177

Comparative analysis of fecal microbiota and

intestinal microbial metabolic activity in captive
polar bears
Clarissa Schwab and Michael Gänzle

Abstract: The composition of the intestinal microbiota depends on gut physiology and diet. Ursidae possess a simple gas-
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by 41.107.48.123 on 04/17/11

trointestinal system composed of a stomach, small intestine, and indistinct hindgut. This study determined the composition
and stability of fecal microbiota of 3 captive polar bears by group-specific quantitative PCR and PCR–DGGE (denaturing
gradient gel electrophoresis) using the 16S rRNA gene as target. Intestinal metabolic activity was determined by analysis
of short-chain fatty acids in feces. For comparison, other Carnivora and mammals were included in this study. Total bacte-
rial abundance was approximately log 8.5 DNA gene copies
(g feces)–1 in all 3 polar bears. Fecal polar bear microbiota
was dominated by the facultative anaerobes Enterobacteriaceae and enterococci, and the Clostridium cluster I. The detec-
tion of the Clostridium perfringens a-toxin gene verified the presence of C. perfringens. Composition of the fecal bacterial
population was stable on a genus level; according to results obtained by PCR–DGGE, dominant bacterial species fluctu-
ated. The total short-chain fatty acid content of Carnivora and other mammals analysed was comparable; lactate was de-
tected in feces of all carnivora but present only in trace amounts in other mammals. In comparison, the fecal microbiota
and metabolic activity of captive polar bears mostly resembled the closely related grizzly and black bears.
Key words: polar bears, intestinal microbiota, short-chain fatty acids.
Résumé : La composition du microbiote intestinal dépend de la physiologie de l’intestin et de la diète. Les Ursidae possè-
For personal use only.

dent un système gastro-intestinal simple composé de l’estomac, de l’intestin grêle et d’un intestin postérieur indistinct.
Cette étude visait à déterminer la composition et la stabilité du microbiote fécal de 3 ours polaires gardés en captivité par
PCR quantitative et PCR–DGGE spécifiques des groupes, en ciblant le gène de l’ARNr 16S. L’activité métabolique intesti-
nale a été déterminée par l’analyse des acides gras à courte chaine dans les fèces. Aux fins de comparaison, d’autres carni-
vores et mammifères ont été inclus dans cette étude. L’abondance bactérienne totale était d’environ log 8,5 copies de gène
par gramme chez les 3 ours polaires. Le microbiote fécal de l’ours polaire était dominé par les anaérobies facultatifs
Enterobacteriaceae et les entérocoques, et par la grappe I de Clostridium. La détection du gène de l’a-toxine de Clostri-
dium perfringens a été utilisée pour vérifier sa présence. La composition de la population de bactéries fécales était stable à
l’échelle du genre; les espèces bactériennes dominantes fluctuaient d’après les résultats obtenus par PCR–DGGE. Les
contenus en acides gras à courte chaine des fèces des carnivores et des autres mammifères étaient comparables; le lactate
a été détecté dans les fèces de tous les carnivores mais était présent à l’état de trace chez les autres mammifères. En com-
paraison, le microbiote fécal et l’activité métabolique des ours polaires gardés en captivité ressemblaient essentiellement à
ceux des ours grizzly et des ours bruns, avec lesquels ils sont fortement apparentés.
Mots-clés : ours polaires, microbiote intestinal, acides gras à courte chaine.
[Traduit par la Rédaction]

Introduction by ruminal herbivores (Topping and Clifton 2001; Williams

The gastrointestinal tract of mammals is a complex eco- et al. 2001).
system that stages a dynamic interplay among diet, host, The composition of the intestinal microbiota depends on
and commensal bacteria. The bacterial gut microbiota acts the physiology of the gut and is further determined by diet
as a stimulator of the intestinal immune system and provides (Ley et al. 2008a, 2008b). The digestive tract of members
nutrients to the host (Neish 2009). Bacterial fermentation of of Ursidae (Carnivora) differs substantially from that of spe-
carbohydrates or proteins otherwise nondigestable by the cialized plant eaters. Lacking a major fermentation organ,
host results in the formation of short-chain fatty acids digestion times of grizzly and black bears (Ursus arctos and
(SCFAs), which deliver between 10% and 35% of the en- Ursus americanus) for plant material and meat are 7 and
ergy needed by omnivores and up to 70% of energy needed 13 h, respectively (Pritchard and Robbins 1990). The almost
Received 7 September 2010. Revision received 3 December 2010. Accepted 6 December 2010. Published on the NRC Research Press
Web site at cjm.nrc.ca on 10 February 2011.
C. Schwab1,2 and M. Gänzle. Department of Agricultural, Food and Nutritional Science, University of Alberta, Edmonton, AB, Canada.
1Corresponding author (e-mail: cschwab@ualberta.ca).
2Present address: 4-10 Ag/For Centre, Edmonton, AB T6E 2P5, Canada.

