- in GLUT4 activity, making insulin’s job more difficult.
tion step that precedes β oxidation). This “priming” cannot occur
when ATP has been exhausted. Chapter 23
24. (a) In the absence of MCAD, fatty acids cannot be fully oxidized to 1. Following aspartate addition to IMP, adenylosuccinate lyase re-
acetyl-CoA (Section 20-2C). Since ketone bodies are synthesized moves fumarate, leaving an amino group. In the urea cycle, follow-
from acetyl-CoA (Section 20-3), ketogenesis is impaired. ing the addition of aspartate to citrulline, argininosuccinase removes
(b) In normal individuals, acetyl-CoA activates pyruvate carboxylase fumarate, leaving an amino group.
(Section 17-5B), which converts pyruvate to oxaloacetate. This increases 2. Structure of caffeine:
O
the capacity of the citric acid cycle to metabolize acetyl-CoA. CH3
When glucose levels are low, the oxaloacetate is used for gluconeo- H3C N
genesis (Section 16-4). In MCAD deficiency, lack of fatty acid– N
derived acetyl-CoA keeps pyruvate carboxylase activity low, thereby
limiting the synthesis of glucose and contributing to hypoglycemia. O N N
25. Elevated levels of circulating fatty acids occur during an extended
CH3
fast, when dietary glucose and glucose mobilized from glycogen
stores are no longer available. Insulin release would be inappropri- Caffeine
ate for these conditions. A combination of abundant fatty acids and Caffeine is derived by the methylation of xanthine, a purine.
glucose, indicating the fed state, would serve as a better trigger for 3. Guanine has an amino group attached to C2; in azahypoxanthine,
insulin release. nitrogen is part of the ring structure.
26. Leucine is an essential amino acid; it cannot be synthesized by hu- 4. PRPP and FGAR accumulate because they are substrates of Re-
mans. It is derived from food. Circulating leucine therefore serves as actions 2 and 5 in the IMP biosynthetic pathway (Fig. 23-1).
a marker of sufficient food intake. XMP also accumulates because the GMP synthetase reaction is
27. Because fatty acids, like glucose, are metabolic fuels, it makes meta- blocked (Fig. 23-3). Although glutamine is a substrate of carbam-
bolic sense for them to stimulate insulin release, which is a signal of oyl phosphate synthetase II (the first enzyme of UMP synthesis;
abundant fuel. Fig. 23-5), the other substrates of this enzyme do not accumulate.
SP-38
UTP, a substrate of the CTP synthetase reaction, also accumulates, 18. 5-Fluorouracil is an anticancer drug because it is converted in the
although strictly speaking, it is a nucleotide biosynthetic product body to FdUMP, an inhibitor of thymidylate synthase. In the ab-
rather than an intermediate. sence of adequate dihydropyrimidine dehydrogenase activity, the
5. Amidophosphoribosyl transferase (step 2 of IMP synthesis), FGAM drug cannot readily be broken down, so it accumulates to toxic
synthetase (step 5 of IMP synthesis), GMP synthetase (GMP syn- levels in the body.
thesis), carbamoyl phosphate synthetase II (step 1 of UMP synthe- 19. Uracil and thymine accumulate in the urine because they cannot be
sis), and CTP synthetase (CTP synthesis). further degraded in the absence of the dihydropyrimidine dehydro-
These are all enzymes of nucleotide biosynthesis that use glutamine genase (Fig. 23-25).
as an amino group donor. 20. Nicotinamide
6. (a) 7 ATP; (b) 8 ATP; (c) 7 ATP
7. Hydroxyurea destroys the tyrosyl radical that is essential for the O
activity of ribonucleotide reductase. Tumor cells are generally fast
C
growing and cannot survive without this enzyme, which supplies NH2
dNTPs for nucleic acid synthesis. In contrast, most normal cells
grow slowly, if at all, and hence have less need for nucleic acid +
_2 N
synthesis. O3P O CH2 O
8. (a) The compound is a uridine derivative (it lacks the ring H H

nitrogen) and acts as a competitive inhibitor of CTP synthase. H H
(b) Because CTP is a precursor of CDP–choline and CDP– OH OH
ethanolamine (Fig. 20-33), reduced CTP production also limits Nicotinamide mononucleotide (NMN)
the production of the lipids phosphatidylcholine and phosphati-
dylethanolamine.
9. dATP is toxic to animals. It inhibits ribonucleotide reductase, there- O
by preventing the synthesis of the deoxynucleotides required for
DNA synthesis. C
NH2
10. FdUMP and methotrexate kill rapidly proliferating cells, such as
+
cancer cells and those of hair follicles. Consequently, hair falls out. N Adenine
11. Serine donates a hydroxymethyl group to THF in order to regenerate
Ribose
P P Ribose
the cofactor for the conversion of dUMP to dTMP by thymidylate
synthase (Fig. 23-16). Nicotinamide adenine dinucleotide (NAD+)
12. The synthesis of histidine and methionine requires THF. The
21. O CH2 O OH
cell’s THF is converted to DHF by the thymidylate synthase
reaction, but in the presence of methotrexate, THF cannot be re- H H
generated. H H
13. Trimethoprim binds to bacterial dihydrofolate reductase but HO O C CH3
does not permanently inactivate the enzyme. Therefore, it is not
a mechanism-based inhibitor. NH2 O
14. p-Aminosalicylate is an analog of p-aminobenzoate, which the bac- O P O–

