Naunyn-Schmiedeberg’s Arch Pharmacol (2000) 361 : 214–220
Digital Object Identifier (DOI) 10.1007/s002109900184
O R I G I N A L A RT I C L E
Tomoyuki Sato · Shigeo Kitayama · Chieko Mitsuhata ·
Tetsurou Ikeda · Katsuya Morita · Toshihiro Dohi
Selective inhibition of monoamine neurotransmitter transporters
by synthetic local anesthetics
Received: 28 May 1999 / Accepted: 29 October 1999 / Published online: 8 December 1999
© Springer-Verlag 1999
Abstract Synthetic local anesthetics (LAs) have been
found to have cocaine-like characteristics with some psy-
chotomimetic action, possibly through monoaminergic neu-
rotransmission. To gain insight into the relation between
LA action and monoamine transporters, we investigated the
effect of synthetic LAs on neurotransmitter transporters,
including monoamine transporters. We used cloned trans-
porter cDNAs and examined transient functional expres-
sion in COS cells and stable expression in HeLa cells.
Among the LAs tested, procaine and other ester-type LAs
inhibited [3H]DA uptake and binding of [3H]2-β-car-
bomethoxy-3-β-(4-fluorophenyl)tropane (CFT), a cocaine
analogue, in COS cells expressing rat dopamine transporter
(DAT). The inhibition was concentration-dependent. The
inhibitory effect on [3H]DA uptake was reversible and not
dependent on pH, as observed in HeLa cells stably express-
ing DAT. Procaine also inhibited uptake of norepinephrine
(NE) and serotonin (5-HT) by the norepinephrine trans-
porter (NET) or serotonin transporter (SERT) expressed in
COS cells. On the other hand, procaine and other LAs had
little or no effect on [3H]GABA and [3H]glutamate uptake
in COS cells expressing mouse GABA or rat glutamate/as-
partate transporter. IC50 values for [3H]DA uptake inhibi-
tion correlated well with those for [3H]CFT binding inhi-
bition, but not with intrinsic anesthetic potency. Kinetic
analysis of monoamine uptake inhibition by procaine in
COS cells expressing rat DAT, NET or SERT revealed a
competitive action similar to that of cocaine. These results
demonstrate that certain LAs selectively inhibit monoamine
transporters. This might contribute to the cocaine-like psy-
chotomimetic action of certain LAs.
T. Sato · S. Kitayama (✉) · C. Mitsuhata · T. Ikeda · K. Morita ·
T. Dohi
Department of Pharmacology,
Hiroshima University School of Dentistry, Kasumi 1-2-3,
Minami-ku, Hiroshima 734-8553, Japan
e-mail: shigeok@ipc.hiroshima-u.ac.jp,
Fax: +81-82-257-5644
Key words Neurotransmitter · Transporter · Local
anesthetics · Cocaine
Introduction
Monoamine neurotransmitter transporters act to terminate
synaptic neurotransmission by Na+-dependent reaccumu-
lation of released monoamines into presynaptic terminals
(Iversen 1971). There are also extraneuronal monoamine
transporters in glial cells that contribute to the clearance
of released monoamines (Gründemann et al. 1998). These
transporters, therefore, play an important role in maintain-
ing fine neural tuning. It is well known that various drugs,
including such psychostimulants as cocaine and metham-
phetamine as well as antidepressants, act on certain neu-
rotransmitter transporters to exert their effects on the cen-
tral nervous system (Langer and Schoemaker 1988; Horn
1990). Thus, the transporter dysfunction is thought to cause
neurological and psychiatric disorders.
While cocaine is known to inhibit reuptake of all mono-
amine neurotransmitters, including dopamine (DA), norepi-
nephrine (NE) and serotonin (5-HT), the mood-enhancing
and psychomotor stimulation effects of cocaine are thought
to be related primarily to the inhibition of the DA trans-
porter (DAT; Ritz et al. 1987). However, cocaine is a natural
substance with potent local anesthetic properties. There-
fore, it has been suggested that the effect of cocaine on
voltage-sensitive Na+ channels in the central nervous sys-
tem may contribute to its in vivo pharmacological action.
