ARTICLES

New helicase-primase inhibitors as drug candidates for the

treatment of herpes simplex disease

GERALD KLEYMANN, RÜDIGER FISCHER, ULRICH A.K. BETZ, MARTIN HENDRIX,

WOLFGANG BENDER, UDO SCHNEIDER, GABRIELE HANDKE, PETER ECKENBERG, GUY HEWLETT,
VENIAMIN PEVZNER, JUDITH BAUMEISTER, OLAF WEBER, KERSTIN HENNINGER, JÖRG KELDENICH,
© 2002 Nature Publishing Group http://medicine.nature.com

AXEL JENSEN, JÖRG KOLB, UTE BACH, ANDREAS POPP, JUTTA MÄΒEN, ISABELLE FRAPPA,
DIETER HAEBICH, OSWALD LOCKHOFF & HELGA RÜBSAMEN-WAIGMANN

Bayer AG, Pharma Research, Wuppertal, Germany

Correspondence should be addressed to G.K.; email: gerald.kleymann@freenet.de

The vast majority of the world population is infected with at least one member of the human
herpesvirus family. Herpes simplex virus (HSV) infections are the cause of cold sores and genital
herpes as well as life-threatening or sight-impairing disease mainly in immunocompromized pa-
tients, pregnant women and newborns. Since the milestone development in the late 1970s of
acyclovir (Zovirax), a nucleosidic inhibitor of the herpes DNA polymerase, no new non-nucleo-
sidic anti-herpes drugs have been introduced. Here we report new inhibitors of the HSV heli-
case-primase with potent in vitro anti-herpes activity, a novel mechanism of action, a low
resistance rate and superior efficacy against HSV in animal models. BAY 57-1293
(N-[5-(aminosulfonyl)-4-methyl-1,3-thiazol-2-yl]-N-methyl-2-[4-(2-pyridinyl)phenyl]acetamide),
a well-tolerated member of this class of compounds, significantly reduces time to healing, pre-
vents rebound of disease after cessation of treatment and, most importantly, reduces frequency
and severity of recurrent disease. Thus, this class of drugs has significant potential for the treat-
ment of HSV disease in humans, including those resistant to current medications.

Eight human herpesviruses (HHV1 to HHV8) have been identi-
fied so far1. One key feature of these viruses is their ability to re-
main latent in their host after primary infection and to
reactivate intermittently from a pool of latently infected cells
upon diverse internal and external stimuli. The HHV genomes
(dsDNA ≈ 125–230 kb in size) code for more than 50 genes that
are essential for viral replication in vitro and/or in vivo and many
viral gene products are potential targets for antiviral therapy.
High-sequence homologies have been identified in HHV genes
encoding the helicase-primase enzyme complex, which is es-
sential for DNA and viral replication2.
Acyclovir (trade name Zovirax)3, developed in the late 1970s,
was the first specific and selective antiviral drug. Newer nucleo-
sidic drugs4 that are chemically related to acyclovir, such as pen-
ciclovir or their pro-drugs valacyclovir (Valtrex) and
famcyclovir (Famvir), were launched in the mid 1990s.
However, nucleosides are pro-drugs that have to be phosphory-
lated by the viral thymidine kinase (TK) and subsequently by
cellular kinases in order to inhibit the viral DNA polymerase. If
the virus does not express a functional TK (for example, a resis-
tant HHV1 strain or TK– viruses such as human cy-
tomegalovirus) or if the DNA polymerase does not have the
optimal primary structure, the potency of the drug diminishes,
the selectivity index is significantly smaller, higher doses have
to be administered and adverse effects are more likely to be as-
sociated with treatment. Until now, nucleosides were the only
compound class available for systemic treatment of herpes dis-
ease and resistance was developing in the growing number of
immunocompromized patients. Thus, potent anti-herpes activ-
ity, efficacy (especially upon delayed treatment), safety and lack
of cross-resistance to nucleosides were the key criteria in the
search for the next generation of drugs directed against novel
targets of herpesviruses.
Identification and optimization of antiviral compounds
We have used a new fluorometric high-throughput screening
(HTS) assay to identify active and tolerable substances in com-
pound libraries that inhibit any target essential for viral replica-
tion in cell culture5,6. Efficacy of a test sample is measured by
assessing the viability and proliferation of surviving cells in a
herpes simplex virus (HSV)-infected cell culture with a fluores-
cent dye at the time when cell viability in the virus (no-drug)
control approaches zero. Approximately 4.2 × 105 compounds
were tested at a concentration of 10 µM and several compound
classes with antiviral activity were discovered. Starting with the
identified compound BAY 38-9489 (ref. 5), several thousand
analogs and new compounds were synthesized during consecu-
tive optimization cycles of synthesis, biological profiling and
modeling techniques to optimize the thiazole urea BAY 38-9489
to the lead structure BAY 44-5138 (ref. 5). BAY 44-5138 showed
first in vivo activity, and finally BAY 57-1293 (ref. 6) was opti-
mized and selected for pre-clinical development (Tables 1 and
2). The structure–activity relationship (SAR) and selected exam-
ples that illustrate the progress during the optimization phase
are summarized in Table 1 and 2 and briefly outlined below.
SAR of the novel herpes inhibitors
Replacement of the morpholino group in BAY 44-5138 by a
phenyl ring and the observation that BAY 44-5138 is demethy-
lated in vivo led to BAY 51-3295, the first compound that was

392 NATURE MEDICINE • VOLUME 8 • NUMBER 4 • APRIL 2002

 ARTICLES

Fig. 1 Antiviral effect of inhibitors in vitro. Dose-dependent anti-herpes ac-

tivity of the screening hit BAY 38-9489 (IC50 = 0.5 µM) and development
candidate BAY 57-1293 (IC50 = 20 nM) compared with acyclovir (IC50 = 1
µM) determined with the fluorescence-based cytopathogenicity assay5,6. The
quotient of relative fluorescence units of an infected well in the presence of
test sample and the uninfected cell control is shown in percentage.
Representative results of 10 experiments are shown. The s.d. for a given con-
centration is generally between 2–8% and at concentrations approaching
the IC50 values, less than 25%. , acyclovir, HSV-1 F; , BAY 38-9489 HSV-1
F; , BAY 57-1293 HSV-1 F; , BAY 57-1293 HSV-1 clinical isolate; , BAY
57-1293 HSV-2 clinical isolate.
© 2002 Nature Publishing Group http://medicine.nature.com