N N
teria use to synthesize tetrahydrofolate. The additional hydroxyl O
group prevents the resulting folate derivative from participating
normally in the thymidylate synthesis pathway, so the bacteria can- O P O– N
N
not grow. (In fact, the folate derivative of the drug blocks the DHFR O CH2 O
reaction.)
H H
15. The conversion of dUMP to dTMP is a reductive methylation. H H
In the thymidylate synthase reaction shown in Fig. 23-15, THF
is oxidized to DHF, so that DHFR must subsequently reduce the HO OH
DHF to THF.
22. The kinase-catalyzed phosphorylation of riboflavin consumes one
Organisms that lack DHFR use an alternative mechanism for con- “high-energy” bond. In the second reaction, an AMP group is trans-
verting dUMP to dTMP in which the FAD cofactor of the enzyme, ferred from ATP to FMN (thereby breaking a second “high-energy”
rather than the folate, undergoes oxidation. bond), leaving PPi, whose subsequent hydrolysis breaks a third
16. Fumarate is converted to malate by fumarase; malic enzyme de- “high-energy” bond.
carboxylates malate to produce pyruvate; pyruvate is converted to 23. The conversion of thymine to methylmalonyl-CoA consumes
acetyl-CoA and CO2 by pyruvate dehydrogenase; and the citric acid NADPH but generates NADH. Methylmalonyl-CoA is converted
cycle oxidizes the acetyl group to 2 CO2. to succinyl-CoA, which enters the citric acid cycle and is converted
17. Suicide inhibition is also known as suicide inactivation or mecha- to malate, thereby producing one ATP equivalent and FADH2
nism-based inhibition. Allopurinol is oxidized by xanthine oxidase (equivalent to 1.5 ATP). Malate is converted to pyruvate by malic
to a product that irreversibly binds to the enzyme. Thus, it is a sui- enzyme, producing NADPH (equivalent to 2.5 ATP). The pyruvate
cide inhibitor of xanthine oxidase. dehydrogenase reaction generates NADH (2.5 ATP equivalents)
SP-39
14
and acetyl-CoA. Oxidation of acetyl-CoA by the citric acid cycle Ccytosine and 14C-ribose would mix with the different-sized
generates 1 ATP, 3 NADH (7.5 ATP), and FADH2 (1.5 ATP), for pools of unlabeled cellular cytosine and ribose before recom-
a total yield of 17.5 ATP. bining as the deoxycytidylate that becomes incorporated into
24. Ribose phosphate pyrophosphokinase catalyzes the activation of DNA. [This experiment established that deoxyribonucleotides,
ribose-5-phosphate to produce PRPP, the substrate for the second in fact, are synthesized from their corresponding ribonucleotides
reaction of purine nucleotide synthesis and the fifth step of pyrimi- (alternative a).]
dine nucleotide synthesis. High concentrations of ADP and GDP
signify high metabolic demand and low concentration of nucleo-
side triphosphates, a situation when the cell’s resources should be Chapter 24
directed toward energy metabolism rather than the production of 1. Hypoxanthine pairs with cytosine in much the same way as does
nucleotides for the synthesis of DNA or RNA. guanine.
25. UTP functions as a feedback inhibitor of its own synthesis, to pre- H
vent the cell from synthesizing too many pyrimidine nucleotides.
ATP activates pyrimidine nucleotide synthesis so that when ATP N H... O N
concentrations are high, the production of other nucleotides will in-
crease to match it. N ...H N N
R
26. Threonine is broken down to acetyl-CoA and glycine, either di- N N
rectly via the serine hydroxymethyltransferase reaction (reac- R O H
tion 5 in Fig. 21-14) or through the intermediacy of α-amino-β-
C Hypoxanthine
ketobutyrate via the threonine dehydrogenase reaction (reaction
6 of Fig. 21-14) followed by the α-amino-β-ketobutyrate lyase 2. H T
reaction (reaction 7 of Fig. 21-14). The acetyl-CoA can enter
N N H...... O CH3
the citric acid cycle to produce considerable ATP via oxidative
phosphorylation. The glycine is a substrate of the glycine cleav-
age system, which generates N5,N10-methylene-THF (reaction 3
N N......H N
of Fig. 21-14), the methyl-group donor required for thymidylate N N
synthesis. A O
27. The mutant cells grow because the medium contains the thymidine
3. Since amino acids have an average molecular mass of ∼110 D, the
they are unable to make. Normal cells, however, continue to synthe-
30-kD protein contains 30,000 D ÷ 110 D/residue = ∼273 resi-
size their own thymidine and thereby convert their limited supply of
dues. These residues are encoded by 273 × 3 = 819 nucleotides. In
THF to DHF. The methotrexate inhibits dihydrofolate reductase, so
B-DNA, the rise per base pair is 3.4 Å, so the contour length of 819 bp
THF cannot be regenerated. Without a supply of THF for the synthe-
is 3.4 Å/bp × 819 bp = 2785 Å, or 0.28μm.
sis of nucleotides and amino acids, the cells die.
4. In A-DNA, the contour length would be 819 bp × 2.9 Å/bp = 2375 Å,
28. In von Gierke’s disease (glucose-6-phosphatase deficiency),
or 0.24 μm.
glucose-6-phosphate accumulates in liver cells, thereby stimu-
lating the pentose phosphate pathway. The resulting increase 5. Table 11-1 shows that the rate of the reaction that is catalyzed by
in ribose-5-phosphate production boosts the concentration of Staphylococcal nuclease, hydrolysis of a polynucleotide chain, is
PRPP, which in turn stimulates purine biosynthesis. High levels 1.7 × 10−13 s−1 in the absence of the enzyme. The half-life for the
of uric acid derived from the breakdown of the excess purines reaction is t1/2 = 0.693/k (Equation 12-9), or 0.693/(1.7 × 10−13 s−1) =
cause gout. 4.1 × 1012 s. This is equivalent to (4.1 × 1012 s)(1 min/60 s)
(1 h/60 min)(1 d/24 h)(1 yr/365 d) = 130,000 years.
29. In muscles, the purine nucleotide cycle functions to convert aspar-
tate to fumarate to boost the capacity of the citric acid cycle. If glu- 6. H
H
tamate dehydrogenase activity were high, then it would combine the N N
N
NH4+ produced by the purine nucleotide cycle with α-ketoglutarate H.....
to yield glutamate, a reaction that depletes a citric acid cycle inter- H N N
mediate. Therefore it is important for the muscle cells to have low N
N H ...
levels of glutamate dehydrogenase. ..
....
O O N
30. Glycine is incorporated in the purine ring during its de novo syn-
...
...
thesis. If the gout is due to overproduction of purines, the excreted N

.
H
...
uric acid should contain a high proportion of 15N. If the gout is due H N H
.
H N H
....
to impaired excretion of uric acid, much of the excess uric acid will
arise from the degradation of ingested purines and hence be 15N- H
N
...
......
free. The fraction of excreted uric acid containing 15N will therefore
N O. . . . . O
be relatively low. . .H
.
31. (a) The recovered deoxycytidylate would be equally labeled in its N

N
base and ribose components (i.e., the same labeling pattern as in the H
N N. . . . . . .H
original cytidine). N
N N
(b) The recovered deoxycytidylate would be unequally la- H
beled in its base and ribose components because the separated H
SP-40
7. T 15. C
A U U G U G A
T A
A T A A U A G C A C U
A U
T
G G 16.
G G Top –
G G 28S RNA
G G
G G
G G 16S RNA
A Direction
A T of
T migration
T
T
5S RNA
Bottom +
8. The nonpolar solvent diminishes the hydrophobic forces that stabi-
lize double-stranded DNA and hence lowers the Tm.
9. Its Tm decreases because the charges on the phosphate groups 17. The target sequence consists of 6 symmetry-related base pairs. Since
are less shielded from each other at lower ionic strength and there are 4 possible base pairs (A · T, T · A, G · C, and C · G), the
hence they repel each other more strongly, thereby stabilizing probability that any two base pairs are randomly related by symme-
the double helix. try is 1/4. Hence, the probability of finding all 6 pairs of base pairs
10. The enzyme has no effect on the supercoiling of DNA since cleav- by random chance is (1/4)6 = 2.4 × 10−4.
ing the C2′—C3′ bond of ribose does not sever the sugar–phosphate 18. Experiment 1. The restriction enzyme failed to digest the ge-
chain of DNA. nomic DNA, leaving the DNA too large to enter the gel during
11. Assuming all the DNAs in Figure 24-8 contain the same number electrophoresis.
of base pairs, the DNA structure with no supercoil at extreme left
Experiment 2. The hybridization conditions were too “relaxed,”
would move slowest during electrophoresis, because its relaxed
resulting in nonspecific hybridization of the probe to all the DNA
structure. Supercoiling of DNA makes its structure compact and al-
fragments. This problem could be corrected by boiling the blot to
lows it to move fast through the agarose matrix in comparison to
remove the probe and repeating the hybridization at a higher tem-
relaxed DNA.
perature and/or lower salt concentration.
12. The segment with 15% A residues (i.e., 30% A · T base pairs)
Experiment 3. The probe hybridized with three different mouse
contains 70% G · C base pairs and therefore melts at a higher
genes. The different intensity of each band reflects the relatedness
temperature than a segment with 30% A residues (i.e., 60% A · T
of the sequences. The most intense band is most similar to the hu-
base pairs) contains 40% G · C base pairs.
man rxr-1 gene, whereas the least intense band is least similar to
13. (a) As the temperature increases, the stacked bases melt apart the rxr-1 gene.
so that their ultraviolet absorbance increases (the hyperchromic
19. (a) A 6-nt sequence would be expected to occur, on average, every
effect).
46 = 4096 nt in single-stranded DNA. However, in double- stranded
(b) The broad shape of the poly(A) melting curve indicates non-
DNA, it would be expected to occur at twice this frequency, that is,
cooperative changes, as expected for a single-stranded RNA. The
every 4096/2 = 2048 bp. Thus the expected number of copies of a
sharp melting curve for double-stranded DNA reflects the coopera-
6-bp sequence in the E. coli genome is 4,639,000 bp/2048 bp = 2265.
tivity of strand separation.
(b) A 12-bp sequence would be expected to occur, on average, every
14. G 412/2 = 8,388,608 bp, which is nearly twice as large as the number
C G
C G of base pairs in the E. coli genome. Thus the trp repressor is unlikely
G C to bind specifically to any other site in the E. coli chromosome.
C G 20. Because they interact closely with DNA, protamines must be rich in
A T
T A basic amino acids. In fact, they are particularly rich in arginine.
C G 21. The decarboxylation of the amino acid ornithine, an intermediate of
G C the urea cycle (Fig. 21-9), generates 1,4-diaminobutane (also known
T A
A T as putrescine):
+
5′- T C A T G C -3′ H3N—(CH2)4—NH3+
3′- A G T A C G -5′ This cationic molecule interacts electrostatically with the negatively
T A charged phosphate groups of DNA.
A T 22. (a) The contour length is 3 × 107 bp × 3.4 A/bp = 10 × 107 Å =
C G
G C
10 mm.
A T (b) A nucleosome, which binds ∼200 bp, compresses the DNA to
T A an 80- Å-high supercoil. The length of the DNA is therefore (80 Å/
G C
200 bp) × (3 × 107 bp) = 1.2 × 107 Å = 1.2 mm.
C G
G C 23. The 30-nm fiber compacts DNA by a factor of ∼36. Thus the length
G C of the 50,000-bp 30-nm fiber is (5 × 107 bp × 3.4 Å / bp)/36 = 1.7 ×
C
108 Å/36 = 0.47 mm.
SP-41
24. (a) The ARSK sequence in NS1 is almost identical to the ARTK 34. Type I is closed circular duplex DNA, type II is a nicked circular
sequence in histone H3. (b) By mimicking the N-terminus of the duplex DNA, and type III is linear duplex DNA. Type I DNA has
histone, NS1 may compete for the enzymes that covalently modify such a broad melting curve and a high Tm because its strands cannot
histones. Since histone modification can alter the transcription separate from each other without breaking a covalent bond (its ΔS
of the associated DNA in the nucleosome, NS1 can alter gene of melting is unusually small). The bases therefore tend to remain
expression. paired above the Tm for the equivalent linear DNA. The slightly
25. Base methylation is expected to have little or no effect on nucleoso- greater sedimentation coefficient of type I in comparison with type
mal structure, because there are few contacts between histones and II DNA indicates that type I is supercoiled, which makes it more
bases and the small, nonpolar methyl group would be unlikely to compact than type II. The relaxed circles of type II DNA are more
disrupt the mostly ionic interactions between the histones and the compact than type III, the linear duplex, and hence type II DNA
DNA backbone. sediments faster than type III.
26. Histones are required in large amounts during a relatively short pe- At pH 13, which denatures duplex DNA, type III DNA under-
riod when DNA is replicated prior to cell division. The large number goes strand separation to yield linear single strands of 16S. Type
of histone genes allows the efficient production of histones. II DNA also undergoes strand separation to yield a 16S linear
single strand and a slightly more compact 18S single-stranded
27. H circle. Type I DNA denatures but its strands cannot unwind from
H
H . each other (L remains constant). However, the stiff double-he-
O .. H
N
N lical structure has collapsed so that denatured type I DNA is a
N
highly compact entity. This accounts for its 53S sedimentation
H N coefficient.
N .
N.. H N
35. In the B-DNA to Z-DNA transition, a right-handed helix with one
N O turn per 10.5 base pairs converts to a left-handed helix with one turn
per 12 base pairs. Since a right-handed duplex helix has a positive
G C twist, the twist decreases:
28. H −120 120