By comparing the action of cocaine, cocaine analogues and
synthetic local anesthetics (LAs) in locomotor activity, it
has been demonstrated that cocaine and cocaine analogues
display both locomotor stimulation and suppression, while
synthetic LAs display only locomotor suppression, suggest-
ing that the inhibitory action probably is due to a local anes-
thetic action (Reith et al. 1985). The inhibitory but not stim-
ulatory action of cocaine and cocaine analogues on loco-
motor activity was highly correlated with their ability to
displace batorachotoxin binding to voltage-sensitive Na+
channels (McNeal et al. 1985). On the other hand, some

LAs were shown to have cocaine-like reinforcing effects
in animals (Ford and Balster 1977; Johanson 1980;
Woolverton and Balster 1982), even though they are not
generally recognized as indirect dopaminergic agonists,
like cocaine.
Recently, Woodward et al. (1995) have suggested that
the cocaine-like action of such synthetic LAs as dimetho-
caine and procaine results from their inhibitory effect on
DA uptake. Since these results suggest that cocaine’s psy-
chostimulating action is not due to its local anesthetic ac-
tivity, it is hypothesized that some synthetic LAs, like co-
caine, possess reinforcing properties via inhibition of DA
uptake. However, the action of LAs on neurotransmitter
transporters, including such monoamine transporters as
DAT, NE transporter (NET) and 5-HT transporter (SERT),
has never been thoroughly investigated, despite suggested
links between these transporters and psychomotor activity
(Langer and Schoemaker 1988). In the present study, we
compared the effects of cocaine and synthetic LAs on var-
ious neurotransmitter transporters using cell systems con-
structed by introducing cloned cDNA of those transporters.
Materials and methods
Neurotransmitter transporter cDNAs. Rat DAT cDNA cloned in
pBluescript (Shimada et al. 1991) was subcloned into pcDNA3. Rat
NET cDNA used in this study was rNETa-S (Kitayama et al. 1999).
Rat SERT cDNA and rat glutamate/aspartate transporter (GLAST)
cDNA were cloned by PCR using total RNA from rat whole brain as
the template. Oligonucleotide primer sets used were 5’-CAGGTA-
CCCCAAGAACCAAGAGCTAGCCTGGGTCC/5’-ATGGGCC-
CGAGAGTCCACGGAAAGAAGTGGTCGGA for rSERT, and 5’-
AGCGAATTCGCTTTCTGGGGACAAGTTCAAGAC/5’-ATG-
CTCGAGACATTTTCCAATCCTATCAGAGTAG for rGLAST,
which include appropriate restriction enzyme sites for subsequent
cloning. Resultant PCR products were cloned into pcDNA3 and se-
lected by functional expression in COS cells. Positive clones were
confirmed by nucleotide sequencing.
Cell lines expressing neurotransmitter transporters. COS cells were
transfected by electroporation with 10 µg/107 or 20 µg/107 cells of
rat DAT cDNA, or mouse GABA transporter (GAT 1) cDNA sub-
cloned into the eukaryotic expression vector pcDNA I (pcDNADAT,
pcDNAGAT 1), as previously described (Schaeffer et al. 1991; Shi-
mada et al. 1991), or with 10 µg/107 cells of rat NET, rat SERT or
rat GLAST cDNAs. Transfected COS cells were plated in 24- or
48-well tissue culture clusters in 1000 µl or 500 µl Dulbecco’s mod-
ified minimal essential medium containing 10% fetal bovine serum.
Cells were cultured at 37°C under 5% CO2/95% air for 2–4 days
before assay.
HeLa cells were used for stable expression of rat DAT (HeLa/
DAT; Mitsuhata et al. 1998). HeLa cells were transfected with
pcDNA3 carrying rat DAT cDNA by electroporation. The resulting
cell colonies were selected by G418 and [3H]DA uptake measure-
ment. HeLa/DAT cells were plated in 48-well tissue culture clusters
in 250 µl Eagle’s modified minimum essential medium containing
10% fetal bovine serum, and cultured for 3–4 days before uptake
analysis.
Uptake and binding assay. To assess the uptake of neurotransmit-
ters, cells were washed three times in Krebs-Ringer-HEPES buffered
solution (KRH in mM: NaCl, 125; KCl, 4.8; CaCl2, 1.3; MgSO4,
1.2; KH2PO4, 1.2; glucose, 5.6; HEPES, 25; pH 7.4±0.1) at 37°C and
incubated with [3H]DA, [3H]GABA, [3H]NE, [3H]5-HT or [3H]glu-
tamate at a final concentration of 10, 10, 10, 10 and 20 nM, respec-
tively, at 37°C for 10 min (Kitayama et al. 1992). After that, cells
215
were washed rapidly three times with ice-cold KRH and any ra-
dioactivity remaining in the cells was extracted with NaOH, neu-
tralized with HCl and determined by liquid scintillation counting.
