Biotechnology Vol 8b Bio Transformation II, 2nd Ed

Biotechnology
Second Edition
Volume 8b
Biotransformations I1
Biotechnology
Second Edition
Fundamentals Special Topics
Volume 1 Volume 9
Biological Fundamentals Enzymes, Biomass, Food and Feed
Volume 2 Volume 10
Genetic Fundamentals and Special Processes
Genetic Engineering
Volumes 11a-c
Volume 3 Environmental Processes 1-111
Bioprocessing
Volume 12
Volume 4 Legal, Economic and
Measuring, Modelling and Control Ethical Dimensions
Products
Volume 5a
Recombinant Proteins, Monoclonal
Antibodies and Therapeutic Genes
Volume 5b
Genomics and Bioinformatics
Volume 6
Products of Primary Metabolism
Volume 7
Products of Secondary Metabolism
Volumes 8a and b
Biotransformations I and I1
All volumes are also displayed on our Biotech Website:

httpJ/m.wiley-vch.delbooks/biotech
A Multi-Volume Comprehensive Treatise
Biotechnology
Second, Completely Revised Edition
Edited by
H.-J. Rehm and G. Reed
in cooperation with
A. Puhler and P.Stadler
Volume 8b
Biotransformations I1
Volume Editor:
D. R. Kelly
Industrial Consultant:
J. Peters
@WILEY=VCH
Weinheim . New York . Chichester . Brisbane . Singapore .Toronto
Series Editors: Volume Editor:
Prof. Dr. H.-J. Rehm Dr. G. Reed Dr. D. R. Kelly
Institut fur Mikrobiologie 1029 N. Jackson St. #501-A Department of Chemistry
Universitat Miinster Milwaukee, WI 53202-3226 Cardiff University
CorrensstraBe 3 USA PO. Box 912
D-48149 Miinster Cardiff CF13TB
FRG UK
Prof. Dr. A. Piihler Prof. Dr. P. J. W. Stadler Industrial Consultant:

Biologie VI (Genetik) Artemis Pharmaceuticals Dr. J. Peters
Universitat Bielefeld Geschaftsfiihrung Bayer AG
P.O. Box 100131 Pharmazentrum Koln Geschilftsbereich Pharma
D-33501 Bielefeld Neurather Ring 1 TO Biotechnologie
FRG D-51063 Koln D-42096 Wuppertal
FRG FRG
This book was carefully produced. Nevertheless, authors, editors and publisher do not warrant the information
contained therein to be free of errors. Readers are advised to keep in mind that statements, data, illustrations,
procedural details or other items may inadvertently be inaccurate.
Library of Congress Card No.: applied for
British Library Cataloguing-in-PublicationData:

A catalogue record for this book is available from the British Library
Die Deutsche Bibliothek - CIP-Einheitsaufnahme
A catalogue record for this book

is available from Der Deutschen Bibliothek
ISBN 3-527-28324-2
0 WILEY-VCH Verlag GmbH, D-69469 Weinheim (Federal Republic of Germany), 2000
Printed on acid-free and chlorine-free paper.
All rights reserved (including those of translation into other languages).No part of this book may be reproduced in any
form - by photoprinting,microfilm, or any other means - nor transmitted or translated into a machine language without
written permission from the publishers. Registered names, trademarks, etc. used in this book, even when not specifi-
cally marked as such, are not to be considered unprotected by law.
Compositionand Printing: Zechner Datenservice und Druck, D-67346 Speyer.
Bookbinding:J. Schaffer,D-67269 Griinstadt.
Printed in the Federal Republic of Germany
Preface
In recognition of the enormous advances in series. Its members come from key institu-
biotechnology in recent years, we are pleased tions representing scientific input from about
to present this Second Edition of “Biotech- twenty countries.
nology” relatively soon after the introduction The volume editors and the authors of the
of the First Edition of this multi-volume com- individual chapters have been chosen for
prehensive treatise. Since this series was ex- their recognized expertise and their contribu-
tremely well accepted by the scientific com- tions to the various fields of biotechnology.
munity, we have maintained the overall goal Their willingness to impart this knowledge to
of creating a number of volumes, each de- their colleagues forms the basis of “Biotech-
voted to a certain topic, which provide scien- nology” and is gratefully acknowledged.
tists in academia, industry, and public institu- Moreover, this work could not have been
tions with a well-balanced and comprehensive brought to fruition without the foresight and
overview of this growing field. We have fully the constant and diligent support of the pub-
revised the Second Edition and expanded it lisher. We are grateful to VCH for publishing
from ten to twelve volumes in order to take “Biotechnology” with their customary excel-
all recent developments into account. lence. Special thanks are due to Dr. Hans-
These twelve volumes are organized into Joachim Kraus and Karin Dembowsky, with-
three sections. The first four volumes consid- out whose constant efforts the series could
er the fundamentals of biotechnology from not be published. Finally, the editors wish to
biological, biochemical, molecular biological, thank the members of the Scientific Advisory
and chemical engineering perspectives. The Board for their encouragement, their helpful
next four volumes are devoted to products of suggestions,and their constructive criticism.
industrial relevance. Special attention is given
here to products derived from genetically en- H.-J. Rehm
gineered microorganisms and mammalian G. Reed
cells. The last four volumes are dedicated to A. Piihler
the description of special topics. P. Stadler
The new “Biotechnology” is a reference
work, a comprehensive description of the
state-of-the-art, and a guide to the original
literature. It is specifically directed to micro-
biologists, biochemists, molecular biologists,
bioengineers, chemical engineers, and food
and pharmaceutical chemists working in indus-
try, at universities or at public institutions.
A carefully selected and distinguished
Scientific Advisory Board stands behind the
Scientific Advisory Board
Prof Dr. M.J. Beker Prof Dr. T K.Ghose

August Kirchenstein Institute of Microbiology Biochemical Engineering Research Centre
Latvian Academy of Sciences Indian Institute of Technology
Riga, Latvia New Delhi, India
Prof Dr. J. D. Bu’Lock Prof Dr. I. Goldberg

Weizmann Microbial Chemistry Laboratory Department of Applied Microbiology
Department of Chemistry The Hebrew University
University of Manchester Jerusalem, Israel
Manchester, UK
Prof Dr. C.L.Cooney Prof Dr. G. Goma

Department of Chemical Engineering DCpartement de Gdnie Biochimique et
Massachusetts Institute of Technology Alimentaire
Cambridge, MA, USA Institut National des Sciences AppliquCes
Toulouse, France
Prof Dr. H. W Doelle Sir D. A. Hopwood

Department of Microbiology Department of Genetics
University of Queensland John Innes Institute
St. Lucia, Australia Norwich, UK
Prof Dr.J. Drews Prof Dr. E.H. Houwink

F. Hoffmann-La Roche AG Organon International bv
Basel, Switzerland Scientific Development Group
Oss. The Netherlands
Prof Dr. A.Fiechter Prof Dr. A.E.Humphrey

Institut fur Biotechnologie Center for Molecular Bioscience and
Eidgenossische Technische Hochschule Biotechnology
Zurich, Switzerland Lehigh University
Bethlehem, PA, USA
VIII Scientific Advisory Board
Prof Dr. I. Karube Prof Dr. K. Schiigerl

Research Center for Advanced Science Institut fiir Technische Chemie
and Technology Universitat Hannover
University of Tokyo Hannover, Germany
Tokyo,Japan
Pro$ Dr. M. A. Lachance Pro$ Dr. €? Sensi

Department of Plant Sciences Chair of Fermentation Chemistry
University of Western Ontario and Industrial Microbiology
London, Ontario, Canada Lepetit Research Center
Gerenzano, Italy
Prof Dr. Y: Liu Prof Dr. Y H. Tan

China National Center for Biotechnology Institute of Molecular and Cell Biology
Development National University of Singapore
Beijing, China Singapore
Prof Dr. J. E Martin Prof Dr. D. Thomas

Department of Microbiology Laboratoire de Technologie Enzymatique
University of Le6n UniversitC de Compiegne
L e h , Spain Compibgne, France
Prof Dr. B. Mattiasson Prof Dr. W Verstraete

Department of Biotechnology Laboratory of Microbial Ecology
Chemical Center Rijksuniversiteit Gent
University of Lund Gent, Belgium
Lund. Sweden
Prof Dr. M. Roehr Pro$ Dr. E. - L. Winnacker

Institut fur Biochemische Technologie Institut fur Biochemie
und Mikrobiologie Universitat Miinchen
Technische Universitat Wien Munchen, Germany
Wien, Austria
Prof Dr. H. Sahm

Institut fur Biotechnologie
Forschungszentrum Julich
Julich, Germany
Contents
Introduction 1 7 Regioselective Oxidation of

D. R. Kelly Aminosorbitol with Gluconobacter
oxydans, A Key Reaction in the Industrial
Synthesis of I-Deoxynojirimycin 295
Carbon-Carbon Bond Formation, M . Schedel
Addition, Elimination and 8 Engineering Microbial Pathways for
Amino Acid Production 313
Substitution Reactions I. Fotheringharn
1 Carbon-Carbon Bond Formation Using 9 Biotechnological Production of Natural
EiiAymes 5 Aroma Chemicals by Fermentation
A. D. M . Curtis Processes 333
J. Rabenhorst
2 Lyases 41
D. R. Kelly, J. Mahdi 10 Synthetic Applications of Enzyme-
Catalyzed Reactions 351
3 Halocompounds 173 J. McGregor-Jones
G. Robinson, S. Jackman, J. Stratford
4 Phosphorylation 221
S. Jones
5 Enzymes in Carbohydrate Chemistry: 243 The Future of Biotransformations
Formation of Glycosidic Linkages
S. Flitsch, G. M. Watt 11 Catalytic Antibodies 403
G. M . Blackburn,A. GarGon
12 Synthetic Enzymes: Artificial Peptides in
Stereoselective Synthesis 491
Applications l? Bentley
6 Industrial Biotransforrnations 277
U ?: Bornscheuer
Index 519
Contributors
Dr. Paul Bentley Dr. Sabine Flitsch