ΔT = − = −21.4 turns
H... .... O
N CH3
12 10.5
N The linking number must remain constant (ΔL = 0) since no covalent
. bonds are broken. Hence, the change in writhing number is ΔW =
N. . H N
−ΔT = 21.4 turns.
N N
N O
Chapter 25
A T
1. Okazaki fragments are 100 to 200 nt long in humans, and the chro-
The helix diameter is smaller in this alternate arrangement (Hoogs-
mosomes contain 6.0 × 109 bp (humans are diploid). Therefore,
teen base pairing).
human chromosomal replication requires 6.0 × 107 to 3.0 × 107
29. Okazaki fragments.
O O
+ –
2. Okazaki fragments are 1000 to 2000 nt long, and the E. coli chromo-
H3N CH2 CH2 NH CH2 C NH CH2 CH2 NH CH2 C O
some contains 4.6 × 106 bp. Therefore, E. coli chromosomal repli-
30. The PNA backbone contains six covalent bonds between each base cation requires 2300 to 4600 Okazaki fragments.
attachment site, the same number of bonds as in a DNA backbone 3. The 5′ → 3′ exonuclease activity of Pol I is essential for DNA
(see Fig. 24-5). Consequently, the spacing between bases within replication as it removes RNA primers and replaces them with
each polymer is compatible with base pairing. DNA. Absence of this activity would be lethal. Thus, mutants
31. At extremely high [Na+], there is little water available to promote completely lacking Pol I 5′ → 3′ exonuclease activity might not
hydrophobic bonding because most water molecules are involved survive at all.
in solvating the ions in the solution. Consequently, the structure of 4. The drug would inhibit DNA synthesis because the polymerization
double-helical DNA, which is largely stabilized by hydrophobic reaction is accompanied by the release and hydrolysis of PPi. Failure
forces, is destabilized by increasing [Na+] as is indicated by its de- to hydrolyze the PPi would remove the thermodynamic driving force
creasing Tm. for polymerization, that is, it would be reversible.
32. The bonds opposite atoms C2′ and C3′ in the ribose ring both con- 5. When DNA polymerase begins synthesizing a new strand, it binds
tain O1′. Since O1′ has no extra-annular substituents, none of the the template DNA to which an RNA primer is already base paired.
substituents to the ribose ring will be eclipsed if either C2′ or C3′ In order to extend the primer, the polymerase active site must ac-
is out of the plane of the other ring atoms. This minimizes the steric commodate DNA–RNA hybrid helix, which has an A-DNA-like
interference between ring substituents. structure (Fig. 24-4).
33. L = T + W. For the constrained DNA circle, W = 0 so that L = T = 6. PPi is the product of the polymerization reaction catalyzed by DNA
217. For the unconstrained DNA circle, L = 217 since this quantity polymerase. This reaction also requires a template DNA strand and
is invariant, T = 2415 bp/(10.5 bp/turn) = 230, and W = L − T = a primer with a free 3′ end.
217 − 230 = −13. For the constrained DNA circle, σ = W/ T = (a) There is no primer strand, so no PPi is produced.
0/217 = 0. For the unconstrained DNA circle, σ = −13/230 =
(b) There is no primer strand, so no PPi is produced.
−0.056 (a value that is typical of naturally occurring DNA circles
in vivo). (c) PPi is produced.
SP-42
(d) No PPi is produced because there is no 3′ end that can be ex- I will pair with C. Thus, one daughter cell will be normal and one
tended. will have an abnormal I · C base pair. (b) After the second round of
(e) PPi is produced. cell division, two cells will be normal (A · T base pairs). One cell
(f) PPi is produced. will have an abnormal I · C base pair, and one will have a normal but
mutated C · G base pair.
7. AT-rich DNA is less stable than GC-rich DNA and therefore would
more readily melt apart, a requirement for initiating replication. 19. The triphosphatase destroys nucleotides containing the modified
base before they can be incorporated into DNA during replication.
8. DNA polymerase could extend a primer that entered its active site,
but polymerization would not be highly processive unless the slid- 20. (a) Without an active site Cys residue, the alkyl transfer reaction
ing clamp was in place. If the primer first associates with the clamp, cannot occur.
which then interacts with DNA polymerase, the primer can be ex- (b) Although the proteins cannot remove the alkyl group attached
tended in a processive and therefore more efficient manner. to the guanine by direct repair, they can still bind to the modified
9. DNA gyrase adds negative supercoils to relieve the positive super- residue, thereby marking this region of DNA for repair by NER
coiling that helicase-catalyzed unwinding produces ahead of the enzymes.
replication fork. 21. Mammalian DNA contains 5-methylcytosine residues paired with
10. Mismatch repair and other repair systems correct most of the errors guanine residues. Oxidative deamination of m5C produces thymine.
missed by the proofreading functions of DNA polymerases. The thymine–DNA glycosylase removes the T in the resulting T · G
base pair so that it can be replaced with C to restore the correct C · G
11. The E. coli replication system can fully replicate only circular
base pair.
DNAs. Bacteria do not have a mechanism (e.g., telomerase cata-
lyzed extension of telomeres) for replicating the extreme 3′ ends of 22. When 5-methylcytosine residues deaminate, they form thymine
linear template strands. residues.
12. After adding the 6-nt telomere sequence, telomerase translocates to
NH2 O
the new 3′ end to add another repeat. The RNA template includes a
region of overlap (∼3 nt) that helps position the enzyme and tem- CH3 H CH3
N N
plate for the next addition of nucleotides (see Fig. 25-27).
13. Telomeres are repetitive nucleotide sequence located at the termini
of linear chromosomes of most of the eukaryotes. It is a short G-rich O N O N
sequence. The broken end of a chromosome will not have the char-
acteristic structure of a telomere, which includes repeating DNA
5-Methyl-C T
sequences plus telomere binding proteins.
14. (a) RNA polymerase or primase; (b) DNA polymerase; (c) reverse Since thymine is a normal DNA base, the repair systems cannot de-
transcriptase or telomerase. termine whether such a T or its opposing G is the mutated base.
15. (a) Br O H... O N Consequently, only about half of the deaminated 5-methylcytosines
are correctly repaired.
N...H
N
N 23. Base excision repair. The deaminated base can be recognized be-
N N cause hypoxanthine does not normally occur in DNA.
O...H N 24. After the damaged DNA has been removed and replaced by the ac-
tion of DNA polymerase, the final phosphodiester bond (between
H
the 5′ end of the original DNA and the 3′-OH of the last nucleotide
5BU added) must be formed by the action of DNA ligase.
(enol tautomer) Guanine 25. An intrastrand cross-link can be repaired by a system such as nu-
(b) When 5BU incorporated into DNA pairs with G, the result is an cleotide excision repair or recombination repair with no net loss of
A · T → G · C transition after two more rounds of DNA replication: nucleotides. However, repair of an interstrand cross-link requires
A · T → A · 5BU → G · 5BU → G · C the removal and replacement of nucleotides on both strands of
DNA, so that even with a system such as homology-directed re-
16. The cytosine derivative base pairs with adenine, generating a C · G →
pair, the repaired DNA is less likely to have the same sequence as
T · A transition.
the original DNA.
H O H
26. First, an endoribonuclease must cleave one of the two phosphodies-
N...H N N
ter bonds involving the ribonucleotide, then a second endonuclease
must cleave the other bond to completely remove the ribonucleotide.
H...N
N The resulting gap can be filled in by DNA polymerase, and the nick
N
N
sealed by DNA ligase.
N
O 27. DNA polymerase η can synthesize a complementary DNA strand,
but the thymine dimer is still present. It can be repaired later by the
Adenine
NER pathway.
17. (a) After one round of cell division, one daughter cell will contain a
28. Pol V is less processive than Pol III. When the progress of Pol III is
normal A · T base pair, and the other cell will contain a C · A mismatch.
arrested by the presence of a thymine dimer, Pol V can take over, al-
(b) Two rounds of cell division yield three cells with a normal A · T lowing replication to continue at a high rate, although with a greater
base pair and one cell with a C · G base pair (a transition mutation). incidence of mispairings. The damage is minimal, however, since
18. (a) The original A · T base pair becomes an I · T base pair. When the Pol V soon dissociates from the DNA, allowing the more accurate
DNA replicates, the template T will pair with A, and the template Pol III to resume replicating DNA.
SP-43
29. Topoisomerases maintain the appropriate degree of supercoiling (c) Okazaki fragments in E. coli range in length from 1000 to 2000 nt.
during DNA replication. These enzymes act by cleaving one or Hence their expanded lengths would be
both DNA strands and covalently linking the 3′- or 5′-phosphate (1000 to 2000) nt × 3.4 Å/nt × 0.05 m/Å × 0.001 km/m
to an enzyme Tyr residue (Section 24-1D). If the catalytic cycle = (0.17 to 0.34) km
is not completed, the enzyme remains associated with the cut
DNA and impedes replication and transcription. A tyrosyl–DNA (d) The E. coli replisome makes around one error for every 10 mil-
phosphodiesterase frees the trapped topoisomerase so that the lion bases it correctly replicates. Hence the distance between errors
DNA can be repaired by other enzymes. that it would travel in our expanded system is
30. (a) Loss of the helicase DnaB, which unwinds DNA for replication, 107 nt × 3.4 Å/nt × 0.05 m/Å × 0.001 km/m = 1700 km
would be lethal. 35. DNA polymerization results in the formation of base pairs. Since
(b) Loss of Pol I would prevent the excision of RNA primers and a back reaction should be the exact reverse of a forward reaction,
would therefore be lethal. pyrophosphorolysis, the back reaction of DNA polymerization,
(c) SSB prevents reannealing of separated single strands. Loss of should act only on base paired 3′-terminal nucleotides. Conse-
SSB would be lethal. quently, there must be two forms of the enzyme–DNA complex.
That which is base paired favors synthesis or pyrophosphorolysis,
(d) RecA protein mediates the SOS response and homologous re-
whereas that which is unpaired favors hydrolysis. Hence, the en-
combination. Loss of RecA would be harmful but not necessarily
zyme must have two at least partially separate active sites for these
lethal.
activities.
31. In gene therapy, a normal copy of the gene is introduced, but the
defective gene is still present; in the CRISPR–Cas9 approach, the 36. E. coli contains a low concentration of dUTP, which DNA
defective gene can be entirely removed and replaced. polymerase incorporates into DNA in place of dTTP. The result-
ing uracil bases are rapidly excised by uracil–DNA glycosylase
32. In conjugation, the ssDNA becomes incorporated into the recipi-
followed by nucleotide excision repair (NER), which temporar-
ent’s DNA through homologous recombination. RecBCD includes
ily causes a break in the DNA chain. DNA that is isolated be-
nuclease and helicase activity, which are necessary to nick and un-
fore DNA polymerase I and DNA ligase can complete the re-
wind the recipient dsDNA so that the incoming ssDNA can be intro-
pair process would be fragmented. However, in the absence of a
duced.
functional uracil–DNA glycosylase, the inappropriate uracil
33. As indicated in Fig. a (below), nucleotides would be added to a poly- residues would remain in place, and hence leading strand DNA
nucleotide strand by attack of the 3′-OH of the incoming nucleotide would be free of breaks. The lagging strand, being synthesized
on the 5′ triphosphate group of the growing strand with the elimina- discontinuously, would still contain breaks, although fewer than
tion of PPi. The hydrolytic removal of a mispaired nucleotide by the otherwise.
5′ → 3′ exonuclease activity (Fig. b, below) would leave only an OH
group or a monophosphate group at the 5′ end of the DNA chain. 37. The Klenow fragment, which lacks 5′ → 3′ exonuclease activity
This would require an additional activation step before further chain (and therefore cannot catalyze nick translation), is used to ensure
elongation could commence. that all the replicated DNA chains have the same 5′ terminus. For
the chain terminator method of sequencing DNA, this is a neces-
sity because a sequence is assigned according to fragment length.
(a) 3′ → 5′ Polymerase
For pyrosequencing or Illumina sequencing, the DNA segments
5′ 3′
PPi at a particular position on the sequencing well or slide must all be
identical or the identification of each nucleotide in the sequence
OH ... ... will be ambiguous.
+
ppp ppp p p ppp p p p 38. Use Equation 12-6,
ln[A] = ln[A]o − kt
(b) 5′ → 3′ Exonuclease
where [A]o = 6.0 × 109, [A] = [A]o − 2 × 104 = 5.99998 × 109,
5′ 3′
and t = 1 d. Solve the equation for k:
H2O
... OH ... [A]o 6 × 109
+ k = (ln /t = (ln /ld
ppp p p [A] ) 5.99998 × 109 )
p p ppp p p
k = ln (1.0000033)/1 d = 0.0000033 d−1