Can. J. Microbiol. 57: 177–185 (2011) doi:10.1139/W10-113 Published by NRC Research Press
 178
exclusively herbivorous giant panda (Ailuropoda melano-
leuca) and red panda (Ailurus fulgens) digest bamboo in
less than 12 and 2–4 h, respectively (Dierenfeld et al. 1962;
Wei et al. 1999). Nevertheless, the presence of SCFAs in
grizzly bear feces indicates metabolic activity and, thus, a
potential for intestinal microbiota to contribute to energy
maintenance (Schwab et al. 2009). The fecal microbiota of
the giant panda and wild grizzly bears feeding on a diet pre-
dominantly composed of vegetative matter is similar, with a
prevalence of the facultative anaerobes Enterobacteriaceae
and enterococci, incapable of digesting plant polysacchar-
ides (Hirayama et al. 1989; Wei et al. 2007; Schwab et al.
2009). The strict anaerobes of the Bacteroides–Prevotella–
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by 41.107.48.123 on 04/17/11
Porphyromonas group and the Clostridium clusters IV and
XIV are present in significantly lower counts (Schwab et al.
2009).
Among the Ursidae, the polar bear (Ursus maritimus) is
the only species with a dominantly carnivorous diet. Wild
polar bears use the sea ice to hunt ringed and bearded seals
(Pusa hispida and Erignathus barbatus, respectively). In the
summer, some polar bears (for example at Hudson Bay)
move onshore and feed on a more varied diet composed of
Arctic char (Salvelinus alpinus), ringed seal, and berries.
Onshore periods may be extended in future as a result of cli-
mate change affecting sea ice conditions and seal popula-
tions (Dyck and Kebreab 2009). In contrast to the
For personal use only.
omnivorous grizzly bears and the herbivorous giant panda
(Hirayama et al. 1989; Wei et al. 2007; Schwab et al.
2009), limited data exist on the composition of the intestinal
microbiota in polar bears. A 16S rRNA gene clone library
based on 161 sequences obtained from feces of 3 animals
indicated low diversity of the fecal microbiota of wild polar
bears and assigned the majority of sequences to the genus
Clostridium (Glad et al. 2010). Ley et al. (2008a) analysed
2 samples from captive polar bears by pyrosequencing and
detected predominantly Firmicutes.
The aim of this study was to further investigate fecal bac-
terial populations and microbial metabolic activity in polar
bears. Feces were obtained from 3 captive polar bears to en-
able consecutive sample collection from the same animal.
Earlier studies on the closely related grizzly bears indicated
that the fecal microbiota composition of wild and captive
animals is similar (Schwab et al. 2009). The composition of
the polar bear fecal microbiota was analysed by group-
specific quantitative PCR using the 16S rRNA gene as target
and was compared with other Carnivora and mammals
(Schwab et al. 2009). Stability of dominant bacterial species
within the polar bear fecal population was determined by
PCR–DGGE (denaturing gradient gel electrophoresis). Intes-
tinal metabolic activity of polar bears, other Carnivora, and
mammals was identified by analysis of SCFAs present in fe-
ces.
Materials and methods
Sampling from captive polar bears
Fecal samples from 1 male (I) and 2 female polar bears
(A, N) housed at the Toronto Zoo, Toronto, Ontario, Can-
ada, were obtained in cooperation with the Toronto Zoo.
Samples were collected 0–24 h after defecation and were
frozen immediately until analysis (–20 8C). The animals
Can. J. Microbiol. Vol. 57, 2011
were fed their regular diet, as indicated in Table 1. Feed
was freely accessible. The first 2 fecal samples (samples 1
and 2) were collected on 2 consecutive days (10 and
11 October) and then in 14-day intervals (samples 3 and 4,
23 October and 11 November). One of the female animals
was fed millet seeds as a marker. Zoo wardens reported that
the female animals did not consume their daily ratios on the
first sampling day.
Sampling from captive grizzly and black bears
Fecal samples from 1 male and 1 female grizzly bear and
from 4 female brown bears housed at the Calgary Zoo, Cal-
gary, Alberta, Canada, were obtained in cooperation with
the Calgary Zoo (Biological Research Permit 2009-01).
These samples were collected 0–24 h after defecation and
were frozen immediately until analysis (–20 8C). The ani-
mals were fed their regular diet as indicated in Table 1.
Feed was freely accessible.
Sampling from other mammals
Fecal samples from striped skunk (Mephitis mephitis), red
panda, rat (Rattus rattus), African crested porcupine (Hystrix
cristata), red-necked wallaby (Macropus rufogriseus), Asian
elephant (Elephas maximus), and Grevy’s zebra (Equus gre-
vyi) were collected at the Valley Zoo, Edmonton, Alberta,
Canada. Samples were less than 24 h old at collection and
were frozen immediately until analysis (–20 8C).
DNA isolation from fecal samples
DNA was isolated from feces with QIAamp DNA stool
mini kit (Qiagen), which has been successfully employed
before for DNA isolation from fecal microbiota (Li et al.
2003; Schwab et al. 2009).
Microbiota analysis by group specific primers using
group specific quantitative PCR
Fecal bacterial composition was analysed using group-
specific primers, as listed in Table 2. An Applied Biosys-
tems 7500 Fast Real-time PCR unit (Applied Biosystems,
Streetsville, Ontario, Canada) was used. The PCR cycle was
set to 94 8C for 5 min of initial denaturation, followed by 40
cycles of 94 8C for 15 s, 60 8C for 15 s, and 72 8C for 30 s.
Master mixes (25 mL) contained 12.5 mL of Applied Biosys-
tems Fast SYBR Green master mix, 1 mL of DNA, and 0.05
pmol of primer. Melting curve analysis and size determina-
tion of amplificates on agarose gels verified amplification of
the target fragments. Standard curves were generated as de-
scribed by Metzler-Zebeli et al. (2010).
Quantitative PCR of clostridial a-toxin gene cpa
The prevalence of the clostridial a-toxin in the feces of 3
captive polar bears was determined by quantitative PCR
using the TaqMan FAM–TAMRA probe (reporter dye
6-carboxyfluorescein – quencher dye 6-carboxytetra-
methylrhodamine) CRPF cpaS in combination with the pri-
mer pair CRPF forward and reverse (Table 2,
Messelhäusser et al. 2007).
PCR–DGGE analysis
The V2–V3 region of the 16S rRNA gene (position 339–
539 in the Escherichia coli gene) of bacteria in polar bear
Published by NRC Research Press
 Schwab and Gänzle 179

Table 1. Species analysed in this study and dietary habits.

Animal Order Sex* Diet{

Polar bear Carnivora Male, I Canine meat diet 32%
Kibble 16%
Fish 13%
Fruit and (or) vegetable 39%
Female 1, N Canine meat diet 36%
Female 2, A Kibble 9%
Fish 16%
Fruit and (or) vegetable 40%
Grizzly bear Carnivora Male (1), female (1) Kibble 23%–26%
Fish 26%–37%
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by 41.107.48.123 on 04/17/11

Fruit and (or) vegetable 37%–51%

Black bear Carnivora Female (4) Kibble 29%
Fish 27%
Fruit and (or) vegetable 44%
Striped skunk Carnivora Unknown Omnivorous
Red panda Carnivora Unknown Herbivorous
Rat Rodentia Unknown Predominantly herbivorous
African crested porcupine Rodentia Unknown Predominantly herbivorous
Red-necked wallaby Diprotodontia Unknown Herbivorous
Asian elephant Proboscidea Female (1) Herbivorous
Grevy’s zebra Perissodactyla Male (1) Herbivorous
*Numbers in parentheses refer to number of animals.
{
Toronto Zoo canine meat diet contains horse meat (70% protein, 15% fat). Kibble (Eukanuba dog kibble) contains chicken
For personal use only.

and corn meal.

Table 2. Primers used in this study for group-specific quantitative PCR.