Nonspecific uptake of 3H-labelled DA, NE, 5-HT, GABA or glu-
tamate was determined in the presence of 100 µM cocaine, 1 mM
nipecotic acid or 1 mM glutamate, respectively. Saturation analy-
ses of monoamine uptake were performed in COS cells incubated
at 37°C in KRH containing 100 nM [3H]DA, [3H]NE or [3H]5-HT
with unlabelled DA, NE or 5-HT (100 nM–10 µM), respectively.
Binding of [3H]CFT to DAT was performed on whole cells in
24-well plates (Kitayama et al. 1992). Cells were washed three times
with ice-cold KRH and incubated with 4 nM [3H]CFT on ice for 2 h.
After that, cells were washed rapidly three times with ice-cold KRH
and radioactivity was extracted with NaOH, neutralized with HCl
and determined by liquid scintillation counting. Nonspecific binding
was measured in the presence of 100 µM cocaine.
Data analysis. The results are in most cases expressed as the
means ± SEM of 3–4 experiments each performed in triplicate. Sta-
tistical analysis was performed using the Student’s t-test. Correla-
tion was examined by Pearson’s correlation coefficient.
Drugs. [3H]DA (888 GBq/mM), [3H]GABA (1480 GBq/mM),
[3H]NE (538.72 GBq/mM), [3H]5-HT (1028.6 GBq/mM), [3H]glu-
tamate (658.6 GBq/mM) and [3H]CFT (3085.8 GBq/mM) were
obtained from NEN Dupont (Boston, Mass., USA). Meprylcaine hy-
drochloride, procaine hydrochloride, tetracaine hydrochloride and
tricaine methanesulfonate salt were obtained from Sigma Chemi-
cal (St. Louis, Mo., USA), butacaine, prilocaine hydrochloride and
bupivacaine from ICN Biomedicals (Aurora, Ohio, USA), lido-
caine hydrochloride and procainamide hydrochloride from Research
Biochemicals (Natick, Mass., USA), dibucaine hydrochloride from
Teikoku Chemical Industries (Osaka, Japan), cocaine hydrochloride
from Takeda Chemical Industries (Osaka, Japan), ethyl 4-aminoben-
zoate from Wako Pure Chemical Industries (Osaka, Japan) and
nipecotic acid from Tokyo Chemical Industries (Tokyo, Japan).
Results
Effect of LAs on DAT
Procaine, an ester-type synthetic LA, displayed concentra-
tion-dependent inhibition of DA uptake (Fig. 1A), though
it was less potent than cocaine. Lidocaine, an amide-type
LA more potent than procaine, had a weak inhibitory effect
on DA uptake. We examined the effect of synthetic LAs on
[3H]CFT binding and compared it to that of cocaine. CFT,
a cocaine analogue, is known to act on DAT at cocaine
recognition sites with an affinity higher than cocaine (Ma-
dras et al. 1989). Figure 1B shows that cocaine, procaine
and lidocaine inhibit [3H]CFT binding with concentration-
effect curves similar to those of [3H]DA uptake inhibition.
Table 1 summarizes the effects of 11 LAs on dopamine
uptake and CFT binding. Dibucaine, butacaine, mepryl-
caine, procaine and tetracaine inhibited DA uptake with
IC50 values between 30 µM and 200 µM. These LAs also
inhibited CFT binding. In general, ester-linked LAs tended
to have greater efficacy for inhibition of DA uptake and
CFT binding than did amide-linked LAs. There was a pos-
itive correlation between inhibition of DA uptake and that
of CFT binding, but not between DA uptake inhibition and
reported anesthetic potency (Fig. 2).
We also examined the mode by which LAs inhibit DA
uptake in HeLa/DAT. Lowering pH in the incubation so-
216

Fig. 1 A Effect of local anesthetics on the uptake of [3H]dopamine

in COS cells expressing the rat dopamine transporter. Closed tri-
angles, closed circles and closed squares represent cocaine, procaine
and lidocaine, respectively. B Effect of local anesthetics on the bind-
ing of [3H]CFT in COS cells expressing the rat dopamine trans-
porter. Closed triangles, closed circles and closed squares represent
cocaine, procaine and lidocaine, respectively. Points and bars rep-
resent means ± SEM, n=3
lution caused a decrease in [3H]DA uptake, probably due
to an increase in Km, as demonstrated in HEK-293 cells ex-
pressing the human DAT (Berfield et al. 1999; Fig. 3).