Using Equation 12.9,
34. The conversion factor between the real and expanded systems is
t1/2 = 0.693/k = 0.693/0.0000033 d−1
1 m/20 Å = 0.05 m/Å.
= 2.08 × 105 d × (1 y/365 d) = 570 y
(a) The length of B-DNA is 3.4 Å/bp. The replisome replicates DNA
at the rate of ∼1000 bp/s. Hence, the rate of travel of the expanded 39. The E. coli genome consists of 4.6 × 106 bp so that it has
replisome is 2 × 4.6 × 106 = 9.2 × 106 nt. The Chi sequence (GCTGGTGG),
3.4 Å/bp × 1000 bp/s × 0.05 m/Å × 3600 s/hr which alters the behavior of RecBCD, consists of 8 nt. Hence,
× 0.001 km/m = 610 km/hr if it occurred at random, its expected frequency would be once
every 48 nt. Consequently, the randomly expected number of Chi
(b) The E. coli genome consists of ∼4.6 million bp (Table 3-3).
sequences in the E. coli genome is
Each replisome in E. coli’s bidirectional replication fork repli-
cates half this DNA. Hence the distance each replisome must Expected number of Chi sequences = 2 × 4.6 × 106 nt/48 nt = 143.
travel is Therefore, the Chi sequence occurs 1009/143 = 7.1 times more
1/2 × 4.6 × 106 bp × 3.4 Å/bp × 0.05 m/Å × 0.001 km/m = 390 km frequently than if it occurred at random.
SP-44
40. A composite transposon consists of a central region flanked by two 9. DNA pol RNA pol
IS-like units, which in turn, are each flanked by inverted repeats:
3′ 5′
ike Central region IS-li 5′
IS-l it unit
ke
u n
Composite
transposon DNA pol
3′ 5′
5′
10. (a) Because expression of bacteriophage genes requires the host’s

