Shawne Thorsen

12/7/2010

ABCC11 Lab Report

Introduction

Single nucleotide polymorphisms, known as SNPs, are defined as

positions in the genome in which two or more different bases occur with a

frequency of at least 1%. These changes in single bases represent genetic

variation amongst the human population. On average, SNPs occur every

1200 bases and are useful as genetic markers since they tend to be

conserved through generations. Yoshiura et al. conducted a study in 2006 on

the ABCC11 gene. ABCC11 (ATP-binding cassette transporter sub-family C,

member 11), is a protein encoded by thy super family of ATP-binding

cassette (ABC) transporters responsible for transport of various molecules

across intra and extracellular spaces. As a result of the study, the ABCC11

SNP was determined to be the first of its kind responsible for a phenotype.

This experiment showed that the ABCC11 gene is responsible for the

determination of earwax type. The AA genotype corresponds to dry earwax,

and the GA and GG to wet type. A 27 bp-deletion in ABCC11 exon 29 was

found in a few individuals of Northeast Asian decent. Cells with the A allele

showed a lower excretory activity for cGMP than those with allele G which

lead to decreased export of fatty acid chains aprocrine excretions of the ear

known as cerumen. The purpose of this experiment was to determine

student’s genotypes for this known SNP and use the information obtained

from extracted DNA to determine whether they had wet or dry earwax.
 Shawne Thorsen

12/7/2010

ABCC11 Lab Report

Methods

To begin the experiment, DNA was extracted from buccal cells following the

protocol outlined by the SIGMA REDExtract-N-Amp Tissue PCR Kit. The

experiment began at step B and followed the guidelines all the way through

the 5th instruction for step C. The same PCR cycling conditions were used and

the PCR reaction mix was set up as follows:

Reagent Volume
Water, PCR grade 4 microliters
REDExtract-N-Amp PCR reaction mix 10 microliters
Forward primer 1 microliter
Reverse primer 1 microliter
Tissue extract 4 microliters
Total volume: 20 microliters
To serve as positive control, GAPDH, a well-established “housekeeping gene”

was used in this experiment to ensure participants were using proper

laboratory methods and conducting this experiment without error. These PCR

reactions were removed from the thermal cycler and frozen until the next lab

session.

Students were instructed to make two 1.5% agarose gels for the entire class

to share. To do this, .60 grams of agarose powder were added to 40mL of

 Shawne Thorsen

12/7/2010

ABCC11 Lab Report

Tris Buffer solution in a 250ml Erlenmeyer flask. The flask was then gently

covered (not sealed) with plastic wrap, and placed in the microwave at 50%

power for 2 minutes, or until the powder was fully suspended in the liquid.

Ethidium bromide was necessary to visualize the products on the gel, so one

drop was added to the agarose solution while swirling to cool the liquid. Once

warm to the touch, the liquid was poured into a well and two 8-comb wells

inserted while it cooled.

10 microliters of both the ABCC11 and GAPDH reactions were added into

separate lanes on their respective gels, as well as 10 microliters of 100bp

ladder standard to be used to verify amplicon size later in the experiment.

If product was seen in both gels (at ~700bp for GAPDH and ~350 for

ABCC11), students were instructed to go forward with the procedure.

A 50 microliter ABCC11 reaction was then prepared as follows:

Red extract: 25 microliters

ABCC11 forward primer: 2.5 microliters

ABCC11 reverse primer: 2.5 microliters

Buccal cell DNA: 4 microliters

Sterile water: 16 microliters

The same cycling parameters were followed as listed in the SIGMA PCR kit

protocol. The reactions were placed in the freezer until the next lab session

the following week.

 Shawne Thorsen

12/7/2010

ABCC11 Lab Report

One 1.5% agarose gel was prepared for the entire class following the

procedure listed previously in this report. Each group loaded 10 microliters of

their ABCC11 reactions onto the gel. Students were instructed to use the

intensity of the product banding pattern to determine the relative

concentration of DNA in their samples. Once this was complete, a 40

microliter PCR cleanup was performed following the Qiaquick protocol. The

product of this procedure was used to prepare two sequencing reactions,

both forward and reverse.

To prepare the sequencing reactions, it was determined from the gel that

each microliter contained 10 nanograms of DNA. Two 20 microliter DNA

sequencing reactions were set up as follows:

ABCC11 primer, either forward or 2 microliters

reverse

DNA (10ng/uL) 2.3. microliters

Sterile water 7.7 microliters

DTCS (added last) 8 microliters

Further preparation of the DNA sequencing reactions followed the protocol

outlined by the CEQ DTCS-Quick Start Kit, with minor changes made to

ignore step 2 and to add 200 microliters of PB in a 1.5mL tube in step 1.

 Shawne Thorsen

12/7/2010

ABCC11 Lab Report

An ethanol precipitation of the sequencing reactions was then performed.

The procedure was followed as outlined by the protocol in the CEQ-8000

Series Genetic Analysis System manual. Two .5mL tubes were labeled with

the group number and sample ID (forward or reverse). Finger vortexing was

performed between steps C and D but great care was taken to keep the

samples on ice. In step H, SLS mixture was added to the samples and they

were vortexed briefly every 5 minutes for a total of 15 minutes. The samples

were spun to the bottom using a desktop centrifuge, then pipetted in their

entirety onto the sequencing reaction plate. One drop of mineral oil was

added on top of the samples to prevent them from drying. Each group noted

the location of their forward and reverse reactions so there would be minimal

confusion identifying whose was whose after sequencing was complete.