Columbia University Department of Chemistry
Chemistry Department University of Edinburgh
Havemeyer Hall West Mains Road
Mail Box 3135 Edinburgh EH9 355
3000 Broadway (119th Street) Scotland
New York, NY 10027 Chapter 5
USA
Chapter 12
Prof. Dr. G. Michael Blackburn Dr. Ian Fotheringham

Department of Chemistry NSC Technologies
The University of Sheffield 601 East Kensington Road
Sheffield, S3 7HF Mt. Prospect, IL 60056
UK USA
Chapter 11 Chapter 8
Prof. Dr. Uwe T. Bornscheuer Dr. Arnaud Gargon

Institut fur Technische Chemie Department of Chemistry
und Biotechnologie The University of Sheffield
Ernst-Moritz-Amdt-Universitat Sheffield, S3 7HF
Soldtmannstrasse 16 UK
D-17487 Greifswald Chapter 11
Germany
Chapter 6
Dr. Antony D. M. Curtis Dr. Simon A. Jackman

Department of Chemistry Biological Laboratory
Keele University University of Kent
Keele, Staffordshire, ST5 5BG Canterbury, Kent CT2 7NJ
UK UK
Chapter 1 Chapter 3
XI1 Contributors
Dr. Simon Jones Dr. Jiirgen Rabenhorst

Department of Chemistry Haarmann & Reimer GmbH
Bedson Building Postfach 1253
University of Newcastle upon Tyne D-37601 Holzminden
Newcastle upon Tyne, NE17RU Germany
UK Chapter 9
and
Cancer Research Institute
Arizona State University
Box 871604
Tempe, A Z 85287-2404
USA
Chapter 4
Dr. David R. Kelly Dr. Gary K. Robinson

Cardiff University University of Kent
P.O. Box 912 Canterbury, Kent CT2 7NJ
Cardiff CF13TB UK
UK Chapter 3
Chapter 2
Dr. Jane McGregor-Jones Dr. Michael Schedel

6 Cartmel Avenue Bayer AG
Maghull, Merseyside L31 9BJ PH-TO Biotechnologie
UK Biotechnikum Mikrobiologie
and Gebaude 226
Cancer Research Institute Friedrich-Ebert-Strasse 217
Arizona State University D-42096 Wuppertal
Box 871604 Germany
Tempe, AZ 85287-2404 Chapter 7
USA
Chapter 10
Dr. Jassem Mahdi Dr. Jane Stratford

University of Wales University of Kent
PO. Box 912 Canterbury, Kent CT2 7NJ
Cardiff, CF13TB UK
UK Chapter 3
Chapter 2
Dr. Gregory M. Watt
Department of Chemistry
University of Edinburgh
West Mains Road
Edinburgh EH9 355
Scotland
Chapter 5
Biotechnology Second, Completely Revised Edition
copyright OWILEY-VCH Verlag GmbH, 2000
Introduction
DAVIDR.KELLY
Cardiff, UK
The two years since the publication of Vol- tivities may well have a “knock on effect”. For
ume 8a have been a period of consolidation for example enzymes derived from GM organ-
the business community.As large chemical and isms, are used in the beverage industry for de-
pharmaceutical companies have merged into hazing and clarification.Will these be regulat-
ever larger companies with increasingfocus on ed? Hydrolytic enzymes from GM organisms
their primary mission (the “best of breed” con- are used in laundry.Will non-foodstuff uses es-
cept), small companies specializing in bio- cape regulation?
transformations have prospered, by providing On the academic front, enantioselective re-
expertise on demand.The lack of familiarity of actions which were once the sole preserve of
most synthetic chemists with biotransforma- enzymes are now being encroached upon by
tions, has in fact worked to the advantage of abiotic catalysts. %o good examples are the
these small companies. Increasing demands for Baeyer-Villiger reaction and ester forma-
enantiomerically pure materials will provide tiodhydrolysis. Conversely the first enzymes
further fuel for this trend. Many medium sized, and catalytic antibodies capable of catalyzing
fine and speciality chemical manufacturers are pericyclic processes such as the Diels-Alder
adding biotransformations to their repertoire reaction are now emerging.
of skills by acquisitions or internal develop- Volume 8b commences with the cornerstone
ments. Much of the impetus in the speciality of organic synthesis: carbon-carbon bond for-
area, is the demand for so called natural or mation. Although there is no enzymatic equiv-
“nature identical”products. alent of the Grignard or organolithium re-
On the other hand the spectre of genetic agent, aldol and benzoin condensationscan be
modification (GM) has undoubtedly acted as a performed with exquisite stereochemical con-
brake on the development of many new prod- trol. These reactions are constrained by a limit-
ucts and processes. It remains to be seen what ed range of anionic components,but are fairly
the public and legislators will tolerate. At- promiscuous with electrophiles.Lyases (Chap-
tempts to stop the growing of GM crops and ter 2 ) are involved in a galaxy of reactions,
banish foodstuffs from GM organisms from which includes just about every prosthetic
the human food chain, lie outside the ambit of groupkofactor known or unknown. In connec-
biotransformations.But regulation of these action with the latter, it has been discovered in
2 Introduction
the last year, that histidine ammonia-lyase banishes some myths about their limitations.
which was long thought to contain a catalytic- The carbohydrate theme of chapter 5 is contin-
ally active dehydroalanine residue, actually ued in chapter 7, which describes the develop-
contains an unprecedented 4-methylene-imid- ment of the microbial oxidation of amino-
azol-5-one residue. This result throws doubt on sorbitol, in the synthesis of l-deoxynojirimy-
the presence of the dehydroalanine residue in cin, a key precursor of the anti-diabetes drug
other enzymes,thought to contain it. Chapter 2 MiglitoP. This is an important example of a
covers carboxy-lyases (many of which are in- synthetic route, which is fast and efficient, be-
volved in carbon-carbon bond formation), hy- cause the biotransformation step removes the
dro-lyases (including the intricate biosynthesis need to employ protecting groups to enforce
of deoxysugars) and the ammonia-lyases many regioselectivity.
of which are involved in the biosynthesis of The majority of amino acids are manufac-
amino acids. Halocompounds (Chapter 3) tured by fermentation, although there are also
have a reputation as un-natural compounds examples of amino acids produced employing
which are persistent and damaging to the envi- isolated enzymes (e.g., L-fert.leucine). Devel-
ronment or at best as exotic marine natural opments in molecular biology and genome
products. This reputation is unfounded. The manipulation have enabled biosynthetic path-
majority of halocompounds in the environ- ways to be optimized to previously unimagin-
ment originate from eological and natural able levels (Chapter 8).This area has been fur-
sources.The fascinating topic of the biosynthe- ther promoted by the continuing demand for
sis of the ten known natural organofluorocom- the dipeptide artificial sweetener, Aspartame.
pounds provides an insight into an element Many of the important natural flavorings or
largely spumed by nature. The cleavage and fragrances are extracted in small amounts
formation of phosphate bonds (Chapter 4) is from exotic plants and the supply is affected by
neglected in most biotransformations reviews. seasonal variations due to the weather, crop
Yet for most phosphorylated and pyrophos- pests, and even political factors. Although
phorylated cofactors the majority of the bind- many flavorings and fragrances can be synthe-
ing energy to the enzyme originates from this sized via chemical routes, the resulting prod-
linkage. Whereas, the traditional organic ucts cannot be marketed using the term “natu-
chemist utilizes halosubstituents as nucleofug- ral”, since EU and US legislation has defined
es, nature utilizes phosphates and their deriva- the term “natural”: The product must be pro-
tives, because they can be selectively activated duced from natural starting materials applying
by carefully placed protonation sites. physical, enzymatic, or microbial processes for
Short polypeptide, RNA, and DNA se- their final production. These are ideal circum-
quences ( < 18residues) are now routinely syn- stances for the development of biotransforma-
thesized using automated machinery. In con- tion routes, described in Chapter 9. For exam-
trast, the synthesis of even a trisaccharide re- ple, potential precursors of vanillin are found
quires a dedicated team of specialists and al- in numerous plants and even waste products.
though spectacular advances have been made, Biotransformations can convert these materi-
a general approach to the controlled synthesis als with low or even negative value (i.e., dispo-
of polysaccharides is still lacking. Simultane- sal costs) into valuable products.
ous control of stereo- and regioselectivity have Biotransformations have yielded a wealth of
confounded conventional chemical approach- new routes to novel and known compounds.
es. Enzymatic glycosidation (Chapter 5) pro- These have provided marvellous opportunities
vides a powerful approach to escape this im- for synthetic organic chemists. Chapter 10
passe. gives brief descriptions of an enormous range
The “Applications” superchapter covers se- of biotransformations and describes applica-
lected industrial scale processes (commis- tions of the products in the synthesis of natural
sioned by Dr. JORG PETERS) and the use of bi- products.
otransformation products as intermediates for The final superchapter in Volume 8b pro-
organic synthesis. Chapter 6 reviews general vides a glimpse into two areas which are likely
aspects of industrial biotransformations and to play a major role in future developments in
Introduction 3
biotransformations. Catalytic antibodies are ripe for development. A Third Edition of

