Cell Metabolism

Short Article

Loss of Autophagy Diminishes Pancreatic b Cell

Mass and Function with Resultant Hyperglycemia
Hye Seung Jung,1 Kun Wook Chung,1 Jeong Won Kim,1 Jin Kim,2 Masaaki Komatsu,3,4,5 Keiji Tanaka,3
Yen Hoang Nguyen,6 Tong Mook Kang,6 Kun-Ho Yoon,7 Ji-Won Kim,7 Yeon Taek Jeong,1 Myoung Sook Han,1
Moon-Kyu Lee,1 Kwang-Won Kim,1 Jaekyoon Shin,8 and Myung-Shik Lee1,*
1Department of Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, 50 Irwon-dong Kangnam-ku,

Seoul 135-710, Korea

2Department of Anatomy and Cell Death Disease Research Center, College of Medicine, The Catholic University of Korea,

505 Banpo-dong, Seocho-ku, Seoul 137-701, Korea

3Laboratory of Frontier Science, Tokyo Metropolitan Institute of Medical Science, Bunkyo-ku, Tokyo 113-8613, Japan
4Department of Biochemistry, Juntendo University School of Medicine, Bunkyo-ku, Tokyo 113-8421, Japan
5PRESTO, Japan Science and Technology Corporation, Kawaguchi 332-0012, Japan
6Department of Physiology, Sungkyunkwan University School of Medicine, Suwon 440-746, Korea
7Department of Endocrinology and Metabolism, College of Medicine, The Catholic University of Korea, 505 Banpo-dong,

Seocho-ku, Seoul 137-701, Korea

8Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, Suwon 440-746, Korea

*Correspondence: mslee0923@skku.edu
DOI 10.1016/j.cmet.2008.08.013

SUMMARY amino acid retrieval (Lum et al., 2005). Paradoxically, autophagy

Autophagy is a cellular degradation-recycling sys-
tem for aggregated proteins and damaged organ-
elles. Although dysregulated autophagy is implicated
in various diseases including neurodegeneration, its
role in pancreatic b cells and glucose homeostasis
has not been described. We produced mice with
b cell-specific deletion of Atg7 (autophagy-related 7).
Atg7 mutant mice showed impaired glucose toler-
ance and decreased serum insulin level. b cell
mass and pancreatic insulin content were reduced
because of increased apoptosis and decreased pro-
liferation of b cells. Physiological studies showed
reduced basal and glucose-stimulated insulin secre-
tion and impaired glucose-induced cytosolic Ca2+
transients in autophagy-deficient b cells. Morpho-
logic analysis revealed accumulation of ubiquitinated
protein aggregates colocalized with p62, which was
accompanied by mitochondrial swelling, endoplas-
mic reticulum distension, and vacuolar changes in
b cells. These results suggest that autophagy is
necessary to maintain structure, mass and function
of pancreatic b cells, and its impairment causes
insulin deficiency and hyperglycemia because of ab-
normal turnover and function of cellular organelles.
INTRODUCTION
Macroautophagy (here referred to as autophagy) is a dynamic
process involving the rearrangement of subcellular membranes
to sequester cytoplasm and organelles for delivery to lyso-
somes, where the sequestered material is degraded and re-
cycled (Klionsky and Emr, 2000). Autophagy is activated during
nutrient deprivation to promote cell survival and to increase
also represents a form of nonapoptotic cell death and is called as
‘‘type 2 programmed cell death’’ (Boya et al., 2005). Thus, au-
tophagy may either promote cell death through excessive degra-
dation of cellular constituents or protect cells from cell death by
providing essential nutrients and removing damaged organelles
during cellular stress, depending on the cellular and environmen-
tal context. Because autophagy degrades unnecessary or dys-
functional organelles such as mitochondria and rejuvenates their
function, autophagy is expected to play important roles in the
development and the maintenance of physiological function of
normal tissues (Klionsky and Emr, 2000). In fact, disruption of
autophagic process leads to failure of cavitation during embryo-
genesis (Qu et al., 2007) or accumulation of abnormal mitochon-
dria in adult tissues (Komatsu et al., 2005). In addition to the
physiological roles, dysregulated autophagy may play pathoge-
netic roles in diverse disease processes. Targeted disruption of
autophagy genes in specific tissues induced neurodegeneration
(Hara et al., 2006; Komatsu et al., 2006) or cardiomyopathy, par-
ticularly when cellular stress is increased, which is probably due
to accumulation of damaged molecules and organelles (Nakai
et al., 2007). Other studies revealed important roles for auto-
phagy in eradication of microbes, antigen presentation, tumor
suppression (Levine and Kroemer, 2008), and endoplasmic retic-
ulum (ER) stress responses (Yorimitsu et al., 2006; Ogata et al.,
2006).
Type 2 diabetes (T2D) is characterized by abnormal regulation
of nutrients and their metabolites that develops as a conse-
quence of combined insulin resistance and relative insulin defi-
ciency. Insulin and its downstream molecules such as mTOR/
S6K1 are well-known inhibitors of autophagy (Blommaart et al.,
1995), whereas glucagon, a counterregulatory hormone of insu-
lin, induces autophagy (Ashford and Porter, 1962). Because T2D
critically depends on the metabolism of nutrients, insulin action,
and its counterregulation, dysregulated autophagy may play
a role in the pathogenesis of T2D. Furthermore, cellular organ-
elles that play crucial roles in b cell survival, death, insulin secre-
tion, and insulin action, or sensitivity, such as mitochondria