This pH change, however, did not shift the inhibition curve
for procaine (Fig. 3; insert panel). Since the pKa of pro-
caine is 8.9 (de Jong 1994), most of the procaine was
cationic in any pH solution tested. However, the basic
Fig. 2 A Correlation between the IC50 values for the inhibition of the
uptake of [3H]dopamine in COS cells expressing the rat dopamine
transporter and the IC50 values for the binding inhibition of [3H]CFT
in COS cells expressing the rat dopamine transporter; r=0.934,
P=0.0170. B Correlation between the IC50 values for the inhibition
of the uptake of [3H]dopamine in COS cells expressing the rat
dopamine transporter and the intrinsic anesthetic potency of some
local anesthetics (Truant and Takman 1965); r=0.502, P=0.5806
form of procaine in pH-6.8 solution was more than tenfold
lower than that in pH-8.0 solution. Taken together, it seems
unlikely that procaine acts in its basic form.

Table 1 Comparison of the

effect of local anesthetics on Drugs Type DA uptake inhibition CFT binding inhibition Ratio of IC50
[3H]dopamine uptake and IC50 (µM) IC50 (µM) DA/CFT
[3H]CFT binding in COS Bupivacaine Amide >1000 ND ND
cells expressing the rat
dopamine transporter. Values Dibucaine Amide 109 ±16 41.6±19.6 2.6
represent means ± SEM, Lidocaine Amide >1000 >1000 ND
n=3–4 (ND not determined) Prilocaine Amide >1000 ND ND
Procainamide Amide 464±139 >1000 >0.4
Butacaine Ester 26±15 ND ND
Cocaine Ester 0.68±0.22 0.22±0.02 3.1
Meprylcaine Ester 32±5 25.2±6.7 1.3
Procaine Ester 114±9 52.7±13.0 2.2
Tetracaine Ester 199±15 74.0±17.2 2.7
Tricaine Ester >1000 >1000 ND
 217

which reduced [3H]DA uptake to about 30% of control

(Fig. 1A), cells were (a) incubated with [3H]DA in the pres-
ence of procaine or (b) washed with KRH, then incubated
with [3H]DA without procaine. In (a), [3H]DA uptake was
31.2±0.4% of the control value (in the absence of pro-
caine during preincubation and incubation periods). On
the other hand, cells in (b) showed [3H]DA uptake that was
108.6±5.5% of that in the control cells (n=3). Therefore,
the inhibitory action of procaine on DAT was reversible.

Effects of LAs on NET and SERT

Next, we investigated the effects of synthetic LAs on NE

Fig. 3 Effect of pH on [3H]DA uptake inhibition by procaine in
HeLa cells stably expressing rat DAT. Inhibitory action of procaine
examined in incubation solutions at different pH. Points and bars
represent means ± SEM, n=3. Insert panel shows the effect of pro-
caine as % of control for each pH
Reversibility of the effect of procaine on DAT was ex-
amined in accordance with the following protocol. After
preincubation of cells with 200 µM procaine for 30 min,
and 5-HT uptake using COS cells expressing rat NET or
rat SERT. Procaine showed concentration-dependent inhi-
bition of [3H]NE uptake and less potent [3H]5-HT uptake
(Fig. 4A,C). Lidocaine had a weak effect on both [3H]NE
and [3H]5-HT uptake. Other LAs tested, including buta-
caine, dibucaine, meprylcaine, procainamide and tetracaine,
inhibited the uptake of [3H]NE and [3H]5-HT to various
extents. The inhibition of [3H]NE uptake was well corre-
lated, but the inhibition of [3H]5-HT was less correlated,
with the inhibition of DAT (Fig. 4B,D).