methyl-2-[4-(2-pyridinyl)phenyl]acetamide with the sum for-

mula C18H18N4O3S2 and a molar mass of 402.5 g/mol. The com-
pound is a stable white powder at room temperature with a
more potent than valacyclovir in vivo. Exchanging the urea moi- melting point of 193 °C (decomposition).
ety with an amide group (BAY 54-6322) and introduction of the
primary sulfonamide resulted in BAY 56-1655, a remarkably po- Biological and medicinal profile of BAY 57-1293
tent compound in vitro (50% inhibitory concentration (IC50) < The concentration at which a drug reduced cytopathic effects
0.01 µM (HSV-1 F and HSV-2 G) and in vivo (50% effective dose (CPE) of viral replication (IC50) or cell viability (Tox50) in cell
(ED50) = 0.5 mg/kg (HSV-1 Walki) and 1.1 mg/kg (HSV-2 MS)). culture by 50% as well as the selectivity index (SI = Tox50/IC50), a
However, solubility of the compounds BAY 51-3295 and BAY 56- measure of tolerability in vitro, are listed in Table 1. The first
1655 was too low for simple intravenous formulation. The 2- identified compound, BAY 38-9489, was tolerable over a broad
pyridyl substituent in para-position of the phenyl ring in BAY concentration range and at least as active as acyclovir in vitro
57-1293 solved this problem and this compound was selected for (Fig. 1). The IC50 of the optimized compound BAY 57-1293 was
in-depth characterization of its biophysical properties as well as determined to be 0.012 ± 0.004 µM (median, sextuplicate exper-
its pharmacokinetic, pharmacodynamic and safety profiles. iment). The results of the fluorescence-based assay5,6 are compa-
rable with those obtained from conventional cytopathogenicity
Physical and chemical properties of BAY 57-1293 or plaque reduction assays7–9. The inhibitory dose (ID50), in-
The systematic name of BAY 57-1293 within the IUPAC nomen- hibitory or effective concentration (IC50 or EC50) of the plaque
clature is N-[5-(aminosulfonyl)-4-methyl-1,3-thiazol-2-yl]-N- reduction assay or the cytopathogenicity assay denotes the drug

Table 1 Pharmacological profile of the helicase primase inhibitors

In vitro viral replication assay

Acyclovir-resistant HSV-1 F Sequencing ATPase inhibition*
Compound Structural HSV-1 F HSV-1 F HSV-2 G HSV-2 G HSV-1 F mutant Mutants Resistance Results (at 1 mM ATP)
formula IC50 [µM] SI IC50 [µM] SI IC50 [µM] IC50 [µM] Index (RI) mutation(s)# IC50 [nM]
Cl
O

BAY 38-9489 O
N O
N
S
S N
O
0.5 500 0.7 500 0.5
N
N

UL5 M355V
O

BAY 44-5138 O
N O
N
S
S N
O
0.75 350 1.5 167 0.75 >250 >333 UL5 V662I 700
N
N
UL52 A897T

O
BAY 51-3295 O N S N
O
0.001 2.5x105 0.005 25000 0.001 >250 >250000 25
S
N N

BAY 54-6322 O N
O 0.0005 1 × 105 0.05 5000 0.0005 >250 >500000 UL5 K356N 120
S N
N S O >1 >2000 UL52 A897T

>8 >400 UL5 G352V

O
BAY 57-1293 N O

N
N

S
S N
O
0.02 2500 0.02 3000 0.02 >0.1 >5 UL5 M355T 30
>3 >150 UL5 K356Q

Acyclovir 1 250 4 125 125 1 on all no inhibition

BAY mutants <100000

Valtrex Val-acyclovir see Acyclovir see Acyclovir

IC50 (inhibitory concentration) and SI (selective index) values of HSV (wild-type and mutants) were determined at a m.o.i. of 0.0025 on Vero cells. *, The UL5 and UL52 genes of
wild-type HSV-1F were cloned into a Baculovirus expression system and kinetic analysis of the enzyme complex UL5-UL52-6xHis, purified from doubly infected Sf9 cells, revealed
the following kinetic constants with Km (ATP) = 500 µM, Kcat = Vmax/E0 = 362 min–1, and IC50 = 30 nM in the case of BAY 57-1293. Neither the spontaneous hydrolysis of ATP (back-
ground) nor the weak DNA-independent ATPase activity of the enzyme complex is altered in the presence of the thiazolyl amides such as BAY 57-1293 or BAY 56-165516. #, A re-
sistant virus containing 3 mutations was selected in the presence of compound BAY 44-5138, whereas single mutations were observed in the genome of 2 viruses resistant to BAY
54-6322 and 3 viruses resistant to BAY 57-1293.