Plasmid
RNAP, the increased rate of transcription of bacteriophage genes
and decreased rate of transcription termination boost the production
Thus, the plasmid has the same relationship to the IS-like units as does of phage-specific mRNAs.
the transposon’s central region; that is, it is flanked by these IS-like units (b) Q must recognize the promoters of bacteriophage genes so that it
with their flanking inverted repeats. The entire plasmid, with the flanking can bind to the RNAP transcribing those genes. Without this speci-
IS-units, may therefore be transposed rather than the composite transpo- ficity, Q could enhance transcription of all genes in E. coli.
son. Indeed, the plasmid with the flanking IS-like units is a transposon. 11. The cell lysates can be applied to a column containing a matrix with
immobilized poly(dT). The poly(A) tails of processed mRNAs will
Chapter 26 bind to the poly(dT) while other cellular components are washed
away. The mRNAs can be eluted by decreasing the salt concentra-
1. The probe should have a sequence complementary to the consensus
tion to destabilize the A · T base pairs.
sequence of the 6-nt Pribnow box: 5′-ATTATA-3′.
12. DNA polymerase needs a primer; poly(A) polymerase uses the
2. (a) Cordycepin is the 3′-deoxy analog of adenosine.
premRNA as a primer; CCA-adding polymerase uses the immature
(b) Because it lacks a 3′-OH group, the cordycepin incorporated tRNA as a primer; and RNA polymerase does not require a primer.
into a growing RNA chain cannot support further chain elongation Both DNA polymerase and RNA polymerase require a DNA tem-
in the 5′ → 3′ direction. plate, but neither poly(A) polymerase nor CCA-adding polymerase
3. (a) mRNA(n residues) + Pi → NDP + mRNA(n − 1 residues) uses a template. The four polymerases use different sets of nucleo-
(b) The reverse of the phosphorolysis reaction is an RNA polymeriza- tides: DNA polymerase uses all four dNTPS; RNA polymerase uses
tion reaction. PNPase uses an NDP substrate to extend the RNA by all four NTPs; poly(A) polymerase uses only ATP; and CCA-adding
one nucleotide residue and releases Pi and is template independent. polymerase uses ATP and CTP.
RNA polymerase uses an NTP substrate, releases PPi, and requires a 13. (a) The phosphate groups of the phosphodiester backbone of the
template DNA. mRNA will be labeled at all sites where α-[32P]ATP is used as a
(c) High processivity would allow the exonuclease to rapidly de- substrate by RNA polymerase.
grade mRNA molecules. This would be important in cases where (b) 32P will appear only at the 5′ end of mRNA molecules that
the gene product was no longer needed. An mRNA that was de- have A as the first residue (this residue retains its α and β phos-
graded more slowly could potentially continue to be translated. phates). In all other cases where β-[32P]ATP is used as a substrate
4. High G.C base pairs tend to decrease the efficiency of the promoter for RNA synthesis, the β and γ phosphates are released as PPi (see
region. G · C base pairs are more stable than A · T base pairs. Hence, Fig. 26-7).
the more G · C base pairs that the promoter contains, the more dif- (c) No 32P will appear in the RNA chain. During polymerization,
ficult it is to form the open complex during transcription initiation. the β and γ phosphates are released as PPi. The terminal (γ) phos-
5. Transcription of an rRNA gene yields a single rRNA molecule that is phate of an A residue at the 5′ end of an RNA molecule is removed
incorporated into a ribosome. In contrast, transcription of a ribosomal during the capping process.
protein gene yields an mRNA that can be translated many times to pro- 14. The mechanism of RNase hydrolysis requires a free 2′-OH group to
duce many copies of its corresponding protein. The greater number of form a 2′,3′-cyclic phosphate intermediate (Figure 11-10). Nucleo-
rRNA genes relative to ribosomal protein genes helps ensure the bal- tide residues lacking a 2′-OH group would therefore be resistant to
anced synthesis of rRNA and proteins necessary for ribosome assembly. RNase-catalyzed hydrolysis.
6. (a) Operons allow cells to turn sets of related genes on and off to- 15. (a) H3C
gether, thereby maximizing efficiency, since all the necessary genes NH
are expressed at the same time and in the same amount. N
N
(b) In eukaryotes, genes in different locations can be turned on or off
at the same time if they share the same transcriptional regulatory se- N N
H
quences, such as core promoter elements and enhancers that interact
with the same transcription factors. (b) Base pairing with U residues involves adenine N1 as a hydrogen
7. Increasing the error rate of transcription increases the chances of bond acceptor and the amino group at position 6 as a hydrogen bond
introducing a mutation that prevents the virus from completing its donor. Methylation of the amino nitrogen weakens but does not pre-
life cycle in the host cell. vent hydrogen bonding, so a stem-loop structure could still form.
8. In the presence of bicyclomycin, transcription of Rho-dependent 16. The active site of poly(A) polymerase is narrower because it does
genes does not terminate, causing read-through into adjacent coding not need to accommodate a template strand.
regions. This results in the transcription of the adjacent gene(s), often 17. Histone genes lack introns, so their mRNAs do not undergo splicing,
causing the inappropriate expression of the corresponding protein(s). and their mRNAs do not have a poly(A) tail.
SP-45
18. The intron must be large enough to include a spliceosome binding feature allows a cell to detect the presence of an infecting virus. The
site(s). cell’s own RNA molecules (other than mRNA, which is capped)
19. The mRNA splicing reaction, which requires no free energy input are all processed (hydrolyzed from larger precursors) and therefore
and results in no loss of phosphodiester bonds, is theoretically re- contain only a single phosphate at their 5′ ends.
versible in vitro. However, the degradation of the excised intron 28. Enhancers are recognized by specific transcription factors that
makes the reaction irreversible in the cell. stimulate RNAP II to bind to the associated promoter. Enhancers
20. Inhibition of snRNA processing interferes with mRNA splicing. As are usually distant from the promoter on the same DNA and hence
a result, host mRNA cannot be translated, so the host ribosomes will the interaction between the enhancer-bound transcription factor and
synthesize only viral proteins. the promoter-bound RNAP II requires that the DNA loop around.
21. If the enhancer and promoter are on different but catenated
plasmids, the enhancer-bound transcription factor and the promoter
exon 1 exon 2 exon 3 bound RNAP II can arrange themselves to contact one another and
thus stimulate translational initiation at the promoter. However,
if the two plasmids are not catenated, the transcription factor and
Alternative mRNA splicing can generate different forms of the pro- the RNAP II are unlikely to find each other and hence transcription
tein. If exon 2 encodes a membrane-spanning segment, then joining initiation will not occur.
exon 1 to exon 2 will generate a membrane-bound protein. If exon 3
encodes a soluble segment, then joining exon 1 to exon 3 will gener-
ate a soluble protein. Chapter 27
22. The top strand is the sense strand. Its TATGAT segment differs by 1. The possible codons are UUU, UUG, UGU, GUU, UGG, GUG,
only one base from the TATAAT consensus sequence of the pro- GGU, and GGG. The encoded amino acids are Phe, Leu, Cys, Val,
moter’s −10 sequence; its TTTACA sequence differs by only one Trp, and Gly (Table 27-1).
base from the TTGACA consensus sequence of the promoter’s −35 2. A UAG Stop codon results from any of the point mutations XAG,
sequence and is appropriately located ∼25 nt to the 5′ side of the UXG, or UAX to UAG. The XAG codons specify Gln, Lys, and Glu;
−10 sequence; and the initiating G nucleotide is the only purine that the UXG codons specify Leu, Ser, and Trp; and the UAX codons
is located ∼10 nt downstream of the –10 sequence. that are not Stop codons both specify Tyr. Hence some of the codons
5′- CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA- 3′ specifying these amino acids can undergo a point mutation to UAG.
3. A 4-nt insertion would add one codon and shift the gene’s read-
–35 –10 start ing frame by one nucleotide. The proper reading frame could be
region region point
restored by deleting a nucleotide. Gene function, however, would
23. not be restored if (a) the 4-nt insertion interrupted the codon for
U G G
a functionally critical amino acid; (b) the 4-nt insertion created a
U A codon for a structure-breaking amino acid; (c) the 4-nt insertion in-
G -3′ troduced a Stop codon early in the gene; or (d) the 1-nt deletion
G C U C
U occurred far from the 4-nt insertion so that even though the reading
G A G G A U G G C A G C
A ⋅⋅⋅⋅⋅
C U C C U
⋅⋅⋅⋅⋅⋅⋅
A C C G U C G
frame was restored, a long stretch of frame-shifted codons separated
the insertion and deletion points.
U
C U U U 4. There are two DNA strands corresponding to the sequence: the one
U -5′
U C whose sequence is given and the one that is complementary to it.
U C U Each strand has three possible reading frames, so there are 6 differ-
ent ways the DNA could be translated.
24. The RNA polymerase from bacteriophage T7 differs structurally from 5. The mitochondrial translation uses UAA and UAG stop codons for
prokaryotic and eukaryotic RNAPs and is extremely specific for its termination. In the genetic code used by mitochondria in many spe-