318 Cell Metabolism 8, 318–324, October 8, 2008 ª2008 Elsevier Inc.

Cell Metabolism
Autophagy in Pancreatic b Cells

Figure 1. Production of b Cell-Specific Atg7 Knockout (Atg7Db cell) Mice

(A) Atg7F/F mice were bred with RIP-Cre mice to produce Atg7Db cell mice. Top: PCR analysis with genomic DNA from isolated pancreatic islet cells and primers
flanking the floxed region was done to confirm Cre-mediated recombination in Atg7Db cell mice. In Atg7F/F mice, the size of the PCR product was larger than that in
wild-type mice because of the inserted Flox sequence. Bottom: RT-PCR was conducted with total RNA from primary islet cells and specific primers to examine
Atg7 expression.
(B) Number and area of autophagosomes with double-membrane vacuole-like structure representing steady-state autophagy level were measured in pancreatic
b cells of overnight fasted animals by EM (n = 2 each). Twenty random spots (total 2000–2400 mm2) were scanned per mouse.
(C) Body weight of Atg7Db cell mice and littermates. Representative data from mice between 6 and 20 weeks of age are presented (n = 15 each).
(D) Random blood glucose level was measured with a glucometer (*, p < 0.05 versus Atg7F/F and Atg7F/W:Cre+ mice; n = 15 each).
(E) IPGTT was done at 20 weeks of age by intraperitoneal injection of 1 g/kg glucose (*, p < 0.01 versus Atg7F/F and Atg7F/W:Cre+ mice; #, p < 0.01 between Atg7F/F
and Atg7F/W:Cre+ mice; n = 15 each).
(F) Fasting serum insulin level in vivo was measured by radioimmunoassay (*, p < 0.05 versus Atg7F/F and Atg7F/W:Cre+ mice; n = 15 each).
In (B)–(F), error bars represent the SEM.

(Petersen et al., 2004; Rodriguez-Enriquez et al., 2006; Maechler
and Wollheim, 1999) and ER (Bernales et al., 2007; Laybutt et al.,
2007; Ozcan et al., 2006), rely on autophagy for proper function.
All these findings suggest the possibility that autophagy is in-
volved in diabetes by controlling hormone action and organelle
function. However, the relationship between autophagy and dia-
betes has been hardly studied (Marsh et al., 2007; Kaniuk et al.,
2007), partly because of lack of proper animal models. We con-
ducted this investigation to examine the role of autophagy in
b cell function and glucose homeostasis using a tissue-specific
knockout mouse model.
RESULTS AND DISCUSSION
Production of b Cell-Specific Atg7 Knockout Mice
By crossing Atg7-floxed mice (Atg7F/F) (Komatsu et al., 2005,
2006) with RIP-Cre mice, we generated b cell-specific Atg7
knockout mice (Atg7Db cell). PCR analysis confirmed deletion of
floxed sequence in genomic DNA from primary islet cells of
Atg7Db cell mice (Figure 1A, top). When we studied Atg7 mRNA
expression by RT-PCR analysis, it was undetectable in pancre-
atic islet cells of Atg7Db cell mice. In islet cells of Atg7F/W:Cre+
mice, Atg7 expression was slightly decreased compared to lit-
termate Atg7F/F mice (Figure 1A, bottom). Accordingly, the num-
ber and area of starvation-induced autophagosomes measured
by electron microscopy (EM) were markedly decreased in
pancreatic b cells of Atg7Db cell mice compared to Atg7F/F mice
(Figure 1B).
Impaired Glucose Tolerance in b Cell-Specific Atg7
Knockout Mice
Up to 1 yr after birth, Atg7Db cell mice were indistinguishable in
appearance and growth from age-matched controls: Atg7F/F
and Atg7F/W:Cre+ littermates (Figure 1C). However, significant
increases in random glucose level were detected in Atg7Db cell
mice since 8 weeks of age (Figure 1D). Intraperitoneal glucose
tolerance test (IPGTT) at 20 weeks of age disclosed significant
glucose intolerance in Atg7Db cell mice. Atg7F/W:Cre+ mice

