Biochemical Engineering Journal 140 (2018) 1–8

Contents lists available at ScienceDirect

Biochemical Engineering Journal

journal homepage: www.elsevier.com/locate/bej

Regular article

Biodiesel production from microalgae oil by lipase from Pseudomonas T

aeruginosa displayed on yeast cell surface
⁎
Zeinab Raoufi, Seyed Latif Mousavi Gargari
Department of Biology, Shahed University, Tehran, Iran

H I GH L IG H T S

• Lipase A from P. aeruginosa was displayed on P. pastoris cells.

• Biochemical characterization and stability of the LipA was investigated.
• Esterification was used to biodiesel production from algae oil by the biocatalyst.
• Operational stability of enzyme was tested in 10 repeated batch cycles.

A R T I C LE I N FO A B S T R A C T

Keywords: Yeast surface display has become a powerful technology in recent decades and one of the promising areas in this
Yeast surface display field is the biodiesel synthesis by microbial lipases. Hence, in this study the optimized lipase A (Lip A) gene from
Pseudomonas aeruginosa Pseudomonas aeruginosa was fused to GPI-anchored protein Gcw61 and successfully displayed on the surface of
Recombinant lipase Pichia pastoris X33. A lipase activity of 85.2 U/mg dry cell weight was obtained from recombinant P. pastoris. The
Microalgae oil
copy numbers of inserted lipase gene were determined 2.09 ± 0.06 by real time PCR absolute quantification
Biodiesel
method. The enzyme showed the best stability in pH 7.0–10.0 and at temperature 37 °C–40 °C and was also
stable in hydrophilic organic solvents. Ca2+, Mg2+, Mn2+ and Cu2+ ions enhanced enzyme activity, whereas
Fe2+ and Zn2+ ions and some detergents like SDS, CTAB, Tween 20 and 80 dramatically decreased the activity
of the enzyme. The results demonstrate that our whole cell biocatalyst exhibited a good potential for biodiesel
production from microalgae oil in 10 repeated batch cycles.

1. Introduction On the other hand, due to its numerous applications in bio-

Yeast surface display which is being used in many fields, such as
development of vaccine and antibody, bioconversion, library screening
and biosorption, has become a powerful technology in recent years [1].
Whole-cell biocatalysts with the proteins displayed on, without any
tedious purification processes, are good candidates as industrial cata-
lysts, adsorbents and sensors [2]. In this system, the target protein is
fused to a carrier which is called anchor. This anchor is as an im-
mobilized protein to expose the enzyme on the cell surface [3,4]. One of
the advantages of the surface display system as a biocatalyst, is non- or
minimum processing before the ultimate application; because the pro-
tein production and immobilization occur in the same stage [5]. In
recent years, many cell wall proteins such as Sed1p, Gcw21, Pir1p,
Flo1p, Cwp2 and Gcw61 have been used as an anchor protein in cell
surface display [6–8].
technology, the display of lipase has attracted the attention of many
researchers [9]. Microbial lipases (EC 3.1.1.3) are an important group
among biotechnological enzymes due to their versatile characteristics
and relative ease of production on a large scale [10]. Lipases belong to
the carboxylic ester hydrolyze family that interact with the aqueous-
organic environments and, by catalyzing the hydrolysis of triacylgly-
cerol, release the fatty acids and the glycerol [11]. In addition, these
enzymes catalyze a wide range of conversion reactions such as ester-
ification, transesterification, alkalization and acidification in non-aqu-
eous environments [12]. Different catalytic characteristics of the lipases
are momentous in the industrial applications such as food, detergents,
pharmaceuticals, cosmetics and biodiesel [13]. The most commercially
important use of lipases is in detergent industry, nearly followed by the
food & beverage industry. Lipases have multiple applications in food
technology, including in baked or prepared foods, flavor expansion,

⁎
Corresponding author at: Biology Department, Shahed University, Tehran-Qom Express Way, Tehran, 3319118651, Iran.
E-mail address: slmousavi@shahed.ac.ir (S.L. Mousavi Gargari).