(Chapter 11) are literally artificial enzymes. this volume is likely to contain a wider range
They can be engineered to catalyze reactions of reactions (possibly including pericyclic and
which have no counterparts in the natural photochemical processes), more engineered
world. Sophisticated strategies for raising anti- pathways and more site directed mutagenesis.
bodies and screening techniques for identify- Gene transfer and heterologous expression is
ing active catalysts, have already yielded cata- now common place. Are there better recipient
lysts of exquisite selectivity. Intrinsic activity organisms than the ubiquitous E. coli? En-
and turnover continue to be limited, but in the zymes from thermophiles were touted as the
best cases they are only a few orders of magni- universal panacea for industrial processes at
tude lower than conventional enzymes. elevated temperatures, but their early promise
The final chapter deals with wholly synthet- has not been fulfilled.Why? Enzyme catalyzed
ic enzymes.These may be constructed from the reactions in organic solvents are highly desir-
familiar amino acid building blocks of conven- able for hydrophobic substrates, but are cur-
tional enzymes and may even borrow design rently thwarted by low activity. Is it possible to
features, but the structures are, nevertheless, design and synthesize an enzyme which is sol-
totally alien. For example, poly-leucine cata- uble in organic solvents (e.g., a lipase mutant)?
lyzes the enantioselective epoxidation of These proposals represent reasonable exten-
enones by hydrogen peroxide and cyclic di- sions of current technology. However, it is cer-
peptides catalyze the enantioselective addition tain that the most spectacular advances will be
of cyanide to aldehydes. This area will surely made in areas, that cannot be predicted at
benefit from the ever continuing improve- present.
ments in computer processing power and new I am pleased to acknowledge Dr. JORGPE-
software for molecular modeling. TERS’helpful comments on this Introduction.
All predictions of the future have one thing
in common. They are wrong! But this does not
absolve us from trying to discern avenues that Cardiff, March 2000 D. R. Kelly
Carbon-Carbon Bond Formation,
Addition, Elimination and
Substitution Reactions
1 Carbon-Carbon Bond Formation

Using Enzymes
ANTHONY
D. M. CURTIS
Keele, UK
1 Introduction 6
2 Aldolases 6
2.1 DHAP Dependent Aldolases 7
2.2 Pyruvate, Phosphoenolpyruvate (PEP) Dependent Aldolases 15
2.3 2-Deoxyribose-5-PhosphateAldolase (DERA) 17
2.4 Glycine Dependent Aldolases 19
3 Transaldolase and Transketolase 20
4 Pyruvate Decarboxylase 23
5 Enzymes from Terpenoid and Steroid Biosynthesis 28
6 Other Enzyme Catalyzed C-C Bond Forming Reactions 30
7 Conclusion 32
8 References 33
6 1 Carbon-Carbon Bond Formation Using Enzymes
1 Introduction torical perspective of developments within this

field.
Many C-C bond forming reactions fall with-
If the formation of carbon to carbon (C-C) in Enzyme Commission subclass 4.1, car-
bonds is undeniably fundamental to organic bon-carbon lyases. Lyases are enzymes which
chemistry then the ability to induce asymme- cleave or form bonds other than by hydrolysis
try in the constructive process must be the un- or oxidation. Systematic names for lyases are
deniable goal of the modern organic chemist. constructed from the template “substrate
Research into chemical methods for enantio- group-lyase”. Groups are defined at the sub-
selective synthesis has yielded many elegant subclass level, e.g., decarboxylases (4.1.1),
methods for asymmetric C-C bond formation aldehydes (4.1.2), and oxoacids (4.1.3). Thus,
but the concepts of efficiency and atom econo- threonine aldolase (EC 4.1.2.5), which catalyz-
my seem to have been ignored in many cases. es the aldol condensation of glycine with acet-
Enantioselective methods are, of course, of aldehyde, is systematically named “threonine
paramount importance to the industrial acetaldehyde-lyase”. Reactions which have
chemist, not least due to ever-tightening reg- only been demonstrated in the carbon<arbon
ulations governing single enantiomer pharma- bond forming direction or for which this direc-
ceuticals. tion is more important are termed synthases.
Historically, reviews concerning the utility However, such designations have not found
of enzymes in organic synthesis paid only cur- favor and trivial names are common. Other
sory respect to the potential of enzymes to cat- carbon-carbon bond forming reactions which
alyze the formation of C-C bonds. However, appear in the following discussion may be
trends in chemistry are not uncommon and found in classes 2 (transferases), 5 (isomeras-
there is certainly a trend for such reviews to es), and 6 (ligases).
devote an increasing amount of space to the The laboratory use of enzymes for C-C
subject. Indeed, as contemporary microbiolog- bond formation has developed in quite distinct
ical methods enable the study of enzymes from areas, often determined by the class of enzyme
different species this exciting field of research used. In recent years, a large amount of infor-
has witnessed an exponential period of devel- mation concerning the effective use of aldolas-
opment, as reflected by the increasing number es in asymmetric synthesis has appeared, per-
of articles devoted to the synthesis of C-C haps surpassing all of the other enzyme
bonds (RACKER, 1961a; OGURAand KOYAMA, systems capable of forming C-C bonds. In an
1981;FINDEIS and WHITESIDES, 1984;BUTTand attempt to provide a balanced chapter, this re-
ROBERTS,1986; JONES,1986; DAVIESet al., view will present developments in the use of
1989; TURNER,1989,1994; SERVI, 1990; CSUK many enzymes, particularly on their use in the
and GLANZER,1991; DRUECKHAMMER et al., synthesis of both naturally occurring and un-
1991; WONGet al., 1991,1995a; SANTANIELLOnatural bioactive products. Reference will be
et al., 1992;LOOKet al., 1993;FANG and WONG, made to specialist reports in each area where
1994; WONGand WHITESIDES, 1994; WALD- they are available.
MA”, 1995; WARD, 1995; GIJSENet al., 1996;
HOFFMANN, 1996;FESSNER and WALTER,1997;
TAKAYAMA et al., 1997a, b). The aim of this
chapter is to present an overview of this rapid-
ly growing field of research using appropriate 2 Aldolases
examples from the literature which exemplify
the versatility of the particular enzymes dis- There are numerous chemical methods for
cussed. As the majority of discoveries in this achieving enantioselective aldol additions cit-
field have taken place within the past two ed in the literature, some simple and some
decades, this survey will focus predominantly quite sophisticated. Catalytic processes are, of
on work which has appeared in the primary lit- course, preferable over all others, provided the
erature during that period. Readers are direct- catalyst is cheap and readily available. Howev-
ed to the review articles cited above for a his- er, stereoselective aldol reactions are a normal
2 Aldolases 7
metabolic process for the vast majority of or- 2.1 DHAP Dependent Aldolases
ganisms and, given the skills of the microbiolo-
gist, naturally occurring catalysts have now be- The aldol addition of a ketone donor and an
come widely available for use in the laborato- aldehyde acceptor can potentially yield four
ry. Several excellent accounts of the use of al- stereoisomeric products which would require
dolases (the general name applied to this costly chromatographic separations. Fortu-
group of lyases and synthases) in organic syn- nately for the synthetic chemist, aldolases exist
thesis detail the progress made in this area, which can deliver all of the four possible ster-
notably the prolific contributions by the eoisomers. This is illustrated by the asymmet-
groups of WHITESIDES and WONG(WONGand ric aldol addition of dihydroxyacetone phos-
WHITESIDES, 1994; GIJSENet al., 1996;FESSNER phate (DHAP) to D-glyceraldehyde 3-phos-
and WALTER, 1997;TAKAYAMA et al., 1997a,b). phate or L-lactaldehyde (Fig. 1). In vivo, D-
At the time of writing, over 30 aldolases fructose-1,6-diphosphate(FDP) aldolase (EC
have been identified and isolated, most of 4.1.2.13), L-rhamnulose-1-phosphate (Rha 1-
which catalyze the reversible stereospecific ad- P) aldolase (EC 4.1.2.19), L-fuculose-l-phos-
dition of a ketone to an aldehyde. These en- phate (Fuc 1-P) aldolase (EC 4.1.2.17), and
zymes are further classified according to the tagatose 1,6-diphosphate (TDP) aldolase (EC
mechanism by which they operate. Type I aldol- 4.1.2.-) form products which differ in the rela-
ases, typically associated with animals and tive conformation of the hydroxy substituents
higher plants, form an imine intermediate with on C-3 and C-4; FDP aldolase gives the
the donor ketone in the enzyme active site. (3S,4R) stereochemistry of L-fructose, Rha 1-P
Type I1 aldolases, on the other hand, require a aldolase gives (3R,4S) as in L-rhamnulose, Fuc
Zn2+ cofactor to act as a Lewis acid in the 1-P aldolase gives (3R,4R) as in L-fuculose,and
enzyme active site; such aldolases predomin- TDP aldolase gives the (3S74S)configuration
ate in bacteria and fungi. Type I1 aldolases of L-tagatose.
tend to be more stable than their type I coun- Each of the above aldolases has been isolat-
terparts. ed from a variety of mammalian and microbial
Aldolases are also characterized by their sources. FDP type I aldolase from rabbit mus-
specificity for particular donor substrates and cle (rabbit muscle aldolase, RAMA) has found
the products they deliver: extensive use in organic synthesis and is com-
mercially available, as are FDP type I1 aldo-
(1) Dihydroxyacetone phosphate lase, Rha 1-P type I1 aldolase, and Fuc 1-P type
(DHAP) dependent lyases yield I1 aldolase. All four complementary aldolases
ketose 1-phosphates upon reaction have been cloned and overexpressed (GAR-
with an aldehyde acceptor. CIA-JUNCEDA et al., 1995).
(2) Pyruvate dependant lyases and The four DHAP-dependent aldolases have
phosphoenolpyruvate (PEP) depen- each been the subject of synthetic investiga-
dent synthases yield 3-deoxy-2-keto- tions. Each aldolase will accommodate a wide
acids. range of aldehydic substrates; the substrate
(3) 2-Deoxyribose 5-phosphate aldolase specificity of each these enzymes has been
(DERA) is an acetaldehyde depen- elaborated in detail elsewhere (WONG and
dent lyase which yields 2-deoxyalde- WHITESIDES, 1994). Aliphatic aldehydes, in-
hydes. cluding those with a-substituents, and mono-
(4) Glycine dependent aldolases yield saccharides are generally suitable acceptor
substituted a-amino acids. substrates, while aromatic, sterically hindered,
and a$-unsaturated aldehydes are not gener-
Several aldolases are commercially avail- ally substrates. A recent review notes that over
able and have been widely used. Other aldo- 100 aldehydes have been used as substrates for
lases have not yet been subjected to such rigor- DHAP dependent aldolases in the synthesis of
ous synthetic investigations, though their in monosaccharides and the sequential use of an
vivo reactions may give some indication as to aldolase and an isomerase facilitates the syn-
their utility. thesis of hexoses from the ketose aldol prod-
FDP aldolase TDP aldolase
D-Giyceraldehyde
3-phosphate
OP
D-Fructose 1,6-diphosphate D-Tagatose 1,gdiphosphate