Cell Metabolism 8, 318–324, October 8, 2008 ª2008 Elsevier Inc. 319


showed no difference from Atg7F/F mice in random or fasting glu-
cose level. However, IPGTT revealed impaired glucose tolerance
in Atg7F/W:Cre+ mice, although less prominent than that of
Atg7Db cell mice (Figure 1E). Fasting serum insulin concentration
was significantly lower in Atg7Db cell mice than in control mice (p <
0.05 versus Atg7F/F and Atg7F/W:Cre+ mice) (Figure 1F), suggest-
ing that insulin deficiency is responsible for the impaired glucose
tolerance in Atg7Db cell mice. We also measured body weight and
glucose and insulin levels of RIP-Cre mice, which were not signif-
icantly different from those of Atg7F/F mice (data not shown) as
reported (Fex et al., 2007; Kim et al., 2007).
Morphological Changes of Atg7-Deficient b Cells
Next, we conducted morphological analysis of pancreatic islets
of Atg7Db cell mice. Microscopic examination after hematoxylin
and eosin (H&E) staining showed frequent vacuolated cells in
islets of Atg7Db cell mice (Figure 2A), which were not found in con-
trol mice. Some of the vacuolated cells contained insulin+ mate-
rials. Relative b cell mass estimated by point counting after insu-
lin immunohistochemistry (IHC) was significantly reduced to
about 40% that of control mice (1.20% ± 0.32% in Atg7F/F,
1.32% ± 0.09% in Atg7F/W:Cre+, and 0.56% ± 0.06% in Atg7Db cell
mice; p < 0.05 versus Atg7F/F and Atg7F/W:Cre+ mice) (Figure 2B).
When we examined b cell apoptosis using TUNEL staining com-
320 Cell Metabolism 8, 318–324, October 8, 2008 ª2008 Elsevier Inc.
Cell Metabolism
Autophagy in Pancreatic b Cells
Figure 2. Morphological and Functional
Changes in b Cells of Atg7Db cell Mice
(A) H&E staining showing variable-sized vacuo-
lated cells in pancreatic islets of Atg7Db cell mice
(arrows) that are similar in morphology to the de-
generation of autophagy-deficient hepatocytes
(Komatsu et al., 2005). Some vacuolated cells
stained positive for insulin.
(B) Paraffin-embedded pancreatic sections were
subjected to insulin IHC, and relative b cell area
was determined by point counting (*, p < 0.05 ver-
sus Atg7F/F and Atg7F/W:Cre+ mice; n = 9 each).
(C) Combined insulin IHC and TUNEL staining was
done to count apoptotic b cell number/islet (*, p <
0.05 versus Atg7F/F and Atg7F/W:Cre+ mice; n = 9
each). Representative apoptotic b cells are shown
(arrow heads).
(D) Double IHC for insulin and BrdU after intraper-
itoneal injection of BrdU was conducted for the
evaluation of b cell proliferation (p < 0.05 by
ANOVA; *, p < 0.05 versus Atg7F/F mice by post
hoc analysis; n = 9 each).
(E) Pancreatic insulin was extracted by acid-
ethanol, and insulin content was measured by
radioimmunoassay (*, p < 0.001 versus Atg7F/W:
Cre+ mice; n = 8 each).
(F) Insulin secretion ex vivo. Pancreatic islets from
20-week-old mice (n = 3 each) were incubated in
KRBB containing 3.0 mM glucose for 1 hr and
then in KRBB containing 16.7 mM glucose for
1 hr. Buffer was collected for insulin radioimmuno-
assay. Results are representative of two indepen-
dent experiments performed in triplicate (*, p <
0.05 versus Atg7F/F and Atg7F/W:Cre+ mice; #,
p < 0.05 versus Atg7F/F mice).
(G) Glucose-induced Ca2+ transients in isolated is-
lets (n = 5 each). [Ca2+]c was determined in Tyrode
solution containing 3.0 or 16.7 mM glucose (36 C).
In (B)–(F), error bars represent the SEM.
bined with insulin IHC to study the mechanism of decreased
b cell mass in Atg7Db cell mice, a significant increase of b cell ap-
optosis was found in Atg7Db cell mice compared to control mice
(0 ± 0/islet in Atg7F/F, 0.012 ± 0.009/islet in Atg7F/W:Cre+, and
0.079 ± 0.029/islet in Atg7Db cell mice; p < 0.05 versus Atg7F/F
and Atg7F/W:Cre+ mice) (Figure 2C). We also studied whether au-
tophagy is involved in b cell proliferation that occurs at a low level
but is important for the maintenance of b cell mass (Dor et al.,
2004). BrdU+ b cell number/islet representing b cell proliferation
was significantly reduced in Atg7Db cell mice (0.100 ± 0.039/islet
in Atg7F/F, 0.072 ± 0.016/islet in Atg7F/W:Cre+, and 0.008 ±
0.006/islet in Atg7Db cell mice; p < 0.05 versus Atg7F/F mice)
(Figure 2D), suggesting that both increased apoptosis and de-
creased proliferation contribute to the decreased b cell mass
of Atg7Db cell mice. Consistent with the decreased b cell mass, in-
sulin content in the pancreas of Atg7Db cell mice was significantly
lower than that in the pancreas of control Atg7F/W:Cre+ mice
(Figure 2E). In contrast to the b cell changes, a and d cells of
Atg7Db cell mice evaluated by IHC for glucagon and somatostatin