Target Primer (5’–3’) Reference

Eubacteria F: CGGYCCAGACTCCTACGGG Lee et al. 1996
R: TTACCGCGGCTGCTGGCAC
Enterobacteriaceae F: GTTAATACCTTTGCTCATTGA Malinen et al. 2003
R: ACCAGGGTATCTAATCCTGTT
Enterococci F: CCCTTATTGTTAGTTGCCATCATT Rinttilä et al. 2004
R: ACTCGTTGTACTTCCCATTGT
Lactobacilli, pediococci, Leuconostoc spp. F: AGCAGTAGGGAATCTTCCA Heilig et al. 2002
R: CACCGCTACACATGGAG Walter et al. 2001
Bacteroides–Prevotella–Porphyromonas group F: GGTGTCGGCTTAAGTGCCAT Rinttilä et al. 2004
R: CGGAYGTAAGGGCCGTGC
Clostridium cluster I F: ATGCAAGTCGAGCGAKG Rinttilä et al. 2004
R: TATGCGGTATTAATCTYCCTTT
Clostridium cluster IV (Clostridium leptum – F: GCACAAGCAGTGGAGT Matsuki et al. 2004
Fecalibacterium prausnitzii subgroup)
R: CTTCCTCCGTTTTGTCAA
Clostridium clusters XIVa and XIVb F: AAATGACGGTACCTGACTAA Matsuki et al. 2002
(Clostridium coccoides – Eubacterium
rectale subgroup)
R: CTTTGAGTTTCATTCTTGCGAA
Bifidobacterium spp. F: TCGCGTCYGGTGTGAAAG Rinttilä et al. 2004
R: CCACATCCAGCRTCCAC
Clostridium perfringens a-toxin F: GCTAATGTTACTGCCGTTGA Messelhäusser et al. 2007
R: CCTCATTAGTTTTGCAACC
CpaS: GCGCAGGACATGTTAAGTTTG* .
*FAM–TAMRA probe.

feces was amplified using primers HDA1-GC and HDA2
(Tannock et al. 2000). PCR–DGGE detects up to 90%–99%
of the numerically dominant bacterial species present in fe-
ces (Zoetendal et al. 1998). The amplification program was
94 8C for 2 min; 40 cycles of 94 8C for 30 s, 56 8C for 30 s,
and 72 8C for 1 min; and 72 8C for 7 min. DGGE was per-
formed as described before, using a 30%–55% urea–
formamide gradient (Walter et al. 2000). The DNA bands
were stained by SYBR Green I nucleic acid gel stain (Invi-
trogen, Burlington, Ontario, Canada). Gels were analysed

Published by NRC Research Press

 180 Can. J. Microbiol. Vol. 57, 2011

using BioNumerics software (Applied Maths, Sint-Martens-

Bifidobacteria
Latem, Belgium). Bands were assigned manually; normal-
ized banding patterns were used for cluster analysis. Similar-
Table 3. Bacterial populations (log DNA gene copies
(g feces)–1) in the feces of Carnivora (polar, black, and grizzly bears, striped skunk, and red panda), Rodentia (rat and

2.6±0.4
3.3±0.8

4.2±0.1

3.3±0.3
3.2±0.5
3.3±0.8
ity between DGGE profiles was determined by calculation

5.7±0
of similarity indices of densitometric curves of profiles by

ND
ND

ND
using the Pearson correlation. The UPGMA (unweighted
pair group method with arithmetic mean) algorithm was
used for construction of dendrograms.

4.7±0.9
7.4±0.5
6.9±0.4
6.4±0.9

6.2±1.1
7.6±0.1
8.2±0.1
6.1±1.0

5.2±0.4
5.3±0.4
Determination of lactate and SCFAs using high-
I

performance liquid chromatography

Fecal samples were incubated with 7.5% perchloric acid

7.1±0.9
3.8±0.6

4.4±0.8
3.2±0.5
8.6±0.4
7.0±0.5

6.9±0.3
7.8±0.4
at 4 8C overnight to remove proteins. Metabolites were sep-
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by 41.107.48.123 on 04/17/11

Clostridium cluster

arated using an Aminex 87H column (Biorad, Mississauga,

ND
ND
IV

Ontario, Canada) at a temperature of 70 8C. The solvent

was 5% acetonitrile in 5 mmol H2SO4, at a flow rate of
0.4 mL
min–1. Metabolites were visualized using an UV de-
7.2±0.8
4.2±1.8
4.4±0.8
5.2±0.8
5.6±0.3

8.6±0.2
7.9±1.1

7.5±0.2
7.6±0.3

tector at 210 nm and identified using external standards.

XIV

Lactate and SCFAs were analysed in duplicate. Total SCFA

ND

content was calculated as the sum of acetate, propionate, bu-

tyrate, isobutyrate, valerate, isovalerate, and caproate
(mmol
kg–1). The percentage of acetate, propionate, or buty-
8.8±0.4
10.5±0.1
5.2±0.5
5.9±0.5
5.9±0.6
5.4±0.4

9.8±0.4

8.8±0.2
8.6±1.0
Note: Log DNA gene copies
(g feces)–1 were determined by quantitative PCR using group-specific primers. ND, not detected.

rate was calculated as the ratio of either SCFA to the sum of

BPP{

ND

acetate, propionate, and butyrate. Rat samples were omitted

from the analysis because of low amounts of sample.
For personal use only.

Results
5.1±0.5
5.1±1.1
5.4±0.5
5.9±0.5
5.6±0.2

5.6±0.2
6.7±0.6
7.0±0.2

5.7±0.1
6.7±0.8
LPL*

Microbiota composition of polar bears in comparison to

other Carnivora and mammals
Total bacteria counts in the feces of polar bears were log
Enterococci

8.5 ± 0.5 DNA gene copies
(g feces)–1 and, thus, were in the
same range as total bacterial abundance in the feces of griz-
African crested porcupine), red-necked wallaby, Asian elephant, and Grevy’s zebra.

6.9±0.4
7.2±0.9
6.6±0.8
7.5±0.5
6.7±0.3

7.7±0.3
7.1±0.3

6.7±0.1
6.1±0.9
6.5±0

zly and black bears and red panda (Table 3). Enterobacter-
iaceae were the predominant facultative anaerobes in feces
of polar bear, grizzly bear, and striped skunk. In comparison
with Enterobacteriaceae, enterococci were present at similar
Enterobacteriaceae

levels in the feces of black bear but prevailed in that of red

panda. Among the strict anaerobes, the Clostridium cluster I
was dominant in the feces of all 5 Carnivora species ana-
lysed.
5.4±1.2
9.0±0.8
7.8±0.8
7.3±0.8
7.8±1.0

6.4±0.4
6.2±2.2

5.5±0.2
5.1±0.4
4.2±0

Total bacteria counts were higher in feces obtained from

Rodentia (rat and African crested porcupine) and Grevy’s
zebra; the Bacteroides–Prevotella–Porphyromonas group
represented the majority of the fecal bacterial population.
eubacteria