NATURE MEDICINE • VOLUME 8 • NUMBER 4 • APRIL 2002 393

 ARTICLES
concentration that reduces the number of viral plaques or viral-
induced cytopathogenicity (CPE, lysis or morphological
changes of infected cells) by 50% as compared with the un-
treated control (infected cell culture). The IC50 of the new fluo-
rescence-based cytopathogenicity assay stands for the drug
concentrations that block the decay of the esterase activity of
an infected cell culture in the presence of compound by 50% at
the time when the esterase activity of the untreated control (in-
fected cell layer) approaches zero (signal of control cells divided
by signal of the virus control (infected cells) > 10). The fluores-
© 2002 Nature Publishing Group http://medicine.nature.com
cence signal (esterase activity) corresponds with the number of
vital or viable cells in the test well; figuratively speaking, the
IC50 is the drug concentration at which the microscopic picture
of an infected cell culture in the presence of compound shows
50% CPE. The IC50 values of the plaque reduction assay (IC50
acyclovir = 0.4–0.75 µM; IC50 BAY 57-1293 = 0.01–0.02 µM) and
the conventional cytopathogenicity assay (IC50 acyclovir =
0.5–1.5 µM; IC50 BAY 57-1293 = 0.01–0.03 µM) were determined
for comparison on Vero cells infected with HSV-1 F.
BAY 57-1293 is nearly two orders of magnitude more potent
than acyclovir in vitro and the superiority was even more promi-
nent when the viral load was increased (BAY 57-1293 IC50 =
12 nM, 20 nM and 50 nM; acyclovir IC50 = 1 µM, 3 µM and
10–50 µM at a multiplicity of infection (m.o.i.) of 0.0025, 0.02
and 0.2, respectively). A minor increase in IC50 values at higher
viral loads was observed for all thiazolyl compounds listed in
Table 1. BAY 57-1293 was also active against porcine (IC50 = 5
µM) and bovine (IC50 = 0.12 µM) herpes strains; however, only
weak activity was observed against varicella-zoster virus or
human cytomegalovirus. Inhibition of viral replication in vitro
was completely reversible upon removal of the drug whereas
the delayed addition of inhibitor up to 6–10 hours post-infec-
tion (p.i.) left the IC50 values nearly unchanged. Similar results
upon delayed addition of inhibitor have been reported for acy-
clovir, which indicates that both the thiazolyl and nucleoside
compounds block viral replication during β gene expression, al-
beit as a result of different mechanisms. BAY 57-1293 was active
at an IC50 of 10–30 nM against all clinical isolates of HSV-1
(from 35 patients) and HSV-2 (from 19 patients) tested so far
with near identical IC50 values to those seen with HSV-1 F and
HSV-2 G (Fig. 1 and Table 1) as well as HSV-1 Walki (IC50 = 20
nM) or HSV-2 MS (IC50 = 15 nM). The same antiviral activity was
also observed on permissive cell lines of epithelial (human em-
bryonic lung fibroblasts and normal human diploid fibroblasts)
and neuronal origin (NT-2, HSV-1 F, IC50 = 20 nM) when viral
titers were determined on the respective cell lines and cell cul-
ture conditions were comparable. Finally, BAY 57-1293 was ac-
tive against acyclovir resistant mutants (Table 1), which display
mutations in the TK and/or pol genes10, with nearly identical
IC50 values observed for HSV-1 F or clinical isolates (Fig. 1).
a b
c d
e f
394
Table 2 Antiviral activity of compounds in vivo (10 mice per group)
Compound Lethal challenge model
ED50 [mg/kg], p.o., 3× daily
HSV-1 Walki HSV-2 MS
BAY 38-9489 49 (i.p.)
BAY 44-5138 60 weak
BAY 51-3295 8 11
BAY 54-6322 1 3
BAY 57-1293 0.5 0.5
Acyclovir 22 16
Valacyclovir 17 14
p.o., per os; i.p., intraperitoneal.
Mechanism of action
To elucidate the mechanism of action of the inhibitors pre-
sented here, we analyzed the influence of compounds on indi-
vidual steps of the replication cycle at several time points after
infection. In the presence of BAY 57-1293, the virus still infected
permissive cells and expression of viral immediate early genes
was initiated. However, PCR, Southern-blot and in situ hy-
bridization analyses demonstrated complete inhibition of viral
DNA synthesis. In agreement with these findings, electron mi-
croscopy showed a total absence of DNA-containing C-capsids,
which normally bud from infected cells as enveloped infectious
viruses. Reverse transcriptase (RT)-PCR experiments revealed
that only immediate early genes are expressed normally in the
presence of inhibitor, whereas early and late gene expression is
reduced, suppressed or not initiated (Fig. 2). In parallel to this
line of experiments, 10 drug-resistant HSV mutants were se-
lected in the presence of 0.5–2.0 µM inhibitor. The frequency at
which mutant HSV-1 F viruses appeared in vitro (0.5–4.5 × 10–6) is
at least one order of magnitude lower compared with acyclovir
(1 × 10–3–1 × 10–4)10. When cells were transfected with a variety of
PCR fragments obtained from drug-resistant viruses and subse-
quently infected with wild-type virus in the presence of in-
hibitor, viral plaques were detected only when cells were
transfected with a mutant UL5 or UL52 gene or a mix of mutant
UL5 or UL52 and wild-type UL5, UL8 and UL52 genes, but not
when cells were transfected with a wild-type UL5, UL8 or UL52
gene (data not shown). From these complementation experi-
ments, we concluded that the helicase-primase complex (UL5
and UL52 gene products) is the target of the thiazole ureas and
their corresponding amides. Furthermore, sequencing of the
complete genome of a virus resistant to BAY 54-6322 revealed a
single mutation (UL5, K356N). Sequencing of partial genomes
and individual genes of nine other mutants localized all resis-
tance-conferring mutations to the UL5 and UL52 genes. The ob-
served mutations and resistance indices were irrespective of the
permissive cell type and are summarized in Table 1.
Fig. 2 Compounds inhibit early and late
gene expression. a–f, Agarose gel elec-
trophoresis of RT-PCR fragments prepared
from virus (HSV-1 F) infected cell cultures
(Vero cells) in the presence of compound BAY
57-1293 (a, c, e; 2 µM) shows inhibition of β
(c versus d; UL8, 12 p.i.) and γ (e versus f; UL13,
16 p.i.) gene expression. Identical results were
obtained with BAY 44-5138 (25 µM). α gene
expression is not altered in the presence of in-
hibitor (a versus b; UL54, 2 p.i.).
NATURE MEDICINE • VOLUME 8 • NUMBER 4 • APRIL 2002

a Superior potency and efficacy of BAY 57-1293 compared with the nucleo-
© 2002 Nature Publishing Group http://medicine.nature.com
b recorded daily. Delayed treatment (15 & 60 mg/kg BAY 57-1293 and 60 &
The mutations in the UL5 gene of HSV-1 were mainly found
between nucleotides 1045 to 1077 corresponding to amino
acids 349 to 359 (the α-helical stretch HEFGNLMKVLE), which
is also the region of highest homology among the UL5 se-
quences of the herpesviridae and just adjacent to the conserved
motif IV of the six protein domains required for helicase activ-
ity11. Mutant virus K356N replicated with near wild-type growth
rate and titers comparable to wild-type virus were obtained,
whereas other mutants such as M355T were strongly impaired
with respect to growth rate and titers. In addition to the com-
plementation analysis and the sequencing results (Table 1), the
mechanism of action of BAY 57-1293 and congeners was also
confirmed by direct inhibition of the ATPase activity of the viral
helicase-primase enzyme complex in a dose-dependent manner
(Table 1).
Superior anti-herpes activity of BAY 57-1293 in vivo
We used a murine model of disseminated herpes infection
(lethal challenge model)12,13 to assess the antiviral activity of the
compounds in vivo. Potential drug candidates were tested in es-
calating doses and the ED50 was determined. The results for se-
lected compounds are summarized in Table 2. After oral (per os)
administration BAY 57-1293 was at least 10 times more potent
than valacyclovir (Table 2), even when applied once daily (Fig.
3a). Superior efficacy and potency of BAY 57-1293 was also
demonstrated in a model of cutaneous HSV infection (Fig. 3b;
zosteriform spread model)14 when oral treatment was initiated
after onset of disease and herpes vesicles were already apparent.
In particular, after treatment was stopped, the rebound of dis-
ease was more effectively controlled in BAY 57-1293-treated ani-
mals.
The guinea pig model of intravaginal HSV-2 infection resem-
bles the clinical situation in humans15. BAY 57-1293 was found
superior to valacyclovir in this model when acute treatment
(Fig. 4a–c), delayed treatment (Fig. 4d) or suppression of recur-
NATURE MEDICINE • VOLUME 8 • NUMBER 4 • APRIL 2002
ARTICLES
Fig. 3 Potency and efficacy of compounds in HSV-infected mice. a and b,
side analog valacyclovir (Valtrex) in the murine lethal challenge12,13 (a) and
zosteriform spread model14 (b). a, Comparison of BAY 57-1293 with valacy-
clovir in the murine lethal challenge model. 10 anesthetized BALB/cABom
female mice per group were intranasally infected with a lethal dose of HSV-
2 MS and treated per os with BAY 57-1293 or valacyclovir once daily from
d0 to d4 post infection. Infected mice were inspected daily and a survival
curve was recorded. The comparison of survival curves was performed
using the generalized Wilcoxon test. All treatment groups yielded statisti-
cally significant different survival curves. , placebo; , valacyclovir 60
mg/kg; , BAY 57-1293 7 mg/kg. b, Comparison of BAY 57-1293 with
valacyclovir in the zosteriform spread model14. The scarified skin of
C3H/TifBom-hr female mice was infected with 1 × 106 p.f.u. HSV-2G and
the disease score (mean of 10 animals per group; see Methods) was
240 mg/kg valacyclovir, 0.5% Tylose/PBS, 3× daily, per os) commenced on
d3 post infection and continued until d7. Sum of disease scores were com-
pared between treatment groups using one-way ANOVA. In order to ac-
count for multiple testing, resulting P-values were adjusted according to
Bonferroni–Holm. Treatment with 15 mg/kg BAY 57-1293 was more effec-
tive compared with treatment with 240 mg/kg valacyclovir (P < 0.011).
, placebo; , valacyclovir 60 mg/kg; , valacyclovir 240 mg/kg; , BAY
57-1293 15 mg/kg; , BAY 57-1293 60 mg/kg.
rent disease was measured in terms of a disease score (Fig. 4e).
BAY 57-1293 not only completely suppressed clinical symp-
toms of primary disease (Fig. 4a–c) but also suppressed viral
shedding by 3 orders of magnitude to nearly undetectable levels
in vaginal swabs (mean plaque-forming units (p.f.u.) per ml log
0.6 ± 0.6 for BAY 57-1293-treated animals in comparison to log
3.7 ± 0.8 for placebo-treated animals). Treatment of acute dis-
ease also prevented recurrent disease symptoms in the follow-
up period (Fig. 4e). Delayed initiation of therapy after
appearance of vesicles showed that BAY 57-1293 was clearly
more efficacious than valacyclovir in reducing time to healing
(Fig. 4d) in guinea pigs.
Pharmacokinetic and safety profile of BAY 57-1293
When female BALB/c mice were treated with a single dose of
1 mg/kg BAY 57-1293 per os as suspension in 0.5% tylose, a
maximal concentration of 1.8 mg/l (4.4 µM) was reached 1 hour
after administration. Due to the slow elimination of BAY 57-
1293 (t1/2 = 6.0 h), plasma concentrations above 100 µg/ml (0.25
µM) were detected up to 24 hours after dosing. Similar favorable
pharmacokinetics with a high bioavailability (> 60%) were also
observed in rats and dogs.
Exploratory toxicology and safety pharmacology studies did
not reveal any safety relevant findings at 30, 100 and 300 mg/kg
BAY 57-1293 (once daily per os) in a 4-week chronic toxicity
study in dogs. However, administration of the same dose to rats
for 4 weeks resulted in a dose-dependent transitional hyperplasia
of the urinary bladder epithelium. The N-[5-(aminosulfonyl)-4-
methyl-1,3-thiazol-2-yl]-N-methylacetamide moiety of BAY 57-
1293 resembles the structure of the diuretic drug Diamox
(acetazolamide). Primary sulfonamides can inhibit rat, dog and
human carbonic anhydrase enzymes and are known to cause a
species-specific hyperplasia in bladder epithelium of rodents,
but not in other animals or humans. In contrast to acetazo-
lamide, which has an IC50 of approximately 30 nM, BAY 57-1293
inhibits the carbonic anhydrase with an IC50 in the range of
2–5 µM in the standard carbonic anhydrase–catalyzed CO2 hy-
dration test system (data not shown). Due to the high exposure,
which reached 100–300 µM in rats, it is likely that the hyperpla-
395
 ARTICLES

