Plant Molecular Biology Reporter 23: 383–395, December 2005

© 2005 International Society for Plant Molecular Biology. Printed in Canada.

Protocols

Detection of Plant Genes, Gene Expression and

Viral RNA from Tissue Prints on FTA® Cards

YVETTE ROY and ANNETTE NASSUTH*

Department of Molecular and Cellular Biology, University of Guelph, Guelph, ON N1G 2W1,
Canada

Abstract. A procedure was established for easy and convenient detection of plant DNA,
plant RNA and viral RNA from plant tissue prints on FTA® (Flinders Technology Associ-
ates, Moscoso et al., 2005) PlantSaver Cards, while avoiding the cross-contamination that
commonly occurs with prints from plant tissues. Detection was successful by adding 2 mm
discs of the prints directly to (RT)-PCR reactions. DNA was detected in leaves from
tobacco, tomato and grapes, and in fruit of tomato and grape. Rubisco and malate dehydro-
genase RNA were detected in tomato fruit and leaf, tobacco leaf and grape leaf. RNA from
Pepino mosaic virus was detected in tomato leaf and fruit and from Rupestis stem pitting
associated virus in grape leaf. Detection was still possible from the tissue prints on FTA®
Cards after storage for many months at room temperature, making this a procedure suit-
able for sample collection and storage off site, prior to further processing in the laboratory.

Key words: FTA® PlantSaver Card, plant nucleic acid detection, plant virus detection, RT-
PCR, tissue print

Abbreviations: DTT, dithiothreitol; FTA, Flinders Technology Associates; PepMV, pepino

mosaic virus; RSPaV, Rupestis stem pitting-associated virus; RT-PCR, reverse transcription-
polymerase chain reaction; RubiscoL, large subunit of ribulose-1,5-bisphosphate
carboxylase/oxygenase; SSR, simple sequence repeat.

Tissue print detection of DNA,

Introduction
RNA and virus Roy and Nassuth
Detecting nucleic acids from plant tissues can often pose difficulties due to the
complex methods currently used to obtain, store and purify the samples. FTA®
Cards (Whatman®) provide an alternate method. A sample can be pressed or spot-
ted on the FTA paper and the nucleic acids within the tissue will be bound to its
matrix, after which it can be archived until further use. The paper is impregnated
with chelators, denaturants and free-radical traps, which inhibit enzymes, mi-
crobes and chemicals that may degrade the DNA or RNA in the sample (Rogers
and Burgoyne, 1997; Salvador et al., 2003; Whatman, 2003). Therefore, nucleic
acids on FTA® Cards can be stored for long periods of time at ambient tempera-
tures, in contrast to the traditional storage in liquid at -20oC or -80oC.
*
Author for correspondence. e-mail: anassuth@uoguelph.ca; fax: 519-837-2075;
ph: 519-824-4120 ext 58787.
384 Roy and Nassuth

The FTA® Card was initially developed to detect excess phenylalanine in

blood samples as a method to screen newborn infants for Phenylketourea (PKU)
(Guthrie and Susi, 1963). The membrane was subsequently used for DNA detec-
tion by PCR, in forensic science (Vanek et al., 2001; Krenke et al., 2002; Nelson
et al., 2002; Seah et al., 2003) and human medicine (Devost, 2000; Roberts, 2000;
Taback, 2003). The scientific community then recognized the potential of FTA®
Cards to allow for sample collection in the field and later analysis in a laboratory
(Gutierrez-Corchero et al., 2002; Crabbe, 2003). It was also discovered that hu-
man RNA can be detected by RT-PCR with RNA eluted from prints on FTA®
Cards (Natarajan et al., 2000; Bhattacharya et al., 2004; Moscoso et al., 2005).
More recently, scientists have expanded the application of the FTA® Card to de-
tect nucleic acids in plant tissue and found it rapid and effective. Detection of
DNA has been reported for FTA prints from leaf tissue of a variety of plants, in-
cluding soybean (Lin et al., 2000), Arabidopsis, marijuana, coca, orchid, papaya,
petunia, opium poppy, potato, rice, sugar beat, sugarcane (Lin et al., 2000), cas-
sava, tobacco, corn (Lin et al., 2000; Ndunguru et al. 2005), tomato (Lin et al.,
2000; Bendezu, 2004; Ndunguru et al., 2005), barley (Drescher and Graner, 2002)
and impatiens (Tsukaya, 2004; Tsukaya et al., 2005). Natarajan et al. (2000) also
successfully detected RNA in eluants from potato leaf prints.
We were interested in improving the FTA-based procedure to enable us to
rapidly detect any type of nucleic acids. Several variations of the procedure were
tried to determine the most simple, accurate and cost-effective method. The proce-
dure was tested on different plants, such as tomato, grape and tobacco, and differ-
ent target sequences, such as malate dehydrogenase (MDH), rubiscoL and green
fluorescence protein (GFP) genes, MDH RNA and Pepino mosaic virus (PepMV)
and Rupestris stem pitting associated virus (RSPaV) We report here for the first
time that detection of DNA, RNA and plant virus is possible by the same FTA®-
based procedure.