were not different in morphology or distribution from those of
control mice (data not shown). The molecular mechanism of
the increased apoptosis and decreased proliferation of auto-
phagy-deficient b cells is unknown. The inhibition of autophagy
may results in a shortage of bioenergetic sources such as
Cell Metabolism
Autophagy in Pancreatic b Cells
Figure 3. Accumulation of Ubiquitin Aggregates in b Cells of Atg7Db cell Mice
(A) Pancreatic sections were subjected to IHC for ubiquitin and p62.
(B) Double immunofluorescent staining for ubiquitin (red) and p62 (green) was done, and confocal microscopy was employed so that their colocalization would be
examined. Hoechst staining was applied for identification of nuclei (blue). (Arrowheads, yellow color after merge, indicating colocalization of ubiquitin and p62.)
NADPH2 and ATP that may trigger apoptosis, presumably
through a direct effect on mitochondria, or deinhibit the activa-
tion of caspases or permeabilization of mitochondrial outer
membrane (Maiuri et al., 2007). p27 activated by metabolic
stress and energy deficiency may also lead to cell-cycle arrest
and decreased proliferation (Liang et al., 2007). Morphological
or functional changes of ER leading to ER stress response ob-
served in autophagy-deficient cells (Nakai et al., 2007; see EM
pictures below) may also play a role in the increased apoptosis
and decreased proliferation of b cells observed in Atg7Db cell
mice (Harding et al., 2001; Wu and Kaufman, 2006; Zhang
et al., 2006). Hence, constitutive turnover of proteins and organ-
elles might be important not only for the maintenance of organ-
elle function and cell viability but also for supply of basic nutrients
that are necessary for low-grade proliferation of b cells.
Functional Changes of Atg7-Deficient b Cells
We next conducted functional analysis of pancreatic islets from
Atg7Db cell mice. When we measured insulin secretion ex vivo us-
ing the same number of viable primary islets of similar size after
excluding apparently damaged or nonviable cells, basal insulin
secretion was significantly decreased in Atg7Db cell mice com-
pared to control mice (p < 0.05 versus Atg7F/F and Atg7F/W:
Cre+ mice). High glucose-stimulated insulin secretion from pri-
mary islets of Atg7Db cell mice was also significantly reduced
compared to control mice (p < 0.05 versus Atg7F/F and Atg7F/W:
Cre+ mice) (Figure 2F). Glucose-stimulated insulin secretion was
also compromised in primary islets of Atg7F/W:Cre+ mice (p <
0.05 versus Atg7F/F mice), while less pronounced compared to
Atg7Db cell mice. We next measured glucose-induced changes
of cytosolic Ca2+ concentration ([Ca2+]c) in viable islet cells to in-
Cell Metabolism 8, 318–324, October 8, 2008 ª2008 Elsevier Inc. 321
vestigate whether autophagy affects intracellular pathway regu-
lating insulin secretion in response to glucose. Tracing of [Ca2+]c
showed that glucose-induced cytosolic Ca2+ transients were
defective in primary islet cells from Atg7Db cell mice (Figure 2G),
suggesting that b cell function is impaired even in apparently
healthy viable b cells from Atg7Db cell mice and that autophagy
is necessary for physiological function of b cells. Some islet cells
isolated from Atg7Db cell mice showing ‘‘damaged’’ appearance
had increased basal [Ca2+]c (data not shown), suggesting more
severe defects in Ca2+ handling.
Ubiquitinated Aggregates Colocalized with p62
in Atg7-Deficient b Cells
We next conducted ubiquitin IHC to study possible accumula-
tion of ubiquitinated proteins by genetic ablation of b cell
autophagy because polyubiquitinated proteins are reportedly
degraded by autophagy (Hara et al., 2006; Nakai et al., 2007; Ko-
matsu et al., 2007). Large ubiquitin+ cytoplasmic inclusions were
found in pancreatic islet cells of Atg7Db cell mice but not in those
of control mice (Figure 3A), similar to the findings in autophagy-
deficient hepatocytes (Komatsu et al., 2007). We also investi-
gated expression of p62 that links ubiquitinated proteins to au-
tophagy apparatus (Bjorkoy et al., 2005). In islet cells of Atg7Db cell
mice, p62 accumulated probably because p62 is degraded by
autophagy (Komatsu et al., 2007) (Figure 3A). Confocal
microscopy at higher magnifications showed that ubiquitin and
p62 were colocalized (Figure 3B). These results suggest the pos-
sibility that accumulation of ubiquitinated proteins associated
with p62 contributes to increased apoptosis-decreased prolifer-
ation of b cells, decreased b cell mass, and impaired insulin
secretion from autophagy-deficient b cells; however, the role of