a b c d
© 2002 Nature Publishing Group http://medicine.nature.com

Fig. 4 Potency and efficacy of compounds in HSV-2-infected guinea pigs. Suppression of acute dis-
ease symptoms (photographed at d6 p.i.) of 10 vaginally infected (2.5 × 105 p.f.u. HSV-2 strain MS) fe-
male guinea pigs per group. a–c, Animals treated with BAY 57-1293 (20 mg/kg, disease score 0) (a), e
valacyclovir (150 mg/kg, disease score 2) (b) and placebo (disease score 4) (c). Redness, swelling and
herpetic vesicles are observed only in placebo- and valacyclovir-treated animals. d, Time to healing
after late treatment of vaginally HSV-2 infected guinea pigs15 with BAY 57-1293 () in comparison
with valacyclovir () and placebo (). Delayed treatment with BAY 57-1293 (20 mg/kg 2× daily per os,
treatment day 4–14) abrogates progression of disease symptoms (mean of 10 animals per group) of
HSV-2 infected guinea pigs within 1 d of treatment and healing is observed subsequently, whereas a
7.5−fold higher dose of valacyclovir (150 mg/kg 2× daily) shows marginal therapeutic efficacy com-
pared with placebo. Time to healing in the BAY 57-1293 group was significantly shorter than in the
valacyclovir-treated group. e, Influence of acute treatment on the recurrence rate of HSV-2 infections in
the guinea pig model15. BAY 57-1293 reduces recurrent HSV-2 disease almost completely when vagi-
nally HSV-2 infected guinea pigs were treated 2× daily per os with 30 mg/kg from d0–d4 (acute treat-
ment; treatment start 6 h post infection). In this experiment valacyclovir (3× daily with 100 mg/kg;
gray line) had no effect compared with placebo (dashed line), whereas BAY 57-1293 treated animals
(2× daily 30 mg/kg; black line) show only very few recurrent episodes. Graph shows cumulative disease
score over time of recurrent genital herpes in the guinea pig model (mean of 10 animals per group).

sia observed in rats is in fact due to the carboanhydrase inhibi-
tion by BAY 57-1293.
Discussion
The best strategy for control of disease caused by pathogens
such as HSV would obviously be prevention. Rising incidence
data show that it is difficult to avoid new infections due to the
insufficient awareness of the problem within the population
and the high prevalence and contagious nature of the virus. In
view of the significant challenge associated with the develop-
ment of a prophylactic vaccine that can block HSV infections
of mucosal surfaces and the limited use of antibodies, thera-
peutic proteins and immunostimulants, treatment with an
orally available, small-molecule antiviral drug amenable to
large-scale production is a proven option to treat HSV infec-
tions3,4,7. However, although the nucleosidic drugs on the mar-
ket represented a major breakthrough, their efficacy is limited,
particularly when they are administered late after onset of dis-
ease.
The preclinical pharmacological profile of the new helicase-
primase inhibitor BAY 57-1293 is superior to the current stan-
dard HSV treatment represented by Zovirax, Valtrex and Famvir
with respect to all parameters of efficacy. BAY 57-1293 is not
only more potent in vitro and in vivo by at least one order of
magnitude, it is especially efficacious when treatment is de-
layed or the viral load is increased, features essential for treat-
ment of herpes encephalitis and disseminated disease.
Importantly, recurrent disease and asymptomatic virus shed-
ding are nearly completely suppressed by the helicase-primase
inhibitors, which should decrease person-to-person transmis-
sion. As some of the disease syndromes caused by HSV are com-
mon, relatively benign and self-limiting, the therapeutic index
of an anti-herpes drug must be extremely high for broad appli-
cation. The new selective and specific mechanism of action
meets this requirement and because it differs from the mecha-
nism of nucleosidic drugs it also satisfies the strong medical
need to combat nucleoside drug resistance, especially in im-
munocompromised patients.
The remarkable potency of the new compound class may be
explained by the pattern of resistance-conferring mutations in
the genes encoding UL5 and or UL52. It can be concluded that
the thiazolyl-amides bind to the helicase and primase subunits
simultaneously thereby mimicking combination therapy with a
single drug. Although all selected resistant viruses displayed
mutations in the viral helicase and/or primase subunits we can-
not rule out that a further target such as UL8 may be identified,
thereby increasing the incidence of resistant viruses under se-
lection pressure. However, the lower resistance rate in vitro com-
pared with acyclovir, which targets the viral thymidine kinase
and DNA-polymerase, argues against this possibility.
The physicochemical properties of BAY 57-1293 permit the
development of topical, oral and intravenous formulations to
suppress or treat primary and recurrent HSV diseases such as
herpes labialis, herpes genitalis, ocular herpes infections, en-
cephalitis and disseminated or visceral HSV infections. The po-
tency of BAY 57-1293 in the lethal challenge model and the
efficacy regarding the reduction of the recurrence rate after
treatment of a primary infection are encouraging for the initia-
tion of trials in humans, but one has to be cautious in predict-
ing the clinical benefit in humans from animal studies due to
different parameters among species such as metabolism and
pharmacodynamics.
Nevertheless, it seems likely that BAY 57-1293 will further re-
duce mortality and morbidity for life-threatening HSV disease as
well as decrease the establishment of latency and subsequent re-
lapse. Clinical trials will now have to show whether the in vitro