Fig. 4 Effect of cocaine and

synthetic LAs on the uptake of
[3H]NE (A) and [3H]5-HAT
(B) in COS cells expressing rat
NET or rat SERT. Points and
bars represent means ± SEM,
n=3. C Correlation between
the IC50 values of various local
anesthetics in inhibiting the up-
take of [3H]DA in COS cells
expressing the rat DAT and
those in inhibiting the uptake
of [3H]NE in COS cells ex-
pressing the rat NET; r=0.998,
P<0.0001. D Correlation be-
tween the IC50 values of vari-
ous local anesthetics in inhibit-
ing the uptake of [3H]DA in
COS cells expressing the rat
DAT and those in inhibiting
the uptake of [3H]5-HT in COS
cells expressing the rat SERT;
r=0.953, P<0.0001
218
Table 2 Comparison of the inhibitory action of cocaine and pro-
caine on dopamine, norepinephrine and serotonin uptake in COS
cells expressing the rat dopamine transporter (DAT), rat norepi-
nephrine transporter (NET) or rat serotonin transporter (SERT).
DAT Km (µM) DAT Vmax (pmol/ NET Km (µM)
well per min)
Experiment 1
Control 3.64 ± 0.10 12.4 ± 0.3 0.79 ± 0.06
Cocaine 6.64 ± 0.35* 11.6 ± 0.5 1.41 ± 0.10*
Experiment 2
Control 3.60 ± 0.15 13.8 ± 0.4 0.72 ± 0.05
Procaine 8.04 ± 0.96* 13.0 ± 1.3 1.20 ± 0.09*
*P<0.05 vs. control
Effects of LAs on GAT and GLAST
To determine whether LAs act selectively on monoamine
transporters, we evaluated the effect of LAs on GABA or
glutamate uptake in COS cells expressing mouse GAT or
rat GLAST. Most LAs tested, including bupivacaine, bu-
tacaine, cocaine, ethyl 4-aminobenzoate, lidocaine, mepryl-
caine, prilocaine, procainamide, procaine and tricaine,
had no effect on [3H]GABA uptake up to 1 mM, except
tetracaine and dibucaine which showed IC50 values of
255±40 µM and 384±151 µM, respectively (n=3). Al-
though COS cells have an endogenous glutamate trans-
port system, the introduction of rat GLAST caused a 2- to
2.5-fold increase in [3H]glutamate uptake. Procaine and
cocaine up to 1 mM had no effect on [3H]glutamate uptake
in COS cells expressing rat GLAST, nor in mock (plasmid
vector only)-transfected COS cells (data not shown).
Kinetic analysis of procaine inhibition
of monoamine transporters
Comparing the inhibitory action of procaine to that of co-
caine, we clarified the mode of action kinetically in COS
cells expressing DAT, NET and SERT. Saturation analysis
of [3H]DA, [3H]NE and [3H]5-HT uptake displayed com-
petitive inhibition by procaine as well as cocaine. Table 2
summarizes the action of procaine and cocaine. Both co-
caine and procaine, despite different potencies, increase Km
values without affecting Vmax values, indicating that procaine
inhibits monoamine uptake competitively, like cocaine.
Discussion
The psychostimulant action of cocaine is known to be me-
diated by the stimulation of monoaminergic neurons, es-
pecially via dopamine neurons by the inhibition of DAT.
One line of evidence indicates that some LAs, including
procaine, have a discriminative effect similar to cocaine,
but with low potency (de la Garza and Johanson 1985;
Zacny and Woolverton 1989; Graham and Balster 1993).
Since cocaine is a potent local anesthetic, these results led
to the hypothesis that the local anesthetic property of co-
Concentrations of cocaine and procaine used in DAT, NET and
SERT were 0.5, 0.5 and 1.0 µM for cocaine and 100, 100 and 500
µM for procaine, respectively. Values represent means ± SEM of
3–4 experiments
NET Vmax (pmol/ SERT Km (µM) SERT Vmax (pmol/
well per min) well per min)
6.48 ± 0.39 0.73 ± 0.13 11.7 ± 1.3
6.16 ± 0.37 1.63 ± 0.10* 13.3 ± 0.6
5.25 ± 0.26 0.96 ± 0.08 18.4 ± 1.0
5.03 ± 0.31 1.43 ± 0.09* 18.7 ± 0.9
caine contributes to its psychotomimetic action. However,
biochemical and behavioral studies have suggested that the
local anesthetic potency of cocaine is not correlated with
its psychostimulating action (McNeal et al. 1985; Reith et
al. 1985). Another hypothesis from the above observations
of LA action is that some LAs, like cocaine, inhibit DA up-
take to exert their cocaine-like psychostimulant action. The
present study clearly demonstrated that some LAs specifi-
cally inhibit DAT, like cocaine. Using the neurotransmitter
transporter-expressing system, we pointed out certain fea-
tures of the action of synthetic LAs on neurotransmitter up-
take. The inhibitory action of LAs on DA uptake was cor-
related well with the inhibition of the binding of CFT, a co-
caine analogue, known to specifically label cocaine-bind-
ing sites (Madras et al. 1989), but not with LA potency.
