ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Jan. 2005, p. 144–147 Vol. 49, No.

1
0066-4804/05/$08.00⫹0 doi:10.1128/AAC.49.1.144–147.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

New Multiplex PCR for Rapid Detection of Isoniazid-Resistant

Mycobacterium tuberculosis Clinical Isolates
Laura Herrera-León,* Tamara Molina, Pilar Saı́z, Juan Antonio Sáez-Nieto, and
Maria Soledad Jiménez
Mycobacterial Reference Laboratory, Servicio de Bacteriologı́a, Centro Nacional de Microbiologı́a,
Instituto de Salud Carlos III, Madrid, Spain
Received 4 February 2004/Returned for modification 26 June 2004/Accepted 11 September 2004

In this study, we describe a multiplex PCR to detect a AGC3ACC (serine to threonine) mutation in the katG
gene and a ⴚ15 C-to-T substitution (inhACⴚ15T) at the 5ⴕ end of a presumed ribosome binding site in the
promoter of the mabA-inhA operon. These mutations have been reported in the majority of previous studies as
the most frequent mutations involved in the resistance to isoniazid (INH) of Mycobacterium tuberculosis clinical
strains with high levels of resistance. The method was optimized and validated after an analysis of 30 M.
tuberculosis clinical isolates with known sequences of the relevant part of the katG gene and the regulatory
region of the mabA-inhA operon. We analyzed 297 INH-resistant M. tuberculosis isolates collected in Spain from
1996 to 2003 by PCR-restriction fragment length polymorphism (using the katG gene), DNA sequencing, and
the newly developed multiplex PCR. The results were concordant for all 297 isolates tested. The analysis
revealed that 204 (68.7%) of the isolates carried one or both of the mutations. This finding suggests that with
further development this multiplex PCR will be able to detect the majority of the INH-resistant M. tuberculosis
clinical isolates from Spain and other countries where a high frequency of similar mutations occur.

Currently, throughout the world, isoniazid (INH) and ri-
fampin (RIF) together represent the backbone of short-course
chemotherapy for Mycobacterium tuberculosis infections. The
number of multidrug-resistant strains of M. tuberculosis, de-
fined as resistant to INH and RIF, has been increasing over the
years, and several outbreaks have been reported (5, 9, 24). The
development of resistance to these two drugs reduces the ef-
ficacy of standard antituberculosis (anti-TB) treatment to 77%.
It is very important, therefore, to identify these strains as soon
as possible to allow for adjustments in treatment and to min-
imize the transmission of drug-resistant strains. Phenotypic
drug susceptibility testing by conventional methods on solid
media (6, 8) requires 10 to 30 days after the primary culture
has been isolated. This time can be reduced by the use of rapid
methods such as BACTEC, which requires 5 to 10 days.
Resistance to RIF has been shown to be caused by an alter-
ation of the ␤ subunit of RNA polymerase, which is encoded by
the rpoB gene. More than 95% of RIF-resistant strains are
associated with mutations within an 81-bp region of the rpoB
gene (encoding the RNA polymerase ␤ subunit). Specific mu-
tations, insertions, and deletions have been described in sev-
eral countries by several authors, and this 81-bp region has
been termed the rifampin resistance determinant region (7, 14,
20, 26, 27, 30). Numerous methods exist to detect resistance to
rifampin (10, 12, 18, 23).