0
Fuc 1-P aldolase $ Rha 1-Paldolase
L-Lac taldehyde
L-Fuculose 1-phosphate L-Rhamnulose 1-phosphate
Dihydroxyacetone 1-phosphate (DHAP)
Fig. 1. Four stereo-complementaryDHAP dependent aldolases.
ucts (WONGand WHITESIDES, 1994;TAKAYAMAmuch less active than the natural ketone sub-
et al., 1997b). In contrast, few analogs of strate (BISCHOFBERGER et al., 1988; BEDNAR-
DHAP, for example, (1) and (2) (Fig. 2), are SKI et al., 1989).Recently, however, the l-thio-
substrates for FDP aldolase, all being very analog of DHAP (3) was found to be a sub-
strate and has found use in carbohydrate syn-
thesis (FESSNER and SINERIUS, 1994; DUNCAN
and DRUECKHAMMER, 1995).
The aldolases discussed thus far require
DHAP as the ketone donor but the prohibi-
tive commercial cost of DHAP may make the
synthetic use of such DHAP dependent al-
dolases rather unattractive. However, many
H 4 O P 2
chemical and enzymatic methods have been
reported for preparing DHAP in quantities
sufficient for synthetic use (WONG and WHITE-
SIDES, 1994;FESSNER and WALTER, 1997).A re-
cent chemical method is able to give multi-
H& SP 3 gram quantities of DHAP from dimer (4) in
61% overall yield (Fig. 3) (JUNG et al., 1994)
Fig. 2. Dihydroxyacetone phosphate (3) (DHAP) and an enzymatic process using glycerol phos-
analogs. phate oxidase gives almost quantitative yields
2 Aldolases 9
facilitates the synthesis of carbohydrates as

single enantiomers (vide supra). Both enan-
tiomers of D- and L-fructose were obtained
from the dihydroxylation of an a,@-unsaturat-
ed aldehyde (not itself a substrate for aldol-
ases), followed by reaction with DHAP catal-
1 (PhO)2FCC1,py, 96% yield yzed by the appropriate aldolase (HENDERSON
2 H l , PtO2, 2411 et al., 1994a).
3 HzO, 65"C, Sh A new route to deoxysugars has become
66%yield for two steps available through the use of the 1-thio-analog
DHAP
&OP
HO >97%
Fig. 3. Synthesis of dihydroxyacetone phosphate
(DHAP).
of highly pure DHAP (FESSNER and SINERIUS,

1994). OH OH
Of all the aldolases discussed thus far, FDP
type I aldolase (rabbit muscle aldolase, S
RAMA) has proved to be a most useful cata- 6HR
lyst. However, the stereochemical outcome of
reactions catalyzed by RAMA strongly de-
pends upon the reaction conditions employed.
For example, under kinetically controlled
conditions D-glyceraldehyde 3-phosphate was
preferred by the enzyme over L-glyceralde-
hyde 3-phosphate with a selectivity of 20: 1
(BEDNARSKI et al., 1989). A model for this se-
lectivity has been proposed (LEESand WHITE-
SIDES,1993). Dynamic resolution is possible in
thermodynamically controlled reactions when
the product is able to form a six-membered
cyclic hemiketal. Compounds with the least
number of diaxial interactions predominate
(Fig. 4) (DURRWACHTER and WONG, 1988;
BEDNARSKI et al., 1989). i R
-
- R
FDP aldolase, more particularly RAMA, OH
may be immobilized, used in a dialysis bag, or 4
as the free enzyme in solution. Many examples
of its use have appeared, notably in the synthe-
sis of carbohydrates and analogs thereof
It
(WONGand WHITESIDES, 1994; GIJSENet al.,
1996).The aldehyde substrate may be used as a
racemic mixture, although the use of single OP <3%
enantiomers avoids the painful separation of HO
diastereomeric product mixtures. Sharpless
asymmetric dihydroxylation when used in tan- Fig. 4. Resolution of racemic aldehydes using FDP
dem with an aldolase catalyzed condensation aldolase.
10 I Carbon-Carbon Bond Formation Using Enzymes
0 FDP aldolase Steps
I C O H R * V O H
Glycol- H8c OH
6 1-Deoxy-D -xylulose
FDP aldolase ~
Steps *;H
___t
= . R
7 PS 6H 8 OMe
9 a-Methyl Dolivopyranoside
Fig. 5. Applications of the thio-analog of dihydroxyacetone phosphate (3) in synthesis.
of DHAP (3) (Fig. 5 ) (DUNCAN and DRUECK- optically pure form, was used as the substrate
HAMMER, 1996). FDP aldolase catalyzed the in a RAMA catalyzed synthesis of deoxynoji-
condensation of (3) with glycolaldehyde to rimycin (17) from L-3-azido-2-hydroxypropa-
give 1-deoxy-1-thio-D-xylulose1-phosphate nal and deoxymannojirimycin (18) from D-3-
(S), further elaboration of which yielded l-de-
oxy-D-xylulose (6). Acetal (7) also reacted
with (3) in the presence of FDP aldolase to de-
liver the diol (8), an intermediate in the syn-
thesis of D-olivose methyl glycoside (9).
RAMA catalyzed the addition of DHAP to
the semialdehyde (10) to give the diol (ll), 10 DHAP
1
which is an intermediate in the synthesis of 3-
deoxy-D-arabino-heptulosonic acid (12) (Fig.
6) (TURNER and WHITESIDES, 1989). RAMA 37% yield
Analogs of so-called “higher sugars” sialic
acid and 3-deoxy-~-manno-2-octu~osonic acid
(D-KDO), e.g., compounds (13) and (14), can
be prepared by employing RAMA to catalyze AcyJ+op OH 0
I
Ma2C
the reaction of DHAP and hexoses or pentos-
es, respectively (BEDNARSKI et al., 1986).High- OH 11
er sugars have been synthesized from simpler
starting materials but with unexpected results 1 NaHB(0Ac)j
(KIMand LIM,1996). RAMA catalyzed reac- 2 6 N HCl
tion of the aldehyde (W) with DHAP followed 3 Transamination
by treatment with phosphatase, surprisingly
gave a 62% yield of ketose (16) (Fig. 7). This
has (3S,4S)-configurations at the newly
formed chiral centers whereas RAMA cataly-
,,- H,*P HO
sis normally delivers products with (3S,4R)- OH

configurations, although other workers have
noted this change in stereoselectivity (GIJSEN 1 2 3-Deoxy-D-arabino
and WONG,1995b;GIJSENet al., 1996). heptulosonic acid
RAMA accepts aldehyde substrates bearing
a variety of polar functionalities. 3-Azido-2- Fig. 6. The synthesis of ketoses from amino acid
hydroxypropanal, either as the racemate or in synthons.
2 Aldolases 11
Po
QHOlll.
OP 13
HO 17 Deoxynojirimycin
OH 18 Deoxymannojirimycin
HO* '
I 1 RAMA, DHAP
OH 16
v OH
6H 21
Fig. 7. RAMA catalyzed synthesis of carbohy- Fig. 8. Retrosynthetic analysis of the use of azido
drates. aldehydes in the RAMA catalyzed synthesis of aza-
sugars.
azido-2-hydroxypropanal (Fig. 8); the same formation of 6-deoxy azasugars (KAJIMOTO et

strategy was adopted by both EFFENBERGER al., 1991b).
and WONG(BDERSON et al., 1988,1990;ZIEG-
LER et a]., 1988; VON DER @TEN et al., 1989)
and has recently found use in the preparation
of iminocyclitols (MoR~s-VARAS et al., 1996).
Analogously, 3-azido-2-hydroxybutanal was
-
NHAC sS NHAC
NHAc
used as starting material for the synthesis of
several iminoheptitols (19-21) (STRAUB et al., (3-24 1 RAMA,DHAP 22
1990). 2 Pase
The synthesis of aza-analogs of 1-deoxy-N- 3 H,, Pd/C
&-., -
acetylglucosamine (22) and I-deoxy-N-acetyl-
mannosamine (23) employed optically pure 3-
azido-2-acetamidopropanal, (S)- or (R)-(U),
Hg&J NHAc
respectively, as the aldehyde substrate in a NHAc R

