Molecular Ecology Notes (2004) 4, 608– 610 doi: 10.1111/j.1471-8286.2004.00752.

PRIMER NOTE
Blackwell Publishing, Ltd.

Microsatellite loci for the weaver ant Oecophylla smaragdina

N . A Z U M A ,* J . T A K A H A S H I ,† S . H I G A S H I * and M . S A S A K I †
*Graduate School of Environmental Earth Science, Hokkaido University, Sapporo, 060-0810, Japan, †Laboratory of Entomology,
Graduate School of Agriculture, Tamagawa University, Machida, Tokyo, 194-8610, Japan

Abstract
We developed 13 microsatellite loci in Oecophylla smaragdina from random amplified poly-
morphic DNA (RAPD) fragments. These loci showed two to 14 alleles in O. smaragdina
with expected heterozygosity of each locus from 0.10 to 0.89, and six were also polymorphic
in the related species, O. longinoda. The results suggested that the loci will be useful to
analyse the genetic structure of Oecophylla species at both the colony and population levels.
Keywords: microsatellite DNA, Oecophylla longinoda, Oecophylla smaragdina, random amplified
polymorphic DNA, weaver ant

Received 9 April 2004; revision received7 June 2004; accepted 23 June 2004

The weaver ant Oecophylla (Hymenoptera, Formicidae) is a
relatively old genus in the subfamily Formicinae, with
only two extant species, Oecophylla longinoda (Latreille) dis-
tributed in tropical Africa, and O. smaragdina (Fabricius) in
Southeast Asia and Australia (Wheeler 1922; Bolton 1995).
Both are arboreal and make peculiar global or elliptical
nests of leaves spun with silk supplied by larvae. They
form exceptionally aggressive and territorial colonies that
occasionally dominate a wide range of forest canopies.
Although these characteristics have attracted many researchers,
the mating structure and the genetic structures of the
colonies are still controversial in O. smaragdina. Fraser &
Crozier (1999) stated that, on average, O. smaragdina has
a monoandrous mating system with rare polyandry.
However, because their estimation was based on only three
microsatellite loci, additional genetic markers should be
used for a more precise conclusion to be made. Also, the
queen numbers in mature colonies should be tested because
O. smaragdina had been regarded as a monogynous species
(Hölldobler & Wilson 1990), but Peng et al. (1998) reported
multiple queens in well-established colonies. Suitable genetic
markers are needed to resolve this conflict. Therefore, as
a preparation for these investigations, in this study we
describe polymorphic microsatellite loci isolated from
O. smaragdina.
Total genomic DNA was extracted by the cetyltrimethyl
ammonium bromide (CTAB) method of Hillis et al. (1990)
and Navarro et al. (1999). Microsatellite loci were searched
Correspondence: Noriko Azuma. Fax: +81-11 7366304;
E-mail: anoriko@ees.hokudai.ac.jp
from random amplified polymorphic DNA (RAPD)
fragments, according to the method of Takahashi et al. (in
preparation). The total DNA of O. smaragdina was randomly
amplified using a 10-bp primer of random nucleotide
sequence (Operon Technologies Inc.) by polymerase chain
reaction (PCR). A total of 120 primers (OPA, OPB, OPH,
OPI, OPY and OPZ01–20) were used in this study. Each
RAPD reaction (15 µL) contained 15 ng of template DNA,
1.5 µL of 10 × reaction buffer, 1.5 µL of dNTP mix (1 mm of
each dNTP), 18 pmol of one of the 120 primers, and 0.6 U
of Taq DNA polymerase (TaKaRa Taq, TaKaRa). The
thermal cycle profile consisted of 45 cycles of 1 min at 94 °C,
1 min at 35 °C, a 0.3 °C/s temperature transition to 72 °C
and 2 min at 72 °C. For the first screening, 1 µL of product
from each different primer was dropped separately onto a
positively charged nylon membrane (FMC). After drying at
room temperature, DNAs on the membrane were blotted
by normal alkaline transfer. RAPD products containing
microsatellite regions were detected using a biotinylated
DNA detection kit (Imaging High-Color, Toyobo) and
biotin-labelled oligonucleotides [(GA)10, (AT)10, (GC)10,
(AGC)7, (AGT)7, (ACG)7, and (ATG)7] as probes for the
microsatellites. Here, 22 of the 120 primers’ products were
positive. These were then mixed together and purified
using a QIAamp PCR purification kit (Qiagen) in a final
volume of 15 µL. Both ends of the purified fragments
were blunted, kinased using TaKaRa BKL kit (TaKaRa),
and ligated into SmaI-cut pUC19 plasmids using the same
kit, following the manufacturer’s instructions. Recombinant
plasmids were transformed into competent Escherichia coli
cells (Competent High-JM109-, TaKaRa). A total of 550