Materials and Methods

Plant material
Tobacco (N. tabacum and N. benthamiana), tomato (L. esculentum) and grape (V.
vinifera) were all grown under standard greenhouse conditions, except that some
grape plants were grown in the field or in tissue culture (supplied by Alois Bilavik)
as indicated in text. Some greenhouse and field-grown tomato fruits were bought in
a local grocery store. V. vinifera fruits were obtained from field-grown plants (sup-
plied by Judy Strommer). N. benthamiana GFP16c, a transgenic plant containing
one copy of mGFP5, was obtained from David Baulcombe (Riuz et al., 1998).

Preparation of FTA® tissue print

• Place leaf or cut fruit tissue directly on the FTA® PlantSaver Card (Whatman®).
• For leaf tissue, apply pressure with a pestle briefly until plant material transfers
to the card.
• For fruit tissue, press the cut side gently on the card.
Tissue print detection of DNA, RNA and virus 385

• Allow the prints to dry for one hour and brush off any excess plant material
with tissue paper.
• Store at ambient temperature in a dry location, preferably with a desiccant.

Preparation of samples for (RT)-PCR analysis

• Clean the Harris® Micro Punch (Whatman®) with a tissue dampened with 70%
ethanol and by taking a disc from a blank, sample-less FTA® Card. Repeat. Do
this every time before punching the next sample.
• Remove a disc from the dried FTA® tissue print using the micro punch and
place the disc directly into a PCR tube.
• Note: For tissues with high amounts of inhibitors, such as grape leaf, wash the
disc twice with 200 µl of 70% ethanol, incubating for 5 min for each wash. Dry
at room temperature for 30 min before proceeding.
• Wash with FTA® Reagent (Whatman®): Add 200 µl FTA® Reagent to each
PCR tube, incubate for 3 min at room temperature and discard liquid. During
this time pipette the liquid up and down twice in each tube.
• Repeat wash with FTA® Reagent.
• Note: For tomato fruit samples it is possible to eliminate the washes with the
FTA® Reagent.
• Wash twice with 200 µl 0.1 TE (10 mM Tris, 0.1 mM EDTA, pH 8) as de-
scribed for FTA® Reagent.
• Air dry samples for 1 hr at room temperature, cover samples with a lid to avoid
contamination while still allowing space for evaporation.

(RT)-PCR analysis (adapted from Nassuth et al. 2000)

• (RT)-PCR mixture (25 µl final volume) contained, in addition to the FTA®
disc containing the nucleic acid sample, a final concentration of 10 mM Tris-
HCl, 50 mM or 100 mM KCl, 2% sucrose, 0.1 mM cresol red, 1.5 mM MgCl2,
5 mM DTT, 0.5 µM of each primer (Table 1), 200 µM of Mg2+ balanced dNTPs,
2 U Taq DNA polymerase (Fermentas) and 0.1 U avian myeloblastosis virus re-
verse transcriptase (AMV RT, Roche).
• (RT)-PCR reactions were incubated at 54oC for 45 min (reverse transcription),
followed by 35 cycles of 94oC for 30 s, 54oC for 45 s, and 72oC for 60 s, with a
final elongation step at 72oC for 5 min. For PCR a similar procedure was fol-
lowed but without the addition of reverse transcriptase and/or without the
45 min incubation at 54oC.

Analysis of (RT)-PCR products

• 10 µl of the final PCR product was electrophoresed on a 1.5% agarose gel in 1×
TBE buffer (45 mM Tris-Borate, 1 mM EDTA).

Re-amplification from discs

• Remove remaining liquid from the PCR tubes and discard.
• Wash each disc with 200 µl 0.1 TE for 2 min.
• Repeat wash.
 386

Table 1. Primers used for (RT-)PCR amplification of DNA, RNA and viruses.