396 NATURE MEDICINE • VOLUME 8 • NUMBER 4 • APRIL 2002


activity, the efficacy in animal models and the favorable phar-
macokinetic and safety profiles open the way to a novel once
daily, non-nucleoside treatment of diseases caused by HSV.
Methods
Animals, cells and viruses. BALB/cABom female mice (weight, 19 g; age,
7 wk) and C3H/TifBom-hr female mice (age, 7 wk) were purchased from
M&B A/S (Ry, Denmark) whereas female Hartley guinea pigs were pur-
chased from Charles River Laboratories (Wilmington, Massachusetts) or
Harlan & Winkelmann (Borchen, Germany). Cells (Vero (African green
© 2002 Nature Publishing Group http://medicine.nature.com
monkey) kidney cells), human embryonic lung fibroblasts, normal human
diploid fibroblasts and viruses were obtained from ATCC (American Type
Culture Collection, Manassas, Virginia) or DSMZ (Deutsche Sammlung
von Mikroorganismen und Zellkulturen, Braunschweig, Germany) and cul-
tivated according to standard procedures8. Animals were housed accord-
ing to German animal protection laws, guidelines and approval.
Fluorescence based cytopathogenicity assay. 1 × 104 Vero cells per well of
a microtiter plate (MTP) were infected with 25 p.f.u. of herpes simplex virus
(HSV-1 F or clinical isolates of HSV-1 or 2; multiplicity of infection (m.o.i. =
0.0025)) in a total volume of 200 µl media (M199 medium supplemented
with 5% FCS, 2 mM glutamine, 100 IU/ml penicillin and 100 µg/ml strepto-
mycin) in the presence or absence of drug and incubated for 5 d at 37 °C,
5% CO2. The wells of the MTP were washed with PBS (200 µl) and then filled
with 200 µl PBS containing 10 µg/ml fluorescein diacetate. After a 45-min
incubation at room temperature, fluorescence was measured at 485 nm ex-
citation and 538 nm emission wavelengths. IC50 values were determined by
a nonlinear plot of antiviral activity as a function of drug concentration5,6.
Agarose gel electrophoresis of RT-PCR fragments prepared from virus
infected cell cultures. 5 × 106 Vero cells were seeded in tissue culture
flasks and incubated over night at 37 °C, 5% CO2. The cells were infected
(m.o.i. = 1) with HSV-1 F in the presence and absence of BAY 57-1293 (2
µM). Identical results were obtained with BAY 44-5138 (25 µM).
The RNA of infected cells was purified at 2 h (UL54), 12 h (UL8) and 16 h
(UL13) after infection (Qiagen, Hilden, Germany) RNA purification (RNeasy
kit; 40 µl elution) and quantified (absorption at 260 nm). The RNA (2 µg)
was reverse transcribed with a specific primer (2 pmol; UL54, 5′
AAACAGGGAGTTGCAATAAA 3′; UL8, 5′ GGCAAACAGAAACGACATCT 3′;
UL13, 5′ CGACAGCGCGTGCCGCGCGC 3′) into cDNA according to the
Superscript II protocol (Invitrogen, Karlsruhe, Germany). Aliquots (2 µl) of
the reverse transcription reaction were amplified by PCR. A 300-bp frag-
ment of the HSV UL54 gene, a 350-bp fragment of the UL8 gene and a 600-
bp fragment of the UL13 gene were amplified in 30 cycles (UL54 and UL8: 3
min, 94 °C hot start; 1 min, 94 °C denaturation; 1 min, 55 °C annealing;
1 min, 72 °C polymerization. UL13: 3 min, 94 °C hot start; 1 min, 94 °C de-
naturation; 1 min, 60 °C annealing; 1 min, 72 °C polymerization.) by PCR
(Taq-Polymerase, Stratagene, Amsterdam Zuidoost, The Netherlands), in a
100-µl reaction volume with the following oligonucleotides: UL54, 5′ GCC
TGT GCG GCC TGG ACG AA 3′ and 5′ AAT ATT TGC CGT GCA CGT AC 3′;
UL8, 5′ CGCCTGCGACCGCCTTATCT 3′ and 5′ TGTCGTCAAAGGGATA-
CACA 3′; UL13, 5′ CGATCGCCCGGGGGCAGTTT 3′ and 5′ ACGGGTTGGT-
GTGACACAGG 3′; 0.1 nmol each. 8-µl aliquots of cycle 20–30 (lanes
2–12) of the PCR were resolved on a 2% agarose gel (Invitrogen) accord-
ing to the manufacturer’s instructions.
Cloning and preparation of the helicase-primase enzyme. HSV-1 heli-
case-primase heterodimer was produced in doubly infected Sf9 (Spodoptera
frugiperda) cells using recombinant baculoviruses expressing the UL5 and
the UL52-6xHis genes of the helicase-primase subunits. The genes were am-
plified by PCR from HSV-1 F (American Type Culture Collection ATCC VR-
733) and cloned into the baculovirus expression system (UL5, pFASTBAC1;
UL52, pFASTHTb) according to the Instruction Manual BAC-TO-BAC
Baculovirus (Expression Systems, Invitrogen, Karlsruhe, Germany). The het-
erodimeric enzyme was purified by IMAC-Chromatography as described16.
ATPase Assay. Purified heterodimeric helicase-primase complex (200–400
ng) was incubated with 1 µg DNA (Sigma D3287 or D8681) in 20 mM
HEPES (pH 7.6; 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid),
NATURE MEDICINE • VOLUME 8 • NUMBER 4 • APRIL 2002
ARTICLES
5 mM MgCl2, 0.2–5.0 mM ATP, 100 µg BSA per ml, 10% glycerol, 1 mM
DTT (DL-dithiothreitol) and incubated for 60 min at 37 °C. The released in-
organic phosphate was detected colorimetrically as described16.
DNA dependent ATPase activity was calculated from the net absorbance
change in the presence and absence of inhibition.
Generation and sequencing of resistant viral mutants. Naturally occur-
ring, resistant viral mutants were selected in the presence of 1 µM BAY
57-1293 or of at least 100 times the IC50 concentration of the compounds
listed in Table 1 using the fluorescence based viral replication assay. 1 ×
104 Vero cells were seeded in 96-well MTPs as described above and incu-
bated overnight. Compound was added to the final concentration and
the cells were infected with 1,000 p.f.i. (m.o.i. = 0.1) per well. Mutants
(viral plaques) were identified with a microscope after 3–5 d incubation
or by storing replica samples of 10 µl of each well and analyzing the
20–40 MTP with the fluorescence dye fluorescein diacetate as described
above. If a resistant virus is present in an individual well, the fluorescence
read-out decreases at least by a factor of 3 as compared with mutant-free
wells. Mutant-positive supernatants or stored samples were used to pro-
duce stocks, the titer was determined, the DNA prepared8 and sequenced
(Custom sequencing, Qiagen).
Murine lethal challenge model. 50 µl virus suspension (HSV-1 Walki or