RAMA catalyzed reaction with DHAP (Fig. (R)-24 23
9) (PEDERSON et al., 1990; KAJIMOTOet al.,
1991a). Reduction of aldol Droducts orior to Fig. 9. Azido aldehydes in the RAMA catalyzed
removal of the phosphate gioup lea& to the synthesis of azasugars.
1,4-Dideoxy-l,4-imino-~-arabitino1 (25), a Aldolase catalyzed reaction of thioalde-

potent a-glucosidase inhibitor found in Arach- hydes with DHAP enables the preparation of
niodes sfandishii and Angylocalyx boutiquea- a range of thiosugars. 2-Thioglycolaldehyde
nus, and other polyhydroxylated pyrrolidines, (28) yielded enantiomerk 5-thio-~-fhreo-pen-
such as heterocycles (%a) and (26b) can be tulofuranoses (29)and (30)when reacted with
prepared using the RAMA catalyzed conden- DHAP in the presence of FDP aldolase or
sation of DHAP and 2-azidoaldehydes (Fig. Rha 1-P aldolase, respectively (Fig. l l ) , while
10) (HUNGet al., 1991; LIU et al., 1991; KAJI- RAMA catalyzed reaction of aldehyde (31)
MOTO et al., 1991a;TAKAOKA et al., 1993).Ho- yielded thioketose (32),elaboration of which
moaza sugars, e.g., (27), may be prepared from gave l-deoxy-5-thio-~-glucopyranose perace-
3-azido-2,4-dihydroxyaldehydesby the same tate (33) (Fig. 12). Further thiopyranose com-
methodology (HENDERSON et al., 1994b;HOLT pounds are obviously accessible by using FDP
et al., 1994). aldolase, Fuc 1-P aldolase, or Rha 1-P aldolase
H OH
H OH
26a 26b 27
Fig. 10. Azasugars.
OH 1 FDPaldolase 1 Rha 1-Paldolase Ho

DHAP DHAP
29 2 8 2-Thioglycolaldehyde 30
Fig. 11. Aldolase catalyzed synthesis of thiofuranoketoses.
31 32
J Steps
33
Fig. 12. RAMA catalyzed synthesis of a 1-deoxythiopyranose. OAc
2 Aldolases 13
and enantiomers of (31) as required (EFFEN-

BERGER et al., 1992a;CHOU et al., 1994).
1
Cyclitols are interesting targets for enzyme A O H 2
catalyzed synthesis. The RAMA catalyzed 0
condensation of DHAP and chloroacetalde-
hyde forms the basis of a general synthesis of a DHAP RAMA, 20h, rt
[~ ]
range of cyclitols and C-glycosides, for exam-
ple, (34) and (35) (Fig. 13) (SCHMIDand
WHITESIDES, 1990; NICOTRAet al., 1993). Ni-
droxy-3-nitropropanal
trocyclitol(36) and DHAP
was prepared by coupling
catalyzed
2-hy-
-
I
by RAMA, followed by cyclization by an intra- i(OEt)2
molecular Henry reaction in 51% overall yield i3H 0
(CHOUet al., 1995). Similarly cyclopentene
DHAP I 1 RAMA
2 Paw
37
aR=Pzl
bR =H
NC'
Sweet potato acid

phosphatase. pH 4.8
Fig. 14. RAMA catalyzed aldol condensation with

in situ olefination.
(37a) was prepared using a one-pot strategy

that required a RAMA catalyzed condensa-
/aOH
_ -- tion as the first step, followed by cyclization by
*q+
Horner-Wadsworth-Emmons olefination at
pH 6.1-6.8 (Fig. 14) (GIJSEN and WONG,
1995a).
HOlW
OH Unlikely as it may appear, the use of aldolas-
- HO es is not entirely restricted to carbohydrate
HO synthesis. RAMA was used to install the
34 35 chirality required for the synthesis of ( + ) - e m -
_________________----------------- brevicomin (38)(Fig. 15), seemingly a favored
target for constructive biotransformations,
from 5-oxohexenal (SCHULTZ et al., 1990).The
02N*
C-9-C-16 fragment (39) of pentamycin has
been prepared from L-malic acid using RAMA
36 to catalyze the final elaboration; an alternative
%OAc route starts from D-glucose, also employing
RAMA (MATSUMOTO et al., 1993; SHIMAGAKI
Fig. 13. The synthesis of carbocycles and C-glyco- et al., 1993).The C-3-C-9 fragment of aspicilin
sides. was similarly prepared in a stereoselective
1995). For example, ozonolysis of cyclohexene