own promoter. By introducing a T7 promoter into recombinant DNA cies, UGA codes for tryptophan rather than a Stop signal. Therefore
and using T7 RNAP, genetic engineers can control the expression of a it is not used as a stop codon.
specific gene without interference from other RNAP enzymes or other 6. The likeliest codons to specify Met would be AUU, AUC, or AUA
promoter sequences that might be present in the experimental system. (all of which specify Ile in the standard genetic code), because these
25. Promoter elements for RNA polymerase II include sequences at −27 codons differ from AUG only at the third position.
(the TATA box) and between –50 and –100. The insertion of 10 bp 7. (a) Like an aaRS, X pot must recognize features of tRNA structure
would separate the promoter elements by the distance of the turn of that are present in all tRNAs, such as the acceptor stem and the TψC
the DNA helix, thereby diminishing the binding of proteins required loop. (b) Xpot can distinguish mature and pre-tRNAs because ma-
for transcription initiation. However, the protein-binding sites would ture tRNAs have a processed 5′ end with a single phosphate group,
still be on the same side of the helix. Inserting 5 bp (half of a helical and the 3′ end must be a —CCA sequence (see Fig. 27-3).
turn) would move the protein-binding sites to opposite sides of the
8. O
helix, making it even more diffcult to initiate transcription.
26. Because TFIIB can bind directly to DNA at the promoter and in- HN
directly to DNA at the end of the gene, it can cause the interven-
ing DNA to form a loop. As a result, an RNA polymerase that has
S N
finished transcribing a gene will be positioned near the promoter so
that transcription can be quickly reinitiated.
Ribose
27. The RNA genomes of certain viruses are not processed and hence 2-Thiouridine
the first nucleotide includes a triphosphate group. Recognizing this
SP-46
9. This arrangement ensures that the rRNAs will be made in the equal The mischarged Ala–tRNAGln binds to EF-Tu much more loosely,
amounts required by functional ribosomes. indicating that it may dissociate from EF-Tu before it reaches the
10. H ribosome. The mischarged Gln-tRNAAla binds to EF-Tu much more
tightly, indicating that EF-Tu may not be able to dissociate from
N O H N it at the ribosome. These results suggest that either a higher or a
lower binding affinity could affect the ability of EF-Tu to carry out
I C
N N H N
its function, which would decrease the rate at which mischarged
aminoacyl–tRNAs bind to the ribosomal A site during translation.
N N
23. By inducing the same conformational changes that occur during
O correct tRNA–mRNA pairing, paromomycin can mask the presence
of an incorrect codon–anticodon match. Without proofreading at
O the aminoacyl–tRNA binding step, the ribosome often synthesizes a
polypeptide with the wrong amino acids, which is likely to be non-
functional or toxic to the cell.
N O H N
I U 24. (a) Each ORF begins with an initiation codon (ATG) and ends with
N a Stop codon (TGA): ATGCTCAACTATATGTGA encodes vir-2
N N H O and ATGCCGCATGCTCTGTTAATCACATATAGTTGA on the
N complementary strand encodes vir-1.
(b) vir-1: MPHALLITYS; vir-2: MLNYM.
11. A mutation that generates a seldom-used codon that requires a rare
tRNA could slow the rate of translation so that although the result- (c) vir-1: MPHALLIPYS; vir-2: MLNYMGLTEHAA.
ing protein is structurally normal, less of it is synthesized. 25. There are four exons (the underlined bases)
12. Gly and Ala; Val and Leu; Ser and Thr, Asn and Gln; and Asp and Glu. TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATC
13. Only newly synthesized bacterial polypeptides have fMet at their GTAGGTAAGTTGTAATAAATATAAGTGAGTATGATA
N-terminus. Consequently, the appearance of fMet in a mamma- CAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAG
lian system signifies the presence of invading bacteria. Leukocytes TATAGATTAATTAAGCACAGGCATGCAGGGATATCCT
that recognize the fMet residue can therefore combat these bacteria CCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAG
through phagocytosis. GCAGTAGATGAATAAACGATATCGATCGGTTAGGTA
AGTCTGAT
14. Prokaryotic ribosomes can select an initiation codon located anywhere
on the mRNA molecule as long as it lies just downstream of a Shine– The mature mRNA, which has a 5′ cap and a 3′ poly(A) tail, there-
Dalgarno sequence. In contrast, eukaryotic ribosomes usually select the fore has the sequence
AUG closest to the 5′ end of the mRNA. Eukaryotic ribosomes there- G C G U A A A U C G U A G G C U U U G G A C C G A U A G AU G C
fore cannot recognize a translation initiation site on a circular mRNA. G AC C C U G G AG G C AU G C AG G G AUAU C C U C C A A A A
15. eIF2 is a G protein that delivers the initiator tRNA to the 40S ribo- A G G C AU G C A G G G AUAU C C U C C A A AUA G G C A G UA
somal subunit and then hydrolyzes its bound GTP to GDP. The GEF GAUGAAUAAACGAUAUCGAUCGGUUAG
eIF2B helps eIF2 release GDP in order to bind GTP so that it can The initiation codon and termination codon are shown in boldface.
participate in another round of translation initiation. The encoded protein has the sequence
16. Ribosomes cannot translate double-stranded RNA, so the base pair- MRPWRHAGISSKKACRDILQIGSR
ing of a complementary antisense RNA to an mRNA prevents its 26. As the pH increases, residue A2486 would be less likely to be pro-
translation. tonated and therefore less likely to stabilize the negatively charged
17. NH+
3 O oxyanion of the tetrahedral reaction intermediate. Thus, the mecha-
–OOC nistic embellishment is inconsistent with the observed effect.
CH CH2 CH2 C NH CH COO–
27. The starvation-induced protein binds to the anti-Shine–Dalgarno
CH2 sequence of the rRNA, which prevents mRNAs from binding to the
ribosome. Because this blocks translation initiation, the starving cell
SH
can avoid undertaking energetically expensive protein synthesis.
18. Formation of a peptide bond is an endergonic reaction. In fact, the
28. From Table 27-2: The 2 amino acids specified by only one codon
synthetase requires the free energy of ATP.
each require a tRNA. The 12 amino acids that are specified by PQX
19. The constrained geometry of Pro could affect the efficiency of pepti- where X may be either purine or else either pyrimidine can each be
dyl transfer, or the poly-Pro segment could fit poorly in the ribosome specified by a single tRNA according to the wobble pairing rules (Ta-
exit tunnel, slowing the rate of chain lengthening. ble 27-3). Ile, which is specified by AUY, where Y = U, C or A, also
20. The 13 proteins synthesized by the mitoribosome are all integral requires a single tRNA. However, the 8 amino acids that are specified
membrane proteins containing large numbers of membrane-spanning by RSZ, where Z = U, C, A or G, must each have 2 tRNAs specifying
α helices. The hydrophobic exit channel probably allows these them (Leu, Arg and Ser are specified by both PQX and RSZ). Finally,
protein segments to begin forming hydrophobic helices before they an initiator tRNA is required. Thus, 2 + 12 + 1 + 2 × 8 + 1 = 32
exit the ribosome. tRNAs are minimally required to translate a standard genetic code.
21. The normal peptide has the sequence –Asp–Ser–Phe–Arg–Gln– 29. The enzyme hydrolyzes peptidyl–tRNA molecules that dissociate
Ser–Glu–, and frameshifting at the CGU codon yields the sequence from a ribosome before normal translation termination takes place.
–Asp–Ser–Phe–Val–Ser–Pro–Arg–. Because peptide synthesis is prematurely halted, the resulting poly-
22. As expected, the correctly charged tRNAs (Ala–tRNAAla and Gln– peptide, which is still linked to tRNA, is likely to be nonfunctional.
tRNAGln) bind to EF-Tu with approximately the same affinity, so Peptidyl–tRNA hydrolase is necessary for recycling the amino acids
they are delivered to the ribosomal A site with the same efficiency. and the tRNA.
SP-47
30. When a ribosome translates an mRNA lacking a Stop codon, trans- the CUG codon), polycysteine (from the UGC codon), and polyala-
lation proceeds all the way to the mRNA’s poly(A) tail. Since AAA nine (from the GCU codon).
is the codon for Lys, the appearance of a poly(Lys) sequence signals 6. Eleven CNPs of 465 kb each is 5115 kb, or about 5115 kb/3,038,000
the cell to destroy the newly made polypeptide, which is likely to be kb = 0.0017 of the genome.
nonfunctional. 7. O1 is the primary repressor-binding site, so lac repressor cannot sta-
31. Start Phe Pro Val bly bind to the operator in its absence and repression cannot occur.
5′-AGGAGCUX~4 A
UG UUUC CCX GCX-
G
8. (a) Both O2 and O3 are secondary repressor-binding sequences. If
one is absent, the other can still function, resulting in only a small
Shine-Dalgarno sequence. loss of repressor effectiveness.
3-10 base pairs with G . U’s
allowed (b) In the absence of both O2 and O3, the repressor can bind only to
O1, which partially interferes with transcription but does not repress
Ala Thr Glu Asn Ser Stop
transcription as fully as when a DNA loop forms through the coop-
GCX ACX GA GA AA UC UCX UAA erative binding of lac repressor to O1 and either O2 or O3.
or UAG-3′ 9. In the absence of β-galactosidase (the product of the lacZ gene),
AG UC UGA lactose is not converted to the inducer allolactose. Consequently, lac
enzymes, including galactoside permease, are not synthesized.
32. Aminoacylation occurs via pyrophosphate cleavage of ATP, and
hence the aminoacylation of 100 tRNAs requires 200 ATP equiva- 10. Since operons other than the lac operon maintain their sensitivity to
lents; translation initiation requires 1 GTP (1 ATP equivalent); 99 the absence of glucose, the defect is probably not in the gene that