https://doi.org/10.1016/j.bej.2018.09.008
Received 22 June 2018; Received in revised form 5 September 2018; Accepted 6 September 2018
Available online 07 September 2018
1369-703X/ © 2018 Published by Elsevier B.V.
Z. Raoufi, S.L. Mousavi Gargari
production of butter and milk equivalents, meat and fish processing,
manufacturing of dairy products, animal feed, and etc. [14]. Another
important use of these enzymes is as biocatalysts in the resolution of
racemic mixtures for pure enantiomers production in the pharmaceu-
tical industry [15].
Among the applications mentioned above, the use of lipases for
producing biodiesel is clearly the most recent one [16]. The application
of lipases in the biodiesel production is beneficial in comparison with
alkaline chemical catalysis because the enzymatic pathway does not
require saponification and biodiesel yields with greater ease and purity
[17].
One of the promising areas in the application of whole cell bioca-
talysts is the biodiesel synthesis by displaying the cell surface lipase
[18].
Biodiesel is usually acquired by the transesterification of fats and
vegetable oils with alcohol in the presence of a catalyst, two of which
are the fatty acid methyl esters (FAMEs) and fatty acid ethyl esters
(FAEEs) used as biofuels [19]. This green fuel as a diesel fuel alter-
native, is non-toxic and biodegradable which can be used in car infra-
structure without major changes in their engine [20]. High production
cost is the major limiting factor for development and use of biodiesel, of
which feedstock expenditure accounts for > 75% [21]. Feedstock costs
are a main and determinative factor in strategies to cause biodiesel
competitive with other fuels. Different kinds of feedstock such as ve-
getable oils, waste cooking oil, animal fats, and waste greases which
have free fatty acids and/or triglycerides can be converted into bio-
diesel [22]. Accordingly, three categories are reviewed in the evolution
of biodiesel feedstocks : 1) Vegetable oils, e.g., sunflower, corn and
soybean oils were used as feedstocks [23], 2) feedstocks based on non-
edible oils such as jojoba oil, jatropha oil, animal fats, waste oil and
recycled oil, intended to reduce usage of edible oil [23,24]. This cate-
gory of feedstocks can be harvested from non-agricultural lands thus
there is no competition with food production. Nevertheless, application
of these generations of feedstocks is restricted by inefficiency and high
cost [23,25]. 3) Researcher now focused on the third generation bio-
diesel feedstocks: algae including macro and microalgae. This type of
feedstocks has rapid reproduction, no requirement of arable and
freshwater, more oil productivity than previous categories which can be
alternative and good candidate for biodiesel production [24]. The
production of biodiesel from microalgae occurs in several steps and
many researches focus only on the microalgae cultivation to enhance oil
output, while research work about the chemical or enzymatic conver-
sion of this oil to biodiesel are very few [26]. Lipase-catalyzed micro-
algal biodiesel production has multiple advantages such as high quality
products, low energy demands and minimal wastewater generation
[27].
Meanwhile, Pseudomonas lipase exhibits special biochemical prop-
erties like good stereoselectivity, thermal stability and natural activity
at alkaline pH which distinguish them from other microbial lipases
[28,29]. Although lipases can be produced by homologous expression
in Pseudomonas hosts, but many of its species are potentially pathogenic
and then, they should be cultured by special safety instructions.
Therefore, a heterologous active expression system is essential [30].
These lipases were used to biodiesel production in free [31] or im-
mobolized forms [32,33]. A major challenge in using these forms of
lipase is purification step. In addition, application of whole cell lipase
biocatalysts reduces the cost of producing purified lipase and is able to
produce biodiesel yields up to 85% [34].
So, in this study, for the first time, we have displayed lipase (Lip A)
from Pseudomonas aeruginosa on P. pastoris X33 by its endogenous GPI-
anchored protein Gcw61 isolated from P. pastoris GS115, with N-
terminal fusion type; and then the enzyme was characterized under
different conditions. Among Gcw anchors used with different re-
searchers, Gcw61 exhibited the highest expression of target proteins on
the cell surface [8]. A newly generated whole cell biocatalyst was also
used to catalyze transesterification of extracted algae oil to FAMEs as
2
Biochemical Engineering Journal 140 (2018) 1–8
biodiesel.
2. Materials and methods
2.1. Strains, plasmid and cultures media
E. coli DH5α and Pichia pastoris X33 Mut+ strains were used as
plasmid recipient and host respectively. pPICZαA plasmid and restric-
tion enzymes such as PmeI, XhoI and NotI were purchased from
Invitrogen, USA. Buffer glycerol complex medium or BMGY (1% (w/v)
yeast extract, 1.34% Yeast Nitrogen Base (YNB), 2% (w/v) peptone,
100 mM potassium phosphate with pH 7.0, 0.4 μg/mL biotin, 1% (v/v)
glycerol) and BMMY medium (all components are the same with BMGY,
except 0.5% methanol instead of 1% glycerol) were used for pre-in-
duction and induction media, respectively. YPD (1% yeast extract, 2%
peptone and 2% dextrose) and low salt LB (1% tryptone, 0.5% yeast
extract and 0.5% sodium chloride) supplemented with antibiotic zeocin
(Invitrogen, USA) were used to select the positive transformants.
Substrate pNPP (p-Nitrophenyl palmitate) and other analytical mate-
rials were bought from Sigma-Aldrich, USA.
2.2. Codon optimization, cassette construction and N-glycosylation sites
prediction
Codon optimization can increase the expression of a heterologous
gene in P. pastoris [35]. Hence, the Lip A gene (GeneBank accession no.:
AE004091) sequence was optimized by “GeneScript” service at https://
www.genscript.com/ssl-bin/quote_gene_synthesis based on Pichia pas-
toris codon usage.
In order to construct the lipase A-anchor cassette, N-terminal of the
Gcw61 anchor gene (GenBank accession no. XP_002494332) from P.
pastoris GS115 was attached to the C-terminal of Lip A optimized gene
(without signal sequence) and XhoI and NotI restriction sites were
added to the 5ʹ and 3ʹ ends of the cassette, respectively. Gcw61 is an
anchor protein with 65 amino acids with its ɷ site on Gly40 and iso-
electric point (pI) of 8.54 [8].
N-glycosylation sites that may affect the cassette expression and
enzyme characterization was predicted by NetNGlyc [36] (http://www.
cbs.dtu.dk/services/NetNGlyc/).
The designed cassette was synthesized by Biomatik Company,
Canada and transformed to pUC57 plasmid.
2.3. Cassette transformation and lipase expression
After digestion of the pUC57 plasmid containing lipase A-anchor
cassette with aforementioned enzymes, the purified fragment was in-
serted to pPICZαA plasmid precisely after the secretory signal (α-factor
secretion signal) with guidance of the AOX1 promoter. The resulted
plasmid was named as pPICZαA-LAG61-op.
pPICZαA-LAG61-op was transferred to competent E. coli DH5α and