Target Primer Primer Sequence (5′–3′) Primer Size (bp) Product Size (bp) Reference

PepMV PepMV–H5649a CTGTTGCTGCCACTTCAAGT 20 719 This Paper

coat protein PepMV–C6367ab* CTCTGATTAAGTTTCGAGTG 20 Mumford and Metcalfe, 2001
PepMV PepMV–H5649a CTGTTGCTGCCACTTCAAGT 20 244 This Paper
coat protein PepMV–C5892a GCATATGCACGAGCTAGATCC 21
PepMV RdRp PepMV–H3259ac CTATTACAACTCCGGAAGCCA 21 312 French et al., 2001
PepMV–C3570ac* TGGTCTGGCCAGGCTTTGAC 20
RSPaV RSPaV–H4372d GATGAGGTCCAGTTGTTTCC 20 320 Meng et al., 2003
RSPaV–C4691d ATCCAAAGGACCTTTTGACC 20
RubiscoL RbcL–H680e TGGACTTGATTTTACCAAAGATGATG 26 642 Nassuth et al., 2000
RbcL–C1321e TGTCCTAAAGTTCCTCCACC 20
RubiscoL RbcL–H535 e CTTTCCAAGGCCCGCCTCA 19 171 Nassuth et al., 2000
RbcL–C705 e CATCATCTTTGGTAAAATCAAGTCCA 26
Tomato malate LeMDH–H183f CCTTTCACTCTACGATATCGC 21 243 RNA This Paper
dehydrogenase LeMDH–C425f GGGCAGTACTTAGCAATGGC 20 >800 DNA
Grape malate VrMDH–H968g GCATCTGTGGTTCTTGCAGG 20 196 RNA 600–800 DNA Nassuth et al., 2000
dehydrogenase VrMDH–C1163g CCCTTTGAGTCCACAAGCCAA 21
Tobacco malate NtMDH–H4h CCTGGTGTTGCCGCTGAT 18 341 RNA This Paper
dehydrogenase NtMDH–C344h TTGCCCTAACAACATCAAGTGT 22 >1kb DNA
i
GFP GFP5–H11 GAGAAGAACTTTTCACTGGA 20 701 This Paper
GFP5–C711i GTATAGTTCATCCATGCCAT 20
aNumbering of primers based on PepMV sequence AF484251 (Spanish isolate 13), *(nearly) identical sequence in AJ438767 (French isolate), AJ606359 (Spanish isolate LE), AJ606361 (Spanish isolate
LP), AF340024 (UK isolate), AY508411 (isolate US3), AY509927 (isolate US2).
bIdentical to PepMV TGB F and PepMV UTR R (Mumford and Metcalfe, 2001).
cIdentical to RdRP Fwd and RdRP Rev (French et al., 2001).
dNumbering of primers based on RSPaV sequence AF026278.
eLarge subunit of ribulose bisphoshate carboxylase oxylase oxygenase, primers based on Rubisco sequence for Triticum (DNA seqAC: D00206) Note that primer binding sites are not around an intron

therefore RT–PCR products on DNA and RNA template produce identically sized fragments.
fPrimers based on, and specific for, Lycopersicon esculentum malate dehydrogenase (MDH) AY725474 (tomato mitochondrial MDH).
gPrimers based on, and specific for, Vitis vinifera malate dehydrogenase (MDH) mRNA L34836.1.
hPrimers based on, and specific for, Nicotiana tabacum putative mitochondrial malate dehydrogenase mRNA, AY554166.1.
iGreen fluorescent protein (GFP), primers based on mgfp5 sequence U87973, numbering based on ORF (1=A of start codon). Note that primer binding sites are not around an intron therefore RT–PCR
Roy and Nassuth

products on DNA and RNA template produce identically sized fragments.

Tissue print detection of DNA, RNA and virus 387

• Remove any excess 0.1 TE and allow discs to air dry for one hour.
• Reuse disc for (RT)-PCR analysis.