(41) and subsequent enzymatic elaboration
gave compound (42) (Fig. 16).The same “tan-
dem aldolization” methodology was used to
convert cyclohexene (43) into disaccharide
38 (+)-exeBrevicornin (44)(Fig. 17) (FESSNERand WALTER,1997).
The strategy noted above has come under re-
cent scrutiny: in the FDP aldolase catalyzed
desymmetrization of a series of dialdehydes in
which the two carbonyl groups are remote
from each other, only one aldehyde group re-
acted with the enzyme and the stereochemis-
try of the product did not appear to have been
influenced by any chirality present in the start-
ing materials (KIMet al., 1997).
Rha 1-P aldolase, Fuc 1-P aldolase, and TDP
aldolase have been used less widely than FDP
aldolase, though this may well change now that
39 40 each enzyme has been overexpressed (GAR-
Fig. 15. Synthetic targets prepared using RAMA C~A-JUNCEDA et al., 1995). Rha 1-P aldolase
catalyzed aldol condensation. and Fuc 1-P aldolase both accept a variety of
aldehydic substrates. The products from both
enzymes have the R-configuration at C-3 but
the stereochemistry at C-4 can be less well de-
manner using RAMA (CHENEVERT et al., fined (FESSNER et al., 1991).Both enzymes will
1997) and the synthesis of homo-C-nucleoside effect dynamic resolution of racemic 2-hydrox-
(40) also has a RAMA catalyzed condensation yaldehydes (FESSNER et al., 1992).
as a key step (LIUand WONG,1992). Rha 1-P aldolase and Fuc 1-P aldolase have
FDP aldolase has been used to effect a bi- been used in the synthesis of a number of aza-
directional synthesis strategy in which a series sugars following analogous strategies to those
of disaccharide mimics have been prepared
from a,w-dialdehydes (EYRISCH and FESSNER,
Hv 41
UH .
OH
Fig. 16. FDP aldolase catalyzed aldol condensation Fig. 17. FDP aldolase catalyzed aldol condensation
of a dialdehyde. of an azido dialdehyde, as a route to aminosugars.
2 Aldolases 15
outlined above for FDP aldolase (LIU et al., relatively stable and can be used in solution, in
1991;KAJIMOTO et al., 1991b;LEESand WHITE- dialysis tubing, or immobilized. It is specific for
SIDES, 1992).It should be noted that all of these pyruvate and an excess of pyruvate is used to
aldolases may be used in combination with favor the formation of aldol products (UCHIDA
other enzymes to extend their synthetic utility. et al., 1984,1985;BEDNARSKI et al., 1987;AWE
Aldolase catalyzed condensation and subse- et al., 1984,1985;AUGBand GAUTHERON, 1987;
quent reaction with a corresponding isomer- KIMet al., 1988). The enzymes from Clostridia
ase gives access to aldoses from ketose inter- and Escherichia coli are commercially avail-
mediates (FESSNERand EYRISCH, 1992). able.
Recent investigations show that TDP aldo- A high conversion (>go%) of ManNAc
lase also shows a low specificity for the alde- (45) to NeuAc (46)is possible using the isolat-
hyde substrate but in all cases examined a dia- ed enzyme though the work-up can be tricky
stereomeric mixture of products resulted. Of (Fig. 18) (KRAGLet al., 1991; LIN et al., 1992;
interest here is the anomalous stereochemical FITZet al., 1995). A wide variety of aldehydes
outcome of the reactions; the major product in are tolerated by the enzyme; a recent review
each case had the (3S,4R) stereochemistry of states that over 60 aldoses are substrates pro-
o-fructose and not the expected (3S,4S) ste- viding certain structural motifs are displayed,
reochemistry of D-tagatose (compare this with though substrates containing less than four
analogous observations made with FDP aldo- carbons are not tolerated (WONGand WHI-
lase as noted above). Only D-glyceraldehyde, TESIDES, 1994; FITZet al., 1995; GIJSENet al.,
the natural substrate, delivered the expected 1996). The stereochemical outcome of reac-
configuration (FESSNERand EYRISCH,1992; tions catalyzed by NeuAc aldolase strongly de-
EYRISCH et al., 1993). This lack of stereospeci- pends upon substrate structure and seems to
ficity has severely hindered the use of TDP al- be under thermodynamic control. Most sub-
dolase in organic synthesis. strates, like the natural substrate D-ManNAc
(45), yield products with the S-configuration at
the new chiral center, arising from attack at the
2.2 Pyruvate, Phosphoenolpyruvate si-face of the aldehyde substrate. Some sub-
strates, however, such as L-mannose, L-xylose,
(PEP) Dependent Aldolases and D-altrose, give the thermodynamically
more stable products with the R-conforma-
These particular enzymes, while performing
opposite biological functions and requiring
different substrates, can be examined together
as they can both be used to synthesize keto-
acids. However, only two aldolases from this
group will be discussed at length, the potential
of the other members not yet having been
realized.
N-Acetylneuraminic lyase (NeuAc aldolase,
pyruvate dependent, EC 4.1.3.3), also known
as sialic acid aldolase, and the corresponding
synthase (PEP dependent, EC 4.1.3.19) would
both appear to deliver the same aldol products
but the latter enzyme has not yet been fully
characterized (GIJSENet al., 1996).A type I al-
dolase, NeuAc aldolase catalyzes in vivo the
reversible aldol condensation of N-acetyl-a-D-
mannosamine (ManNAc, (45)) and pyruvate Ho OH 46 NeuAc
to yield the a-anomer of N-acetyl-5-amino-
3,5-dideoxy-~-g~ycero-D-ga~acto-2-nonu~oson- Fig. 18. NeuAc aldolase catalyzed aldol condensa-
ic acid (NeuAc, (46))(Fig. 18). The enzyme is tion of N-acetylmannosamine with pyruvate.
tion, resulting from attack at the re-face of the nose and L-KDN (50) (from L-mannose) were
substrate (LINet al., 1992;FITZet al., 1995). all synthesized using NeuAc aldolase (Fig. 19)
Many biologically relevant target com- (AuGE et al., 1990; LINet al., 1997).
pounds have been realized from NeuAc aldol- 6-O-(N-Carbobenzyloxyglycinoyl)-N-acetyl
ase catalyzed reactions, including a wide va- mannosamine (51)underwent a NeuAc aldol-
riety of NeuAc derivatives. For example, L- ase catalyzed transformation to yield the aldol
NeuAc (47) (from L-ManNAc), D-KDO (48) product (52), from which the fluorescent sialic
;&
(from D-arabinose), L-KDO (49) from L-arabi- acid (53) was prepared (Fig. 20) (FITZ and
WONG,1994).Polyacrylamides with a-sialoside
and poly-C-sialosides appendages have been
&co2H
H synthesized, which inhibit agglutination by the
influenza virus (SPALTENSTEIN and WHITE-
SIDES,1991; NAGYand BEDNARSKI, 1991; SPE-
VAK et al., 1993). Pyrrolidine (SS), derived
AcN C02H from the NeuAc catalyzed reaction of protect-
ed D-mannosamine (54) followed by catalytic
OH OH hydrogenation, was converted to 3-(hydroxy-
47 L-NeuAc 48 DKDO methyl)-6-epicastanospermine (56) (Fig. 21)
(ZHOUet al., 1993).
Again, despite performing distinctly differ-
+CO2H H&
ent functions in vivo, 3-deoxy-~-manno-2-
octulosonate lyase (2-keto-3-deoxyoctanoate
aldolase, KDO aldolase, EC 4.1.2.23) and 3-de-
oxy-~-manno-2-octulosonate8-phosphate syn-
HO CO2H thase (phospho-2-keto-3-deoxyoctanoate syn-
HOoH thase, KDO 8-P aldolase) may be used to cata-
OH
49 L-KDO 50 L-KDN lyze the formation of the D-KDO skeleton; D-
KDO 8-P has been prepared on a preparative
Fig. 19. Higher sugars prepared using NeuAc aldo- scale using KDO 8-P aldolase (BEDNARSKI et
lase catalyzed aldol condensation. al., 1988). KDO aldolase isolated from E. coli
BocN
51 oH
NeuAc aldolase
AC02H
0
- AcNH &
HOlll.
Ho 52
CO2H
_.i 1 HCI
&
lJ 2 Dansyl chloride,
<
Me2N,@ Na2C03
0
/
HOlItl* C02H
AcN H
53 HO
Fig. 20. NeuAc aldolase catalyzed aldol condensation in the synthesis of a fluorescent sugar.
2 Aldolases 17
as the ketone donor (Rosso and ADAMS,1967;

NISHIHARA and DEKKER,1972; SCHOLTZ and
SCHUSTER, 1984;FLOYDet al., 1992).
OH 2-Keto-3-deoxy-6-phosphogluconate(KD-
PG) aldolase from Pseudomonas fluorescens
will not accept simple aliphatic aldehydes as
substrates: rather, the only requirement ap-
pears to be that there must be a polar substitu-
OH ent at C-2 or C-3. KDPG aldolase generates a
new chiral center at C-4 with the S-configura-
tion (ALLENet al., 1992).
55 A number of other aldolases which are de-
pendent on pyruvate or PEP have been isolat-
Hs
ed but their substrate specificities have not
OH been investigated in any depth (GIJSENet al.,
1
1996).
Steps
2.3 2-Deoxyribose-5-Phosphate
56 Aldolase (DERA)
2-Deoxyribose 5-phosphate aldolase (DE-
HO
-%
OH
RA, EC 4.1.2.4) is unique in that the donor
species is an aldehyde. A type I aldolase, DE-
RA catalyzes in vivo the reversible addition of
Fig. 21. NeuAc aldolase catalyzed aldol condensa- acetaldehyde and D-glyceraldehyde 3-phos-
tion of N-carbobenzyloxymannosamine (54) with phate to give 2-deoxyribose 5-phosphate. The
pyruvate in the synthesis of 3-(hydroxymethyl)d- enzyme has been obtained from several differ-
epicastanospermine (56). ent organisms but DERA from E. coli is avail-
able in large quantities as a consequence of
cloning and overexpression (BARBASet al.,
1990; CHENet al., 1992; WONGet al., 1995b).
will accept a number of different aldose sub- DERA will also accept propanal, acetone, and
strates though the rate of reaction is much fluoroacetone as donor moieties though their
slower than that for the natural substrate rates of reaction are considerably slower than
D-arabinose (GHALAMBOR and HEATH,1966). that of the natural donor. The enzyme will ac-
KDO aldolase from Aureobacterium barkeri, cept a wide range of aldehyde acceptor sub-
strain KDO-37-2, shows a much wider substrates and is capable of effecting dynamic res-
strate specificity. Substrates require the R-con- olution of a racemic mixture of aldehydes,
figuration at C-3 but the stereochemical re- D-isomers reacting preferentially to L-isomers,
quirements for C-2 are more relaxed, the S- and the new stereocenter created during reac-
configuration being preferred for kinetically tion generally has the S-configuration. DERA
controlled reactions and the R-configuration has been used to prepare a number of carbo-
being favored under thermodynamic condi- hydrate analogs from suitably substituted
tions. A number of carbohydrate derivatives aldehydes, examples being furanose (57), pyra-
were prepared during the course of these stud- nose (58), thiosugar (59), azasugar (a), and
ies (SUGAIet al., 1993). simple aldehyde (61) (Fig. 22).
The 2-keto-4-hydroxyglutarate(KHG) al- Conveniently, when acetaldehyde is used as
dolases from bovine liver and E. coli have the donor substrate the products from DERA
been isolated, both enzymes having been catalyzed reactions are themselves aldehydes
shown to accept a range of analogs of pyruvate and are thus capable of acting as acceptor sub-
Fig. 22. Retrosynthetic analysis of the use of 2-de- Fig. 23. 2-Deoxyribose 5-phosphate aldolase (DE-
oxyribose 5-phosphate aldolase (DERA). RA) catalyzed acetaldehyde condensations.
strates for further reaction (GIJSENand WONG,