These results suggest that certain LAs have a direct in-
hibitory action on DAT, and this may explain their cocaine-
like psychotomimetic action. Differing potencies of pro-
caine and lidocaine on DAT inhibition observed in the pre-
sent investigation are consistent with their differing dis-
criminative properties reported elsewhere (Huang and Wil-
son 1982; Woolverton and Balster 1982; Graham and Bal-
ster 1993). Recently, Woodward et al. (1995) reported that
the LAs dimethocaine and procaine, as well as cocaine, in-
hibit DA uptake in synaptosome and increase striatal
dopamine outflow as measured by in vivo microdialysis.
Wilcox et al. (1999) also suggested that affinity at DAT is
related to the reinforcing effects of LAs in rhesus monkeys.
Taken together, these findings suggest that the cocaine-like
psychotomimetic actions of certain LAs is brought about
by their inhibition of DAT.
Most in vivo investigations observed the higher doses
of LAs to promote the psychotomimetic actions than those
of cocaine. For instance, Middaugh et al. (1998) showed
the discriminative effect of procaine at doses of 100 mg/kg
in contrast to 10 mg/kg of cocaine. According to the phar-
macokinetics of procaine (de Jong 1994), the concentra-
tion of procaine in the brain tissues after injection of such
doses was expected to be over 100 µM, which is close to
the IC50 values of procaine in inhibiting [3H]DA uptake in
COS cells expressing the rat DAT observed in the present
study. Taken together, it is suggested that some LAs re-
vealed the reported psychotomimetic action at least partly
via inhibition of monoamine transporters.

The present study also demonstrated that some synthetic
LAs selectively inhibit monoamine transporters, like co-
caine. Certain LAs such as procaine, tetracaine and dibu-
caine, but not lidocaine, revealed the inhibition of not only
DAT but also NET and SERT. It seems likely that this in-
hibitory action results in an increase in overall monoamin-
ergic neural activity. Although the psychostimulant action
of cocaine is mainly due to its inhibition of DAT as men-
tioned above, a recent study on transgenic mice lacking
DAT or SERT gene questioned the dopamine hypothesis of
cocaine reward (Rocha et al. 1998; Sora et al. 1998). Co-
caine still reinforced self-administration in DAT knock-
out mice, but its locomotor-stimulating action disappeared.
Since cocaine impacts all monoamine transporters, both no-
radrenergic and serotonergic modification might contribute
to its reinforcing property. Indeed, several reports describe
the characteristics of cocaine reward examined with vari-
ous serotonergic agents, suggesting that serotonin 1B
agonists may enhance cocaine’s reinforcing effects by
augmenting cocaine-induced elevations in extracellular
DA concentrations (Benloucif et al. 1993; Cameron and
Williams 1994; Boulenguez et al. 1996). Rocha et al. (1998)
have also suggested that increases in serotonergic neuro-
transmission may mediate the reinforcing effect of cocaine
in DAT knock-out mice. Therefore, it can be assumed that
a concomitant increase in DA and 5-HT (or NE) is neces-
sary to exert its reinforcing properties. If this is the case,
the ability to inhibit not only DAT but also SERT (or NET)
is essential to mimic cocaine-like action. Accordingly, it
is necessary to re-evaluate the properties of the action of
certain drugs that exert cocaine-like reinforcing proper-
ties. Based on the reinforcing properties of procaine, the
present findings that certain LAs such as procaine showed
selective inhibition of monoamine transporters like co-
caine offer examples that help to answer this question.
It is well known that LAs act on the voltage-sensitive
Na+ channel at intracellular sites in cationic form. They
must pass through the plasma membrane initially in their
basic form to act at their binding site (de Jong 1994). In in-
tact cells, therefore, acidic pH prevent the LAs’ inhibitory
action on Na+ channels by reducing the basic form. In the
present study, however, lowering pH in the incubation so-
lution did not affect the potency of procaine in inhibiting
DA uptake in HeLa cells expressing rat DAT. In addition,
the effect of procaine was reversible; recovery from the in-
hibition by procaine occurred quickly after removing pro-
caine from the incubation solution. These results suggest
that the mode of action of procaine on DAT is different
from that on Na+ channels.