Results and Discussion

Detection of DNA in fruit and leaf discs: plant genes and transgenes
FTA® Cards were used to successfully amplify DNA in tomato fruit, leaf and peti-
ole sap (Figures 1 and 2; petiole sap not shown). To demonstrate the possibility of
detecting single copy (trans)genes using FTA® Cards, transgenic tobacco leaf
samples were used to amplify not only endogenous RbcL and MDH genes but
also the GFP transgene (Figure 3).
Detecting nucleic acids from plant tissue prints presented challenges that
were not a concern with tissue from other organisms. First, DNA amplification
using grape leaf and fruit tissues was inconsistent. To determine if the difficulties
amplifying the nucleic acids were due to inhibitors in the plant, purified amplifiable
tomato nucleic acid extracts were added to grape leaf discs prior to PCR. As posi-
tive controls, tomato extract was also added to tomato leaf discs and to blank
discs (Figure 4a). Tomato extract DNA in control reactions amplified successfully
using RbcL primers, while the tomato extract added to a grape leaf disc was
unable to amplify, indicating that the grape leaf prints contained inhibitors that
were interfering with the PCR reaction. The fact that grape tissue prints contained
inhibitors was not surprising because plant tissues from woody plants are known
to contain large amounts of polysaccharides and phenols that interfere with (RT)-
PCR amplification (Newbury and Possingham, 1977; Rezaian and Krake, 1987;
Demeke and Adams, 1992; John, 1992), and this has been a problem with RT-
PCR reactions on grape RNA extracts, especially from older tissues (MacKenzie
et al., 1997; Nassuth et al., 2000). Traditional RNA extraction methods can be
modified to include PVP-40 or mercaptoethanol, which reduce the amount of
inhibitors (Monette and James, 1990; John, 1992; Henson and French, 1993;
Rowhani et al., 1993; Minafra and Hadidi, 1994; MacKenzie et al., 1997; Zhang
et al., 1998; Nassuth et al., 2000). The FTA® method does not allow for these
types of modifications, although PVP-40 can be added directly to the (RT)-PCR
mixture in order to reduce inhibition of the (RT)-PCR components. Inhibition can
also be reduced by pre-washing the sample discs twice, for 5 min with 200 µl of
70% ethanol, as recommended by Ndunguru et al. (2005). Amplification of DNA
in grape leaf prints was possible after including this washing procedure and 2%
PVP-40 in the PCR reaction mixture (Compare leaf print from greenhouse-grown
grape in Figure 4a (G) with those in Figure 4b (g)). Amplification was better from
DNA in leaf prints of young tissue culture plants compared to those from plants
grown in the greenhouse or field (Figure 4b). For less problematic tissues, such as
tomato leaves and fruits, a variety of washing buffer types and volumes were
tested and it was determined that elimination of the wash with FTA® Reagent, to
minimize time and cost, was possible although no amplification was obtained
with some discs (Figure 1). Therefore we routinely wash leaf tissues twice with
200 µl of FTA® Reagent followed by two washes of 200 µl 0.1 TE, as recom-
mended by the manufacturer.
388 Roy and Nassuth

Figure 1. PCR products from tomato fruit and leaf tissue prints on FTA® PlantSaver Cards (a, b, c).
Discs taken from prints were washed with TE buffer only and then used to amplify nucleic acids with
RubiscoL primers producing products of different sizes (The expected sizes are noted on the right).
Discs from (a) were washed with TE buffer and used in a second PCR reaction (c). A 100 bp DNA
ladder (M) was used to confirm fragment size; nucleic acid extracts were used as a positive control
(+) and water was used as a negative control (-). These amplification reactions were repeated on at
least two different tissue prints.

Figure 2. PCR products from tomato (T) leaf prints and blank (B) FTA® PlantSaver Cards were
amplified with RubiscoL primers. A 100 bp DNA ladder (M) was used to confirm fragment size.
Tomato nucleic acid extract was used as a positive control (+) and water was used as a negative
control (-). This test was repeated on at least two different tissue prints.

Another problem was cross-contamination between samples, due to tissue

transferring via the micro-punch. This was tested by removing a disc from a tissue
print with the micro-punch, then removing a blank disc as a negative control.
Since cross-contamination was occurring, the blank disc provided an amplified
PCR product (Figure 2, lanes labeled B; Figure 4a, B and - lanes). Blood samples
apparently provide no cross-contamination of the micro-punch (Whatman, 2003).
This is likely because blood easily absorbs within an FTA® Card, while plant
material is more liable to leave tissue on top of the card, readily available to
attach to the micro-punch and contaminate the next sample. Testing for cross-
contamination was not reported by other researchers who used plant tissue on the
FTA® Cards, so we assume that it wasn’t considered. Whatman® suggests cleaning
the micro-punch with ethanol or taking a blank disc between samples (Whatman,
Tissue print detection of DNA, RNA and virus 389

Figure 3. PCR products from non-transgenic (a) and transgenic (b) tobacco leaf prints on FTA®
PlantSaver Cards were amplified using tobacco malate dehydrogenase (MDH), RubiscoL or GFP
primers. A 100 bp DNA ladder (M) was used to confirm fragment size; nucleic acid extracts were
used as a positive control (+), and water was used as a negative control (-). These amplification
reactions were repeated on at least two different tissue prints.

2003), but we found that both treatments were necessary twice to prevent cross-
contamination. We recommend that a consecutively sampled blank disc be tested
for each (RT)-PCR reaction as a negative control.