1994).As observed with a number of a-substi-
Me-0 yH
tuted aldehydes, if the product from the first
I
addition of acetaldehyde is unable to form a cy-
clic hemiacetal then reaction with a second
molecule of acetaldehyde proceeds to yield 2,4-
dideoxyhexoses, e.g., (62),cyclization of which
1 D E W , RAMA
yields cyclic hemiacetal (63) thus preventing
further addition (Fig. 23).The best substrate for 2 Pase
such sequential additions appears to be succin-
ic semialdehyde, the carboxylic acid group
mimicking the phosphate group of D-glyceral-
dehyde 3-phosphate (WONGet al., 1995b).
In the same vein, DERA has also been used Me%o~ 64
in combination with FDP-aldolase (RAMA)
to give a range of 5-deoxyketoses with three OH OH
axial substituents (64) together with other
compounds which arise from thermodynamic Fig. 24. One-pot multiple enzyme catalyzed syn-
equilibration (Fig. 24), and in combination thesis of sugars.
2 Aldolases 19
B 3 equiv.
rabbit liver and pig liver (LOTZet al., 1990;
SAEEDand YOUNG, 1992).An excess of glycine
was required to favor formation of the new
I 1 DERA amino acids. L-Amino acids predominated but
I y””’””
2 NeuAc aldolase long reaction times resulted in equilibration of
product stereochemistry, delivering the ther-
modynamically more stable threo isomers.
Threonine aldolase from mammalian tissues
catalyzes in vivo the liberation of glycine and
acetaldehyde from L-threonine, although L-
do-threonine appears to be a more active sub-
strate for the enzyme (FESSNER and WALTER,
H&C02H OH 65 1997). The enzyme from Candida hurnicola
showed tolerance to a variety of aliphatic and
aromatic aldehyde acceptors, although a,p-un-
Fig. 25. Two step multiple enzyme catalyzed syn- saturated aldehydes were not accepted (VASSI-
thesis of sugars. LEV et al., 1995a).A large excess of glycine was
required to drive the preparative reactions and
the (2S,3S) :(2S,3R) diastereoselectivity varied
with NeuAc-aldolase to yield derivatives of depending upon the aldehyde used. L-Threo-
sialic acid (65) (55% yield) (Fig. 25) (GIJSEN nine aldolase was used in a synthesis of a-ami-
and WONG,1995b,c). In the latter reaction the no-/3-hydroxy-y-butyrolactone (66) (Fig. 26)
configuration of C-4 is the opposite to that (VASSILEV et al., 1995b). Kinetic and thermo-
normally observed in NeuAc-aldolase cata- dynamic control has been applied to the reac-
lyzed reactions and results from equilibrated
coupling.
2.4 Glycine Dependent Aldolases
I
Serine hydroxymethyltransferase (SHMT,
serine aldolase) and threonine aldolase (both Glycine
EC 2.1.2.1) require pyridoxal5-phosphate and L-Threoni ne
tetrahydrofolate to catalyze the reversible aldolase
addition of glycine and an aldehyde to deliver
P-hydroxy-a-amino acids. Despite their appar-
ent synthetic potential, neither enzyme has re-
ceived intensive investigative attention. The
IRR’
term “threonine aldolase” is also used to refer
to pyridoxal phosphate requiring enzymes
(EC 4.1.2.5) which do not require tetrahydro-
folate. 1 H2, Pd/C
In vivo SHMT catalyzes the reversible aldol 2 HCl
reaction of glycine with “formaldehyde” (in
the form of 5,lO-methylenetetrahydrofolate
and water) to give L-serine. SHMT can be iso-
lated from numerous organisms and cloning
experiments have been successfully carried NH2.HCl66
out (FESSNER and WALTER, 1997). SHMT will H
react with other aldehyde substrates in the ab-
sence of tetrahydrofolate, as demonstrated by Fig. 26. The synthesis of a-amino-/3-hydroxy-y-bu-
synthetic studies carried out using SHMT from tyrolactone (66) using L-threonine aldolase.
Transaldolase catalyzes in vivo the transfer

of a dihydroxyacetone unit between phos-
phorylated metabolites; for example, the
C-1-C-3 aldol unit is transferred from D-sedo-
heptulose 7-phosphate (69) to D-glyceralde-
hyde 3-phosphate, delivering D-erythrose 4-
L-Threonine aldolase phosphate (70) and D-fructose 6-phosphate
15 minutes (71)(Fig. 28). However, despite its availability
and potentially low acceptor substrate speci-
ficity, transaldolase has not been fully exploit-
ed in organic synthesis. This can probably be
attributed to the fact that reactions catalyzed
by transaldolase have the same stereochemical
outcome as is obtained by using fructose 1,6-
diphosphate (FDP) aldolase (RAMA).
Fig. 27. Kinetically controlled synthesis of amino Transaldolase has been used in a multien-
acids using L-threonine aldolase. zyme system for the conversion of starch to D-
fructose. The transaldolase catalyzed transfer
of dihydroxyacetone from D-fructose 6-phos-
phate to D-glyceraldehyde enabled the final
tions of L-threonine aldolase. Enzymic con- step of the synthesis,a step which could not be
densation of ybenzyloxybutanal(67) (Fig. 27) satisfactorily completed using a phosphatase
and glycine for 15 min gave the (2S,3S)-amino (MORIDIAN and BENNER, 1992).
acid (68)as the major product (80% de, 18% Transketolase, on the other hand, has seen
yield), whereas over 15 h the thermodynami- rather more widespread use as a reagent in or-
cally more stable (2S,3R)-diastereoisomer pre- ganic synthesis. Transketolase catalyzes in vivo
dominated (20% de, 70% yield) (SHIBATA et the reversible transfer of a nucleophilic hy-
al., 1996). Recent studies have focused on the droxyacetyl unit from a ketose phosphate to
use of recombinant D- and L-threonine aldo-
lases (KIMURA et al., 1997).
A threonine aldolase from Streptomyces
amakusaensis has been purified and prelimi-
nary synthetic investigations conducted, in-
cluding the resolution of several racemic
threo-phenylserines to deliver enantiomerical- OH OH OH
ly pure (2R,3S)-~-aminoacids (HERBERTet 69 DSedoheptulose 7-P D-Glyceralde-
al., 1993,1994). Iiyde 3-P
Transaldolase
3 Transaldolase and
Transketolase
Transaldolase (EC 2.2.1.2) and transketo- -
OH
HJs-
+
OH OH
OP
lase (EC 2.2.1.1) are enzymes found in both

the oxidative and reductive pentose phosphate
pathway (RACKER,1961b, c; MOCALIet al., 70 DErythrose 4-P 71 DFructose 6-P
1985) and an example of each enzyme ob-
tained from bakers' yeast is commercially Fig. 28. Transaldolase catalyzed transfer of a dihy-
available. droxyacetone unit.
3 Transaldolase and Transketolase 21
an aldose phosphate, specifically the C-1-C-2 substrate specificity of transketolase has been
ketol unit of D-xylulose 5-phosphate (72) to D- surveyed and its synthetic potential compared
ribose 5-phosphate (73),yielding D-sedohep- to the established chemistry of fructose 1,6-
tulose 7-phosphate (69) and D-glyceraldehyde diphosphate (FDP) aldolase (RAMA) (DE-
3-phosphate (Fig. 29). D-Erythrose 4-phos- MUYNCK et al., 1991; KOBORIet al., 1992; DAL-
phate (70) also acts as a ketol donor, yielding MAS and DEMUYNCK, 1993). A wide range of
D-fructose 6-phosphate. The enzyme requires aldehydes will act as ketol acceptors, the rate
both thiamine pyrophosphate and Mg2' as co- of reaction being increased if there is an oxy-
factors. gen atom a or P to the carbonyl group, and the
P-Hydroxypyruvic acid may also be used as new chiral center formed always has the S-
the ketol donor for transketolase, though it is configuration. Transketolase can also be used
transferred to an aldose acceptor with an ac- to effect a kinetic resolution of racemic 2-hy-
tivity 4% of that of D-xylulose 5-phosphate droxyaldehydes as only the R-enantiomer
(SREREet al., 1958; BOLTEet al., 1987; HOBBS reacts (EFFENBERGER et al., 1992b).
et al., 1993). The key advantage to using hy- Recent investigations into the synthetic util-
droxypyruvic acid, however, is that the transfer ity of transketolase from E. coli have yielded
process is now irreversible, due to the elimina- promising results. The use of a genetically
tion of carbon dioxide subsequent to transfer modified strain of E. coli to provide transketo-
of the ketol unit. lase of sufficient purity for biotransformations,
Transketolases have been isolated from sev- combined with an efficient synthesis of potas-
eral different species; the enzymes used most sium hydroxypyruvate, enables the gram-scale
commonly are obtained from bakers' yeast or synthesis of trio1 (75) from aldehyde (74) in
from spinach leaves (BOLTE et al., 1987; 76% yield (Fig. 30) (MORRISet al., 1996).
SCHNEIDER et al., 1989; DEMUYNCK et al., Several natural product syntheses employ-
1990a, b; LINDQVIST et al., 1992), although re- ing transketolase have been reported. The
cent reports have discussed the use of trans- glycosidase inhibitor 1,4-dideoxy-1,4-imino-~-
ketolase from E. coli (HOBBSet al., 1993;HUM- arabinitol (25) was prepared by using the
PHREY et al., 1995; MORRISet al., 1996). The transketolase catalyzed condensation of ra-
cemic aldehyde (76) with lithium hydroxypyr-
uvate and kinetic resolution as the key step.
Condensation gave the azido compound (77)
in 71% effective yield, with further chemical
72 DXylulose 5-P
It
7 3 DRibose 5-P
Transketolase
E coli transketolase
co2
i R
HE
69 DSedoheptulose 7-P D-Glyceralde-
hyde 3-P 75 5-OBenzyl-D-sylulose
Fig. 29. Transketolase catalyzed transfer of a hy- Fig. 30. Transketolase catalyzed condensation of
droxyacetyl unit. P-hydroxypyruvate.
elaboration delivering the pyrrolidine deriva-