positive clones were screened using low salt LB medium with 25 μg/mL
zeocin. The cloned plasmid was purified by plasmid DNA purification
kit (GeneAll, Korea) and 12 μg of it was linearized by PmeI and trans-
formed to competent P. pastoris X33 cells via electroporation. The cells
were recovered in 1 mL of YPD and incubated at 28 °C for 1 h. Then,
they were plated onto YPD agar (containing 100 μg/mL zeocin), in-
cubated at 28 °C for 4 days and positive colonies were selected by
colony PCR.
Colonies containing the desired cassette were cultivated in 10 mL of
BMGY within a 100 mL shake flask and incubated at 30 °C for 24 h with
220 rpm shaking until OD600 reached to 4–6. Then the cells were har-
vested, inoculated to 100 mL of BMMY within a 1 L shake flask and
incubated for 4–6 days. Methanol was added to the flasks every 24 h to
final concentration of 1% (v/v). P. pastoris X33 transformed with
pPICZαA (X33/ pPICZαA) was used as a negative control.
Z. Raoufi, S.L. Mousavi Gargari
2.4. Lipase activity assay
A modified method for the lipase activity assay was used [3,8]. The
induced cells were centrifuged at 13,000 rpm for 1 min, washed three
times and resuspended in distilled water. Substrate was prepared with
the addition of 90 μL of solution A (16.5 mM pNPP in isopropanol) to
810 μL of solution B (50 mM Tris−HCl pH 8.0, 0.4% Triton X-100,
0.1% Arabic gum). Reaction was started with addition of 100 μl of cell
suspension to substrate and incubated at 37 °C for 15 min. The activity
of Lip A was assayed by measuring the absorbance of the liberated p-
nitrophenol (pNP) at 410 nm. One unit (U) of activity was defined as the
amount of enzyme required to release 1 μ mol pNP per minute from
pNPP under the experimental conditions. The cell density was con-
firmed by OD600 measurement, and the cell suspension was used for
lipase activity measurement. After enzyme activity assay, the cells were
separated, dried and weighted. Finally, lipase activity was divided to
this weight and reported as U per mg dry cell weight. Each assay was
repeated 3 times.
2.5. Lip A gene expression assay
To check if the optimized Pseudomonas lipase gene is being ex-
pressed in P. pastoris, real-time PCR with SYBER Green was employed as
follow: Total RNA from wild and recombinant P. pastoris strains cul-
tured in induced BMMY medium were extracted by RNeasy Mini Kit
(QIAGEN, USA) and converted to cDNA (complementary DNA) by re-
verse transcription polymerase chain reaction using PrimeScript RT
reagent Kit (TaKaRa, Japan). The constructed cDNA from recombinant
P. pasroris was used as a template to indicate the lipase gene expression
and the cDNA from X-33 was used as a negative control. 26S rDNA
expression was used as a positive control. The primer pairs which
amplify approximately 150 bps fragment are listed at Table 1.
2.6. Copy number determination
The recombinant P. pastoris clone with the highest lipase activity
was selected to determine the copy number of inserted lipase gene in its
genome by absolute quantification method and using SYBER Green as
described by Abad et al. [37]. Briefly, genomic DNA was extracted and
used as template in real-time PCR with designed special primer pairs
exhibited in Table 1. Serial dilution of genomic DNA was prepared
based on molecular weight and the standard curve was plotted by Ct
obtained from real-time PCR for ARG4, the reference gene that has one
copy in haploid strain of P. pastoris. Then the normalized copy number
of lipase gene was calculated by following formula:
lipA (copy quantity )
Copy number =
ARG 4 (copy quantity ) (1)
2.7. Protease accessibility tests
To confirm the cell surface display of lipase, the protease accessi-
bility tests with different kind of proteases were done. In Proteinase K
accessibility test, harvested yeasts were washed three times, re-
suspended in a 15 mM Tris−HCl buffer with pH = 7.8 and adjusted to
Table 1
Primers used in this study (Fw: Forward, Re: Reverse).
Primers Sequence (5’-3’)
Lip-Fw GGTTCTGATACTGCTGATTTC
Lip-Re CTCAGAGTTCAAAGATTCCAA
26s-Fw CGTAGCATACAACCAATCTTC
26s-Re CACGCACTGTTTCACTCTCT
ARG4-Fw TTGAGGGGTAAATCTGGTAG
ARG4-Re CAAAATCGAGTGCTCTACAGT
3
Biochemical Engineering Journal 140 (2018) 1–8
OD600 of 10.0. Proteinase K (0.5 mg/mL) was added to cell suspensions
and treated at 30 °C for 30 min. The reaction was stopped with PMSF to
yield a final concentration of 1 mM. For trypsin protease treatment, the
yeast cells were washed three times with distilled water, resuspended in
PBS and adjusted to OD600 of 10. The cells were treated with trypsin
stock solution (1 mg/mL trypsin) to a final concentration of 50 μg/mL
and incubated for 1 h at 37 °C. Washing the treated cells three times
with PBS, was used to stop the reaction. When papain was used as
protease, the yeast cells collected from the culture medium were wa-
shed twice with distilled water and resuspended in a 50 mM potassium
phosphate buffer containing 2 mM L-cysteine and 12.5 μg/mL papain
until reaching an OD600 of 4. The cells were incubated at 37 °C for 3 h.
The cells treated with different proteases were subjected for determi-
nation of residual lipase activity as described above.
2.8. Assessment of metal ions and detergents on enzyme activity
The effect of K+, Mg2+, Ca2+, Fe2+, Mn2+, Cu2+and Zn2+ ions on
enzyme activity were evaluated by adding metal salts (10 mM) to
standard reaction mixture (90 μL of 16.5 mM pNPP in isopropanol
mixed with 810 μL of 50 mM Tris−HCl pH 8.0, 0.4% Triton X-100,
0.1% Arabic gum and 100 μL of cell suspension). Enzyme activity was
assayed after treatments at 37 °C and pH 8.0 for 15 min.
Effects of several detergents on the enzyme activity were assayed by
replacing the same amount of Triton X-100 of reaction mixture with
Tween-80, Tween-20, SDS and CTAB.
2.9. Enzyme stability assessment
To determine the thermal stability of displayed lipase, the reaction
mixture in pH 8.0 and in the absence of substrate was incubated at
different temperatures of 30 °C, 37 °C, 40 °C, 45 °C and 50 °C for 4 h and
residual activity of enzyme was assayed at 0.5, 1, 2, 3 and 4 h after
incubation.
pH stability of recombinant lipase was assessed by incubating re-
action mixture in 37 °C for 30 min in different pH values after 5, 6, 7, 8,
9 and 10. Residual lipase activity of different treatments were mea-
sured. Phosphate buffer, Tris−HCl buffer and carbonate-bicarbonate
buffer were applied to adjust these pH ranges.
Different organic solvents such as methanol, ethanol, 2- propanol,
acetone, n-hexane and glycerol were used for evaluation of organic
solvent stability of cell surface displayed enzyme. 25% (v/v) of these
solvents were added to reaction mixture individually and incubated at
37 °C and pH 8.0 for 1 h. Residual activities were assayed in standard
conditions.
2.10. Oil extraction from microalgae powder and determination of fatty
acid profile
50 mg of Spirulina platensis microalgae dry powder (bought from
Marine Expert of Stars Valley Co., Iran) was mixed with 20 mL of
deionized water and the cell wall was broken with sonication (200 W,