Detection of plant RNA

RNA in tomato fruit, leaf and petiole sap, grape leaf and fruit and tobacco leaf was
easily detected from discs placed directly in the (RT)-PCR reaction (Figures 4 and 5;
grape fruit not shown). This is simpler than the procedure applied by Natarajan et al.
(2000) for human blood, human cells, and plant leaf tissue, as recommended by the
manufacturer (Whatman®), which involves eluting RNA from the disc and using the
eluant in the RT-PCR reaction (Whatman, 2003). All malate dehydrogenase primers
(Table 1) were designed around an intron so that amplification on an RNA template
would yield a different size RT-PCR product than its DNA counterpart. For example,
grape malate dehydrogenase primers amplified multiple fragments between 600 and
900 base pairs long due to presence of intron(s) in the DNA (Nassuth et al., 2000),
whereas the fragment produced by these primers on RNA template is only 196 base
pairs and easily distinguishable by agarose gel electrophoresis (Figure 4b). A simi-
lar situation exists for tomato and tobacco (Figure 5a, b).

Detection of viral RNA

Viral RNA was readily amplified directly from discs. Tomato fruit and leaf tissue
tested positive for the presence of PepMV in both asymptomatic and symptomatic
infected plants (Figure 6a, b). RSPaV was successfully detected in infected grape
leaf tissue (Figure 6c). An additional advantage of FTA® Cards is that they appar-
ently inactivate viral pathogens (Moscoso et al., 2005) allowing for safe shipment
and storage of viral samples.
390 Roy and Nassuth

Figure 4. PCR (a) and RT-PCR (b) products from grape leaf prints on FTA® PlantSaver Cards.
(a) Discs were taken from blank (B), tomato (T), and grape (G) prints. Tomato nucleic acid extract
was added (+) or not (-), and the resulting samples were PCR amplified using RubiscoL primers
which are known to amplify DNA from both tomato and grape (Myslik and Nassuth, 2001). (b) Discs
were taken from leaf prints of grape plants grown in tissue culture (t), the greenhouse (g), or the field
(f). For (b) the discs were washed twice with 200 µl of 70% ethanol prior to the normal washing
procedure, and 2% PVP-40 was added to the RT-PCR mixture. A 100 bp DNA ladder (M) was used
to confirm fragment size; nucleic acid extracts were used as a positive control (+), and water was
used as a negative control (-). These amplification reactions were repeated on at least two different
tissue prints.

While this manuscript was in preparation, Ndunguru et al. (2005) reported

the detection of the RNA viruses Tobacco mosaic virus, Potato virus Y and
Tobacco etch virus, as well as the DNA geminiviruses, from leaf tissue pressed
upon FTA® Cards. However, these researchers eluted the viral RNA and DNA
before (RT)-PCR, as did others for the detection of animal viruses (Bhattacharya
et al., 2004; Moscoso et al., 2005).
We chose to use PepMV for this study because it is extremely stable (Aguilar,
2002) and appears to be well distributed throughout the plant in sufficiently high
titer. Small aliquots of tomato fruit sap (1 µl) and small grape buds were sufficient
to detect PepMV (Nassuth and Gu, 2005) and RSPaV (Stewart and Nassuth,
2001) respectively by RT-PCR. However, not all viruses are evenly distributed
throughout the plants they infect, which can be a problem for the FTA® method
since it samples only a small area of the plant. Therefore, we recommend that the
FTA® detection procedure be compared with RT-PCR on extracts for each virus in
a known infected plant before it is applied to large scale studies.

Reusing FTA® discs for multiple experiments for DNA detection

After using samples for PCR or RT-PCR, we reused the washed discs in a second
reaction. The primers chosen for the second reaction were such that they could
not use the first amplification product as template, thereby ensuring that the
visualized amplification product was truly from a second amplification on the
original DNA template (Figure 1). For plants containing large amounts of inhibitors,
Tissue print detection of DNA, RNA and virus 391

Figure 5. RT-PCR products from prints of (a) tomato leaf, fruit and petiole sap and (b) tobacco leaf
from N. benthamiana and N. tabacum, on FTA® PlantSaver Cards, produced with plant species-
specific malate dehydrogenase (MDH) primers. A 100 bp DNA ladder (M) was used to confirm
fragment size; nucleic acid extracts were used as a positive control (+), and water was used as a
negative control (-). These amplification reactions were repeated on at least two different tissue
prints. Note that amplification yield from the DNA template is lower because the primers have been
depleted from amplifying the RNA template (Nassuth et al., 2000).

such as grape, a second (RT)-PCR reaction was often more successful than the
first (results not shown), presumably due to reduction of inhibitors through the
washes and RT-PCR procedure. However, reusing plant tissue discs for (RT)-
PCR was generally not reliable (Figure 1c), in contrast to what had been reported
for tissues from other organisms. Del Rio et al. (1995) found that blood stained
discs may be used repeatedly for up to 3 separate PCR reactions.