The Bacteroides–Prevotella–Porphyromonas group was also

Bacteroides–Prevotella–Porphyromonas group.
9.4±0.2

8.7±0.7
8.5±0.5
8.9±0.4
8.6±0.2

8.2±0.3

9.8±0.6

8.7±0.1
9.3±0.2
10.5±0.1

dominant in the feces of red-necked wallaby, Asian ele-

Total

*Lactobacilli, pediococci, Leuconostoc spp.

phant, and Grevy’s zebra. Among the clostridia, the Clostri-

dium clusters IV and XIV were generally present in equal
numbers, whereas Clostridium cluster I was detected be-
tween log 1.4 and 2.5 DNA gene copies
(g feces)–1 lower
African crested porcupine (2)

numbers in feces of rodents, red-necked wallaby, Asian ele-

Animal (no. of samples)

Red-necked wallaby (3)

phant, and Grevy’s zebra. Enterococci were the most domi-

nant among the facultative anaerobes, with the exception of
zebra, where lactobacilli, pediococci, and Leuconostoc spp.
Striped skunk (2)
Grizzly bear (6)
Polar bear (12)

Asian elephant

prevailed. Bifidobacteria numbers were low or below detec-

Black bear (6)

Red panda (2)

Grevy’s zebra

tion limit in all the species analysed.

Rat (2)

Stability of polar bear fecal bacterial populations

{

During the study period, total bacteria counts were log 8.5 ±
0.7, 8.3 ± 0.4, and 8.8 ± 0.2 DNA gene copies
(g feces)–1

Published by NRC Research Press

 Schwab and Gänzle
Fig. 1. Bacterial abundance of 3 captive polar bears: 1 male (I) and 2 females (N, A). Abundance of total bacteria population (*); Entero-
bacteriaceae (*); enterococci (!); lactobacilli, pediococci, and Leuconostoc spp. (D); the Bacteroides–Prevotella–Porphyromonas group
(&); and the Clostridium cluster I (&) was determined by quantitative PCR using group-specific primers targeting the 16S rRNA gene. The
presence of the clostridial a-toxin gene (?) was confirmed by a TaqMan probe.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by 41.107.48.123 on 04/17/11
for I, N, and A, respectively. In feces of the male polar bear
(I), Enterobacteriaceae and Clostridium cluster I were the
dominant bacterial populations, whereas in feces of the fe-
male polar bears, enterococci were also present. The Bacter-
oides–Prevotella–Porphyromonas cluster was present at
approximately log 6 gene copies
(g feces)–1 in the male
bear at 3 sampling days and below detection at the fourth
For personal use only.
day. In feces of both female bears, the numbers of the Bac-
teroides–Prevotella–Porphyromonas group fluctuated more
than log 1 gene copies
(g feces)–1 during the sampling pe-
riod. Clostridium cluster IV was only detected irregularly
(data not shown). Counts of Clostridium cluster XIV dif-
fered up to log 4 between sampling days in 2 of the bears
(I, N) and were low, but stable, in the third bear (A, log
3.7 ± 0.5 DNA gene copies
(g feces)–1) (data not shown).
The presence of lactobacilli, pediococci, Leuconostoc spp.
fluctuated near log 5.4 ± 0.3, 5.5 ± 0.3, and 5.2 ± 0.9 DNA
gene copies
(g feces)–1 for I, N, and A, respectively, whereas
bifidobacteria were present in >log 4 DNA gene copies
(g
feces)–1 in all 3 bears (data not shown).
Prevalence of clostridial a-toxin gene cpa
The a-toxin gene cpa was detected in feces of all 3 cap-
tive polar bears (Fig. 1). DNA gene copy numbers of cpa
stabilized at above log 7 DNA gene copies
(g feces)–1 in fe-
cal samples obtained from all 3 bears at sampling days 2, 3,
and 4.
Temporal presence of dominant bacterial species in polar
bear feces
Stability of bacterial species present in polar bear feces
was analysed by PCR–DGGE using universal primers
HDA1-GC and HDA2; the DGGE gel and the results of the
cluster analysis are shown in Fig. 2. The profiles were
heterogeneous; the number of bands varied among animals
and among sampling days. Similarity values obtained from
dendrograms of single bears ranged from 37.3% to 77.1%,
35.1% to 91.7%, and 48.1% to 73.5% for I, N, and A, re-
spectively. Similarity of all samples was 42.4%. Profiles of
single bears did not cluster; profiles did not contain any
band, which was shared by all samples.
181
Metabolic activity of intestinal microbiota of Carnivora
in comparison with other mammals
Lactate was routinely detected in feces of all 5 Carnivora
and was present in only low amounts in feces of the other
mammals tested (Table 4). Total SCFA content in Ursidae
feces varied to a large extent among samples but was com-
parable to the other mammals tested. Black bear total SCFA
content was lower compared with polar bears and grizzly
bears. In bear feces, the ratio of acetate, propionate, and bu-
tyrate was generally consistent (acetate ‡ propionate > buty-
rate). In feces of striped skunk and red panda, acetate was
the main SCFA, followed by butyrate and propionate. In fe-
ces of African crested porcupine, acetate prevailed, whereas
feces of red-necked wallaby and Grevy’s zebra predomi-
nantly contained butyrate. Acetate and butyrate were equally
present in feces of the Asian elephant.
Discussion
Polar bears face significant habitat and diet changes in the
future caused by a decline of sea ice and corresponding ef-
fects on their predominant diet, seal populations, and in-
creasing exposure to humans in the Arctic habitat (Burek et
al. 2008; Prowse et al. 2009). Few data exist on the polar
bear gut microbiota (Ley et al. 2008a; Glad et al. 2010).
Therefore this study investigated the composition, stability,
and metabolic activity of the intestinal microbiota of 3 cap-
tive polar bears. Samples were obtained within 24 h of defe-
cation, fecal microbiota composition and SCFA content
within feces could be affected by postdefecation metabo-
lism. However, similar sampling schemes have been em-
ployed successfully in previous studies (Ley et al. 2008a).
Strict anaerobes do not grow upon exposure to oxygen. The
absence of fermentable sugars in fresh feces minimizes the
risk of growth of facultative anaerobes and limits metabolic
activity after defecation.
Captive polar bears black and grizzly bears analysed in
this study consumed a similar diet composed of animal pro-
tein and vegetative matter. Accordingly, total bacterial
counts in polar bear feces were comparable to other Ursidae
(Hirayama et al. 1989; Schwab et al. 2009) but were lower
than that in other Carnivora (Swanson et al. 2002; Mentula
Published by NRC Research Press
 182 Can. J. Microbiol. Vol. 57, 2011

Fig. 2. Denaturing gradient gel electrophoresis profile of PCR products of 16S rRNA gene V3 regions of fecal samples from polar bears I,
N, and A taken at different times over a period of 4 weeks. I, male polar bear; N and A, female polar bears; 1, 2, 3, and 4 refer to sampling
days.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by 41.107.48.123 on 04/17/11
For personal use only.