inclusion body formation in those processes is yet to be eluci-
dated (Casas et al., 2007; Komatsu et al., 2007). Although diabe-
tes state itself could induce formation of ubiquitin aggregates in
b cells (Kaniuk et al., 2007), contribution of hyperglycemia to the
ubiquitin aggregates in b cells of Atg7Db cell mice would be minor
because the size and number of ubiquitin aggregates in b cells
were much smaller in other types of diabetes models such as
db/db mice than those in Atg7Db cell mice (M.S.H. and M.-S.L., un-
published data), and hyperglycemia was mild in Atg7Db cell mice.
Electron Microscopy
We finally studied ultrastructural changes associated with ge-
netic ablation of b cell autophagy. EM revealed that some b cells
of Atg7Db cell mice contained remarkably reduced numbers of in-
sulin granules (Figure 4A, left) compared to b cells of Atg7F/F
mice (Figure 4A, right). Ubiquitin aggregates (Figure 4B, top)
and large cystic structure (Figure 4B, bottom) that correspond
to a part of vacuolated islet cells (Figure 2A) were also found in
b cells of Atg7Db cell mice. Some cystic structures were open to
plasma membrane (Figure 4B, bottom). Further magnification
revealed more ultrastructural abnormalities such as swelling of
mitochondria and cisternal distension of rough ER and Golgi
complex (Figure 4C), even in apparently normal-looking b cells
of Atg7Db cell mice at lower magnifications. In b cells of Atg7F/F
mice, such abnormal changes were not found but occasional au-
tophagosomes were found (Figure 4D). The cellular mechanism
responsible for the sparse insulin granules in b cells of Atg7Db cell
mice is unclear. Defective biogenesis of insulin granules due to
322 Cell Metabolism 8, 318–324, October 8, 2008 ª2008 Elsevier Inc.
Cell Metabolism
Autophagy in Pancreatic b Cells
Figure 4. EM Analysis of the Pancreas at
20 Weeks of Age
(A) b cells of Atg7Db cell mice with markedly re-
duced number of insulin granules (left, white ar-
row) compared to those of Atg7F/F mice with nu-
merous insulin granules dispersed in the
cytoplasm (right).
(B) Ubiquitin aggregates (top, asterisk) and large
cystic structures (bottom, double asterisks) were
found in b cells of Atg7Db cell mice, which were
not found in those of Atg7F/F mice. The cystic
structure had an opening to the plasma membrane
(arrowhead).
(C) Ultrastructural changes in b cells of Atg7Db cell
mice at higher magnifications: swelling of mito-
chondria (white arrowheads) and cisternal disten-
sion of ER (circle) and Golgi complex (rectangle).
(D) Organelles surrounded by double membrane
representing autophagosomes (arrows) were
seen in pancreatic b cells of Atg7F/F mice.
ER dysfunction or unbalanced control of
insulin degradation secondary to autoph-
agy deficiency (Uchizono et al., 2007)
might account for the decreased num-
bers of insulin granules.
Our results demonstrate that constitu-
tive autophagy plays important roles in
the maintenance of pancreatic b cell
mass by regulating cell survival and
proliferation. Glucose-induced insulin se-
cretion was also impaired in b cells lacking autophagy, which is
attributable to the decreased glucose-induced Ca2+ transients
caused by dysfunction of cellular organelles such as mitochon-
dria. Consequently, b cell mass was decreased, serum insulin
level decreased, and hyperglycemia developed in mice with ge-
netic ablation of b cell autophagy. We speculate that accumula-
tion of ubiquitinated proteins and dysfunction of organelles such
as ER and mitochondria contribute to these changes. Autophagy
could be a key regulator of cellular organelles in b cells, where
vigorous protein synthesis occurs, abundant energy is required,
and therefore function of ER and mitochondria may be critical,
particularly when increased demand for insulin production exists
such as insulin resistance.
EXPERIMENTAL PROCEDURES
Production of Atg7Db cell Mice
Atg7F/F mice were crossed with RIP-Cre mice (Jackson Laboratory) for the
generation of Atg7Db cell mice. Cre-mediated recombination was confirmed by
