Conserv Genet
DOI 10.1007/s10592-009-9867-3
TECHNICAL NOTE
A simple method for isolation of microsatellites
from the mudskipper (Boleophthalmus pectinirostris),
without constructing a genomic library
Shou-Jie Tang Æ Zhi-Zhi Liu Æ Wen-Qiao Tang Æ
Jin-Quan Yang
Received: 23 February 2009 / Accepted: 24 February 2009

Springer Science+Business Media B.V. 2009
Abstract The mudskipper Boleophthalmus pectinirostris
is an important aquaculture species in China. It is endan-
gered due to the loss and fragmentation of natural habitat,
seawater pollution and overfishing. In this study, ten
polymorphic microsatellite loci were isolated by the 50 -
anchored polymerase chain reaction technique. Population
genetic parameters were estimated on 60 wild individuals
collected from Jiuduansha wetland in Yangtze River estu-
ary. The number of alleles ranged from 3 to 14. The
observed(HO) and expected(HE) heterozygosities ranged
from 0.2500 to 0.8500 and from 0.3679 to 0.8692,
respectively. This suite of microsatellite loci will facilitate
future studies of the genetic status of wild and hatchery
bred populations of B. pectinirostris.
Keywords Boleophthalmus pectinirostris

Microsatellite
50 -anchored PCR
The mudskipper Boleophthalmus pectinirostris is an
amphibious gobioid fish distributed on the mudflats of
eastern Asia, including Japan, South Korea, and China
(Murdy 1989; Akihito et al. 2000). In China, it is mainly
found in coastal waters in the southeast mainland and
around Taiwan. The mudskipper is an euryhaline and
eurythermal species, living in the middle-low tidal zone
along the coast and in estuaries. As it is low in the food
chain and has few diseases, the mudskipper has been
regarded as a good species for mariculture in China. In
S.-J. Tang
Z.-Z. Liu (&)
W.-Q. Tang
J.-Q. Yang
Key Laboratory of Exploration and Utilization of Aquatic
Genetic Resources, Ministry of Education, Shanghai Ocean
University, 999 Hu Cheng Ring Road, 201306 Shanghai, China
e-mail: zzliu@shou.edu.cn
2004, the breeding area of mudskipper has reached 13,000
hectares on the southeast coast of China (Zhang and Hong
2006). However, the natural resource of B. pectinirostris
has been decreasing due to overfishing and seawater pol-
lution. For the purposes of conservation and sustainable
exploitation for fishery resources of B. pectinirostris,
population genetic studies are necessary. Intraspecific
variations and population diversity of B. pectinirostris have
been investigated by random amplified polymorphic DNA
(RAPD) markers (Jin et al. 2004) and mitochondrial
cytochrome b (Cyt b) gene sequences (Liu et al. 2009) as
well as D-loop sequences (Kanemori et al. 2006). Micro-
satellites or simple sequence repeats (SSRs) have been
widely used as DNA markers in population genetic studies,
parentage and kinship analyses because of their high level
of polymorphism and codominant Mendelian inheritance
(O’Connell and Wright 1997). To date, no polymorphic
microsatellite markers were reported on B. pectinirostris.
Here we report on the use of the 50 -anchored polymerase
chain reaction (PCR) technique to rapidly capture micro-
satellite loci and to use them in identifying genetic
variation in B. pectinirostris.
About 60 natural mudskipper samples were collected
randomly from Jiuduancha wetland in Yangtze River
estuary. Fin clips were stored in 95% ethanol until DNA
extraction. Genomic DNA was extracted using phenol–
chloroform procedure (Sambrook and Russell 2001). The
microsatellites were isolated using an enrichment proce-
dure based on the 50 -anchored PCR technique described by
Fisher et al. (1996), Brachet et al. (1999), and Provan and
Wilson (2007). Eight 50 -anchored primers with various
repeat motifs, M1 [50 -KKVRVRV(CT)10-30 ], M2 [50 -KKV
RVRV(AG)10-30 ], M3[50 -KKHBHBH(AG)10-30 ], M4 [50 -
KKVRVRV(TG)10-30 ], M5[50 -KKHRHRH(TG)10-30 ],M6
[5’-GGCC(AC)8-3’], M7[5’-GCGC(AG)8-3’], M8[5’-GC
123
 Conserv Genet