cycles of elongation require 99 GTP (99 ATP equivalents) for EFTu encodes CAP. Instead, the defect is probably located in the portion
action; 99 cycles of ribosomal translocation require 99 GTP (99 of the lac operon that binds CAP–cAMP.
ATP equivalents) for EF-G action; and translation termination re- 11. In eukaryotes, transcription takes place in the nucleus and transla-
quires 1 GTP (1 ATP equivalent), bringing the total energy cost to tion occurs in the cytoplasm. Hence, in eukaryotes, ribosomes are
200 + 1 + 99 + 99 + 1 = 400 ATP equivalents. never in contact with nascent mRNAs, an essential aspect of the
33. The E. coli ribosome contains 52 proteins + 3 RNAs. A minimum attenuation mechanism in prokaryotes.
of 31 noninitiating tRNAs and their 20 cognate aminoacyl-tRNA 12. Deletion of the leader peptide sequence from trpL would eliminate
synthetases is required. tRNAMet f is also required (it is charged by sequence 1 of the attenuator. Consequently, the 2 · 3 hairpin rather
the aminoacyl–tRNA synthetase for Met). than the 3 · 4 terminator hairpin would form. Transcription would
Initiation requires 3 factors: IF-1, IF-2, and IF-3. therefore continue into the remainder of the trp operon, which would
then be regulated solely by trp repressor.
Elongation requires 3 factors: EF-Tu, EF-Ts, and EF-G.
13.
Termination requires 4 factors: RF-1, RF-2, RF-3, and RRF. (CH2)3
mRNA is also required.
NH
Thus, the total number of macromolecules is:
(CH2)4 C
52 + 3 + 31 + 20 + 1 + 3 + 3 + 4 + 1 = 118 different macro-
+ +
molecules. NH2 H2N NH
CH3 CH3
Chapter 28 Methyllysine Methylarginine
1. The Daphnia and Drosophila genomes are similar in size (200,000 In methyllysine and methylarginine, the hydrophobic methyl group
kb versus 180,000 kb), but Daphnia contains far more genes partially masks the cationic character of the Lys or Arg side chain.
(∼30,000 versus ∼13,000). The Daphnia genome is much smaller 14.
than the human genome (200,000 kb versus 3,038,000 kb) but ap- (CH2)4
pears to contain more genes (∼30,000 versus ∼21,000).
NH
2. The alga O. tauri allots about 13,000 kb/8000 genes or ∼1600 bp
per gene, which is not much more than E. coli, which allots 4639 kb/ C O
4289 genes or ∼1100 bp per gene. CH3
3. Virtually all the DNA sequences in E. coli are present as single cop- Acetyllysine
ies, so the renaturation of E. coli DNA is a straightforward process
of each fragment reassociating with its complementary strand. In In acetyllysine, the cationic side chain of Lys has been converted to
contrast, the human genome contains many repetitive DNA se- a polar but uncharged side chain.
quences. The many DNA fragments containing these sequences find 15. The product is a citrulline side chain (Fig. 21-9).
each other to form double-stranded regions (renature) much faster N CH C
than the single-copy DNA sequences that are also present, giving H
rise to a biphasic renaturation curve. (CH2)3 O
4. Because genes encoding proteins with related functions often occur NH
in operons, the identification of one or several genes in an operon
may suggest functions for the remaining genes in that operon. C
5. (a) Translation of CAG repeats will yield polypeptides containing O NH2
polyglutamine (from the CAG codon), polyserine (from the AGC
codon), and polyalanine (from the GCA codon). (b) Translation of 16. A sequence located downstream of the gene’s promoter (i.e., with-
CTG repeats will yield polypeptides containing polyleucine (from in the coding region) could regulate gene expression if it were
SP-48
recognized by the appropriate transcription factor such that the re- so that a narrow beam of light is necessary to separately interrogate
sulting DNA–protein complex successfully recruited RNA poly- them.
merase to the promoter. 26. Transcriptionally active chromatin has a more open structure due to
17. Since there are 65 VH, 27 D, and 6 JH segments that can be used to histone modifications that help make the DNA more accessible to
assemble the coding sequence of the variable region of the heavy transcription factors and RNA polymerase as well as nucleases.
chain, somatic recombination could theoretically generate 65 × 27 × 27. Histone and DNA methylation requires S-adenosylmethionine
6 = 10,530 heavy chain genes (junctional flexibility would increase (SAM), which becomes S-adenosylhomocysteine after it gives up
this number). Since each immunoglobulin molecule contains two its methyl group (Fig. 21-18). S-Adenosylhomocysteine is converted
identical heavy chains and two identical light chains, the possible back to methionine, the precursor of SAM, in a reaction in which the
number of immunoglobulins would be 10,530 × 2000 = ∼21 million. methyl group is donated by the folic acid derivative tetrahydrofolate
18. The susceptibility of RNA to degradation in vivo makes it possible (THF; Fig. 21-18). A shortage of this cofactor could limit cellular
to regulate gene expression by adjusting the rate of mRNA degrada- production of SAM, which would result in the undermethylation of
tion. If mRNA were very stable, it might continue to direct transla- histones and DNA.
tion even when the cell no longer needed the encoded protein. 28. (a) Protein phosphorylation (Section 13-2B) leads to immediate
19. The imprecise joining of V, D, and J segments, along with nucleo- changes in protein function through allosteric effects, so the release
tide addition or removal at the junction, can generate a Stop codon of active NF-κB is rapid.
(yielding a truncated and hence nonfunctional immunoglobulin (b) Phosphorylation of a protein introduces negative charges that
chain) or create a shift in the reading frame (yielding a misfolded might impede the binding of the transcription factor to its recognition
and nonfunctional protein). sequences in DNA. This potential problem is avoided by the indirect
20. AID, a cytidine deaminase, is required for somatic hypermutation activation of NF-κB through phosphorylation of its inhibitor IκB.
in B cells. If the enzyme were active in another cell, that cell might (c) By removing ubiquitin from IκB, the Yersinia protein prevents
exhibit a very high rate of mutation. IκB degradation. As a result, IκB is able to bind to NF-κB, prevent-
21. Phosphatidylserine is normally present only on the inner leaflet of ing the transcription factor from turning on the genes required for
the plasma membrane (Section 9-4C). The loss of membrane asym- lymphocyte proliferation and differentiation. Thus, the bacteria can
metry in a dying cell would distinguish it from normal cells and suppress the immune response.
facilitate its disposal. 29. B cells are diploid [have two sets of genes specifying heavy chains
22. In multicellular organisms, apoptosis of damaged cells minimizes and fours sets of genes specifying light chains (two κ’s and two
damage to the entire organism. For a single-celled organism, survival λ’s)]. Hence, if allelic exclusion were defective, they would continue
of a genetically damaged cell is preferable (in a Darwinian sense) to to rearrange gene segments even after functional heavy and light
its death. Therefore, apoptosis is disadvantageous for them. chain genes had been assembled. Such a B cell could produce more
23. The knirps mRNA is expressed in a band posterior to the embryo’s than one type of heavy and light chain. The resulting mixed chain
midpoint (Fig. 28-56c). This band would appear blue due to the ac- immunoglobulins would be unable to cross-link antigens since the
tion of β-galactosidase on X-gal. two antigen-binding sites would have different binding specificities.
24. The esc gene is apparently a maternal-effect gene. Thus, the proper 30. A 22-bp segment of RNA, incorporating all four nucleotides, has 422
distribution of the esc gene product in the fertilized egg, which is = 1.8 × 1013 possible unique sequences. An RNA half this size would
maternally specified, is sufficient to permit normal embryonic have only 411 or 4.2 × 106 possible sequences. The shorter the siRNA,
development regardless of the embryo’s genotype. the greater the probability that it could hybridize with more than one
25. Red–green color blindness is conferred by a mutation in an X-linked complementary mRNA, thereby making it less efficient in silencing a
gene so female carriers of the condition, who do not appear to be specific gene. (In the 3.0 × 109-bp human genome, a sequence of 16
red–green colorblind, have one wild-type gene and one mutated bp has a high probability of randomly occurring at least once.)
gene. In placental mammals such as humans, females are mosaics 31. If the cancer cell’s transformed state results, at least in part, from the
of clones of cells in which only one of their two X chromosomes absence of a functional tumor suppressor gene such as that express-
is transcriptionally active. Hence in a female carrier of red–green ing pRb, and if the chromosomes that the normal cell contribute to
color blindness, the transcriptionally active X chromosome in some the fused cell express that tumor suppressor gene, then the fused cell
clones will contain the wild-type gene and the others will contain will have a non-tumorigenic phenotype. This is because tumor sup-
the mutated gene. The former type of retinal clone is able to differ- pressor gene products suppress uncontrolled cell proliferation (can-
entiate red and green light, whereas the latter type of retinal clone cer) so that cells requiring such a gene product for normal growth,
is unable to do so. Apparently, these retinal clones are small enough but lacking it, will assume the cancerous state.