To resolve a serious problem of cocaine addiction, the
development of medicaments for the treatment of cocaine
addiction or prevention of its re-use is desired. One possi-
ble target of this is the DAT molecule which is primarily
impacted by cocaine. To dissect DA/cocaine-binding sites
on the DAT molecule, we examined its molecular func-
tional map by site-directed mutagenesis, and demonstrated
that although DA and cocaine share common sites on DAT,
they do not completely overlap their recognition sites
(Kitayama et al. 1992). This predicts the possibility of de-
219
veloping medicaments that selectively prevent cocaine
from binding to DAT without affecting normal DA trans-
port. Based on this rationale, several compounds are be-
ing screened in the search for compounds that display dis-
sociated inhibitory potency for DA uptake and CFT bind-
ing (Kitayama et al. 1996). Since some LAs revealed spe-
cific inhibition of DAT, we examined the possibility of
dissociated inhibitory potency. However, the IC50 values
of the LAs described in Table 1 have thus far revealed no
great difference between DA uptake and CFT binding in-
hibition. Therefore, we conclude that the interaction of
synthetic LAs with DAT is similar to that of cocaine, and
the possibility mentioned above remains to be clarified.
In summary, the present results demonstrated that cer-
tain synthetic LAs display a selective inhibition of mono-
amine neurotransmitter transporters. It is suggested that this
effect might contribute to the cocaine-like psychotomimetic
action of certain LAs.
Acknowledgements This work was supported in part by the Grant-
in-Aid for Scientific Research from the Ministry of Education, Sci-
ence and Culture, Japan (C06671858).
References
Benloucif S, Keegan MJ, Galloway MP (1993) Serotonin-facili-
tated dopamine release in vivo: pharmacological characteriza-
tion. J Pharmacol Exp Ther 265:373–377
Berfield JL, Wang LC, Reith MEA (1999) Which form of dopamine
is the substrate for the human dopamine transporter: the cationic
or the uncharged species? J Biol Chem 274:4876–4882
Boulenguez P, Rawlins JN, Chauveau J, Joseph MH, Mitchell SN,
Gray JA (1996) Modulation of dopamine release in the nucleus
accumbens by 5-HT1B agonists: involvement of the hip-
pocampo-accumbens pathway. Neuropharmacology 35:1521–
1529
Cameron DL, Williams JT (1994) Cocaine inhibits GABA release
in the VTA through endogenous 5-HT. J Neurosci 14:6763–6767
Ford RD, Balster RL (1977) Reinforcing properties of intravenous
procaine in rhesus monkeys. Pharmacol Biochem Behav 6:289–
296
Garza R de la, Johanson CE (1985) Discriminative stimulus prop-
erties of cocaine in pigeons. Psychopharmacology (Berl) 85:23–
30
Graham JH, Balster RL (1993) Cocaine-like discriminative stimu-
lus effects of procaine, dimethocaine and lidocaine in rats. Psy-
chopharmacology (Berl) 110:287–294
Gründemann D, Schechinger B, Rappold GA, Schömig E (1998)
Molecular identification of the corticosterone-sensitive extra-
neuronal catecholamine transporter. Nat Neurosci 1:349–351
Horn AS (1990) Dopamine uptake: a review of progress in the last
decade. Prog Neurobiol 34:397–400
Huang D, Wilson MC (1982) Comparative stimulus properties of
cocaine and other local anesthetics in rats. Res Commun Subst
Abuse 3:129–140
Iversen LL (1971) Role of transmitter uptake mechanisms in synap-
tic neurotransmission. Br J Pharmacol 41:571–591
Johanson CE (1980) The reinforcing properties of procaine, chloro-
procaine and proparacaine in rhesus monkeys. Psychopharma-
cology (Berl) 67:189–194
Jong RH de (1994) Local anesthetics. Mosby Yearbook, St. Louis