HSV2MS) in ice-cold PBS (∼5 × 104 p.f.u.) was applied to the nares of
lightly ether-anesthetized BALB/cABom female mice12,13, resulting in a
mortality of 90–100% after 7–10 d. For oral treatment compounds were
suspended in 0.5% Tylose (MH 4000 P2, Clariant, Muttenz, Switzerland)
in PBS via ultrasonication. The suspension was subsequently administered
via oral gavage in a total volume of 200 µl/dose twice daily at the day of
infection and 3× daily (7:00 AM, 2:00 PM and 7:00 PM) from d1 to d4 p.i.
Infected animals were inspected daily for signs of disease (encephalitis,
paralysis) and moribund animals were killed.
Murine zosteriform spread model. C3H/TifBom-hr female mice were
anesthetized by ether and the lateral side of the body was scratched 10
times in a crossed-hatch pattern with a 27-gauge needle. 10 µl virus sus-
pension (1 × 106 p.f.u. HSV-2G) was inoculated on the scarified area and
rubbed using the pipette tip14. Mice were inspected daily and disease
severity was determined using a scoring system: 0, no signs of infection
visible; 1, vesicle formation; 2, slight zoster spread; 3, large patches of
zoster formed; 4, confluent zoster band; 5, hind limb paralysis; 6, death.
Moribund animals were killed.
Guinea pig model of genital herpes. Female Hartley guinea pigs were
infected intravaginally15 with 2.5 × 105 p.f.u. HSV-2 strain MS. Depending
on the therapy regimen examined, treatment started 6 h p.i. and contin-
ued for 4 more days (‘very early episodic therapy’), or started at d4 p.i.
and lasted for 10 d (‘delayed episodic therapy’) or started at d20 p.i. and
continued for 20 d (‘suppression therapy’). Animals were examined daily
for herpes lesions and the lesion severity was scored on a 0–4 scale.
During d1–d4, p.i. samples of vaginal secretion were obtained using cot-
ton tipped swabs. Individual swabs were placed in tubes with 1 ml
Dulbecco’s MEM and processed as described15. Virus titers were deter-
mined using standard plaque test procedures8.
Antiviral compounds used in animal models. BAY 57-1293 was synthe-
sized at Bayer AG, Central Research, Leverkusen and micronized using a
conventional air-jet mill. Acyclovir was purchased as Zovirax injection flasks
(GlaxoSmithKline), valacyclovir as Valtrex film tablets (GlaxoSmithKline).
Acknowledgments
We thank J. Blümel for clinical field isolates (UB1-31, UB33-47 & UB49-56) of
HSV-1 and HSV-2; P. Spear and L. Kwan for analyzing herpesvirus entry into
cells; P. Schaeffer for ICP-4 plasmids; S. Weller for recombinant baculoviruses;
H.R. Hehnen for material and lab space to carry out the animal virus
experiments (equine, porcine and bovine herpes strains).; M. Becka for statisti-
cal analysis of data; and K. Ostertag-Palm, M. Hucke, C. Stamm, E. Clemente,
M. Werth, J. Wann, I. Hulsmann, S. Schaab, S. Vogel, S. Veldhoen, D. Ganzer,
G. Köppe, J. Hotho, J. Leske, U. Zuther, H. Schoop, O. Augustin, M. Peters, J.
397
 ARTICLES
Dornieden, H. Blum, E. Lindner, G. Heckmann, E. Carrozzo, B. Schulz, H.
Küper, U. Reimann, M. Heidtmann, D. Höpker, A. Haas, A. Rudek, J. Daheim,
J. Verlage, B. Poschmann, M. Heine and P. Hartmann for technical assistance.
RECEIVED 2 JULY 2001; ACCEPTED 13 FEBRUARY 2002
1. Knipe, D.M. & Howley, P.M. Fields Virology, 4th edn. 2399–2509 (Lippincott
Williams Wilkins, Philadelphia, 2001).
2. Boehmer, P.E. & Lehmann I.R. Herpes simplex virus replication. Ann. Rev.
Biochem. 66, 347–384 (1997).
3. Schaeffer, H.J. et al. 9-(2-Hydroxyethoxymethyl)guanine activity against viruses
© 2002 Nature Publishing Group http://medicine.nature.com
of the herpes group. Nature 272, 583–585 (1978).
4. Keating, M.R. Antiviral agents for non-human immunodeficiency virus infection.
Mayo Clin. Proc. 74, 1266–1283 (1999).
5. Fischer, R. et al. Thiazole urea derivatives and their utilization as antiviral agents.
Patent application WO-00/53591-A, PCT/EP01498 EP1161423 (2000).
6. Fischer, R. et al. Thiazole amide derivatives and their utilization as antiviral
agents. Patent application WO-01/47904, PCT/EP01498 EP1161423 (2001).
7. O’Brien, J.J. & Campoli-Richards, D.M. Acyclovir—an updated review of its an-
tiviral activity, pharmacokinetic properties and therapeutic efficacy. Drugs 37,
233–309 (1989).
8. Brown, S.M. & MacLean, A.R. Herpes Simplex Virus Protocols (Humana, Totowa,
398
New Jersey, 1998).
9. Crumpacker, C.S., Schnipper, L.E., Zaia, J.A. & Levin M.J. Growth inhibition by
acycloguanosine of herpesviruses isolated from human infections. Antimicrob.
Agents Chemother. 15, 642–645 (1979).
10. Collins, P. & Darby G. Laboratory studies of herpes simplex virus strains resistant
to acyclovir. Rev. Med. Virol. 1, 19–28 (1991).
11. Hall, M.C. & Matson, S.W. Helicase motifs: the engine that powers DNA unwind-
ing. Mol. Microbiol. 34, 867–877 (1999).
12. Field, H.J., Anderson, J.R. & Efstathiou, S. A quantitative study of the effects of
several different nucleoside analogues on established herpes encephalitis in mice.
J. Gen. Virol. 65, 707–719 (1984).
13. de Clercq, E. & Luczac, M. Intranasal challenge of mice with herpes simplex virus:
an experimental model for the evaluation of the efficacy of antiviral drugs. J. Inf.
Dis. 133, A226–A236 (1976).
14. Simmons, A. & Nash, A.A. Zosteriform spread of herpes simplex virus as a model
of recrudescence and its use to investigate the role of immune cells in prevention
of recurrent disease. J. Virol. 52, 816–821 (1984).
15. Kern, E.R. & Glasgow L. Treatment of genital herpes simplex virus infections in
guinea pigs. in Herpesvirus, Proceedings of a Burroughs Wellcome–UCLA Symposium
(ed. Rapp, F.) 617–636 (Alan R. Liss Inc., New York, 1984).
16. Spector, F.C., Liang, L., Giordano, H., Sivaraja, M. & Peterson, M.G. Inhibition of
herpes simplex virus replication by a 2-amino thiazole via interactions with the
helicase component of the UL5-UL8-UL52 complex. J. Virol. 74, 6979–6987
(1998).
NATURE MEDICINE • VOLUME 8 • NUMBER 4 • APRIL 2002
 NEWS & VIEWS