GC(AC)8-3’] (where K = G/T, V = G/C/A, R = G/A,
H = A/C/T and B = G/C/T) were used in PCR amplifi-
cation to capture various repeat motifs of the mudskipper
genome.
PCR amplification was carried out in a total volume of
10 ll containing 30 ng of template DNA, 2.5 mM MgCl2,
1 9 PCR buffer containing 10 mM Tris–HCl (pH 8.0),
50 mM KCl, 1 U Taq DNA polymerase (Promega),
10 pmol of 50 -anchored primer (M1–M8, respectively),
0.2 mM of dATP, dGTP, dCTP, and dTTP. Amplification
was carried out in a thermocycler (Eppendorf Mastercy-
cler) with an initial denaturation at 94C for 5 min,
followed by 35 cycles of 30 s at 94C, 30 s at (53C for
M2, M5; 55C for M7; 59C for M3, M8; 60C for M1,
M6; 62C for M4), 1 min at 72C and a final extension step
of 10 min at 72C. The amplification products were
resolved electrophoretically on a 2% agarose gel. A D2000
Marker (TIANGEN) was used as a size standard. The gel
was stained with ethidium bromide and visualized using
UV light.
Following successful amplification as observed by gel
electrophoresis, the PCR products were then cloned into a
pMD19-T vector (TaKaRa) and transformed into chemi-
cally competent TOP10 Escherichia coli cells according to
the method described by the manufacturers (TIANGEN).
A total of 134 recombinant clones were then randomly
selected from the Luria–Bertani plates for sequencing.
Plasmid miniprep was performed by using the alkaline
lysis technique by Sambrook and Russell (2001) and sub-
sequently the plasmids were sequenced by using the
BigDye Terminator version 2.0 Cycle Sequencing Ready
Reaction Kit (Applied Biosystems) on an ABI PRISM 377
DNA sequencer. DNA sequencing of the clones revealed a
total of 458 microsatellites. These microsatellites consist of
445 dinucleotide, 11 trinucleotide, and 2 tetranucleotide
repeats. All clones had inserts containing flanking micro-
satellite motifs corresponding to the anchored primer used
to generate the Inter simple sequence repeat (ISSR) frag-
ments. Thirty-eight unique clones contained one internal
microsatellite motif and a further ten contained two internal
microsatellites.
Specific primer pairs were designed to amplify the
microsatellite-flanking region using the online software
primer 3 (Rozen and Skaletsky 2000). These primers were
then used to screen for polymorphisms at microsatellite
loci in B. pectinirostris. PCR amplifications were per-
formed in a final reaction volume of 10 ll containing 30 ng
of genomic DNA, 1 mM MgCl2, 10 mM Tris–HCl, 50 mM
KCl, 0.2 mM of each dNTPs, 0.35 lM of each forward
and reverse primers, and 1.25 U Taq DNA Polymerase
(Promega). The loci were amplified using a Thermal Cycler
(Eppendorf Mastercycler). The conditions were as follows:

Table 1 Repeat motif, primer sequences, expected size, annealing temperature(Ta), number of alleles, observed heterozygosity(HO), expected
heterozygosity(HE) and exact test for the HWE after Bonferroni correction(PHW) for ten Boleophthalmus pectinirostris microsatellite loci
Locus Repeat motif Primer (50 –30 ) Expected TaC No. of HO HE PHW GenBank
size (bp) alleles accession
no.

DTT01 (CT)7…(TC)6 F:TGCCCTCCCTCTCTCCTTAT 125 60.9 6 0.5500 0.8154 0.1186 FJ598058

R:AGCTCTGGATCAGAACGAACA
DTT02 (AG)5…(GA)5 F:CTCCACACACAAGAGCCTCA 154 60.6 12 0.4000 0.8692 0.4210 FJ598059
R:TTCCTCTCTCTTCTCTCCCCTA
DTT03 (AG)5…(AG)7…(GA)5 F:GGGGTGGGGCTAGATAGAGA 187 56.0 6 0.5500 0.6897 0.5009 FJ598060
TG(GA)5 R:AACGCGTGATTTACGAGACC
DTT04 (TTC)9 F:TCCTGATTCTGGACCCTTTC 224 56.0 14 0.6500 0.8513 0.9818 FJ598061
R:CCAACACGACCATCAGAAGA
DTT05 (GA)6 F:AGGGAAGGGGAGACAGAAATA 170 57.0 5 0.6500 0.7885 0.0819 FJ598062
R:CCACACGCTTTCTCTCTCTTT
DTT06 (AGA)8…(AGG)5… F:ACGCGCTCAGAAGAAGAAGA 158 54.5 12 0.5000 0.8333 0.9117 FJ598063
(GC)5 R:GGGAAACACCGTTAGACGAG
DTT07 (GT)8 F:GTGCGTGTGTGTGTGTGTGT 212 61.6 7 0.8000 0.8179 0.6958 FJ598064
R:AAGCAGTTGGTGCCACTAGG
DTT08 (GA)8…(GA)6…(CA)5 F:GAGACAGACAGGCAACGATA 155 55.9 3 0.2500 0.3679 0.3769 FJ598065
R:CACAGAGAGAGGAGTATTCTTGA
DTT09 (AGT)6 F:GGGCGTCGTATTGTGTGTAA 186 55.9 4 0.8500 0.7577 0.7130 FJ598066
R:GGATTCCAACTGCACTCACA
DTT10 (AGT)16…(GT)8 F:CAGGGCAAAAGGTCTAATGTT 219 51.0 5 0.7000 0.8013 0.3507 FJ598067
R:AGGGAGTGTCTGGGGAGAGT