Kitayama S, Shimada S, Xu H, Markham L, Donovan DM, Uhl
GR (1992) Dopamine transporter site-directed mutations dif-
ferentially alter substrate transport and cocaine binding. Proc
Natl Acad Sci USA 89:7782–7785
220
Kitayama S, Morita K, Dohi T, Wang JB, Davis SC, Uhl GR
(1996) Dissection of dopamine and cocaine binding sites on the
rat dopamine transporter expressed in COS cells. Ann NY Acad
Sci 801:388–393
Kitayama S, Ikeda T, Mitsuhata C, Sato T, Morita K, Dohi T
(1999) Dominant negative isoform of rat norepinephrine trans-
porter produced by alternative RNA splicing. J Biol Chem 274:
10731–10736
Langer SZ, Schoemaker H (1988) Effects of antidepressants on
monoamine transporters. Prog Neuropsychopharmacol Biol Psy-
chiatry 12:193–216
Madras BK, Spealman RD, Fahey MA, Neumeyer JL, Saha JK,
Milius RA (1989) Cocaine receptors labeled by [3H] 2beta-car-
bomethoxy-3beta-(4-fluorophenyl) tropane. Mol Pharmacol
36:518–524
McNeal ET, Lewandowski GA, Daly JW, Creveling CR (1985)
[3H]Batrachotoxinin A 20 alpha-benzoate binding to voltage-
sensitive sodium channels: a rapid and quantitative assay for lo-
cal anesthetic activity in a variety of drugs. J Med Chem 28:
381–388
Middaugh LD, McGroarty KK, Groseclose CH, Adinoff B (1998)
Cocaine discrimination: relationship to local anesthetics and
monoamine uptake inhibitors in C57BL/6 mice. Psychopharma-
cology 136:44–49
Mitsuhata C, Kitayama S, Morita K, Vandenbergh D, Uhl GR, Dohi
T (1998) Tyrosine-533 of rat dopamine transporter: involve-
ment in interactions with 1-methyl-4-phenylpyridinium and co-
caine. Mol Brain Res 56:84–88
Reith ME, Meisler BE, Lajtha A (1985) Locomotor effects of co-
caine, cocaine congeners, and local anesthetics in mice. Phar-
macol Biochem Behav 23:831–836
Ritz MC, Lamb RJ, Goldberg SR, Kuhar MJ (1987) Cocaine re-
ceptors on dopamine transporters are related to self-administra-
tion of cocaine. Science 237:1219–1223
Rocha BA, Fumagalli F, Gainetdinov RR, Jones SR, Ator R, Giros
B, Miller GW, Caron MG (1998) Cocaine self-administration
in dopamine-transporter knockout mice. Nat Neurosci 1:132–
137
Schaeffer JC, Lin CL, Kitayama S, Uhl GR (1991) Ligand autora-
diographic receptor screening. II. Expression of receptor cDNA
in transfected COS cells grown on polyester disks and its re-
covery. Mol Brain Res 9:271–276
Shimada S, Kitayama S, Lin CL, Patel A, Nanthakumar E, Gregor
P, Kuhar M, Uhl G (1991) Cloning and expression of a co-
caine-sensitive dopamine transporter complementary DNA. Sci-
ence 254:576–578
Sora I, Wichems C, Takahashi N, Li XF, Zeng Z, Revay R, Lesch
KP, Murphy DL, Uhl GR (1998) Cocaine reward models: con-
ditioned place preference can be established in dopamine- and
in serotonin-transporter knockout mice. Proc Natl Acad Sci
USA 95:7699–7704
Truant AP, Takman B (1965) Local anesthetics. In: DiPalma JR
(ed) Drill’s pharmacology in medicine, 3rd edn. McGraw-Hill,
New York, pp 133–156
Wilcox KM, Paul IA, Woolverton WL (1999) Comparison be-
tween dopamine transporter affinity and self-administration po-
tency of local anesthetics in rhesus monkeys. Eur J Pharmacol
367:175–181
Woodward JJ, Compton DM, Balster RL, Martin BR (1995) In
vitro and in vivo effects of cocaine and selected local anesthet-
ics on the dopamine transporter. Eur J Pharmacol 277:7–13
Woolverton WL, Balster RL (1982) Behavioral pharmacology of
local anesthetics: reinforcing and discriminative stimulus effects.
Pharmacol Biochem Behav 16:491–500
Zacny JP, Woolverton WL (1989) Discriminative stimulus proper-
ties of local anesthetics in d-amphetamine- and pentobarbital-
trained pigeons. Pharmacol Biochem Behav 33:527–531