PCR with genomic DNA from isolated pancreatic islet cells and primers flanking
the floxed region (forward, TGGCTGCTACTTCTGCAATGATGT; reverse,
CTAAGCAGGTGAGATCTACACTCA). Blood glucose level and body weight
were monitored weekly. Similar number of male and female mice in each group
was employed for all experiments. All animal experiments were conducted in
accordance with the institutional guidelines of Samsung Medical Center.
RT-PCR
Expression of Atg7 was examined by PCR with total RNA from primary islet
cells and specific primers (forward, ATGCCAGGACACCCTGTGAACTTC;
reverse, CAGGACAGAGACCATCAGCTCCAC).
Cell Metabolism
Autophagy in Pancreatic b Cells
Glucose Tolerance Test
IPGTT was carried out after overnight fasting by intraperitoneal injection of
1 g/kg glucose to 20-week-old mice. Blood glucose concentrations were de-
termined with an Accu-Check glucometer (Roche) before (0 min) and 15, 30,
60, and 120 min after glucose injection. Serum insulin concentration was mea-
sured with a commercial radioimmunoassay kit for rat and mouse insulin mea-
surement (Linco).
Measurement of Pancreatic Insulin Content
Pancreatic insulin was extracted by a previously published method (Yoon
et al., 2003). Insulin content was measured by radioimmunoassay as de-
scribed above and normalized to pancreas weight.
Isolation of Pancreatic Islets
Islets were isolated from overnight fasted mice via the collagenase digestion
technique (Chang et al., 2004).
Glucose-Stimulated Insulin Secretion Ex Vivo
After isolation, medium-sized (150 mm in diameter) islets were picked, and 20
islets of each genotype were placed on the 12 mm-Millicell inserts (Millipore) in
24-well plates. They were starved in Krebs-Ringer bicarbonate buffer (KRBB)
containing 3.0 mM glucose for 1 hr, and wells were replenished with 800 ml of
the same buffer. After incubation for additional 1 hr, the replenished buffer was
collected for measurement of basal insulin release by radioimmunoassay.
Then, islets were stimulated with 800 ml of KRBB containing 16.7 mM glucose
for 1 hr. The buffer was collected for assay of glucose-stimulated insulin
release.
2+
Measurement of [Ca ]c
[Ca2+]c was measured as published with modifications (Chang et al., 2004). In
brief, medium-sized islets were loaded with 4 mM Fura 2-AM for 30 min at room
temperature. After islets were washed twice with Tyrode solution, [Ca2+]c was
recorded by a microfluorometric system comprising an inverted fluorescence
microscope (Olympus IX-70) equipped with a dry-type fluorescence objective
lens, a photomultiplier tube (Hamamatsu), and Deltascan illuminator (Photon
Technology International). [Ca2+]c was calculated from the fluorescence emis-
sion ratio at 340 nm/380 nm excitation.
Histological Analysis
After fixation and embedding, the pancreata were sectioned to a thickness of
3 mm for H&E staining. IHC for insulin, glucagons, somatostatin, ubiquitin, and
p62 was done as described (Kim et al., 1999). Relative b cell mass was esti-
mated by point counting after insulin IHC (Montana et al., 1993). An average
of 7000 points/mouse was counted. The number of test points was chosen us-
ing a nomogram to set the probable error of volume density to less than 10% of
the calculated value (Weibel, 1978). TUNEL staining (Roche) combined with in-
sulin IHC was conducted for the identification of apoptotic b cells (Kim et al.,
1999). So that b cell proliferation could be measured, BrdU incorporation
into b cells 16 hr after intraperitoneal injection of 100 mg/kg BrdU was evalu-
ated by double IHC for insulin and BrdU as described (Kim et al., 1999).
Confocal Microscopy
Colocalization of p62 and ubiquitin was evaluated by confocal microscopy (Ni-
kon E600) after double immunofluorescent staining and Hoeschst33342 stain-
ing (Molecular Probes).
Antibodies
Primary antibodies used for IHC or confocal microscopy were as follows:
anti-insulin, anti-somatostatin, anti-ubiquitin (from DAKO), anti-glucagon
(Chemicon), and anti-p62 (Abnova). Secondary antibodies with or without fluo-
rescence were from Zymed.