New anti-HSV therapeutics target the helicase–primase

complex
The only targets for clinical treatment of herpes simplex virus infections have been the viral enzymes thymidine
kinase and DNA polymerase. Now, animal experiments show the healing benefits of new antiherpes drugs that act
on the viral helicase–primase complex and appear superior to the standard treatment, acyclovir.
© 2002 Nature Publishing Group http://medicine.nature.com

H erpes simplex virus types 1 and 2 (HSV-

1 and -2) are responsible for the quiet
pandemics of oral and genital herpes that
have plagued humanity for centuries. In
the United States
alone, 22% of the
population is in-
fected with HSV-2,
and 1.6 × 106 new
genital herpes infec-
tions are predicted to
occur each year.
Newborn infants and
immunocompro-
mised patients suffer
the greatest risk of
life-threatening HSV
infections. HSV is
also the leading cause
of infectious blind-
ness in the industrial-
ized world. In the
absence of an effec-
tive vaccine to pre-
vent primary and
recurrent HSV infec-
tions, the antiviral
drug acyclovir and its
derivatives have been
CLYDE S. CRUMPACKER &
PRISCILLA A. SCHAFFER
phate. Acyclovir triphosphate acts as a
competitive inhibitor of HSV DNA poly-
merase and a terminator of viral DNA-
chain elongation (Fig. 1)6. The specificity of
acyclovir also reflects
the fact that it in-
a Accessory protein hibits cellular DNA
UL42 polymerase weakly in
DNA polymerase
3'
comparison to its in-
hibition of viral DNA
Single-stranded DNA-binding
Leading strand polymerase. To date,
protein ICP8
viral TK and DNA
polymerase have
been the only molec-
8 ular targets success-
52 fully exploited for the
5
development of clini-
Helicase–primase complex cally useful anti-HSV
(UL5,8,52) 3'
3'
drugs. For the
Lagging strand
neonate, the patient
with herpes en-
b c cephalitis and the im-
munocompromised
patient, acyclovir is a
life-saving therapy.
For those with genital
herpes, acyclovir has
greatly improved the
quality of life.
Renee Lucas

the only effective and TZP/U Acyclovir triphosphate Despite the avail-
safe oral therapies for ability of acyclovir
treatment of HSV in- therapy, life-threat-
Fig. 1 Mechanism of DNA synthesis inhibition by acyclovir and the new drugs (modified
fections since acy- from Boehmer and Lehman11). a, HSV DNA synthesis. The helicase–primase complex, consist- ening infections with
clovir was initially ing of viral proteins UL5, -8 and -52, unwinds HSV DNA at the replication fork and primes both HSV such as herpes
reported as the first spe- lagging-strand (wavy green lines) and leading-strand (not shown) DNA synthesis. The single- encephalitis continue
cific antiviral drug in stranded DNA binding protein, ICP8, binds to single-stranded template DNA (straight blue to be associated with
1977 (ref. 1). Now, two lines). HSV DNA polymerase and its accessory protein, UL42, promote leading- and lagging- significant morbidity
papers in this issue of strand DNA synthesis (wavy blue lines). The arrows indicate the direction of movement of the and mortality. In im-
Nature Medicine de- DNA replication proteins. b, New drugs target the helicase–primase complex. The TZP/Us munocompromised
(amino-thiazolylphenyl-containing compounds and thiazole urea derivatives; red band) en-
scribe two distinct but patients, HSV infec-
hance binding of the UL5 and UL52 subunits of the helicase–primase complex to both leading-
structurally related and lagging-strand DNA resulting in inhibition of helicase activity, primase activity and viral tion can disseminate
classes of drugs2,3 that DNA synthesis. c, Acyclovir. Acyclovir triphosphate (orange wedge) binds to HSV DNA poly- to involve liver, brain
show great promise merase, inhibiting polymerase activity and synthesis of both leading and lagging DNA strands. and lungs, and acy-
as novel anti-HSV clovir has been the
agents. The drugs tar- primary treatment
get the HSV helicase–primase complex ing that of acyclovir. regimen in this group. However, resistance
(Fig. 1), a molecular target distinct from The viral specificity of acyclovir results, to acyclovir has posed a significant prob-
the viral DNA polymerase and thymidine in part, from the fact that HSV TK initiates lem, and in HIV infected patients, 6% of
kinase (TK) targeted by acyclovir and its the activation of the drug. TK monophos- HSV isolates are resistant to acyclovir. The
derivatives4,5 (Fig. 1). In animal models of phorylates acyclovir and cellular enzymes only treatment alternative for acyclovir- re-
HSV infection, the new drugs appear to subsequently add two additional phos- sistant HSV has been the pyrophosphate
have therapeutic value rivaling or exceed- phate groups to yield acyclovir triphos- analog, phosphonoformic acid (Foscarnet),