Storage and integrity of samples

To determine if nucleic acid templates degrade over time to the extent that they
can no longer be amplified, we tested prints that had been stored for various
amounts of time. All tests turned out positive and showed that plant DNA larger
than 800 nucleotides could be detected after eight months, plant RNA up to
243 nucleotides in length could be detected after five and a half months and viral
RNA up to 719 nucleotides could be detected after six months of storage at ambi-
ent temperatures. Viral RNA was detectable after even longer periods of time
(8 months), although this was tested only for shorter PCR fragments (312 bp).
Drescher and Graner (2002) amplified an 1800 bp fragment from barley leaf
DNA. Natarajan et al. (2000) amplified a 1.05 kb fragment on RNA eluted from
potato leaf prints, and Ndunguru et al. (2005) also used eluant to amplify a 2.8 kb
fragment from a DNA virus and a 2.1 kb fragment from an RNA virus.
392 Roy and Nassuth

Figure 6. RT-PCR products from tomato leaf and fruit prints on FTA® PlantSaver Cards. Viral RNA
in tomato was amplified using PepMV RdRp primers (a) and PepMV CP primers (b), and in grape
using RSPaV primers (c). Tomato leaf samples were taken from tissues of both symptomatic (s) and
asymptomatic (n) plants. Asymptomatic tomato fruits were bought at the grocery store and came
from either greenhouse (n) or field (f-n). Grape leaf discs (c) were washed twice with 200 µl of 70%
ethanol prior to the normal washing procedure and addition to an RT-PCR mixture containing 2%
PVP-40. A 100 bp DNA ladder (M) was used to confirm fragment size; nucleic acid extracts were
used as a positive control (+), and water was used as a negative control (-). These amplification
reactions were repeated on at least two different tissue prints.

Lin et al. (2000) stored plant tissue prints for up to one month at room tem-
perature, while others stored their plant prints at temperatures of -20oC or lower
(Natarajan et al., 2000). There was no information on how long plant tissue could
be stored on FTA® Cards at freezing temperatures, but Lange et al. (1998) used a
similar system, the Generation DNA Purification System (Gentra Systems Inc.),
and were able to store their plant samples for up to 6 months at -20oC. Whatman®
has reported that genomic DNA can be stored on FTA® Cards for up to 14 years
at room temperature (Whatman, 2003). To increase the integrity of the sample it
has been recommended to store samples at freezing temperatures, but this in-
creases the chance of moisture uptake by the FTA® Card, possibly spoiling the
sample. By storing the samples at ambient temperatures for long periods of time
we have demonstrated the reliability of the FTA® paper to collect samples in a
field or greenhouse and to mail samples to laboratory facilities, without compro-
mising amplification abilities.

Conclusions
We show here for the first time that it is possible to detect plant RNA and viral
RNA by the same easy, convenient method that can detect plant DNA, by (RT)-
PCR amplification directly from a disc taken from FTA® tissue prints. We
Tissue print detection of DNA, RNA and virus 393

detected DNA in leaves from tobacco, tomato and grapes, and in fruit from
tomato and grape, while avoiding cross-contamination, which often occurs when
using plant tissue prints. Plant RNA was detected in tomato fruit and leaf, tobacco
leaf and grape leaf, and the RNA viruses PepMV and RSVaP were detected in
tomato leaf and fruit and grape leaf, respectively.
This procedure could be used to test the presence of a transgene, do SSR
analysis (Merdinoglu et al., 2005), marker genotyping (Lange et al., 1998; Drescher
and Graner, 2002) or simple and rapid plant virus detection. The ability to obtain
and store the prints at ambient temperatures means that these tests could be em-
ployed for wide-scale studies in the field. Restriction digestion and/or cloning and
sequencing of the (RT)-PCR products would expand the application to additional
studies, such as differentiating between virus (Martinez-Culebras et al., 2002) or
plant species by, for example, DNA barcoding (Kress et al., 2005).

Acknowledgments

We thank Alois Bilavik and Judy Strommer for grape material and David C.
Baulcombe for transgenic tobacco. The constructive criticism of the manuscript
by Mahbuba Siddiqua and Fariba Shahmir is acknowledged. This work was sup-
ported by grants from AMCO Farms Inc., IRAP and OMAF to A.N., as well as
the Work Study Program and an URA through the University of Guelph to Y.R.