Electron Microscopy
After fixation in 2.5% glutaraldehyde-0.1 M NaH2PO4/Na2HPO4 phosphate
buffer (pH 7.2) and PBS washing, pancreas tissues were postfixed with 1%
OsO4 and embedded in Epon812. Ultrathin sections were mounted and
stained with uranyl acetate/lead citrate (JEM-1010, Jeol). They were randomly
scanned at 20 different spots (total 2000–2400 mm2) per each mouse
Cell Metabolism 8, 318–324, October 8, 2008 ª2008 Elsevier Inc. 323
at 3 5000. Number and area of autophagosomes with double-membrane vac-
uole-like structure in the scanned area were measured with a software pro-
gram (ImagePro, Media Cybernetics).
Statistical Analysis
All values were expressed as means ± SEM. Student’s t test and one-way
ANOVA with post hoc Tukey test were employed for two-group and multiple
comparisons, respectively. p values less than 0.05 were considered to repre-
sent statistically significant differences.
ACKNOWLEDGMENTS
We thank Hong-Lim Kim, Dong-Sik Ham, and Seung Hoon Oh for technical as-
sistance. This work was supported by a Nano/Bio Science Program Grant
(2004-00716) and by the 21C Frontier Functional Proteomics Project of the Ko-
rean Ministry of Science and Technology (FPR05C1-160). M.-S.L. is the recip-
ient of SRC Grant R11-2000-080-11003-0 from the Korea Science and Engi-
neering Foundation.
Received: March 31, 2008
Revised: June 29, 2008
Accepted: August 15, 2008
Published: October 7, 2008
REFERENCES
Ashford, T.P., and Porter, K.R. (1962). Cytoplasmic components in hepatic cell
lysosomes. J. Cell Biol. 12, 198–202.
Bernales, S., Schuck, S., and Walter, P. (2007). ER-phagy: Selective auto-
phagy of the endoplasmic reticulum. Autophagy 3, 285–287.
Bjorkoy, G., Lamark, T., Brech, A., Outzen, H., Perander, M., Overvatn, A.,
Stenmark, H., and Johansen, T. (2005). p62/SQSTM1 forms protein aggre-
gates degraded by autophagy and has a protective effect on huntingtin-in-
duced cell death. J. Cell Biol. 171, 603–614.
Blommaart, E.F., Luiken, J.J., Blommaart, P.J., van Woerkom, G.M., and
Meijer, A.J. (1995). Phosphorylation of ribosomal protein S6 is inhibitory for au-
tophagy in isolated rat hepatocytes. J. Biol. Chem. 270, 2320–2326.
Boya, P., Gonzalez-Polo, R.A., Casares, N., Perfettini, J.L., Dessen, P., Lar-
ochette, N., Metivier, D., Meley, D., Souquere, S., Yoshimori, T., et al. (2005).
Inhibition of macroautophagy triggers apoptosis. Mol. Cell. Biol. 25, 1025–
1040.
Casas, S., Gomis, R., Gribble, F.M., Altirriba, J., Knuutila, S., and Novials, A.
(2007). Impairment of the ubiquitin-proteasome pathway is a downstream en-
doplasmic reticulum stress response induced by extracellular human islet am-
yloid polypeptide and contributes to pancreatic beta-cell apoptosis. Diabetes
56, 2284–2294.
Chang, I., Cho, N., Kim, S., Kim, J.Y., Kim, E., Woo, J.E., Nam, J.H., Kim, S.J.,
and Lee, M.S. (2004). Role of calcium in pancreatic islet cell death by IFN-g/
TNF-a. J. Immunol. 172, 7008–7014.
Dor, Y., Brown, J., Martinez, O.I., and Melton, D.A. (2004). Adult pancreatic
beta-cells are formed by self-duplication rather than stem-cell differentiation.
Nature 429, 41–46.
Fex, M., Wierup, N., Nitert, M.D., Ristow, M., and Mulder, H. (2007). Rat insulin
promoter 2-Cre recombinase mice bred onto a pure C57BL/6J background
exhibit unaltered glucose tolerance. J. Endocrinol. 194, 551–555.
Hara, T., Nakamura, K., Matsui, M., Yamamoto, A., Nakahara, Y., Suzuki-Mi-
gishima, R., Yokoyama, M., Mishima, K., Saito, I., Okano, H., and Mizushima,
N. (2006). Suppression of basal autophagy in neural cells causes neurodegen-
erative disease in mice. Nature 441, 885–889.
Harding, H.P., Zeng, H., Zhang, Y., Jungries, R., Chung, P., Plesken, H., Saba-
tini, D.D., and Ron, D. (2001). Diabetes mellitus and exocrine pancreatic dys-
function in perk / mice reveals a role for translational control in secretory cell
survival. Mol. Cell 7, 1153–1163.
Kaniuk, N.A., Kiraly, M., Bates, H., Vranic, M., Volchuk, A., and Brumell, J.H.
(2007). Ubiquitinated-protein aggregates form in pancreatic beta-cells during