© 2004 Blackwell Publishing Ltd

 P R I M E R N O T E 609

Table 1 Characterization of 13 polymorphic microsatellite loci isolated from Oecophylla smaragdina. The product size and repeat region data
are based on the sequenced allele submitted to the GenBank with expressed Accession no. Number of alleles detected for each species are
shown in parentheses following observed heterozygosity (HO). NP = no scorable product

GenBank
Locus Size Ta Accession O. smaragdina O. longinoda
name Repeat pattern (bp) Primer sequence (5′−3′) (°C) no. (n = 20) (n = 1)

MS2.2.2 (GCA)6 107 F: GTCTTATGTGTGGCCACTGCGA 48 AB174735 HO = 0.45 (4) (2)

R: GTGAAATGAACGTGACTTG HE = 0.61
MS2.3 (GT)5GC(GT)5 134 F: TCCAGGTGACCGTCGTGT 48 AB174736 HO = 0.10 (4) NP
R: CATACACATTCGCGTACG HE = 0.63
MS2.14 (CGA)4CGT(CGA)6CAA–(CGA)10TGA(CGA)3 235 F: TCTACGTGTCTAACCCAAC 52 AB174734 HO = 0.40 (13) (1)
R: GCGAGTCTACTCCATCGTATAG HE = 0.89
MS3.2 (GA)6 93 F: GTGACATTGTCGGCGA 52 AB174737 HO = 0.00 (2) (1)
R: CGAGCGCGAAAATTTCGTC HE = 0.10
MS5.2 (CT)11(CTTT)3GTTT(CTTT)2 129 F: AATTACAGTTCGGTCTCG 48 AB174740 HO =0.60 (7) (2)
R: ATCGAACTTCGCTTCGGTTGTA HE = 0.77
MS5.10 (GA)3AA(GA)5A8(GA)4 103 F: GAGAGGAAGTGCACCACAATG 52 AB174738 HO = 0.05 (3) (1)
R: CGAACCGTGAGGAAATGTCGA HE = 0.52
MS5.13 (GA)9 133 F: AGGCATGCATTAAGCTTC 48 AB174739 HO = 0.4 (6) (2)
R: AGGCATGCATTAAGCTTC HE = 0.67
MS6.29 (GA)3AA(GA)4A(GA)3 176 F: CAATCCAGTTGCACGGCTA 49 AB174741 HO = 0.15 (4) (1)
R: GTAACTTCGAGTTCGC HE = 0.23
MS6.45 (GTT)3GCT(GTT)9(GCT)4(GTT)2(GCT)4 235 F: GGTCGTTGCTGACCGT 49 AB174742 HO = 0.60 (6) (2)
R: CAGATACAGGCAATGCT HE = 0.70
MS6.47 (GA)9 137 F: AGCCCTCTTGTTCATGA 45 AB174743 HO = 0.20 (3) (2)
R: TTAAATTCGGCCGCA HE = 0.66
MS7.1 (GAT)8 95 F: AAAGGACGTTGACGCGAC 52 AB174744 HO = 0.25 (3) (2)
R: ACGTGCAATCCATTCACG HE = 0.52
MS7.1.3 (GAT)9–(GTT)4–(GCC)4 248 F: TGATGATACGATTGCAGA 48 AB174745 HO = 0.15 (4) (1)
R: TGCTGGAGTCGAGCAGT HE = 0.42
MS8.24 (CTT)5TCT(CTT)3–(GA)3AA(GA)11AATA(GA)9 289 F: GCAGACAATGGCTATTTGT 50 AB174746 HO = 0.56 (6)* (1)
R: CGATGTGATTTAGCCGA HE = 0.83

*The primer pair for MS8.24 could not amplify proper PCR products in five individuals from India of O. smargdina.