Table 4. Lactate, total short-chain fatty acid (SCFA) content, and the ratio of acetate, propionate, and butyrate present in
feces of the polar bear in comparison with other Carnivora and mammals.

Lactate Total SCFA content

Animal (no. of samples) (mmol
kg–1) (mmol
kg–1) % Acetate % Propionate % Butyrate
Polar bear (12) 10.0–142.3 75.3–340.5 56.1±10.4 33.0±13.1 10.9±6.9
Black bear (6) 3.4–29.8 15.4–82.6 58.9±24.6 30.8±22.0 10.3±10.6
Grizzly bear (6) 3.9–50.9 35.0–385.9 43.0±14.1 43.6±21.0 13.4±13.4
Striped skunk (2) 5.2–39.5 223.5–613.3 48.3±8.0 17.5±10.8 34.2±2.8
Red panda (2) 1.0–33.5 309.9–355.4 74.1±7.1 4.4±1.8 21.5±8.9
African crested porcupine (2) 0 289.3–548.0 81.7±5.4 2.8±0.6 15.5±6.0
Red-necked wallaby (3) 0–2.9 109.9–266.3 25.4±14.7 5.7±5.5 68.9±19.5
Asian elephant (2) 0 70.6–366.8 39.9±7.8 21.2±4.1 38.9±12.0
Grevy’s zebra (2) 0–1.1 80.6–303.4 36.5±9.9 9.6±13.6 53.9±23.5
Note: Lactate and SCFA were determined by high-performance liquid chromatography.

et al. 2005). The composition of the polar bear fecal micro-
biota closely resembled the fecal bacterial population of
captive grizzly and black bears, confirming that gut physiol-
ogy affects microbiota composition (Ley et al. 2008a,
2008b). Bacterial populations in polar bear, black and griz-
zly bears, and striped skunk feces were dominated by the
facultative anaerobes Enterobacteriaceae and enterococci
and by the strict anaerobes of Clostridium cluster I. The
prevalence of facultative anaerobes had previously been ob-
served in wild and captive grizzly bears feeding on a mostly
vegetative and protein-rich regular diet, respectively
(Schwab et al. 2009). Enterobacteriaceae, enterococci
(streptococci), and clostridia were identified as the dominant
species in the giant panda (Hirayama et al. 1989; Wei et al.
2007). In wild polar bears, clostridia of Clostridium clusters
I and XI prevailed; facultative anaerobes were not detected
(Glad et al. 2010), possibly owing to the small size of the
clonal library used and to a bias of universal primers in
PCR reactions (Metzler-Zebeli et al. 2010).
In captive polar bear feces, Clostridium cluster I clearly
outnumbered Clostridium clusters IV and XIV. Clostridium
clusters IV and XIV contain several cellulolytic and fibro-
lytic bacteria (Collins et al. 1994). Clostridium cluster I in-
cludes proteolytic and fibrolytic species; and the toxinogenic
species Clostridium botulinum and Clostridium perfringens
(Collins et al. 1994). Clostridium perfringens is a common
inhabitant of the mammal intestinal tract causing disease in
times of decreased host resistance (for example diet change,
antibiotic treatment). The a-toxin gene, which is associated
with all 5 different toxin types (A, B, C, D, and E) of
C. perfringens (Petit et al. 1999) was detected in the feces
of all 3 captive polar bears, but no disease was observed in
any animal. Clostridium perfringens has been previously de-
tected in wild polar bear feces (Jores et al. 2008; Glad et al.
2010). High detection numbers of a-toxin confirmed the