ultrasonic 10 s, intermittent 1 min, 20 times). Broken cells were mixed
with a two-phase chloroform/methanol solvent and placed in a shaker
incubator (200 rpm, 30 min) to form two layers. The mixture was
centrifuged at 6000 ×g for 10 min and the lower layer containing
solvent and oil was evaporated at room temperature. The extracted oil
was subjected to analysis by GC-FID for determination of fatty acid
profiles.
2.11. Biodiesel preparation in repeated batch cycles
0.1 M phosphate buffer with pH 7.0 was added to a 50 mL screw cap
bottle containing 2 mg of microalgae oil to keep the water content
(water to oil ratio) of 0.5 v/v. Then, 7% (w/v) of the recombinant cells
were used as catalyst and the reaction was carried out in 48 h with
Z. Raoufi, S.L. Mousavi Gargari
constant agitation at 150 rpm and 40 °C. Oil/methanol ratio was
maintained at 1:3 and one third of the methanol was added to the re-
action mixture every time at the intervals of 0 h, 12 h and 24 h. The
reaction mixture was centrifuged at 7000×g for 5 min and supernatant
was analyzed for biodiesel products. The cells were reused to repeat the
process for 10 batches. After end of each reaction, the cells were wa-
shed by isooctane solvent and resuspended in fresh batch to restart
reaction.
2.12. GC analysis
FAMEs in the reaction mixture were analyzed by a GC (6890 N,
Agilent) equipped with a Flame Ionization Detector and BPX-70 capil-
lary column (100 M * 0.22 MM * 0.25 μM; Agilent). The injection port
was kept at 250 °C and the detector port at 280 °C. The temperature of
the oven was started from 160 °C and increased by 15 °C for every two
minutes. The carrier gas was nitrogen with flow rate 1 ml/min.
Obtained chromatograms were analyzed with the help of standard
FAMEs chromatograms.
2.13. Statistical analysis
To determine differences of two group, Independent-Samples t-test
was applied. If the number of group were more than two, One-way
analysis of variance (ANOVA) was applied and when there were sig-
nificant differences between the groups, the Tukey test was employed
to determine which group differed significantly. Differences were con-
sidered significant at P < 0.05. All tests were carried out in SPSS
Version 17, and each of the graphs was plotted in Excel 2013 software.
3. Results and discussion
3.1. Codon optimization and vector construction
The Lip A gene from P. aeroginusa with a sequence of 936 bps was
optimized based on P. pastoris codon usage by “GenScript” service to
increase the rate of expression (supplementary file). Because, the native
gene employs tandem rare codons that can reduce the efficiency of
translation or even disengage the translational machinery. The Codon
Adaptation Index (CAI) represents the predicted expression level of a
gene. This service upgraded the CAI from 0.52 to 0.94. A CAI of 1.0 is
considered as perfect in the desired expression organism and a CAI
of > 0.8 is regarded as good in terms of high gene expression level. GC
content and unfavorable peaks were optimized to prolong the half-life
of the mRNA. GC% was adjusted from 40.61 to 66.07 based on GC
content in highly expressed genes in P. pastoris.
Target protein can be displayed on the cell surface by fusion to ei-
ther the C- or N-terminal domains of various cell wall proteins [38]. For
the construction of the cassette in the present work, due to the presence
of the active site of the lipase enzyme near the N-terminal, Gcw61 was
fused to the C-terminal of the target gene through its N-terminal and
successfully displayed on the host cell surface.
3.2. Recombinant lipase expression
Among all positive colonies, the clone with highest lipase activity
was selected to carry out additional experiments. The lipase activity
was assayed daily for 6 days after induction by methanol (Fig. 1). The
enzyme activity was increased until 120 h with highest value 85.2 U/
mg dry cell weight. This is the first time that the P. aeruginosa lipase
gene (Lip A) is being expressed on the P. pastoris X33 cell surface. The
gene was previously expressed only by the use of the foldase gene (Lip
B) in E. coli under T7 promoter [30], because Lip A belongs to class III
pseudomonas lipases and requires a supplement gene for expression in E.
coli [39]. In our display system, the Lip A gene was successfully ex-
pressed on the yeast surface under AOX1 promoter without using any
4
Biochemical Engineering Journal 140 (2018) 1–8
Fig. 1. Lipase activity (U/mg dry cell weight) assay in different incubation
times by methanol induction. The highest activity was observed in 120 h for
Clone, 14.
supplement. The high activity of lipase can be due to the capabilities of
the yeast expressive system. A formation of insoluble and inactive in-
clusion bodies for many recombinant proteins expressed in E. coli, such
as SIK W1 lipase from P. fluorescens28 [40] and Lip M from P. mor-
aviensis M929 [41] is reported. Efforts have been made to achieve the
high expression with proper activation of Pseudomonas lipases [42], but
only the co-expression of Lip B especially with Lip A from Pseudomonas
aeruginosa was successful [30].
“Based on the results shown in Fig. 1, lipase activity decreased after
120 h. This can be due to the proteolytic degradation of displayed re-
combinant lipase on the cell surface, a usual problem with yeasts when
are employed to express recombinant proteins [43,44]. Methanol as an
inducer of AOX1 promoter also makes conditions like oxidative stress,
which trigger excess vacuolar protease production to the culture
medium leading to proteolytic degradation of recombinant proteins
exposed to this enzyme [45]. The proteolytic activity increases with the
time of induction as well as the growth rate on methanol. This is im-
portant to assess the optimum induction time for recombinant protein
production [46]. In our study, lipase activity increased with time of
induction till 120 h which is naturally due to the growth rate and cell
density then decreased indicating that the optimum induction time for
recombinant lipase production is 120 h.
3.3. Lipase expression analysis and copy number determination
Real time PCR confirmed Lip A gene expression in P. pastoris X33
with 2.09 ± 0.06 gene copy numbers. There is a correlation between
gene copy number and expression level. Huang and colleagues (2014)
proved that the lipase activity in the strains with 2 lipase gene copies
were higher than the strains with 4 or 8 copies. In strains with more
copies of inserted gene, the UPR (unfolded protein response-related
gene) system is somehow unable to improve the protein folding and
consequence enzyme activity or secretion of the enzyme. It seems that
higher expression of the recombinant protein as a result of high gene
copy number create high stress which cannot be relieved by upregu-
lation of UPR related genes [47]. Therefore, it can be predicted that the
copy numbers of the Lip A gene in this study is almost optimal.
3.4. Protease accessibility assays
Protease accessibility tests were applied with three protease to de-
termine the localization of the Lip A fusion proteins. The results are