BMSolutions PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

BMSolutions PDF

Uploaded by

Copyright:

Available Formats

BMSolutions.

indd Page SP-1 11/14/17 3:25 PM user /207/WB01592_ISV/XXXXXXXXXX/bmmatter/text_s

SOLUTIONS TO ALL PROBLEMS

N = −2/ (−4.34 × 10−5) = 4.6 × 104 C C C

(b) The DEAE chromatography step results in only a 53% yield,

The resulting increase in blood pH would increase the O2 aﬃnity H C OH

6. (a) CH2OH CH2OH

13. One Cl O H ClCH2 O H

19. CH2OH CH2OH H O H O H

= (8.314) (310) (−2.71) J · mol−1 cytosol

via the ammonia channel. c

Reaction coordinate 19. O CH3 O

1.5 [P] [ES]

6. Only a plot of 1/[reactant] versus t gives a straight line, so the reac-

Time (s) 1/[reactant](mM−1)

0.2 KM = −1/x-intercept = −1/(−4 μM−1) = 0.25 μM

α = 4 = 1 + [I]/KI = 1 + 6 mM/KI 0.8

6. A plot of fractional saturation (Y) versus [L] yields a hyperbola

26. (a) Cys .... Gln Chapter 15

The number of moles of 220-nm photons required to produce one C O

8. (a) The compound is a uridine derivative (it lacks the ring H H

14. p-Aminosalicylate is an analog of p-aminobenzoate, which the bac- O P O–

thesis. If the gout is due to overproduction of purines, the excreted N

31. (a) The recovered deoxycytidylate would be equally labeled in its N

28. H −120 120

k = ln (1.0000033)/1 d = 0.0000033 d−1

10. (a) Because expression of bacteriophage genes requires the host’s

You might also like