In contrast, resistance to INH is more complicated, as mu-
tations in several genes can lead to drug resistance. For most
INH-resistant strains, mutations have been found in two genes,
i.e., the katG gene, encoding catalase-peroxidase (31), and the
* Corresponding author. Mailing address: Instituto de Salud Carlos
III, Laboratorio de Referencia de Micobacterias, 28820 Majadahonda,
Madrid, Spain. Phone: (34) 918223642. Fax: (34) 915097966. E-mail:
lherrera@isciii.es.
mabA-inhA regulon (4), encoding a target of activated pro-
drug, enoyl-acyl carrier protein reductase (1–3, 11, 13, 15, 17,
21, 27). For some other INH-resistant strains, however, muta-
tions in the ahpC promoter region (located in the 105-bp
oxyR-ahpC intergenic region) or within the ␤-ketocyl acyl car-
rier protein synthase gene kasA have also been reported (19,
25). Most studies have examined the mutations present in
these genes by DNA sequencing or analyses of a portion of the
katG gene after PCR amplification and digestion with the
restriction enzyme MspI or SatI (2, 3, 17).
Molecular methods have been developed to detect resis-
tance to INH and RIF as an alternative to conventional tests
because of their ability to provide results rapidly. Upon the
elucidation of the genes involved in resistance to RIF and INH,
several studies describing various PCR-based molecular ge-
netic techniques for the detection of resistance were published
(12).
In the present study, we report a simple, rapid, and inexpen-
sive assay based on allele-specific PCR methodology targeting
an AGC3ACC mutation in the katG gene and an inhAC⫺15T
mutation in the regulatory region of the mabA-inhA operon to
detect INH-resistant M. tuberculosis strains and to identify the
M. tuberculosis complex in the same PCR tube for each sample.
MATERIALS AND METHODS
Description of study samples. (i) Set one. Thirty M. tuberculosis strains with
known sequences for the relevant part of the katG gene and the regulatory region
of the mabA-inhA operon served as samples for optimization of the PCR assay
conditions. The strains had the following distribution of katG and mabA-inhA
operon alleles: wild type, 6 strains; AGC3ACC mutation, 10 strains; inhAC⫺15T
mutation, 10 strains; and both the AGC3ACC and inhAC⫺15T mutations, 4
strains.
(ii) Set two. A total of 297 isolates collected from 1996 to 2003 in Spain and
identified as INH-resistant M. tuberculosis strains by standard biochemical meth-
ods served to validate the developed multiplex PCR assay. Susceptibility testing
with INH (0.2 and 1.0 ␮g/ml) was performed with Lowenstein-Jensen medium by

144
VOL. 49, 2005 RAPID DETECTION OF INH-RESISTANT M. TUBERCULOSIS
FIG. 1. Schematic presentation of multiplex allele-specific PCR to
detect the AGC3ACC mutation in codon 315 of the katG gene
(A) and the ⫺15 C-to-T substitution (inhAC⫺15T) at the 5⬘ end of a
presumed ribosome binding site in the promoter of the mabA-inhA
operon (B). Short arrows indicate the primers, and long double-
headed arrows depict the resulting PCR fragments. The targeted se-
quences are shown in shaded boxes. The mutated bases are underlined
and in bold, and the mutated bases are underlined.
the proportional method of Canetti et al. (6). A total of 50 M. tuberculosis strains
that were susceptible to isoniazid were used as controls.
Extraction of DNAs for PCR. DNAs were extracted from cultures grown in
Lowenstein-Jensen medium. A loop of culture was suspended in 500 ␮l of
distilled water and boiled for 5 min, followed by centrifugation for 5 min at
12,000 ⫻ g, and 5 ␮l of the supernatant was used as a source of genomic DNA
for amplification of the katG gene and the mabA-inhA operon.
PCR-RFLP. katG restriction fragment length polymorphism (RFLP) analysis
to detect codon 315 mutations was performed by the use of previously described
protocols and reaction components (23). A 620-bp region of the katG gene was
amplified by use of the following primer set described by Uhl et al. (28): katG904,
5⬘-AGCTCGTATGGCACCGGAAC; and katG1523, 5⬘-TTGACCTCCCACCC
GACTTG. After amplification, 10 ␮l of the product was digested with MspI
(MBI Fermentas, Madrid, Spain) and analyzed by 2% MS8 agarose (8066;
Pronadisa, Madrid, Spain) gel electrophoresis. Ten microliters of the same katG-
specific PCR product was digested with SatI (MBI Fermentas) and analyzed in
the same run with products generated by restriction with MspI (Fig. 1). SatI
contains an overlapping GC sequence at a single recognition site of the triplet
AGC at position 315, and any mutation at this position eliminates cleavage of the
katG fragment.