Published by NRC Research Press

 Schwab and Gänzle
presence of C. perfringens in feces of captive polar bears. In
dogs and cats, the prevalence of C. perfringens in feces was
associated with a protein-rich diet (Zentek et al. 2003;
Lubbs et al. 2009).
Strict anaerobes of the Bacteroides–Prevotella–Porphyro-
monas group, which includes species capable of effectively
digesting plant polysaccharides, prevailed in the
foregut-fermenting rodents, the red-necked wallaby, and the
hindgut-fermenting Grevy’s zebra (Salyers et al. 1977; Macy
and Probst 1979; Brooks et al. 2003; Yamano et al. 2008).
The lactobacilli, pediococci, Leuconostoc spp. were highly
represented in feces of rodents and Grevy’s zebra. Rodentia
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by 41.107.48.123 on 04/17/11
and Equidae possess forestomachs and stomachs, respec-
tively, lined with nonglandular, stratified, squamous epithe-
lium, which enables the persistence of lactobacilli (Stevens
and Hume 1995; Yuki et al. 2000; Walter 2008). Bifidobac-
teria were present in low numbers in all species tested. Bifi-
dobacteria are highly representative in human feces but are
differentially abundant in animals (Furet et al. 2009). In
cats and dogs, bifidobacteria are highly representative; abun-
dance is lower if quantification methods are based on the
16S rRNA gene (Mentula et al. 2005; Middelbos et al.
2007; Desai et al. 2009). Nevertheless, low detection of bifi-
dobacteria in polar, grizzly, and black bear feces confirmed
low bifidobacteria counts in the giant panda, which were de-
For personal use only.
termined by culture-dependent techniques (Hirayama et al.
1989).
Bacterial species present in polar bear feces varied to a
large extent, as indicated by PCR–DGGE; whereas, bacterial
composition was rather stable on a genus level according to
group-specific quantitative PCR. In contrast, bacterial spe-
cies distribution within the fecal microbiota of omnivores is
rather stable (Simpson et al. 2000; Tannock et al. 2000;
Maukonen et al. 2008; McOrist et al. 2008). High fluctua-
tions of bacterial species within the polar bear microbiota
may be caused by the simple gut physiology and fast diges-
tion times.
SCFA formation depends on gut physiology, bacterial mi-
crobiota, and substrate availability. Carnivora possess simple
intestinal tracts and are fast digesters (Dierenfeld et al. 1962;
Pritchard and Robbins 1990; Wei et al. 1999). Nevertheless,
the presence of SCFA in feces of all Carnivora analysed in-
dicated microbial fermentative activity. Total SCFA and ra-
tios of acetate, propionate, and butyrate fluctuated, most
likely to because of feeding schedule and sample collection,
but were within ranges previously reported (Stevens and
Hume 1995). Molar ratios of SCFAs in feces of captive po-
lar bears and black and grizzly bears in this study resembled
ratios previously observed in mammals (Swanson et al.
2002; Delgado et al. 2006; Alvaro et al. 2007; Metzler et
al. 2009; Schwab et al. 2009). Remarkably, lactate was rou-
tinely detected in feces of all Carnivora, whereas lactate was
present in only very low amounts in feces of the other mam-
mals. In omnivores, herbivores, and dogs, lactate is metabo-
lized in the cecum, and only traces are detected in the feces
(Clemens et al. 1975; Banta et al. 1979; Swanson et al.
2002; Delgado et al. 2006; Alvaro et al. 2007; Metzler et
al. 2009). However, during the passage through the gastroin-
testinal tract of the raccoon (Procyon lotor, Carnivora),
which also possess the simple gastrointestinal system of
183
Carnivora, no lactate metabolism occurs, and lactate is still
detectable in the distal gut (Clemens and Stevens 1979).
In summary, the fecal bacterial population of captive po-
lar bears is predominantly composed of the facultative anae-
robes Enterobacteriaceae and enterococci and the strict
anaerobes of Clostridium cluster I and, therefore, resembles
the fecal microbiota of wild and captive grizzly bears and
black bears. The presence of SCFAs in feces confirmed in-
testinal bacterial metabolic activity; the SCFA content and
composition in feces of captive polar bears was comparable
with that of other Carnivora and mammals analysed in this
study; the presence of lactate in feces is an indicator of the
Carnivora digestive system.
Acknowledgements
The authors wish to thank Elena Dlusskaya and Petya Ko-
leva for their help with PCR–DGGE.
References
Alvaro, E., Andrieux, C., Rochet, V., Rigottier-Gois, L., Lepercq,
P., Sutren, M., et al. 2007. Composition and metabolism of the
intestinal microbiota in consumers and non-consumers of yogurt.
Br. J. Nutr. 97(1): 126–133. doi:10.1017/S0007114507243065.
PMID:17217568.
Banta, C.A., Clemens, E.T., Krinsky, M.M., and Sheffy, B.E. 1979.
Sites of organic acid production and patterns of digesta move-
ment in the gastrointestinal tract of dogs. J. Nutr. 109(9): 1592–
1600. PMID:39123.
Brooks, S.P.J., McAllister, M., Sandoz, M., and Kalmokoff, M.L.
2003. Culture-independent phylogenetic analysis of the faecal
flora of the rat. Can. J. Microbiol. 49(10): 589–601. doi:10.
1139/w03-075. PMID:14663493.
Burek, K.A., Gulland, F.M.D., and O’Hara, T.M. 2008. Effects of
climate change on Arctic marine mammal health. Ecol. Appl.
18(Suppl. 2): S126–S134. doi:10.1890/06-0553.1. PMID:
18494366.
Clemens, E.T., and Stevens, C.E. 1979. Sites of organic acid pro-
duction and patterns of digesta movement in the gastro-intestinal
tract of the raccoon. J. Nutr. 109(6): 1110–1116. PMID:448450.
Clemens, E.T., Stevens, C.E., and Southworth, M. 1975. Sites of
organic acid production and pattern of digesta movement in the
gastrointestinal tract of swine. J. Nutr. 105(6): 759–768. PMID:
237989.
Collins, M.D., Lawson, P.A., Willems, A., Cordoba, J.J., Fernan-
dez-Garayzabal, J., Garcia, P., et al. 1994. The phylogeny of
the genus Clostridium: proposal of five new genera and eleven
new species combinations. Int. J. Syst. Bacteriol. 44(4): 812–
826. doi:10.1099/00207713-44-4-812. PMID:7981107.
Delgado, S., Ruas-Madiedo, P., Suárez, A., and Mayo, B. 2006. In-
terindividual differences in microbial counts and biochemical-