References
Aguilar JM, Hernandez-Gallardo MD, Cenis JL, Lacasa A, and Aranda MA (2002) Com-
plete sequence of the Pepino mosaic virus RNA genome. Arch Virol 147: 2009-2015.
Bendezu IF (2004) Detection of the tomato Mi 1.2 gene by PCR using non-organic DNA
purification. Nematropica 34: 23-30.
Bhattacharya SS, Kulka M, Lampel KA, Cebula TA, and Goswami BB (2004) Use of re-
verse transcription and PCR to discriminate between infectious and non-infectious
hepatitis A virus. J Virol Methods 116: 181-187.
Crabbe MJ (2003) A novel method for the transport and analysis of genetic material from
polyps and zooxanthellae of scleractinian corals. J Biochem Biophys Meth 57: 171-
176.
Del Rio SA, Marino MA, and Belgrader P (1995) Reusing the same blood-stained punch
for sequential DNA amplifications and typing. Biotechniques 20: 970-974.
Demeke T and Adams RP (1992) The effects of plant polysaccharides and buffer additives
on PCR. Biotechniques 12: 332-334.
Devost NC and Choy FY (2000) Mutation analysis of Gaucher Disease using dot-blood
samples on FTA filter paper. Am J Med Genet 94: 417-420.
Drescher A and Graner A (2002) PCR-genotyping of barley seedlings using DNA samples
from tissue prints. Plant Breeding 121: 228-231.
French CJ, Bouthillier M, Bernardy M, Ferguson G, Sabourin M, Johnson RC, Masters C,
Godkin S, and Mumford R (2001) First report of pepino mosaic virus in Canada, and
the United States. Plant Dis 85: 1121.
Guthrie R and Susi A (1963) A simple phenylalanine method for detecting phenyl-
ketonuria in large populations of newborn infants. Am Acad Pediatrics 32: 338-343.
394 Roy and Nassuth

Gutierrez-Corchero F, Arruga MV, Sanz L, Garcia C, Hernandez MA, and Campos F

(2002) Using FTA registered cards to store avian blood samples for genetic studies.
Their application in sex determination. Mol Ecol Notes 2: 75-77.
Henson JM and French R (1993) The polymerase chain reaction and plant disease diagno-
sis. Annu Rev Phytopathol 31: 81-109.
John ME (1992) An efficient method for isolation of RNA and DNA from plants contain-
ing polyphenolics. Nucleic Acids Res 20: 2381.
Krenke BE, Tereba A, Anderson SJ, Buel E, Culhane S, Finis CJ, Tomsey CS, Zachetti JM,
and Sprecher CJ (2002) Validation of a 16-locus fluorescent multiplex system. J Fo-
rensic Sci 47: 773-785.
Kress WJ, Wurdack KJ, Zimmer EA, Weigt LA, and Janzen DH (2005) Use of DNA
barcodes to identify flowering plants. Proc Natl Acad Sci USA 102: 8369-8374.
Lange DA, Penuela S, Denny RL, Mudge J, Concibido VC, Orf H, and Young ND (1998)
A Plant DNA isolation protocol suitable for polymerase chain reaction based marker-
assisted breeding. Crop Sci 38: 217-220.
Lin J-J, Fleming R, Kuo J, Matthews BF, and Saunders JA (2000) Detection of plant genes
using a rapid, nonorganic DNA purification method. Biotechniques 28: 346-350.
MacKenzie DJ, McLean M, Mukerji S, and Green M (1997) Improved RNA extraction
from woody plants for the detection of viral pathogens by reverse transcription-
polymerase chain reaction. Plant Dis 81: 222-226.
Martinez-Culebras P, Lazaro A, Abad Campos P, and Jorda C (2002) A RT-PCR assay
combined with RFLP analysis for detection and differentiation of isolates of Pepino
Mosaic Virus (PepMV) from tomato. Eur J Plant Pathol 108: 887-892.
Meng B, Credi R, Petrovic N, Tomazic I, and Gonsalves D (2003) Antiserum to recombi-
nant virus coat protein detects rupestris stem pitting associated virus in grapevines.
Plant Dis 87: 515-522.
Merdinoglu D, Butterlin G, Bevilacqua L, Chiquet V, Adam-Blondon A, and Decroocq S
(2005) Development and characterization of a large set of microsattellite markers in
grapevine (Vitis Vinifera L.) suitable for multiplex PCR. Mol Breeding 15: 349-366.
Minafra A and Hadidi A (1994) Sensitive detection of grapevine virus A, B, or leafroll-
associated III from viruliferous mealybugs and infected tissue by cDNA amplification.
J Virol Methods 47: 175-188.
Monette PL and James D (1990) Detection of two strains of grapevine virus A. Plant Dis
74: 898-900.
Moscoso H, Raybon EO, Thayer SG, and Hofacre CL (2005) Molecular detection and
serotyping of infectious bronchitis virus from FTA filter paper. Avian Dis 49: 24-29.
Mumford RA and Metcalfe EJ (2001) The partial sequencing of the genomic RNA of a
UK isolate of Pepino Mosaic Virus and the comparison of the coat protein sequence
with other isolates from Europe and Peru. Arch Virol 146: 2455-2460.
Myslik JT and Nassuth A (2001) Rapid detection of viruses, transgenes and mRNAs in
small plant leaf samples. Plant Mol Biol Rep 19: 329-340.
Nassuth A and Gu C (2005) Pepino Mosaic Virus. In: Molecular Diagnosis of Plant
Viruses. Studium Press, Huston, Texas. Submitted.
Nassuth A, Pollari E, Helmeczy K, Stewart S, and Kofalvi SA (2000) Improved RNA
extraction and one-tube RT-PCR assay for simultaneous detection of control plant
RNA plus several viruses in plant extracts. J Virol Methods 90: 37-49.
Natarajan P, Trinh T, Mertz L, Goldsborough M, and Fox DK (2000) Paper-based archiv-
ing of mammalian and plant samples for RNA analysis. Biotechniques 29: 1328-1333.
Ndunguru J, Taylor NJ, Yadav J, Aly H, Legg JP, Aveling T, Thompson G, and Fauquet
CM (2005) Application of FTA technology for sampling, recovery and molecular char-
Tissue print detection of DNA, RNA and virus 395