recombinant colonies were chosen and suspended inde-
pendently in 30 µL of Tris-EDTA (10 mm Tris-HCl pH 7.4,
1 mm EDTA pH 8.0). Each suspended colony was heated
at 98 °C for 5 min and then centrifuged for 1 min at
8000 g. Inserts were amplified by PCR using a primer
pair for the multicloning site pUC19 (Bca BEST TM Sequenc-
ing Primer RV-M and M13-47, TaKaRa) with TaKaRa Taq
(TaKaRa) according to the manufacturer’s instructions.
Temperature cycles were as follows: 30 cycles of 1 min at
95 °C, 1 min at 55 °C and 2 min at 70 °C. After PCR, 1 µL of
each amplified product was used to detect clones contain-
ing the microsatellite sequences in the same manner as
the first screening. It was seen that 20 of 550 clones were
positive. For each positive clone, 4 µL of the remaining
PCR product was verified for its length on 1% agarose
gel in Tris-borate-EDTA, and 18 unique insert lengths
were found (350–1800 bp). The remaining product of each
positive clone was purified using a QIAamp PCR purifica-
tion kit (Qiagen) and sequenced using the automated
sequencer, Genetic Analyser 3100 (Applied Biosystems).
Proper PCR primer regions could be determined for
14 loci from the results of sequencing, and to test the
effectiveness of these loci, 20 individuals of O. smaragdina
from mainland Asia, Indonesia and Australia, and one of
O. longinoda were used. PCR amplifications were carried
out in a total volume of 15 µL, which contained c. 10 ng
of template DNA, 3 pmol of each primer [forward was
labelled with 6-FAM, PET, VIC or NED fluorescent dyes
(Applied Biosystems)], 1.5 µL of 10 × reaction buffer,
1.5 µL of dNTP mix (1 mm of each dNTP), and 0.6 U of Taq
DNA polymerase (AmpliTaq Gold, Applied Biosystems),
by thermal cycling parameters of 5 min at 95 °C for hot
start, 30 cycles of 45 s at 92 °C, 45 s at 48 or 52 °C (according
to the annealing temperature for each primer set, see Ta
in Table 1) and 1 min at 72 °C. The PCR products were
electrophoresed along with GeneScan 500 LIZ size standard
on Genetic Analyser 3100 (Applied Biosystems), and allele
sizes were assigned using GeneScan analysis software
(Applied Biosystems). We found 13 polymorphic loci with
two to 14 alleles in O. smaragdina (expected heterozygosity,

© 2004 Blackwell Publishing Ltd, Molecular Ecology Notes, 4, 608–610

610 P R I M E R N O T E
HE from 0.10 to 0.89), and six heterozygous loci in O. longi-
noda (Table 1). Although observed HE was remarkably
lower than that in O. smaragdina at some loci, apparently
due to fragmentated population structure of this species,
we totally concluded that these microsatellite markers
would be useful in genetic analysis on both species at
colony and population levels.
Acknowledgements
We express our sincere thanks to Professor K. Ogata, Kyushu Uni-
versity, Dr A. N. Andersen, CSIRO Tropical Ecosystems Research
Centre, Australia, Dr K. Tsuji, University of Ryukyus, and Dr Sih
Kahono, The Indonesian Institute of Science, for providing samples.
References
Bolton B (1995) A New General Catalogue of the Ants of the World.
Harvard University Press, London.
© 2004 Blackwell Publishing Ltd, Molecular Ecology Notes, 4, 608– 610
Fraser VS, Crozier RH (1999) The mating structure of Oeco-
phylla smaragdina ants. In: Proceeding of the XIII International
Congress of IUSSI, p. 172. Flinders University Press, Adelaide,
Australia.
Hillis DM, Larson A, Davis SK, Zimmer E (1990) Nucleic acids III:
sequencing. In: Molecular Systematics (eds Hillis DM, Moritz C).
Sinauer Associates, Sunderland, MA.
Hölldobler B, Wilson EO (1990) The Ants. Harvard University
Press, Cambridge, MA.
Navarro E, Jaffre T, Gauthier D et al. (1999) Distribution
of Gymnostoma spp. microsymbiotic Frankia strains in New
Caledonia is related to soil type and to host-plant species.
Molecular Ecology, 8, 1781–1788.
Peng PK, Christian K, Gibb K (1998) Locating queen ant nests in
the green ant, Oecophylla smaragdina (Hymenoptera, Formicidae).
Insectes sociaoux, 45, 477–480.
Wheeler WM (1922) Ants of the American Museum Congo
Expedition. A contribution to the Myrmecology of Africa.
Bulletin of the American Museum of Natural History, 45, 224–
236.