PCR and DNA sequencing. For PCRs and DNA sequencing, specially de-
signed primers (for regions in the katG gene and the regulatory region of the
mabA-inhA operon that are known to confer resistance to M. tuberculosis) were
used to amplify genomic DNAs. These primers were designed from a published
sequence of the M. tuberculosis H37Rv genome (GenBank) by the use of
PCGENE software (IntelliGenetics, Mountain View, Calif.).
PCRs were performed with a pureTaq Ready-To-Go PCR bead kit (Amer-
sham Biosciences, Piscataway, N.J.). PCRs were performed in a 9600 thermocy-
cler (Perkin-Elmer) under the same PCR conditions for both katG and mabA-
inhA (an initial denaturation step of 5 min at 94°C, followed by 30 cycles of 1 min
at 94°C, 1 min at 65°C, and 90 s at 72°C and ending with a final elongation step
of 10 min at 72°C). Efficient PCR amplifications were confirmed by gel electro-
phoresis in 0.7% MS8 agarose gels (8066; Pronadisa). PCR products were pu-
rified by use of a GFX PCR DNA and gel band purification kit (Amersham
Biosciences) and were sequenced by use of a Big Dye Terminator cycle sequenc-
ing ready reaction kit (Applied Biosystems Inc., Foster City, Calif.) in an ABI
Prism 377 automated DNA sequencer (Applied Biosystems). The following
thermocycler parameters were used: denaturation at 94°C for 3 min, followed by
25 cycles of denaturation at 96°C for 10 s and primer annealing at 60°C for 4 min.
The primer sequences are shown in Table 1.
All sequence data were assembled and edited electronically with the
EDITSEQ, ALIGN, and MEGALIGN programs (DNASTAR, Madison, Wis.)
and were compared with the published sequences for the katG gene and the
mabA-inhA operon (GenBank accession number NC_000962).
Multiplex PCR. Specially designed primers were used to detect the
AGC3ACC and inhAC⫺15T mutations. The reverse primer R315mut was posi-
tioned so that its 3⬘-OH end paired with two changed bases, i.e., a GC-to-CT
substitution (Fig. 1A). Consequently, in the presence of the AGC3ACC muta-
tion at this position in katG, a 296-bp fragment was amplified by the forward
145
TABLE 1. Primer sequences
Primer
Primer target or type Sequence
designation
Sequencing primers
katG katGF GTGCCCGAGCAACACCCACC
katGR CGCACGTCGAACCTGTCGAGG
mabA-inhA mabAF CGAAGTGTGCTGAGTCACACCG
inhAR CCCCACCGAAATGCAGGTCG
Multiplex PCR primers
gyrB MTUBf TCGGACGCGTATGCGATATC
MTUBr ACATACAGTTCGGACTTGCG
katG katg0F GCAGATGGGGCTGATCTACG
R315mut TCCATACGACCTCGATGCCAG
mabA-inhA mabAF CGAAGTGTGCTGAGTCACACCG
inhARmut AGTCACCCCGACAACCTATTA
primer katg0F (described previously by Mokrousov et al. [22]). On the other
hand, the reverse primer inhARmut was positioned so that its 3⬘-OH end paired
with two changed bases, a ⫺15 C-to-T substitution (inhAC⫺15T) and a ⫺14
G-to-A substitution at the 5⬘ end of a presumed ribosome binding site in the
promoter of the mabA-inhA operon (Fig. 1B). If the inhAC⫺15T mutation oc-
curred, a 146-bp fragment was amplified by the forward primer mabAF. In the
absence of a mutation, the result would be two mismatches at the 3⬘ end of the
reverse primers (R315mut and inhARmut). Thus, under appropriate PCR con-
ditions, resistant strains with these two mutations resulted in 296-bp and/or
146-bp PCR products. The MTUBf and MTUBr primers (previously reported by
Kasai et al. [16]) produced a 1,020-bp fragment by amplification of a partial
sequence of the gyrB gene. This fragment was the individual positive control and
needed to be present in every sample. The absence of this amplification product
would show that the PCR was inhibited and that the result should be ignored.