presented in Fig. 2. Markedly, reduced activity was observed in all three
treatments including proteinase K (95.86%), trypsin (96.96%) and pa-
pain by 97.69% (P < 0.05). These results proved that a large portion of
the lipase enzyme was located on the surface of the yeast cell that was
readily available to proteases. Reduced activity of other cell surface
displayed enzymes were also reported when treated with papain and
trypsin [48,49].
Z. Raoufi, S.L. Mousavi Gargari
Fig. 2. Lipase activity (U/mg dry cell weight) assay before and after treatments
with Three proteases; Proteinase K, trypsin and papain. Asterisks show sig-
nificant difference of lipase activity between before and after protease treat-
ments. (*** p < 0.001).
3.5. Biochemical characterization and stability
The effects of various metal ions on the activity of lipase displayed
on cell surface is exhibited in Fig. 3a. The Mg2+, Cu2+, Ca2+ and Mn2+
ions increased the enzyme activity by 23.5%, 25. 2%, 38.4% and
24.3%, respectively. On the contrary, Zn2+ and Fe2+ markedly in-
hibited this enzyme activity (P < 0.05). Our results are in consistent
with previous studies carried out by Qiao et al. [50,51]. Also, Mg2+,
Ca2+ and Zn2+ treatments with lipase from P. aeruginosa FW_SH-1
exhibited similar patterns [52]. Moreover, lipase from P. fluorescens
Pf0–1 was activated by Mg2+and Ca2+ and inhibited by Zn2+ and Fe2+
ions [32]. Similar to Pf0–1 [32], the activity of Lip A may also be
calcium ion dependent.
Crystallographic study of the lipA, shows a calcium binding pocket
close to the catalytic site of the enzyme [53] which may suggest the
Ca2+ dependence of the enzyme activity.
The activation by Ca2+ can also be justified by the synthesis of fatty
acid calcium salts, which could led to positive hydrolysis of the esters
[51]. The variation in lipase activity, in presence of different metal ions,
could be due to the conformational changes occurred in lipase on in-
teracting with different metal ions [54].
The effect of different surfactants on the enzyme activity is pre-
sented in Fig. 3b. All surfactants replaecd with Triton X-100 in the re-
action mixture greatly decreased recombinant lipase activity. The en-
zyme activity was reduced (P < 0.05) by 84.71%, 49.47%, 43.46%
and 63.83% for Tween 80, Tween 20, CTAB and SDS, respectively. Si-
milar results were observed by Yan et al. [55] and Qiao et al. [51]. In
the case of SDS, this ionic detergent affects enzymes disulfide bonds and
reduces its function [56]. Generally, non-ionic surfactants such as
Tween 20, Tween 40, Tween 60, Tween 80, and NP-40 and ionic sur-
factants like SDS and CTAB, decrease the lipases activity [57]. De-
tergents can attach to lipases and alter their 3D structure, leading to
their inhibition [58].
The stability of the recombinant enzyme was tested at different
temperatures 30 °C, 37 °C, 40 °C, 45 °C and 50 °C for 4 h (Fig. 4a). The
enzyme was completely active at 37 °C and 40 °C after two hours. The
enzyme lost 50% of its activity when it was incubated at 30 °C and 45 °C
5
Biochemical Engineering Journal 140 (2018) 1–8
for 3 h while residual activity of the enzyme was decreased by 45.5%,
only after 1 h incubation at 50 °C. Compared to recombinant Lip A with
Lip B in E. coli [30], our yeast surface displayed Lip A showed a better
thermostability. The NetNGlyc server predicted five asparagine at po-
sitions 23, 57, 67, 380 and 392 which can be N-glycosylated. According
to the predicted glycosylation sites, a better thermal stability of the
enzyme could be due to its glycosylation during expression in P. pas-
toris. Expressed proteins in P. pastoris are most glycosylated, and gly-
cosylation is beneficial to the stability of the recombinant proteins [59].
It was also proved that the cell surface display is an efficient technology
to enhance the thermal stability of the enzyme by increasing its struc-
tural stability at the cell surface [60,61].
The stability of the enzyme activity was also measured in different
pH values of 5.0, 6.0, 7.0, 8.0, 9.0 and 10.0 for 30 min. Residual activity
with various treatments is given in Fig. 4b. The recombinant enzyme
retained more than 90% of its activity in pH 9.0 and more than 60% in
pH ranges from 7 to 10. These results were consistent with Wu et al.
results which expressed Lip A in E. coli [30]. Lipases from other Pseu-
domonas sp. such as P. mendocina PK-12CS [62] and P. aeruginosa [63]
also showed good stability over a wide pH range. pH stability indicates
that the Lip A should be alkaline in nature.
Acetone, methanol, ethanol, n-hexane, glycerol and isopropanol as
organic solvents were used to check the stability of recombinant cell
surface lipase at 37 °C and pH 8.0 for 1 h. As shown in Fig. 4c, in pre-
sence of methanol, ethanol, glycerol, iso-propanol and acetone, the
activity of enzyme was maintained more than 80% whereas its activity
was reduced by 38.3% and 27.5% in the presence of chloroform and n-
hexane, respectively (P < 0.05). In general, with compared to hydro-
phobic solvents, the hydrophilic ones cause more unfavorable enzyme
denaturation [64], but our results indicated better lipase stability in the
hydrophilic solvents which is similar to Ali et al. (2016) findings [52].
However, the flexibility of protein conformation is also considered as a
decisive determinant of their function in the presence of organic sol-
vents [65]. High stability of lipase in the polar solvents such as me-
thanol and ethanol, makes it desirable to catalyze transesterification
reaction for biodiesel production [52]. These results demonstrated that
recombinant Lip A has a high potential for application in organic
synthesis and transesterification.
3.6. Determination of fatty acid profile of microalgae oil and biodiesel yield
Two extraction solvent containing Chloroform/Methanol with 1:2
ratio was used for oil extraction from microalgae (Spirulina platensis)
powder. Oil production yield was calculated as 11.85%. Five organic
solvent mixtures were used for extracting lipids from Botryococcus
braunii cells and Chloroform/Methanol gave the highest total lipid yield
[66]. Fatty acid compositions of oil determine the final quality of the
biodiesel due to different chemical characteristics such as the length of
the carbon chain and the degree of their unsaturation [67]. Therefore,
GC was carried out for qualitative and quantitative analysis of fatty
acids contained in microalgae oil. As shown in Fig. 5a, most contents of
fatty acids were oleic (33.7%) and palmitic acids (30.8%). Fatty acid
profile of our extract was similar to that of Chlorella vulgaris oil [68].
Oleic acid, palmitoleic and palmitic acids were measured as the major
Fig. 3. (a) Effect of various metal ions on lipase
activity. Enzyme activity of standard reaction
mixture without any metal ion was set as 100%
(b) Evaluation of different surfactants effects on
Lipase activity %. Enzyme activity in standard
reaction mixture with 0.4% Triton X-100 was
set as 100%. Different characters in columns
show significant differences between groups.
Z. Raoufi, S.L. Mousavi Gargari Biochemical Engineering Journal 140 (2018) 1–8