NATURE MEDICINE • VOLUME 8 • NUMBER 4 • APRIL 2002 327

 NEWS & VIEWS
a reversible inhibitor of HSV DNA poly-
merase which is more toxic than acyclovir
and must be administered intravenously7.
Despite its unrivaled safety record and effi-
cacy in the treatment of primary and recur-
rent HSV disease, acyclovir has limited oral
bioavailability, must be given early in the
disease to have a significant effect and the
active form of the drug, acyclovir triphos-
phate, possesses a short intracellular half-
© 2002 Nature Publishing Group http://medicine.nature.com
life. For these reasons, new therapies are
clearly needed.
The two new classes of drugs, amino-
thiazolylphenyl-containing drugs2 and
thiazole urea derivatives3, have a different
target in the HSV DNA replication
process, the helicase–primase complex
(Fig. 1). This complex consists of three
viral proteins, the products of the HSV
UL5, -8, and -52 genes, which act together
to unwind double-stranded viral DNA
and generate primers for DNA synthesis
by the viral DNA polymerase8,9. Mutations
in virus isolates that are resistant to the
new drugs map to the UL5 and UL52
genes, demonstrating that both drugs tar-
get the helicase–primase complex. At the
molecular level, the amino-thia-
zolylphenyl-containing drugs appear to
act by enhancing the affinity of the heli-
case–primase complex for DNA, which in-
hibits the enzymatic activities of the
complex2 (Fig. 1). The anti-HSV activity of
an amino-thiazole compound has been
reported previously, but the compound
described was less potent in vitro and no
data concerning efficacy in animals or
comparisons with acyclovir were pre-
sented10.
Both newly described drugs are active
orally and both exhibit impressive effects
on the healing of HSV-1 and HSV-2 in cu-
taneously infected mice, and HSV-2 in
vaginally infected guinea pigs. When
compared with acyclovir and valacyclovir
in the same experiments, the results with
Polygenic or Pollyanna?
A study suggesting that many genes, each conferring a small risk, account for most cases of breast cancer could have
important implications for population-based prevention programs—provided that the genes can be identified.
A bout 3% of all primary breast cancer
is due to mutations in BRCA1 or
BRCA2, which confer a high risk of de-
veloping the disease. However, most
analyses of large data sets suggest that
other genes must contribute to the famil-
ial clustering of breast cancer. Following
the discovery of BRCA1 and BRCA2 (in
1994 and 1995, respectively), there was a
328
the helicase–primase inhibitors were gen-
erally superior. The claim by Kleymann et
al. that the thiazole urea derivative BAY
57-1293 reduces the severity and fre-
quency of recurrences is intriguing but
sparse data in support of this conclusion
will necessitate additional experimenta-
tion. The finding that the amino-thia-
zolylphenyl-containing drug B1LS-179-BS
was effective even when treatment was
delayed by 65 hours may represent an im-
portant advance over nucleoside analogs,
which require early application for suc-
cess. The evidence that resistance to heli-
case–primase inhibitors occurs less
frequently than resistance to acyclovir is
promising, but must be confirmed in the
clinic. Both classes of drugs inhibit HSV-1
and -2 (but not varicella zoster virus or cy-
tomegalovirus), both are effective against
acyclovir-resistant mutants and both ap-
pear to be well tolerated in animals.
Carefully controlled clinical trials in
humans are clearly the next step for both
classes of compounds. It will be interest-
ing to see how these new drugs compare
with acyclovir, valacyclovir and famcy-
clovir with regard to efficacy and reduc-
tion of recurrences. The remarkable lack
of toxicity and side effects observed with
acyclovir in humans poses a strong chal-
lenge for any new class of antiherpes
drugs. Such safety features are essential if
anti-HSV therapy is to be carried out for
extended periods in healthy patients.
The clinical implications for treatment
with these new classes of orally available
drugs are enormous. If helicase–primase
drugs inhibit HSV infections more effec-
tively than nucleoside analogs and ex-
hibit safety parameters comparable with
acyclovir, they would represent a major
advance in controlling HSV infections.
Despite the potential promise of these
new drugs, however, neither they nor the
nucleoside analogs can eliminate virus in
WILLIAM D. FOULKES
reasonable expectation in the research
community that at least one more highly
penetrant susceptibility gene would be
identified, but no such gene has been
found despite intensive searching by sev-
eral groups. An article in the May issue of
NATURE MEDICINE • VOLUME 8 • NUMBER 4 • APRIL 2002
the latent state. Consequently, continua-
tion of the HSV pandemic is anticipated
and efforts to develop vaccines and novel
therapies aimed at eliminating latent
virus are still warranted.
1. Elion, G.B. et al. Selectivity of action of an antiher-
pectic agent 9-(hydroxyethoxymethyl) guanine.
Proc. Natl. Acad. Sci. USA 74, 5716–5720 (1977).
2. Crute, J.J. et al. Herpes simplex virus helicase–pri-
mase inhibitors are active in animal models of
human disease. Nature Med. 8, 386–391 (2002).
3. Kleymann, G. et al. New helicase–primase in-
hibitors as drug candidates for the treatment of
herpes simplex disease. Nature Med. 8, 392–398
(2002).
4. Coen, D. & Schaffer, P. Two distinct loci confer re-
sistance to acycloguanosine in herpes simplex virus
type 1. Proc. Natl. Acad. Sci. USA 77, 2265–2269
(1980).
5. Schnipper, L.E. & Crumpacker, C.S. Resistance of
herpes simplex virus to acycloguanosine: The role
of viral thymidine kinase and DNA polymerase loci.
Proc. Natl. Acad. Sci. USA 77, 2270–2273 (1980).
6. Furman, P.A. et al. Inhibition of herpes simplex
virus induced DNA polymerase activity and viral
DNA replication by 9-(2-hydroxyehoxymethyl)
guanine and its triphosphate. J. Virol. 32, 72–77
(1979).
7. Safrin, S. et al. Treatment of acyclovir-resistant mu-
cocutaneous herpes simplex infection in patients
with the acquired immunodeficiency syndrome. A
randomized multicenter study of foscarnet vs. vi-
darabrine. New Engl. J. Med. 325, 551–555 (1991)
8. Crute, J.J. & Lehman, I.R. Herpes simplex virus heli-
case primase. Physical and catalytic properties. J.
Biol. Chem. 266, 4484–4488 (1991).
9. Zhu, L.A. & Weller, S.K. The UL5 gene of herpes
simplex virus type 1: Isolation of a lac Z insertion
mutant and association of the UL5 gene product
with other members of the helicase-primase com-
plex. J. Virol. 66, 1458–1468 (1992).
10. Spector, F.C., Liang, L., Giordano, H., Sivaraja, M.
& Peterson, M.G. Inhibition of herpes simplex virus
replication by a 2-amino-thiazole via interactions
with the helicase component of the UL5-UL8-UL52
complex. J. Virol. 72, 6979–6987 (1998).
11. Boehmer, P.E. & Lehman, I.R. Herpes simplex virus
DNA replication. Annu. Rev. Biochem. 66, 347–384
(1997).
Departments of Medicine and Microbiology and
Molecular Genetics
Harvard Medical School and
Division of Infectious Diseases
Beth Israel Deaconess Medical Center
Boston, Massachusetts
Email: pschaffe@caregroup.harvard.edu
Nature Genetics by Pharoah et al.1 suggests
that there is no BRCA3 as such. Instead,
many susceptibility alleles, each causing
a small (perhaps very small) augmenta-
tion of a woman’s breast-cancer risk,
would be responsible for familial cluster-
ing of breast cancer that essentially mim-
ics the presence of a single allele when a
critical number of them segregate to-