The PCR mix consisted of 10 mM Tris-HCl (pH 9), 50 mM KCl, 1.5 mM
MgCl2, a 200 ␮M concentration of each deoxynucleoside triphosphate, 2.5 U of
pureTaq DNA polymerase and reaction buffer, which were included in the
pureTaq Ready-To-Go PCR bead kit (Amersham Biosciences), and PCR prim-
ers to a final volume of 25 ␮l. The concentrations of the primers were 200 mM
for katG0F and 400 mM for R315mut (to detect the AGC3ACC mutation), 400
mM for both mabAF and inhARmut (to detect the inhAC⫺15T mutation), and
400 mM for both MTUBf and MTUBr. All primer sequences are shown in Table
1.
For PCRs, a GenAmp PCR system 9600 thermocycler (Applied Biosystems)
was used, beginning with a 5-min denaturation at 95°C and followed by 30 cycles
of 1 min at 95°C, 1 min at 68°C, and 45 s at 72°C. The final cycle was followed
by an extension time of 10 min at 72°C. Efficient PCR amplifications and the sizes
of the products were estimated after electrophoresis in 2% agarose gels by
staining with ethidium bromide.
RESULTS AND DISCUSSION
An analysis of 297 INH-resistant and 50 INH-susceptible M.
tuberculosis clinical isolates from TB cases by katG PCR-RFLP
and automated DNA sequencing showed that none of the 50
INH-susceptible strains had the AGC3ACC mutation
(S315T) at codon 315 of katG or the less frequent mutations in
that codon. The AGC3ACC missense mutation was observed
in 130 (43.8%) INH-resistant strains by PCR-RFLP with an
MspI endonuclease treatment (Fig. 2, lanes 2 and 3), and 17
INH-resistant strains showed a different mutation in codon 315
by PCR-RFLP with a SatI endonuclease treatment (Fig. 2,
lanes 10 and 11). The use of the MspI endonuclease only
detected the AGC3ACC mutation, whereas SatI was able to
detect any mutation in codon 315 that affected the GC nucle-
otides at that position. Of the 17 strains with different muta-
tions, 12 (4.0%) showed an AGC3AAC mutation at codon
315 of katG and 5 (1.7%) showed an AGC3ACA mutation by
automated DNA sequencing. The results are summarized in
Table 2.
146 HERRERA-LEÓN ET AL. ANTIMICROB. AGENTS CHEMOTHER.

FIG. 2. Profiles generated by PCR-restriction digestion with MspI
and SatI endonucleases. Lanes 1 to 6, strains digested with MspI; lane
1, wild-type strain; lane 2, AGC3ACC mutation (S315T); lane 3,
S315T mutation and R463L polymorphism; lane 4, AGC3AAC mu-
tation at katG codon 315; lane 5, AGC3ACA mutation at katG codon
315; lane 6, wild type; lanes 7 to 12, the same strains digested with the
SatI endonuclease; M, 50-bp DNA ladder (Amersham Biosciences).
FIG. 3. Profiles generated by multiplex PCR assay. Lanes 1 to 4,
strains with the AGC3ACC mutation at katG codon 315; lanes 5 to
13, strains with the ⫺15C3T substitution in the promoter of the
mabA-inhA operon; lanes 14 to 15, strains with both mutations; lanes
16 to 18, INH-susceptible strains; M, 100-bp DNA ladder (Bio Tools).