Fig. 4. (a) Lipase stability assay in different

temperatures. Residual activity of enzyme for
each temperature after 30 min was set as 100%
(b) pH stability of lipase activity at different pH
ranges for 30 min (c) Effect of various organic
solvents on stability of Lipase residual activity
(%). Asterisks show significant difference of
lipase activity between before and after pH and
organic solvents stability treatments.
(*p < 0.05, ** p < 0.01, *** p < 0.001).

contents of fatty acids in the most of microalgae oils [69]. S. platensis oil industrial applications, recycling of lipase is required to reduce the
was not enriched with unsaturated fatty acids such as eicosapentaenoic production costs [18].
(EPA) and docosahexaenoic (DHA) acids, and for this reason this oil is Altogether, our new whole cell biocatalyst revealed a noticeable
desirable for preparation of high-quality biodiesel. Because the fatty advantage in production of biodiesel (FAMEs) from microalgae oil.
acids with ≥4 double bonds such as eicosapentaenoic and docosahex-
aenoic acids are easily oxidized during storage and thus inappropriate
4. Conclusion
as biodiesel components [70].
P. pastoris cells with surface displayed Lip A were applied to cata-
Lipase A from P. aeruginosa was optimized and expressed on the
lyze the biodiesel production from extracted microalgae oil. FAMEs
surface of P. pastoris cells. Biochemical characteristics of the Lip A
yields as biodiesel products which assayed by GC and presented here
presented good potential for biodiesel production and other industrial
indicated that methanolysis reactions were successfully performed by
applications. The whole cell biocatalyst obtained from this study
our whole-cell biocatalyst with cell-surface-displayed Lip A. Biodiesel
showed high operational stability and high yield of biodiesel from ex-
yields of 64.1% and 87.6% were gained after the 24 and 48 h, respec-
tracted microalgae oil.
tively (Fig. 5b). Table 2 is the comparison between our results with
those of free, immobilized and whole cell biocatalysts previously used
for biodiesel production. Although free and immobilized lipases show Declarations of interest
some better yields of biodiesel production, their applications are still
limited due to their high costs [71]. None.
In this study, methanol / oil with 3: 1 ratio was used in the reaction.
Because higher contents of methanol can reduce the efficiency [68]. Funding
Results from reuse of the recombinant cells in 10 repeated batch cycles
indicated high relative biodiesel yields (Fig. 6). This findings suggest This research did not receive any specific grant from funding
high operational stability of the produced enzyme by this study. In agencies in the public, commercial, or not-for-profit sectors.