123
Conserv Genet
a predenaturation at 94C for 5 min followed by 40 cycles
of 30 s at 94C, 30 s at the appropriate annealing tem-
peratures listed in Table 1, 30 s extension at 72C, and
concluded with a 10 min final extension at 72C. The PCR
products were then electrophoresed on a 8% nondenaturing
polyacrylamide gel and visualized by silver staining
method of Sambrook and Russell (2001) with minor
modifications. A pBR322 DNA/MspI Marker (TIANGEN)
was used as a size standard for polyacrylamide gel. The
analyses of polymorphism, including number of alleles
(Na), observed heterozygosity (HO), expected heterozy-
gosity (HE), and pairwise tests for linkage disequilibrium
(LD) and exact tests for the Hardy–Weinberg equilibrium
(HWE) were performed by using Arlequin version 3.1
(Excoffier et al. 2005). Bonferroni probabilities were used
to evaluate the significance of the correlations (Rice 1989).
Twenty-seven out of 39 pairs of primers had specific
amplification products, but only 10 were polymorphic in
the test population of mudskipper with 60 individuals.
These microsatellite sequences have been deposited in
GenBank (Accession numbers: FJ598058–FJ598067). The
number of alleles per locus ranged from 3 to 14, and values
for observed and expected heterozygosities ranged from
0.2500 to 0.8500 and from 0.3679 to 0.8692, respectively,
(Table 1). All pairwise tests for linkage disequilibrium
among loci and exact tests for the HWE were nonsignifi-
cant after applying sequential Bonferroni correction.
The 50 -anchored approach described in this study should
be applicable to different types of di-, tri,- and tetra-
nucleotide repeats and to any genome containing abundant
microsatellites. Furthermore, the simplicity of the ISSR
cloning technique means that polymorphic markers can be
generated quickly without the need for enrichment and/or
hybridization screening. These novel polymorphic micro-
satellites developed in the present study would be
candidate codominant markers with sufficient level of
polymorphism to study the fine-scale population genetic
structure and conservation genetics of B. pectinirostris.
Acknowledgments We are grateful to Ms. Sang-Ni Lu, Mr. Ding
He, Ms. Qi Ding, Mr. Qing-Hui Meng and Mr. Wei Feng for the help
in lab work. This research was supported by the grants from Shanghai
Leading Academic Discipline Project (S30701, Y1101).
References
Akihito SK, Ikeda Y, Iwata A (2000) Suborder gobioidei. In: Nakabo
T (ed) Fishes of Japan with pictorial keys to the species. Tokai
University Press, Tokyo, pp 1139–1628 (in Japanese)
Brachet S, Jubier MF, Richard M, Jung-Muller B, Frascaria-Lacoste
N (1999) Rapid identification of microsatellite loci using 50 -
anchored PCR in the common ash Fraxinus excelsior. Mol Ecol
8:157–168
Excoffier L, Laval G, Schneider S (2005) ARLEQUIN (version 3.0):
an integrated software package for population genetics data
analysis. Evol Bioinform Online 1:47–50
Fisher PJ, Gardner RC, Richardson TE (1996) Single locus micro-
satellites isolated using 50 -anchored PCR. Nucleic Acids Res
24:4369–4371. doi:10.1093/nar/24.21.4369
Jin CH, Zhong AH, Huang FY, Zhang CD, Li MY (2004) The
research on genetic diversity of Boleophthalmus pectinirostris L.
from natural population by RAPD method. Mar Sci 12:26–30
Kanemori Y, Takegaki T, Natsukari Y (2006) Genetic population
structure of Boleophthalmus pectinirostris inferred from mito-
chondrial DNA sequences. Jpn J Ichthyol 53:133–141
Liu ZZ, Yang JQ, Wang ZQ, Tang WQ (2009) Genetic structure and
population history of Boleophthalmus pectinirostris in Yangtze
River Estuary and its southern adjacent regions. Zool Res 1:1–10
Murdy EO (1989) A taxonomic revision and cladistic analysis of the
oxudercine gobies (Gobiaidae: Oxudercinae). Rec Aust Mus
Suppl 11:1–93
O’Connell M, Wright M (1997) Microsatellite DNA in fishes. Rev
Fish Biol Fish 7:331–363. doi:10.1023/A:1018443912945
Provan J, Wilson PJ (2007) Development of microsatellites for the
peat moss Sphagnum capillifolium using ISSR cloning. Mol Ecol
Notes 7:254–256. doi:10.1111/j.1471-8286.2006.01572.x
Rice WR (1989) Analyzing tables of statistical tests. Evol Int J Org
Evol 43:223–225. doi:10.2307/2409177
Rozen S, Skaletsky HJ (2000) Primer 3 on the WWW for general
users and for biologist programmers. In: Krawetz S, Misener S
(eds) Bioinformatics methods and protocols: methods in molec-
ular biology. Humana Press, Totowa, pp 365–386
Sambrook J, Russell DW (2001) Molecular cloning: a laboratory
manual, 3rd edn. Cold Spring Harbor Laboratory Press, New
York
Zhang QY, Hong WS (2006) Review and prospect of mudskipper
Boleophthalmus pectinirostris studies. J Xiamen Univ (Natural
Science) Sup 2:97–108
123