C⫺15T
The inhA mutation was found in 70 (23.6%) INH-
resistant isolates, with 4 of these strains showing the
AGC3ACC mutation as detected by PCR-RFLP, and in none
of the 50 INH-susceptible strains (Table 2).
The multiplex PCR that we developed was evaluated for its
detection of the AGC3ACC mutation in codon 315 of the
katG gene and the inhAC⫺15T mutation in the promoter of the
mabA-inhA operon in the same PCR tube for each sample.
The 130 INH-resistant strains with the AGC3ACC mutation
produced a 296-bp band (Fig. 3, lanes 1 to 4), while the 70
strains with the inhAC⫺15T mutation produced a 146-bp band
(Fig. 3, lanes 5 to 12). The four strains with both mutations
produced two bands, one at 296 bp and the other at 146 bp
(Fig. 3, lanes 13 and 14). All of the strains, including the
susceptible strains (Fig. 2, lanes 16 to 18), produced a 1,020-bp
band by amplification of a partial sequence of the gyrB gene.
The multiplex PCR results were concordant with those gener-
ated by PCR-RFLP analysis and DNA sequencing for all of the
strains tested (Table 2). The specificity of the multiplex PCR
for the detection of INH resistance in resistant strains carrying
the AGC3ACC mutation at codon 315 of katG and/or the
inhAC⫺15T mutation in our setting was 100%. The sensitivity of
the multiplex PCR for the detection of INH resistance de-
pended on the prevalence of these two mutations among the
INH-resistant strains in each geographic area. In our setting,
the sensitivity was 68.7%. The negative predictive value was
35%, and the positive predictive value was 100%. In Spain, the
prevalence rates of the AGC3ACC allele at codon 315 of
katG and of the inhAC⫺15T mutation are 47.2 and 25%, re-
spectively (unpublished data), whilst other mutations in codon
315 are found in 6.6% of INH-resistant strains. Consequently,
72.2% of the INH-resistant strains in our country could be
detected with the multiplex PCR.
Mutations at the Ser315 codon of katG and at the regulatory
region of the mabA-inhA operon occur most frequently in
INH-resistant isolates (1–3, 11, 13, 15, 17, 21, 27). These mu-
tations, AGC3ACC and inhAC⫺15T, respectively, may be re-
sponsible for 70% of INH-resistant M. tuberculosis cases.
The prevalence of mutations in codon 315 of katG varies
depending on the geographical region studied, with percent-
ages ranging from 35% in Beirut (2) to 91% in Latvia and
Russia (21, 27), while the prevalence of the inhAC⫺15T muta-
tion varied from 32.7% in a study by Bakonyte et al. (3) to
3.3% in a study by Van Rie et al. (29), with several studied
strains being similar to those in Bakonyte et al.’s study. Torres
et al. (26) reported that this mutation was found with a fre-
quency of 4.3% in strains isolated from Seville, Spain, but the
present study shows a much higher frequency of 23.6%. The
frequency of other mutations in codon 315 (5.7%) was found
to be lower than those in other studies (1, 11).
The high prevalence of the AGC3ACC mutation in the
katG gene and of the inhAC⫺15T mutation in the promoter of
the mabA-inhA operon in the strains isolated from Spain sug-
gests that the multiplex PCR technique can be used as a single,
rapid tool for detecting INH resistance in M. tuberculosis clin-
ical strains with a high probability. The assay is easy to perform
and interpret and could be implemented as part of the routine

TABLE 2. Comparison of INH susceptibility test results obtained by the different methods used in this study
Susceptibility of strains by indicated methoda
No. of
Proportional PCR-RFLP
strains DNA sequencingc Multiplex PCR
methodb MspI SatI

130 R AGC ⬎ ACC R AGC ⬎ ACC AGC ⬎ ACC

12 R S R AGC ⬎ AAC S
5 R S R AGC ⬎ ACA S
70 R S S inhAC⫺15T inhAC⫺15T
4 R AGC ⬎ ACC R AGC ⬎ ACC ⫹ inhAC⫺15T AGC ⬎ ACC ⫹ inhAC⫺15T
76 R S S S S
50 S S S S S
a
R, resistant; S, susceptible. When indicated, mutations were detected by the various methods.
b
Performed on Lowenstein-Jensen medium.
c
DNA sequencing of the katG gene and the promoter of the mabA-inhA operon.