Results
 Shawne Thorsen

12/7/2010

ABCC11 Lab Report

Figure 1a: Analysis of ABCC11 Figure 1b: Analysis of

GAPDH

1 2 3 4 5 6 7 8 1 2 3 4
5 6 7 8

Agarose Gel Electrophoretic Analysis of

ABCC11

Buccal Swab Isolation

Lane 1—100 bp ladder

Lane 8—Group 9’s ABCC11 amplicon

~350bp

Figure 2: Determination of DNA concentration

 Shawne Thorsen

12/7/2010

ABCC11 Lab Report

Figure 3: Semi-log graph of Standards and unknown sample—turned in for

previous grade.

Data set 1: Trim Report

101-

9F.E03_10111709J

0 E 470 7 7 No
101-

9R.F03_10111709J

1 F 326 313 313 Yes

Data Set 2: Reverse ABCC11 primer sequence:

 Shawne Thorsen

12/7/2010

ABCC11 Lab Report

>101-9R.F03_10111709J1 313 0 313 CEQ

TTCAAGGCTTCACCGCCTTTGGGAAGAAGAAGTCTCAAGGCGAGGGATTGAAAAAGCTTCA

GTGCTTCTGGTGATGCTGAGGTTCCAGAGAACAAGGTTGATTTTCGATGCACTTCTGGGCA

TCTGCTTCTGCATTGCCAGTGTACTCGGGCCAGTAAGTGGCAGACTTGGTGAGGTTTGGG

GGACTCTAGGCTTCAGAGGTTTAGCGATGGAACTGCGGGCATGTTCAAGTCCATGCCAGG

AGTTAGAGATGCATTTGTCTTTCAGTTGCTGTCTAGAAAATGAAGACCTTTTGAGGACAGTA

GAGCATGGT

Discussion:

The isolation of DNA from buccal cell swabs was successful in providing

quantifiable amounts of product to be sequenced and compared to those

known in the BLAST database. After isolation, a PCR reaction was set up and

run with the genes of interest: ABCC11 and GAPDH. Figure 1 shows the

analysis of both ABCC11 and GAPDH after being run on agarose gel through

electrophoresis. Lane 1 on both gels contained a 100 bp pair ladder that

allowed for the determination of banding sizes for both genes. The ABCC11

amplicon was the expected size at 350 bp, and GAPDH was found to be the

expected 700 bp in length. Because useable products were successfully

 Shawne Thorsen

12/7/2010

ABCC11 Lab Report

obtained and verified through electrophoresis, students were then able to

mix another PCR reaction with the DNA isolated from individual samples.

Figure 2 demonstrates the results obtained after running the gel. This gel

was used to check the amlpicon size versus semi-log graph paper to

demonstrate the relationship between distance migrated and size in base

pairs. Also, by observing the intensity of the banding pattern, students were

able to determine the relative concentration of DNA in their sample. This 1.5

% agarose gel was used to determine the concentration (ng/uL) of DNA in

the final ABCC11 PCR products. The bands in the 100bp ladder were

compared to the amplicons on the gel. The intensity of the amplicons was

about that of the 400bp standard in the ladder. Since these reactions were

40uL, it was determined that DNA was in a 10ng/uL concentration. This

determined concentration was used to calculate the appropriate amount of

DNA to add to the sequencing reactions. After the reaction was completed, a

trim report was obtained. Data Set 1 summarizes the report: the forward

sequence had very few alignments to produce a significant peak in the

Sequencher algorithm, thus only the reverse ABCC11 primer sequence (Data

Set 2) was used. The BLAST (Basic Local Alignment Search Tool) program

was used to compare and contrast the similarities between the group’s

individual reverse ABCC11 primer sequence and a human partial sequence

containing the ABCC11 locus. This allowed students to determine what

 Shawne Thorsen

12/7/2010

ABCC11 Lab Report

nucleotide (A or G) was present at the known SNP position in the locus. The

ABCC11 primer sequence contained 313 bases, with 312 appearing in the

actual alignment output. This demonstrated that 99% was identical to the

reference sequence, with 0 gaps present. The polymorphic position in the

query sequence of the alignment was observed in order to determine which

base (A or G) was in the group’s sample. The SNP base identity was C, the

reverse complement of G, which denotes the wet earwax phenotype.

 Shawne Thorsen

12/7/2010

ABCC11 Lab Report

References:

Altschul SF, Madden TL, Schaffer AA, Zhang Z, Miller W, Lipman DJ (1997)

Gapped BLAST and

PSI-BLAST: a new generation of protein database search programs. Nucleic

Acids Res 25:3389-3402.

Lesk, Arthur. Introduction to Genomics. Oxford University Press. New York.

2007.

Yoshiura,et. Al. "A SNP in the ABCC11 Gene Is the Determinant of Human

Earwax Type." Nature Genetics 38.3 (2006): 324-30. Print

 Shawne Thorsen

12/7/2010

ABCC11 Lab Report