associated variables in the feces of healthy Spanish adults. Dig.
Dis. Sci. 51(4): 737–743. doi:10.1007/s10620-006-3200-5.
PMID:16614997.
Desai, A.R., Musil, K.M., Carr, A.P., and Hill, J.E. 2009. Charac-
terization and quantification of feline fecal microbiota using
cpn60 sequence-based methods and investigation of animal-to-
animal variation in microbial population structure. Vet. Micro-
biol. 137(1–2): 120–128. doi:10.1016/j.vetmic.2008.12.019.
PMID:19167842.
Dierenfeld, E.S., Hintz, H.F., Robertson, J.B., van Soest, P.J., and
Oftedal, O.T. 1962. Utilization of bamboo by the giant panda.
J. Nutr. 112: 636–641.
Published by NRC Research Press
 184
Dyck, M.G., and Kebreab, E. 2009. Estimating the energetic contri-
bution of polar bear (Ursus maritimus) summer diets to the total
energy budget. J. Mammal. 90(3): 585–593. doi:10.1644/08-
MAMM-A-103R2.1.
Furet, J.-P., Firmesse, O., Gourmelon, M., Bridonneau, C., Tap, J.,
Mondot, S., et al. 2009. Comparative assessment of human and
farm animal faecal microbiota using real-time quantitative PCR.
FEMS Microbiol. Ecol. 68(3): 351–362. doi:10.1111/j.1574-
6941.2009.00671.x. PMID:19302550.
Glad, T., Bernhardsen, P., Nielsen, K.M., Brusetti, L., Andersen,
M., Aars, J., and Sundset, M.A. 2010. Bacterial diversity in
faeces from polar bear (Ursus maritimus) in Arctic Svalbard.
BMC Microbiol. 10(1): 10. doi:10.1186/1471-2180-10-10.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by 41.107.48.123 on 04/17/11
PMID:20074323.
Heilig, H.G.H.J., Zoetendal, E.G., Vaughan, E.E., Marteau, P., Ak-
kermans, A.D.L., and de Vos, W.M. 2002. Molecular diversity
of Lactobacillus spp. and other lactic acid bacteria in the human
intestine as determined by specific amplification of 16S riboso-
mal DNA. Appl. Environ. Microbiol. 68(1): 114–123. doi:10.
1128/AEM.68.1.114-123.2002. PMID:11772617.
Hirayama, K., Kawamura, S., Mitsuoka, T., and Tashiro, K. 1989.
The faecal flora of the giant panda (Ailuropoda melanoleuca). J.
Appl. Bacteriol. 67(4): 411–415. PMID:2584169.
Jores, J., Derocher, A.E., Staubach, C., and Aschfalk, A. 2008. Oc-
currence and prevalence of Clostridium perfringens in polar
bears from Svalbard, Norway. J. Wildl. Dis. 44(1): 155–158.
PMID:18263831.
For personal use only.
Lee, D.-H., Zo, Y.-G., and Kim, S.-J. 1996. Nonradioactive method
to study genetic profiles of natural bacterial communities by
PCR-single-strand-conformation polymorphism. Appl. Environ.
Microbiol. 62(9): 3112–3120. PMID:8795197.
Ley, R.E., Hamady, M., Lozupone, C., Turnbaugh, P.J., Ramey,
R.R., Bircher, J.S., et al. 2008a. Evolution of mammals and their
gut microbes. Science, 320(5883): 1647–1651. doi:10.1126/
science.1155725. PMID:18497261.
Ley, R.E., Lozupone, C.A., Hamaday, M., Knight, R., and Gordon,
J.I. 2008b. Worlds within worlds: evolution of the vertebrate gut
microbiota. Nature, 6: 776–788.
Li, M., Gong, J., Cottrill, M., Yu, H., de Lange, C., Burton, J., and
Topp, E. 2003. Evaluation of QIAamp DNA Stool Mini Kit for
ecological studies of gut microbiota. J. Microbiol. Methods,
54(1): 13–20. doi:10.1016/S0167-7012(02)00260-9. PMID:
12732417.
Lubbs, D.C., Vester, B.M., Fastinger, N.D., and Swanson, K.S.
2009. Dietary protein concentration affects intestinal microbiota
of adult cats: a study using DGGE and qPCR to evaluate differ-
ences in microbial populations in the feline gastrointestinal tract.
J. Anim. Physiol. Anim. Nutr. (Berl.), 93(1): 113–121. doi:10.
1111/j.1439-0396.2007.00788.x. PMID:19386015.
Macy, J.M., and Probst, I. 1979. The biology of gastrointestinal
bacteroides. Annu. Rev. Microbiol. 33(1): 561–594. doi:10.
1146/annurev.mi.33.100179.003021. PMID:386933.
Malinen, E., Kassinen, A., Rinttilä, T., and Palva, A. 2003. Com-
parison of real-time PCR with SYBR Green I or 5’-nuclease as-
says and dot-blot hybridization with rDNA-targeted
oligonucleotide probes in quantification of selected faecal bac-
teria. Microbiology, 149(1): 269–277. doi:10.1099/mic.0.25975-
0. PMID:12576600.
Matsuki, T., Watanabe, K., Fujimoto, J., Miyamoto, Y., Takada, T.,
Matsumoto, K., et al. 2002. Development of 16S rRNA-gene-
targeted group-specific primers for the detection and identifica-
tion of predominant bacteria in human feces. Appl. Environ. Mi-
crobiol. 68(11): 5445–5451. doi:10.1128/AEM.68.11.5445-5451.
2002. PMID:12406736.
Can. J. Microbiol. Vol. 57, 2011
Matsuki, T., Watanabe, K., Fujimoto, J., Takada, T., and Tanaka,
R. 2004. Use of 16S rRNA gene-targeted group specific primers
for real-time PCR analysis of predominant bacteria in human
feces. Appl. Environ. Microbiol. 70(12): 7220–7228. doi:10.
1128/AEM.70.12.7220-7228.2004.
Maukonen, J., Mättö, J., Suihko, M.L., and Saarela, M. 2008. Intra-
individual diversity and similarity of salivary and faecal micro-
biota. J. Med. Microbiol. 57(12): 1560–1568. doi:10.1099/jmm.
0.47352-0. PMID:19018030.
McOrist, A.L., Abell, G.C.J., Cooke, C., and Nyland, K. 2008.
Bacterial population dynamics and faecal short-chain fatty acid
(SCFA) concentrations in healthy humans. Br. J. Nutr. 100(1):
138–146. doi:10.1017/S0007114507886351. PMID:18205991.
Mentula, S., Harmoinen, J., Heikkilä, M., Westermarck, E., Rautio,
M., Huovinen, P., and Könönen, E. 2005. Comparison between
cultured small-intestinal and fecal microbiotas in beagle dogs.
Appl. Environ. Microbiol. 71(8): 4169–4175. doi:10.1128/AEM.
71.8.4169-4175.2005. PMID:16085799.
Messelhäusser, U., Zucker, D., Elmer-Englhard, D., Busch, U.,
Hörmansdorfer, S., Pudich, U., and Höller, C. 2007. Nachweis
und Charakterisierung von Clostridium perfringens mittels real-
time-PCR. J. Verbr. Lebensm. 2(2): 194–197. doi:10.1007/
s00003-007-0173-z.
Metzler, B.U., Vahjen, W., Baumgärtel, T., Rodehutscord, M., and
Mosenthin, R. 2009. Changes in bacterial populations in the
ileum of pigs fed low-phosphorus diets supplemented with dif-
ferent sources of fermentable carbohydrates. Anim. Feed Sci.
Technol. 148(1): 68–89. doi:10.1016/j.anifeedsci.2008.03.009.
Metzler-Zebeli, B.U., Hooda, S., Pieper, R., Zijlstra, R.T., van Kes-
sel, A.G., Mosenthin, R., and Gänzle, M.G. 2010. Nonstarch
polysaccharides modulate bacterial microbiota, pathways for bu-
tyrate production, and abundance of pathogenic Escherichia coli