acterization of viral pathogens and virus-derived transgenes from plant tissues. Virol J
2: 45.
Nelson MS, Levedakou EN, Matthews JR, Early BE, Freeman DA, Kuhn CA, Sprecher
CJ, Amin AS, McElfresh KC, and Schumm JW (2002) Detection of a primer-binding
site polymorphism for the STR locus D16S539 using the powerplex 1.1 system and
validation of a degenerate primer to correct for the polymorphism. J Forensic Sci 47:
345-349.
Newbury HJ and Possingham JV (1977) Factors affecting the extraction of intact ribonu-
cleic acid from plant tissue containing interfering phenolic compounds. Plant Physiol
60: 543-547.
Rezaian MA and Krake LR (1987) Nucleic acid extraction and virus detection in grape-
vine. J Virol Methods 17: 277-285.
Roberts R, Sullivan P, Joyce P, and Kennedy MA (2000) Rapid and comprehensive deter-
mination of cytochrome P450 CYP2D6 poor metabolizer genotypes by multiplex poly-
merase chain reaction. Human mutation 16: 77-85.
Rogers C and Burgoyne L (1997) Bacterial typing: storing and processing of stabilized
reference bacteria for polymerase chain reaction without preparing DNA- an example
of an automatable procedure. Analytical Biochem 247: 223-227.
Rowhani A, Chay C, Golino DA, and Falk BW (1993) Development of a polymerase chain
reaction technique for the detection of grapevine fanleaf virus in grapevine tissue.
Phytopathology 83: 749-758.
Ruiz MT, Voinnet O, and Baulcombe DC (1998) Initiation and maintenance of virus-
induced gene silencing. Plant Cell 10: 937-946.
Salvador JM and De Ungria MCA (2003) Isolation of DNA from saliva of betel quid
chewers using treated cards. J Forensic Sci 48: 794-797.
Seah LH, Jeevan NH, Othman MI, Jaya P, Ooi YS, Wong PC, and Kee SS (2003) STR
data for the AmpF/STR identifiler loci in three ethnic groups (Malay, Chinese, Indian)
of the malaysian population. Forensic Sci Int 138: 134-137.
Stewart S and Nassuth (2001) RT-PCR based detection of rupestris stem pitting associated
virus within field-grown grapevines throughout the year. Plant Dis 85: 617-620.
Taback B, Giuliano AE, Hansen NM, Singer FR, Shu S, and Hoon DSB (2003) Detection
of tumor-specific genetic alterations in bone marrow from early-stage breast cancer
patients. Cancer Res 63: 1884-1887.
Tsukaya H (2004) Gene flow between Impatiens radicans and I. javensis (Balsaminaceae)
in Gunung Pangrango, central Java, Indonesia. Am J Bot 91: 2119-2123.
Tsukaya H, Iokawa Y, Kondo M, and Ohba H (2005) Large-scale general collection of
wild-plant DNA in Mustang, Nepal. J Plant Res 118: 57-60.
Vanek D, Hradil R, and Budowle B (2001) Czech population data on 10 short tandem re-
peat loci of SGM plus STR system kit using DNA purified in FTA cards. Forensic Sci
Int 119: 107-108.
Whatman (2003) Nucleic acid sample preparation. Avaibable at: http://www.whatman.
com/products/?pageID=7.31. Accessed August 4, 2005.
Zhang Y-P, Uyemoto JK, Golino DA, and Rowhani A (1998) Nucleotide sequence and RT-
PCR detection of a virus associated with grapevine rupestris stem-pitting disease.
Phytopathology 88: 1231-1237.