diabetes-induced oxidative stress and are regulated by autophagy. Diabetes
56, 930–939.
Kim, S., Millet, I., Kim, H.S., Kim, J.Y., Han, M.S., Lee, M.K., Kim, K.W., Sher-
win, R.S., Karin, M., and Lee, M.S. (2007). NF-kappa B prevents beta cell death
and autoimmune diabetes in NOD mice. Proc. Natl. Acad. Sci. USA 104, 1913–
1918.
Kim, Y.H., Kim, S., Kim, K.A., Yagita, H., Kayagaki, N., Kim, K.W., and Lee,
M.S. (1999). Apoptosis of pancreatic beta-cells detected in accelerated
diabetes of NOD mice: No role of Fas-Fas ligand interaction in autoimmune
diabetes. Eur. J. Immunol. 29, 455–465.
Klionsky, D.J., and Emr, S.D. (2000). Autophagy as a regulated pathway of cel-
lular degradation. Science 290, 1717–1721.
Komatsu, M., Waguri, S., Chiba, T., Murata, S., Iwata, J., Tanida, I., Ueno, T.,
Koike, M., Uchiyama, Y., Kominami, E., and Tanaka, K. (2006). Loss of auto-
phagy in the central nervous system causes neurodegeneration in mice.
Nature 441, 880–884.
Komatsu, M., Waguri, S., Ueno, T., Iwata, J., Murata, S., Tanida, I., Ezaki, J.,
Mizushima, N., Ohsumi, Y., Uchiyama, Y., et al. (2005). Impairment of starva-
tion-induced and constitutive autophagy in Atg7-deficient mice. J. Cell Biol.
169, 425–434.
Komatsu, M., Waguri, S., Koike, M., Sou, Y.S., Ueno, T., Hara, T., Mizushima,
N., Iwata, J., Ezaki, J., Murata, S., et al. (2007). Homeostatic levels of p62 con-
trol cytoplasmic inclusion body formation in autophagy-deficient mice. Cell
131, 1149–1163.
Laybutt, D.R., Preston, A.M., Akerfeldt, M.C., Kench, J.G., Busch, A.K., Bian-
kin, A.V., and Biden, T.J. (2007). Endoplasmic reticulum stress contributes to
beta cell apoptosis in type 2 diabetes. Diabetologia 50, 752–763.
Levine, B., and Kroemer, G. (2008). Autophagy in the pathogenesis of disease.
Cell 132, 27–42.
Liang, J., Shao, S.H., Xu, Z.X., Hennessy, B., Ding, Z., Larrea, M., Kondo, S.,
Dumont, D.J., Gutterman, J.U., Walker, C.L., et al. (2007). The energy sensing
LKB1-AMPK pathway regulates p27(kip1) phosphorylation mediating the de-
cision to enter autophagy or apoptosis. Nat. Cell Biol. 9, 218–224.
Lum, J.J., Bauer, D.E., Kong, M., Harris, M.H., Li, C., Lindsten, T., and Thomp-
son, C.B. (2005). Growth factor regulation of autophagy and cell survival in the
absence of apoptosis. Cell 120, 237–248.
Maechler, P., and Wollheim, C.B. (1999). Mitochondrial glutamate acts as
a messenger in glucose-induced insulin exocytosis. Nature 402, 685–689.
Maiuri, M.C., Zalckvar, E., Kimchi, A., and Kroemer, G. (2007). Self-eating and
self-killing: Crosstalk between autophagy and apoptosis. Nat. Rev. Mol. Cell
Biol. 8, 741–752.
Marsh, B.J., Soden, C., Alarcon, C., Wicksteed, B.L., Yaekura, K., Costin, A.J.,
Morgan, G.P., and Rhodes, C.J. (2007). Regulated autophagy controls hor-
324 Cell Metabolism 8, 318–324, October 8, 2008 ª2008 Elsevier Inc.
Cell Metabolism
Autophagy in Pancreatic b Cells
mone content in secretory-deficient pancreatic endocrine beta-cells. Mol.
Endocrinol. 21, 2255–2269.
Montana, E., Bonner-Weir, S., and Weir, G.C. (1993). Beta cell mass and
growth after syngeneic islet cell transplantation in normal and streptozotocin
diabetic C57BL/6 mice. J. Clin. Invest. 91, 780–787.
Nakai, A., Yamaguchi, O., Takeda, T., Higuchi, Y., Hikoso, S., Taniike, M.,
Omiya, S., Mizote, I., Matsumura, Y., Asahi, M., et al. (2007). The role of au-
tophagy in cardiomyocytes in the basal state and in response to hemodynamic
stress. Nat. Med. 13, 619–624.
Ogata, M., Hino, S., Saito, A., Morikawa, K., Kondo, S., Kanemoto, S., Mura-
kami, T., Taniguchi, M., Tanii, I., Yoshinaga, K., et al. (2006). Autophagy is ac-
tivated for cell survival after endoplasmic reticulum stress. Mol. Cell. Biol. 26,
9220–9231.
Ozcan, U., Yilmaz, E., Ozcan, L., Furuhashi, M., Vaillancourt, E., Smith, R.O.,
Gorgun, C.Z., and Hotamisligil, G.S. (2006). Chemical chaperones reduce
ER stress and restore glucose homeostasis in a mouse model of type 2 diabe-
tes. Science 313, 1137–1140.
Petersen, K.F., Dufour, S., Befroy, D., Garcia, R., and Shulman, G.I. (2004). Im-
paired mitochondrial activity in the insulin-resistant offspring of patients with
type 2 diabetes. N. Engl. J. Med. 350, 664–671.
Qu, X., Zou, Z., Sun, Q., Luby-Phelps, K., Cheng, P., Hogan, R.N., Gilpin, C.,
and Levine, B. (2007). Autophagy gene-dependent clearance of apoptotic cells
during embryonic development. Cell 128, 931–946.
Rodriguez-Enriquez, S., Kim, I., Currin, R.T., and Lemasters, J.J. (2006).
Tracker dyes to probe mitochondrial autophagy (mitophagy) in rat hepato-
cytes. Autophagy 2, 39–46.
Uchizono, Y., Alarcon, C., Wicksteed, B.L., Marsh, B.J., and Rhodes, C.J.
(2007). The balance between proinsulin biosynthesis and insulin secretion:
Where can imbalance lead? Diabetes Obes. Metab. 9, 56–66.
Weibel, E.R. (1978). Sterologic methods. In Practical Methods for Biologic
Morphometry, Volume 1, E.R. Weibel, ed. (London: Academic Press),
pp. 101–161.
Wu, J., and Kaufman, R.J. (2006). From acute ER stress to physiological roles
of the Unfolded Protein Response. Cell Death Differ. 13, 374–384.
Yoon, K.H., Ko, S.H., Cho, J.H., Lee, J.M., Ahn, Y.B., Song, K.H., Yoo, S.J.,
Kang, M.I., Cha, B.Y., Lee, K.W., et al. (2003). Selective beta-cell loss and al-
pha-cell expansion in patients with type 2 diabetes mellitus in Korea. J. Clin.
Endocrinol. Metab. 88, 2300–2308.
Yorimitsu, T., Nair, U., Yang, Z., and Klionsky, D.J. (2006). Endoplasmic retic-
ulum stress triggers autophagy. J. Biol. Chem. 281, 30299–30304.
Zhang, W., Feng, D., Li, Y., Iida, K., McGrath, B., and Cavener, D.R. (2006).
PERK EIF2AK3 control of pancreatic b cell differentiation and proliferation is
required for postnatal glucose homeostasis. Cell Metab. 4, 491–497.