VOL. 49, 2005 RAPID DETECTION OF INH-RESISTANT M. TUBERCULOSIS
practices of clinical laboratories in areas with a high prevalence
of multidrug-resistant TB strains. For easier and unambiguous
interpretations of multiplex PCR profiles, each run should
include a wild-type strain (as a positive control for no ampli-
fication due to mutation) and one strain with a known muta-
tion (as a positive control of amplification due to mutation).
Furthermore, the procedure is inexpensive and requires only
standard PCR and electrophoresis equipment. However, all
negative results should be confirmed by conventional methods
based on cell culture.
ACKNOWLEDGMENTS
We thank A. Valverde and M. A. Garcı́a-Aranda for excellent tech-
nical assistance and A. Echeita and S. Herrera for their time and
advice. We are indebted to Malcolm Yates for revisions of the English
language in the manuscript.
This work was supported by Instituto de Salud Carlos III (0017/99).
REFERENCES
1. Abate, G., S. E. Hoffner, V. Ostergaard Thomsen, and H. Miöiner. 2001.
Characterization of isoniazid-resistant strains of Mycobacterium tuberculosis
on the basis of phenotypic properties and mutations in katG. Eur. J. Clin.
Microbiol. Infect. Dis. 20:329–333.
2. Ahmad, S., E. Fares, G. F. Araj, T. D. Chugh, and A. S. Mustafa. 2002.
Prevalence of S315T mutation within the katG gene in isoniazid-resistant
clinical Mycobacterium tuberculosis isolates from Dubai and Beirut. Int. J.
Tuberc. Lung Dis. 6:920–926.
3. Bakonyte, D., A. Baranauskaite, J. Cicenaite, A. Sosnovskaya, and P. Satak-
enas. 2003. Molecular characterization of isoniazid-resistant Mycobacterium
tuberculosis clinical isolates in Lithuania. Antimicrob. Agents Chemother.
47:2009–2011.
4. Banerjee, A., E. Dubnau, A. Quemard, U. Balasubramanian, K. S. Um, T.
Wilson, D. Collins, G. Lisle, and W. R. Jacobs, Jr. 1994. inhA, a gene
encoding a target for isoniazid and ethionamide in Mycobacterium tubercu-
losis. Science 263:227–230.
5. Bifani, P. J., B. Plikaytis, V. Kapur, K. Stockbauer, X. Pan, M. L. Lutfey,
S. L. Moghazeh, W. Eisner, T. M. Daniel, M. H. Kaplan, J. T. Crawford,
J. M. Musser, and B. N. Kreiswirth. 1996. Origin and interstate spread of
New York City multidrug-resistant Mycobacterium tuberculosis clone family.
JAMA 275:452–457.
6. Canetti, G., N. Rist, and J. Grosset. 1963. Mesure de la sensibilité du bacilli
tuberculeux aux drogues antibactériens port le méthode des proportions.
Rev. Tuberc. Pneumol. 27:217–272.
7. Cavusoglu, C., S. Himioglu, S. Guneri, and A. Bilgic. 2002. Characterization
of rpoB mutations in rifampin-resistant clinical isolates of Mycobacterium
tuberculosis from Turkey by DNA sequencing and line probe assay. J. Clin.
Microbiol. 40:4435–4438.
8. Collins, C. H., J. M. Grange, and M. D. Yates. 1997. Tuberculosis bacteri-
ology: organization and practice. Butterworth-Heinemann, Oxford, United
Kingdom.