in the pig gastrointestinal tract. Appl. Environ. Microbiol.
76(11): 3692–3701. doi:10.1128/AEM.00257-10. PMID:
20382813.
Middelbos, I.S., Fastinger, N.D., and Fahey, G.C., Jr. 2007. Evalua-
tion of fermentable oligosaccharides in diets fed to dogs in com-
parison to fiber standards. J. Anim. Sci. 85(11): 3033–3044.
doi:10.2527/jas.2007-0080. PMID:17686893.
Neish, A.S. 2009. Microbes in gastrointestinal health and disease.
Gastroenterol. 136(1): 65–80. PMID:11427691.
Petit, L., Gibert, M., and Popoff, M.R. 1999. Clostridium perfrin-
gens: toxinotype and genotype. Trends Microbiol. 7(3): 104–
110. doi:10.1016/S0966-842X(98)01430-9. PMID:10203838.
Pritchard, G.T., and Robbins, C.T. 1990. Digestive and metabolic
efficiencies of grizzly and black bears. Can. J. Zool. 68(8):
1645–1651. doi:10.1139/z90-244.
Prowse, T.D., Furgal, C., Wrona, F.J., and Reist, J.D. 2009. Impli-
cations of climate change for northern Canada: freshwater, mar-
ine, and terrestrial ecosystems. Ambio, 38(5): 282–289. doi:10.
1579/0044-7447-38.5.282. PMID:19714961.
Rinttilä, T., Kassinen, A., Malinen, E., Krogius, L., and Palva, A.
2004. Development of an extensive set of 16S rDNA-targeted
primers for quantification of pathogenic and indigenous bacteria
in faecal samples by real-time PCR. J. Appl. Microbiol. 97(6):
1166–1177. doi:10.1111/j.1365-2672.2004.02409.x. PMID:
15546407.
Salyers, A.A., West, S.E., Vercellotti, J.R., and Wilkins, T.D. 1977.
Fermentation of mucins and plant polysaccharides by anaerobic
bacteria from the human colon. Appl. Environ. Microbiol. 34(5):
529–533. PMID:563214.
Schwab, C., Cristescu, B., Boyce, M.S., Stenhouse, G.B., and Gän-
zle, M. 2009. Bacterial populations and metabolites in the feces
Published by NRC Research Press
 Schwab and Gänzle
of free roaming and captive grizzly bears. Can. J. Microbiol.
55(12): 1335–1346. doi:10.1139/W09-083. PMID:20029525.
Simpson, J.M., McCracken, V.J., Gaskins, H.R., and Mackie, R.I.
2000. Denaturing gradient gel electrophoresis analysis of 16S ri-
bosomal DNA amplicons to monitor changes in fecal bacterial
populations of weaning pigs after introduction of Lactobacillus
reuteri strain MM53. Appl. Environ. Microbiol. 66(11): 4705–
4714. doi:10.1128/AEM.66.11.4705-4714.2000. PMID:
11055913.
Stevens, C.E., and Hume, I.D. 1995. Comparative physiology of
the vertebrate digestive system. Vol. 2. Cambridge University
Press, Cambridge.
Swanson, K.S., Grieshop, C.M., Flickinger, E.A., Bauer, L.L.,
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by 41.107.48.123 on 04/17/11
Chow, J., Wolf, B.W., et al. 2002. Fructooligosaccharides and
Lactobacillus acidophilus modify gut microbial populations, to-
tal tract nutrient digestibilities and fecal protein catabolite con-
centrations in healthy adult dogs. J. Nutr. 132(12): 3721–3731.
PMID:12468613.
Tannock, G.W., Munro, K., Harmsen, H.J.M., Welling, G.W.,
Smart, J., and Gopal, P.K. 2000. Analysis of the fecal microflora
of human subjects consuming a probiotic product containing
Lactobacillus rhamnosus DR20. Appl. Environ. Microbiol.
66(6): 2578–2588. doi:10.1128/AEM.66.6.2578-2588.2000.
PMID:10831441.
Topping, D.L., and Clifton, P.M. 2001. Short-chain fatty acids and
human colonic function: roles of resistant starch and nonstarch
polysaccharides. Physiol. Rev. 81(3): 1031–1064. PMID:
For personal use only.
11427691.
Walter, J. 2008. Ecological role of lactobacilli in the gastrointest-
inal tract: implications for fundamental and biomedical research.
Appl. Environ. Microbiol. 74(16): 4985–4996. doi:10.1128/
AEM.00753-08. PMID:18539818.
Walter, J., Tannock, G.W., Tilsala-Timisjarvi, A., Rodtong, S.,
Loach, D.M., Munro, K., and Alatossava, T. 2000. Detection
and identification of gastrointestinal Lactobacillus species by
using denaturing gradient gel electrophoresis and species-
specific PCR primers. Appl. Environ. Microbiol. 66(1): 297–
303. doi:10.1128/AEM.66.1.297-303.2000. PMID:10618239.
Walter, J., Hertel, C., Tannock, G.W., Lis, C.M., Munro, K., and
185
Hammes, W.P. 2001. Detection of Lactobacillus, Pediococcus,
Leuconostoc, and Weissella species in human feces by using
group-specific PCR primers and denaturing gradient gel electro-
phoresis. Appl. Environ. Microbiol. 67(6): 2578–2585. doi:10.
1128/AEM.67.6.2578-2585.2001. PMID:11375166.
Wei, F., Feng, Z., Wang, Z., Zhou, A., and Hu, J. 1999. Use of nu-
trients in bamboo by the red panda (Ailurus fulgens). J. Zool.
(Lond.), 248(4): 535–541. doi:10.1111/j.1469-7998.1999.
tb01053.x.
Wei, G., Lu, H., Zhou, Z., Xie, H., Wang, A., Nelson, K., and
Zhao, L. 2007. The microbial community in the feces of the
giant panda (Ailuropoda melanoleuca) as determined by PCR–
TGGE profiling and clone library analysis. Microb. Ecol. 54(1):
194–202. doi:10.1007/s00248-007-9225-2. PMID:17394039.
Williams, B.A., Verstegen, M.W.A., and Tamminga, S. 2001. Fer-
mentation in the large intestine of single-stomached animals and
its relationship to animal health. Nutr. Res. Rev. 14(2): 207–
228. doi:10.1079/NRR200127. PMID:19087424.
Yamano, H., Koike, S., Kobayashi, Y., and Hata, H. 2008. Phylo-
genetic analysis of hindgut microbiota in Hokkaido native
horses compared to light horses. Anim. Sci. J. 79(2): 234–242.
doi:10.1111/j.1740-0929.2008.00522.x.
Yuki, N., Shimazaki, T., Kushiro, A., Watanabe, K., Uchida, K.,
Yuyama, T., and Morotomi, M. 2000. Colonization of the strati-
fied squamous epithelium of the nonsecreting area of horse sto-
mach by lactobacilli. Appl. Environ. Microbiol. 66(11): 5030–
5034. doi:10.1128/AEM.66.11.5030-5034.2000. PMID:
11055960.
Zentek, J., Marquart, B., Pietrzak, T., Ballèvre, O., and Rochat, F.
2003. Dietary effects on bifidobacteria and Clostridium perfrin-
gens in the canine intestinal tract. J. Anim. Physiol. Anim. Nutr.
(Berl.), 87(11–12): 397–407. doi:10.1046/j.0931-2439.2003.
00451.x. PMID:14633049.
Zoetendal, E.G., Akkermans, A.D., and De Vos, W.M. 1998. Tem-
perature gradient gel electrophoresis analysis of 16S rRNA from
human fecal samples reveals stable and host-specific commu-
nities of active bacteria. Appl. Environ. Microbiol. 64(10):
3854–3859. PMID:9758810.
Published by NRC Research Press