Fig. 5. (a) Fatty acid profile of extracted oil from Spirulina platensis microalgae (b) Biodiesel yields (%) in different times of methanolysis reaction.

6
Z. Raoufi, S.L. Mousavi Gargari Biochemical Engineering Journal 140 (2018) 1–8

Table 2
Comparison of biodiesel production by different biocatalysts.
Biocatalyst type Lipase origin Reaction period (h) Algal oil Biodiesel yields% Reference

Immobilize lipase Imm-A Aspergilous niger 36 Scenedesmus obliquus 53.76 [27]

Immobilize lipase Candida rugosa 24 Scenedesmus quadricauda 96 [72]
Free enzyme Candida rugosa 24 Scenedesmus quadricauda 85.7 [72]
Lipase GH2-Free Enzyme Rhizomucor miehei 25 Chlorella vulgaris 90 [68]
Whole cell-CalB, CalA Candida antarctica 48 Gracilaria edulis 88.5 [73]
Ulva lactuca 87
Enteromorpha 89
compressa
Whole cell Rhizopus 24 Enteromorpha compressa 83 [74]
oryzae
Whole cell Pseudomonas aeruginosa 48 Spirulina platensis 87.6 This study

[14] R. Aravindan, P. Anbumathi, T. Viruthagiri, Lipase Applications in Food Industry,

Fig. 6. Relative biodisel yield% in 10 repeated batch cycles by whole cell
biocatalyst.
Appendix A. Supplementary data
Supplementary material related to this article can be found, in the
online version, at doi:https://doi.org/10.1016/j.bej.2018.09.008.
References
[1] E.V. Shusta, L.R. Pepper, Y.K. Cho, E.T. Boder, A decade of yeast surface display
technology: where are we now? Comb. Chem. High Throughput Screen. 11 (2008)
127–134.
[2] M. Saleem, H. Brim, S. Hussain, M. Arshad, M. Leigh, Perspectives on microbial cell
surface display in bioremediation, Biotechnol. Adv. 26 (2008) 151–161.
[3] W. Li, H. Shi, H. Ding, L. Wang, Y. Zhang, X. Li, F. Wang, Cell surface display and
characterization of Rhizopus oryzae lipase in Pichia pastoris using Sed1p as an anchor
protein, Curr. Microbiol. 71 (2015) 150–155.
[4] M.V.H. Moura, G.P. da Silva, A.C. de Oliveira Machado, F.A.G. Torres,
D.M.G. Freire, R.V. Almeida, Displaying lipase B fromCandida antarctica in Pichia
pastoris using the yeast surface display approach: Prospection of a new anchor and
characterization of the whole cell biocatalyst, PLoS One 10 (2015) e0141454.
[5] J. Yan, X. Zheng, S. Li, A novel and robust recombinant Pichia pastoris yeast whole
cell biocatalyst with intracellular overexpression of a Thermomyces lanuginosus li-
pase: preparation, characterization and application in biodiesel production,
Bioresour. Technol. 151 (2014) 43–48.
[6] M. Kojima, T. Akahoshi, K. Okamoto, H. Yanase, Expression and surface display of
Cellulomonas endoglucanase in the ethanologenic bacterium Zymobacter palmae,
Appl. Microbiol. Biotechnol. 96 (2012) 1093–1104.
[7] A. Kondo, M. Ueda, Yeast cell-surface display—applications of molecular display,
Appl. Microbiol. Biotechnol. 64 (2004) 28–40.
[8] L. Zhang, S. Liang, X. Zhou, Z. Jin, F. Jiang, S. Han, S. Zheng, Y. Lin, Screening for
glycosylphosphatidylinositol-modified cell wall proteins in Pichia pastoris and their
recombinant expression on the cell surface, Appl. Microbiol. Biotechnol. 79 (2013)
5519–5526.
[9] Y. Liu, R. Zhang, Z. Lian, S. Wang, A.T. Wright, Yeast cell surface display for lipase
whole cell catalyst and its applications, J. Mol. Catal. B Enzym. 106 (2014) 17–25.
[10] A.K. Singh, M. Mukhopadhyay, Overview of fungal lipase: a review, Appl. Biochem.
Biotechnol. 166 (2012) 486–520.
[11] M. Lotti, L. Alberghina, Lipases: molecular structure and function, Industrial
Enzymes, Springer, 2007, pp. 263–281.
[12] C.O. Nwuche, J.C. Ogbonna, Isolation of lipase producing fungi from palm oil mill
effluent (POME) dump sites at Nsukka, Braz. Arch. Biol. Technol. 54 (2011)
113–116.
[13] F. Hasan, A.A. Shah, A. Hameed, Industrial applications of microbial lipases,
Enzyme Microb. Technol. 39 (2006) 235–251.
(2007).
[15] R. Sharma, Y. Chisti, U.C. Banerjee, Production, purification, characterization, and
applications of lipases, Biotechnol. Adv. 19 (2001) 627–662.
[16] K. de Godoy Daiha, R. Angeli, S. de Oliveira, R.V. Almeida, Are lipases still im-
portant biocatalysts? A study of scientific publications and patents for technological
forecasting, PLoS One 10 (2015) 0131624.
[17] A.C. Vici, et al., Beauveria bassiana Lipase A expressed in Komagataella (Pichia)
pastoris with potential for biodiesel catalysis, Front. Microbiol. 6 (2015).
[18] Z. Jin, S.-Y. Han, L. Zhang, S.-P. Zheng, Y. Wang, Y. Lin, Combined utilization of
lipase-displaying Pichia pastoris whole-cell biocatalysts to improve biodiesel pro-
duction in co-solvent media, Bioresour. Technol. 130 (2013) 102–109.
[19] J.R. Almeida, L.C. Fávaro, B.F. Quirino, Biodiesel biorefinery: opportunities and
challenges for microbial production of fuels and chemicals from glycerol waste,
Biotechnol. Biofuels 5 (2012) 48.
[20] R. Luque, J.C. Lovett, B. Datta, J. Clancy, J.M. Campelo, A.A. Romero, Biodiesel as
feasible petrol fuel replacement: a multidisciplinary overview, Energy Environ. Sci.
3 (2010) 1706–1721.
[21] S. Lim, L.K. Teong, Recent trends, opportunities and challenges of biodiesel in
Malaysia: an overview, J. Renew. Sustain. Energy 14 (2010) 938–954.
[22] J. Janaun, N. Ellis, Perspectives on biodiesel as a sustainable fuel, J. Renew. Sustain.
Energy 14 (2010) 1312–1320.
[23] A. Ahmad, N.M. Yasin, C. Derek, J. Lim, Microalgae as a sustainable energy source
for biodiesel production: a review, J. Renew. Sustain. Energy 15 (2011) 584–593.
[24] S. Pinzi, D. Leiva, I. López‐García, M.D. Redel‐Macías, M.P. Dorado, Latest trends in
feedstocks for biodiesel production, Biofuels Bioprod. Biorefin. 8 (2014) 126–143.
[25] M. Balat, H. Balat, Progress in biodiesel processing, Appl. Energy 87 (2010)
1815–1835.
[26] J.-Q. Lai, Z.-L. Hu, P.-W. Wang, Z. Yang, Enzymatic production of microalgal bio-
diesel in ionic liquid [BMIm][PF 6], Fuel 95 (2012) 329–333.
[27] A. Guldhe, P. Singh, S. Kumari, I. Rawat, K. Permaul, F. Bux, Biodiesel synthesis
from microalgae using immobilized Aspergillus niger whole cell lipase biocatalyst,
Renew. Energy 85 (2016) 1002–1010.
[28] G.H. Chung, Y.P. Lee, G.H. Jeohn, O.J. Yoo, J.S. Rhee, Cloning and nucleotide se-
quence of thermostable lipase gene from Pseudomonas fluorescens SIK W1, Agric.
Biol. Chem. 55 (1991) 2359–2365.
[29] K. Liebeton, A. Zonta, K. Schimossek, M. Nardini, D. Lang, B.W. Dijkstra,
M.T. Reetz, K.-E. Jaeger, Directed evolution of an enantioselective lipase, Chem.
Biol. 7 (2000) 709–718.
[30] X. Wu, P. You, E. Su, J. Xu, B. Gao, D. Wei, In vivo functional expression of a
screened P. Aeruginosa chaperone-dependent lipase in E. Coli, BMC Biotechnol. 12
(2012) 58.
[31] C.H. Ali, A.S. Qureshi, S.M. Mbadinga, J.-F. Liu, S.-Z. Yang, B.-Z. Mu, Biodiesel
production from waste cooking oil using onsite produced purified lipase from
Pseudomonas aeruginosa FW_SH-1: central composite design approach, Renew.
Energy 109 (2017) 93–100.
[32] W. Liu, M. Li, Y. Yan, Heterologous expression and characterization of a new lipase
from Pseudomonas fluorescens Pf0–1 and used for biodiesel production, Sci. Rep. 7
(2017) 15711.
[33] Q. Ji, S. Xiao, B. He, X. Liu, Purification and characterization of an organic solvent-
tolerant lipase from Pseudomonas aeruginosa LX1 and its application for biodiesel
production, J. Mol. Catal. B Enzym. 66 (2010) 264–269.
[34] L.P. Christopher, H. Kumar, V.P. Zambare, Enzymatic biodiesel: challenges and
opportunities, Appl. Energy 119 (2014) 497–520.
[35] Z. Gao, Z. Li, Y. Zhang, H. Huang, M. Li, L. Zhou, Y. Tang, B. Yao, W. Zhang, High-
level expression of the Penicillium notatum glucose oxidase gene in Pichia pastoris
using codon optimization, Biotechnol. Lett. 34 (2012) 507–514.
[36] N. Blom, T. Sicheritz‐Pontén, R. Gupta, S. Gammeltoft, S. Brunak, Prediction of
post‐translational glycosylation and phosphorylation of proteins from the amino
acid sequence, Proteomics 4 (2004) 1633–1649.
[37] S. Abad, K. Kitz, A. Hörmann, U. Schreiner, F.S. Hartner, A. Glieder, Real‐time
PCR‐based determination of gene copy numbers in Pichia pastoris, Biotechnol. J. 5
(2010) 413–420.
[38] E.Y. Yuzbasheva, T.V. Yuzbashev, N.I. Perkovskaya, E.B. Mostova, T.V. Vybornaya,
A.V. Sukhozhenko, I.Y. Toropygin, S.P. Sineoky, Cell surface display of Yarrowia
lipolytica lipase Lip2p using the cell wall protein YlPir1p, its characterization, and