9. Davies, P. D. 2003. The worldwide increase in tuberculosis: how demo-
graphic changes, HIV, infection and increasing numbers in poverty are
increasing tuberculosis. Ann. Med. 35:235–243.
10. De Beenhouwer, H., Z. Liang, G. Jannes, W. Mijs, L. Machtelinckx, R.
Rossau, H. Traore, and F. Portaels. 1995. Rapid detection of rifampin
resistance in sputum and biopsy specimens from tuberculosis patients by
PCR and line probe assay. Tuberc. Lung. Dis. 76:425–430.
11. Dobner, P., S. Rüsch-Gerdes, G. Bretzel, K. Felsmann, M. Rifai, T. Löscher,
and H. Hinder. 1997. Usefulness of Mycobacterium tuberculosis genomic
mutations in the genes katG and inhA for the prediction of isoniazid resis-
tance. Int. J. Tuberc. Lung Dis. 1:365–369.
12. Garcı́a de Viedma, D. 2003. Rapid detection of resistance in Mycobacterium
tuberculosis: a review discussing molecular approaches. Clin. Microbiol. In-
fect. 9:349–359.
13. Haas, W. H., K. Schilke, J. Brand, B. Amthor, K. Weyer, P. Fourie, G.
Bretzel, V. Sticht-Groh, and H. Bremer. 1997. Molecular analysis of katG
gene mutations in strains of Mycobacterium tuberculosis complex from Africa.
Antimicrob. Agents Chemother. 41:1601–1603.
147
14. Herrera, L., M. S. Jiménez, A. Valverde, M. A. Garcı́a-Aranda, and J. A
Sáez-Nieto. 2003. Molecular analysis of rifampin-resistant Mycobacterium
tuberculosis isolated in Spain (1996–2001). Description of new mutations in
the rpoB gene and review of the literature. Int. J. Antimicrob. Agents 21:
403–408.
15. Herrera, L., A. Valverde, P. Saı́z, J. A. Saéz-Nieto, J. L. Portero, and M. S.
Jiménez. 2004. Molecular characterization of isoniazid-resistant Mycobacte-
rium tuberculosis clinical strain isolates in The Philippines. Int. J. Antimicrob.
Agents 23:572–576.
16. Kasai, H., T. Ezaki, and S. Harayama. 2000. Differentiation of phylogeneti-
cally related slowly growing mycobacteria by their gyrB sequences. J. Clin.
Microbiol. 38:301–308.
17. Kiepiela, P., K. S. Bishop, A. N. Smith, L. Roux, and D. F. York. 2000.
Genomic mutations in the katG, inhA and ahpC genes are useful for the
prediction of isoniazid resistance in Mycobacterium tuberculosis isolates from
Kwazululu Natal, South Africa. Tuberc. Lung Dis. 80:47–56.
18. Kim, B., K. Lee, B. Park, S. Kim, E. Park, Y. Park, G. Bai, S. Kim, and Y.
Kook. 2001. Detection of rifampin-resistant Mycobacterium tuberculosis in
sputa by nested PCR-linked single-strand conformation polymorphism and
DNA sequencing. J. Clin. Microbiol. 39:2610–2617.
19. Lee, A. S. G., I. H. K. Lim, L. L. H. Tang, A. Telenti, and S. Y. Wong. 1999.
Contribution of kasA analysis to detection of isoniazid-resistant Mycobacte-
rium tuberculosis in Singapore. Antimicrob. Agents Chemother. 43:2087–
2089.
20. Mani, C., N. Selvakumar, S. Narayanan, and P. R. Narayanan. 2001. Mu-
tations in the rpoB gene of multidrug-resistant Mycobacterium tuberculosis
clinical isolates from India. J. Clin. Microbiol. 39:2987–2990.