7
Z. Raoufi, S.L. Mousavi Gargari
application as a whole-cell biocatalyst, Appl. Environ. Microbiol. 175 (2015)
3888–3900.
[39] N. Oshima-Hirayama, K. Yoshikawa, T. Nishioka, Lipase from Pseudomonas aerugi-
nosa, FEBS J. 215 (1993) 239–246.
[40] Y.P. Lee, G.H. Chung, J.S. Rhee, Purification and characterization of Pseudomonas
fluorescens SIK W1 lipase expressed in Escherichia coli, Biochim. Biophys. Acta Lipids
Lipid Metab. 1169 (1993) 156–164.
[41] W. Yang, H. Cao, L. Xu, H. Zhang, Y. Yan, A novel eurythermic and thermostale
lipase LipM from Pseudomonas moraviensis M9 and its application in the partial
hydrolysis of algal oil, BMC Biotechnol. 15 (2015) 94.
[42] S. Jørgensen, K. Skov, B. Diderichsen, Cloning, sequence, and expression of a lipase
gene from Pseudomonas cepacia: lipase production in heterologous hosts requires
two Pseudomonas genes, J. Bacteriol. 173 (1991) 559–567.
[43] K. Kobayashi, S. Kuwae, T. Ohya, T. Ohda, M. Ohyama, H. Ohi, K. Tomomitsu,
T. Ohmura, High-level expression of recombinant human serum albumin from the
methylotrophic yeast Pichia pastoris with minimal protease production and activa-
tion, J. Biosci. Bioeng. 89 (2000) 55–61.
[44] J.A. Gimenez, D.D. Monkovic, M.L. Dekleva, Identification and monitoring of
protease activity in recombinant Saccharomyces cerevisiae, Biotechnol. Bioeng. 67
(2000) 245–251.
[45] T.H. Stevens, J.H. Rothman, G.S. Payne, R. Schekman, Gene dosage-dependent
secretion of yeast vacuolar carboxypeptidase Y, J. Cell Biol. 102 (1986) 1551–1557.
[46] J. Sinha, B.A. Plantz, M. Inan, M.M. Meagher, Causes of proteolytic degradation of
secreted recombinant proteins produced in methylotrophic yeast Pichia pastoris:
Case study with recombinant ovine interferon-τ, Biotechnol. Bioeng. 89 (2005)
102–112.
[47] J. Huang, J. Xia, Z. Yang, F. Guan, D. Cui, G. Guan, W. Jiang, Y. Li, Improved
production of a recombinant Rhizomucor miehei lipase expressed in Pichia pastoris
and its application for conversion of microalgae oil to biodiesel, Biotechnol.
Biofuels 7 (2014) 111.
[48] T. Tanino, T. Ohno, T. Aoki, H. Fukuda, A. Kondo, Development of yeast cells
displaying Candida antarctica lipase B and their application to ester synthesis re-
action, Appl. Microbiol. Biotechnol. 75 (2007) 1319–1325.
[49] H.-J. Ko, E. Park, J. Song, T.H. Yang, H.J. Lee, K.H. Kim, I.-G. Choi, Functional cell
surface display and controlled secretion of diverse agarolytic enzymes by
Escherichia coli with a novel ligation-independent cloning vector based on the au-
totransporter YfaL, Appl. Environ. Microbiol. 78 (2012) 3051–3058.
[50] H. Qiao, F. Zhang, W. Guan, J. Zuo, D. Feng, Optimisation of combi‐lipases from
Aspergillus niger for the synergistic and efficient hydrolysis of soybean oil, Anim. Sci.
J. 88 (2017) 772–780.
[51] H. Qiao, W. Zhang, W. Guan, F. Chen, S. Zhang, Z. Deng, Enhanced expression of
lipase I from Galactomyces geotrichum by codon optimisation in Pichia pastoris,
Protein Expr. Purif. 138 (2017) 34–45.
[52] C. Ali, A. Qureshi, S. Mbadinga, J. Liu, S. Yang, B. Mu, Organic solvent tolerant
lipase from Pseudomonas aeruginosa FW_SH-1: purification and characterization,
JSM Enzym. Prot. Sci 1 (2016) 1005.
[53] M. Nardini, D.A. Lang, K. Liebeton, K.-E. Jaeger, B.W. Dijkstra, Crystal structure of
pseudomonas aeruginosa lipase in the open conformation THE prototype for family I.
1 of bacterial lipases, J. Biol. Chem. 275 (2000) 31219–31225.
[54] N. Nawani, N.S. Dosanjh, J. Kaur, A novel thermostable lipase from a thermophilic
Bacillus sp.: characterization and esterification studies, Biotechnol. Lett. 20 (1998)
997–1000.
[55] J. Yan, J. Yang, L. Xu, Y. Yan, Gene cloning, overexpression and characterization of
a novel organic solvent tolerant and thermostable lipase from Galactomyces
Biochemical Engineering Journal 140 (2018) 1–8
geotrichum Y05, J. Mol. Catal. B Enzym. 49 (2007) 28–35.
[56] V. Kukreja, M. Bera, Lipase From Pseudomonas aeruginosa MTCC 2488: Partial
Purification, Characterization and Calcium Dependent Thermostability, (2005).
[57] H. Shao, L. Xu, Y. Yan, Thermostable lipases from extremely radioresistant bac-
terium Deinococcus radiodurans: cloning, expression, and biochemical character-
ization, J. Basic Microbiol. 54 (2014) 984–995.
[58] B. Ranjan, T. Satyanarayana, Recombinant HAP phytase of the thermophilic mold
Sporotrichum thermophile: expression of the codon-optimized phytase gene in Pichia
pastoris and applications, Mol. Biotechnol. 58 (2016) 137–147.
[59] S.-J. Tang, J.-F. Shaw, K.-H. Sun, G.-H. Sun, T.-Y. Chang, C.-K. Lin, Y.-C. Lo, G.-
C. Lee, Recombinant expression and characterization of the Candida rugosa lip4
lipase in Pichia pastoris: comparison of glycosylation, activity, and stability, Arch.
Biochem. Biophys. 387 (2001) 93–98.
[60] G.-d. Su, X. Zhang, Y. Lin, Surface display of active lipase in Pichia pastoris using
Sed1 as an anchor protein, Biotechnol. Lett. 32 (2010) 1131–1136.
[61] Y.P. Chen, I.E. Hwang, C.J. Lin, H.J. Wang, C.P. Tseng, Enhancing the stability of
xylanase from Cellulomonas fimi by cell‐surface display on Escherichia coli, J. Appl.
Microbiol. 112 (2012) 455–463.
[62] U.K. Jinwal, U. Roy, A.R. Chowdhury, A. Bhaduri, P. Roy, Purification and char-
acterization of an alkaline lipase from a newly isolated Pseudomonas mendocina PK-
12CS and chemoselective hydrolysis of fatty acid ester, Bioorg. Med. Chem. 11
(2003) 1041–1046.
[63] I. Karadzic, A. Masui, L.I. Zivkovic, N. Fujiwara, Purification and characterization of
an alkaline lipase from Pseudomonas aeruginosa isolated from putrid mineral cutting
oil as component of metalworking fluid, Bioorg. Med. Chem. 102 (2006) 82–89.
[64] C.-H. Shu, C.-J. Xu, G.-C. Lin, Purification and partial characterization of a lipase
from Antrodia cinnamomea, Process Biochem. 41 (2006) 734–738.
[65] A.M. Klibanov, Why are enzymes less active in organic solvents than in water?
Trends Biotechnol. 15 (1997) 97–101.
[66] S.J. Lee, B.-D. Yoon, H.-M. Oh, Rapid method for the determination of lipid from the
green alga Botryococcus braunii, Biotechnol. Technol. 12 (1998) 553–556.
[67] E.A. Mahmoud, L.A. Farahat, Z.K.A. Aziz, N.A. Fatthallah, R.A.S. El Din, Evaluation
of the potential for some isolated microalgae to produce biodiesel, Egypt, J. Pet 24
(2015) 97–101.
[68] J. Huang, J. Xia, W. Jiang, Y. Li, J. Li, Biodiesel production from microalgae oil
catalyzed by a recombinant lipase, Bioresour. Technol. 180 (2015) 47–53.
[69] G. Knothe, “Designer” biodiesel: optimizing fatty ester composition to improve fuel
properties, Energy Fuels 22 (2008) 1358–1364.
[70] Y. Chisti, Biodiesel from microalgae, Biotechnol. Adv. 25 (2007) 294–306.
[71] A. Robles-Medina, P. González-Moreno, L. Esteban-Cerdán, E. Molina-Grima,
Biocatalysis: towards ever greener biodiesel production, Biotechnol. Adv. 27 (2009)
398–408.
[72] G. Bayramoglu, A. Akbulut, V.C. Ozalp, M.Y. Arica, Immobilized lipase on micro-
porous biosilica for enzymatic transesterification of algal oil, Chem. Eng. Res. Des.
95 (2015) 12–21.
[73] B. Bharathiraja, R.R. Kumar, R. PraveenKumar, M. Chakravarthy, D. Yogendran,
J. Jayamuthunagai, Biodiesel production from different algal oil using immobilized
pure lipase and tailor made rPichia pastoris with Cal A and Cal B genes, Bioresour.
Technol. 213 (2016) 69–78.
[74] B. Bharathiraja, R.R. Kumar, M. Chakravarthy, D. Yogendran, J. Jayamuthunagai,
R.P. Kumar, D. Yuvaraj, S. Palani, Analysis of reaction parameters for the transes-
terification of algal oil from Enteromorpha compressa using purified lipase and whole
cell biocatalyst, J. Chem. Pharm. Res. 7 (2015) 395–410.