21. Martilla, H., H. Soini, E. Eerola, E. Vyshnevskaya, B. Vyshnevskiy, T. Otten,
A. Vasilyef, and M. Viljanen. 1998. A Ser315Thr substitution in KatG is
predominant in genetically heterogeneous multidrug-resistant Mycobacte-
rium tuberculosis isolates originating from the St. Petersburg area in Russia.
Antimicrob. Agents Chemother. 42:2443–2445.
22. Mokrousov, I., T. Otten, A. Vyazovaya, E. Limeschenko, M. L. Filipenko, C.
Sola, N. Rastogi, L. Steklova, B. Vyshnevskiy, and O. Narvskaya. 2003.
PCR-based methodology for detecting multidrug-resistant strains of Myco-
bacterium tuberculosis Beijing family circulating in Russia. Eur. J. Clin. Mi-
crobiol. Infect. Dis. 22:342–348.
23. Nachamkin, I., C. Kang, and P. Weinstein. 1997. Detection of resistance to
isoniazid, rifampin and streptomycin in clinical isolates of Mycobacterium
tuberculosis by molecular methods. Clin. Infect. Dis. 24:894–900.
24. Narvskaya, O., T. Otten, E. Limeschenco, N. Sapozhnikova, N. Graschen-
kova, L. Steklova, A. Nikonova, M. L. Filipenko, I. Mokrousov, and B.
Vyshnevskiy. 2002. Nosocomial outbreak of multidrug-resistant tuberculosis
caused by a strain of Mycobacterium tuberculosis W-Beijing family in St.
Petersburg, Russia. Eur. J. Clin. Microbiol. Infect. Dis. 21:596–602.
25. Sreevatsan, S., X. Pan, Y. Zhang, V. Deretic, and J. M. Musser. 1997.
Analysis of the oxyR-ahpC region in isoniazid-resistant and -susceptible My-
cobacterium tuberculosis complex organisms recovered from diseased hu-
mans and animals in diverse localities. Antimicrob. Agents Chemother. 41:
600–606.
26. Torres, M. J., A. Criado, N. Gónzalez, J. C. Palomares, and J. Aznar. 2002.
Rifampin and isoniazid resistance associated mutations in Mycobacterium
tuberculosis clinical isolates in Sevilla, Spain. Int. J. Tuberc. Lung Dis. 6:160–
163.
27. Tracevska, T., I. Jansone, L. Broka, O. Marga, and V. Baumanis. 2002.
Mutations in the rpoB and katG genes leading to drug resistance in Myco-
bacterium tuberculosis in Latvia. J. Clin. Microbiol. 40:3789–3792.
28. Uhl, J. R, B. Kline, and L. Abu-Khader. 1995. Association of two point
mutation in the catalase-peroxidase (katG) gene of Mycobacterium tubercu-
losis with isoniazid resistance, abstr. U46, p. 125. Abstr. 95th Gen. Meet. Am.
Soc. Microbiol. 1995. American Society for Microbiology, Washington, D.C.
29. Van Rie, A., R. Warren, I. Mshanga, A. M. Jordaan, G. D. Van der Spuy, M.
Richardson, J. Simpson, R. P. Gie, D. A. Enarson, N. Beyers, P. D. Van
Helden, and T. C. Victor. 2001. Analysis for a limited number of gene codons
can predict drug resistance of Mycobacterium tuberculosis in a high-incidence
community. J. Clin. Microbiol. 39:636–641.
30. Yue, J., W. Shi, J. Xie, Y. Li, E. Zeng, and H. Wang. 2003. Mutation in the
rpoB gene of multidrug-resistant Mycobacterium tuberculosis isolates from
China. J. Clin. Microbiol. 41:2209–2212.
31. Zhang, Y., B. Heym, B. Allen, D. Young, and S. T. Cole. 1992. The catalase
peroxidase gene and isoniazid resistance in Mycobacterium tuberculosis. Na-
ture 358:501–593.