tive (25)in good overall yield (Fig. 31) (ZIEG-
‘C-hOH 76 LER et al., 1988).
(+)-exo-Brevicomin (38)represents an ideal
target as it possesses the stereochemical motif
obtained from a transketolase catalyzed trans-
Transke tolase formation. Taking advantage of the enzymatic
co2
kinetic resolution, intermediate (79) was ob-
tained in 45% yield by reacting 2-hydroxybu-
tyraldehyde (78)with hydroxypyruvic acid in
the presence of transketolase and cofactors.
Ketone (79) may also be obtained from the
RAMA catalyzed condensation of propanal
and DHAP, followed by enzymic dephosphor-
ylation. Further chemical operations delivered
(+)-exo-brevicomin (38) (Fig. 32) (MYLESet
al., 1991).
HYGH
Yeast transketolase was used to prepare
trio1 (81) from 3-cyano-2-hydroxyaldehyde
(80)as the key step in a synthesis of fagomine
H
N 25 (82)(Fig. 33) (EFFENBERGER and NULL,1992).
The same catalyst delivered 5-thio-D-threo-2-
pentulofuranose (29)from the thiol-substitut-
Fig. 31. The synthesis of 1,4-dideoxy-1,4-imino-~-ed aldehyde (31) (Fig. 34) (EFFENBERGER et
arabitinol(25) using transketolase. al., 1992a) which is also accessible from the
FDP aldolase condensation of DHAP and 2-
thioglycolaldehyde (28) (Fig. 11) (EFFEN-
BERGER et al., 1992a; CHOU et al., 1994).
Ha
OH
Transketolass COzH b C N 80
co2 OH
Transketolase
co2
I
I
Steps
H2, Pd/C
38 (+)-exeBrevicomin
H5h 8 2 Fagomine
Fig. 32. The synthesis of a bark beetle pheromone Fig. 33. The synthesis of fagomine (82) using trans-
using transketolase. ketolase.
OH
84 6-Deoxy-D-fructose
S
85 6-Deoxy-L-sorbose
Fig. 34. The synthesis of S-thio-~-thre0-2-pentulo- Fig. 35. Deoxysugars prepared using transketolase.
furanose (29) using transketolase.
Transketolase catalyzed condensation of a duction on the re-face of the carbonyl, and the
racemic mixture of erythro- and threo-2d-di- major by-product is benzyl alcohol. The reduc-
hydroxybutanals with hydroxypyruvate was tion step has been studied in some detail
specific for the (2R)-stereoisomers, and yield- (CSUKand GLANZER, 1991).
ed exclusively 6-deoxy-~-fructose(84) and 6-
deoxy-L-sorbose (85) (Fig. 35) (HECQUET et
al., 1994a, 1996). Similarly the triols (86) and
(87) were prepared from the corresponding
dithiane precursors. The corresponding alde-
hydes are intermediates for the synthesis of
fagomine (82) and 1,4-dideoxy-l,44mino-~-
arabitinol (25), respectively (Fig. 36) (HEC-
QUET et al., 1994b).
8 2 Fagomine
4 Pyruvate Decarboxylase
The capability of bakers' yeast to catalyze
the acyloin condensation was first observed
over 70 ago and has since been examined in
several review articles (FUGANTIand GRAS-
SELLI, 1985; DAVIESet al., 1989; SERVI,1990;
CSUKand GLANZER, 1991; WARD,1995; HOW-
MA", 1996;FESSNER and WALTER, 1997).
In this classic biotransformation, a C-C , I
bond is formed by reaction of an aldehyde, t

e.g., benzaldehyde, and an acetaldehyde equiv-
alent to yield an a-hydroxyketone (88); with
bakers' yeast the acetaldehyde equivalent
adds to the si-face of the aldehydic carbonyl
group (Fig. 37) (FUGANTI et al., 1984).The ket- H
01 product (88) is usually accompanied by Fig. 36. The synthesis of fagomine (82) and 1,4-di-
varying amounts of the corresponding diol deoxy-1,4-imino-~-arabitinol (25) from intermedi-
(89), derived from subsequent enzymatic re- ates prepared using transketolase.
During their investigations using isolated

yeast pyruvate decarboxylase, CROUTet al.
(1991) observed that aldehydes actually inhib-
ited the enzyme. Indeed, at a concentration of
Sf-face 0.05 mol L-’ benzaldehyde completely inhib-
its the decarboxylation reaction, thus explain-
Bakers’ yeast ing why the large-scale production of PAC is
(pyruvate decarboxylase) disfavored if the concentration of benzalde-
hyde in the reactor is too high. Various poly-
meric supports have been investigated for the
immobilization of yeast cells during PAC pro-
duction (NIKOLOVA and WARD,1994).In a fed-
0 88 OH 89 batch process, immobilized Cundidu utilis led
to a PAC yield of 15.2 g L-l (SHINand Ro-
Fig. 37. Pyruvate decarboxylase mediated acyloin GERS, 1995),while the use of isolated pyruvate
condensation. decarboxylase from C. utilis delivered an opti-
mum yield of 28.6 g L-l (SHINand ROGERS,
1996). Most recently, the large-scale produc-
tion of PAC has been optimized further to give
The acyloin condensation is catalyzed by py- a “cleaner” process and higher yields of PAC
ruvate decarboxylase in the presence of thia- (OLIVERet al., 1997).
mine pyrophosphate and Mg*+. Decarboxyla- An alternative enzyme, benzylformate de-
tion of pyruvic acid supplies the acetaldehyde carboxylase isolated from Pseudomonus puti-
equivalent and the condensation is highly du ATCC 12633, has potential for use in the
enantioselective. The caveat is that the bio- production of PAC and other a-hydroxyke-
transformation usually gives low yields of the tones by condensing benzylformate with ace-
desired condensation products. However, both taldehyde (WILCOCKS et al., 1992; WILCOCKS
reactants and biocatalyst are cheap and the en- and WARD,1992). Benzylformate decarboxyl-
zymic condensation can deliver chiral com- ase from Acinerobucter calcoacericus will also
pounds which may not be readily obtained deliver PAC from benzylformate and acetalde-
from the chiral pool. hyde in an optimized yield of 8.4 g L-’ (PRO-
The main reason why this particular bio- SEN and WARD, 1994).
transformation continues to be of interest is The yeast catalyzed acyloin condensation is
that the venerable condensation of benzalde- not restricted to the use of benzaldehyde and
hyde with pyruvic acid to give ~-3-hydroxy-3- pyruvic acid, although pyruvate decarboxylase
phenylpropan-2-one (phenylacetyl carbinol, does appear to show some substrate specific-
PAC) (88) is used in the industrial synthesis ity. Variously substituted cinnamaldehydes
of L-( - )-ephedrine and D-pseudoephedrine have been used extensively as substrates for
(ROSE, 1961). In fact, the vast majority of pyruvate decarboxylase to provide chiral com-
recent publications concerning the enzymatic pounds since the seminal observation that diol
acyloin condensation discuss the production of (91a) may be isolated from a fermenting mix-
PAC. Despite this, all these reports have indi- ture containing cinnamaldehyde (Wa) (Fu-
cations for the laboratory-scale production of GANTI and GRASSELLI, 1977). For example,
a-hydroxyketones. aldehydes (9Oa-d) gave the corresponding
It has been reported that the judicious addi- diols (91a-d) in 30%, 50%, 30%, and 10%
tion of acetone to the reaction mixture sup- yield, respectively (Fig. 38). Larger substitu-
presses diol formation, by undergoing reduc- ents a to the carbonyl group inhibited the con-
tion and inhibiting further reduction of PAC densation but addition of acetaldehyde to the
(SHIMAZU, 1950). Moreover, the use of carbo- reaction mixture was reported to dramatically
hydrate-free yeast partially surpresses the for- increase the yield of condensation products
mation of several by-products (GLANZERet (FUGANTIet al., 1979). Diols (93a, b) were
al., 1987). obtained in 15% and 10’30,respectively, from
&Q
donors appears extremely limited (FUGANTI et
al., 1988).
CROUTet al. provided firm experimental
90 evidence that pyruvate decarboxylase is in-
deed responsible for a-hydroxyketone forma-
tion by carrying out a series of biotransforma-
tions with the commercially available enzyme
(CROUTet al., 1991; KRENet al., 1993). Pyru-
(pyruvate vate decarboxylase was subsequently the sub-
cR1=H,R2=Me
decarboxylase) ject of a molecular modeling study, based upon
d R’ = Me, R2 = H the published crystal structure of the enzyme
from Saccharomyces uvarum (DYDA et al.,
1993; LOBELL and CROW,1996).
Other species have been shown to have py-
ruvate decarboxylase activity. The enzyme
from Zymomonm mobilis has been isolated
and purified; while by-products resulting from
reduction were suppressed, the purified en-
Fig. 38. Bakers’ yeast mediated acyloin condensa-
tion of cinnamaldehyde to give erythro-diols (91). zyme does not give higher yields than purified
decarboxylases from other species (BRINGER-
MEYERand SAHM, 1988). Interestingly, the
2- and 3-methyl-5-phenylpenta-2,4-dien-l-a1stereoselectivity of pyruvate decarboxylase
(92a, b) (Fig. 39) (FUGANTIand GRASSELLI,from brewers’ yeast differed from that ob-
1978).Recently, the condensation of cinnamal- tained from Z . mobilis or from wheat germ in
dehyde to give (2S,3R)-5-phenylpent-4-en-2,3-reactions with acetaldehyde (Fig. 40) (CHEN
diol in the presence of bakers’ yeast was op-
timized using statistical methods to modify the
a;- v
experimental design (EBERTet al., 1994). ee 2 8-5 4% ee 19-22%
a-Ketoacids other than pyruvic acid can
0
participate in the condensation with benzalde-
hyde to yield the corresponding diols in
> 95% ee, though the range of such alternative OH OH
Yeast
t
CO2H
Bakers’ yeast
a R1 = H, R2 = M e
(pyruvate
decarboxy lase)
b R1 = Me, R2 = H
J Z. mobilis
’ R’ OH
ee 24-29% ee 5241%
Fig. 39. Bakers’ yeast mediated acyloin condensa-
tion of 2- and 3-methyl-5-phenylpenta-2,4-dien-l-alFig. 40. Enantiocomplementary acyloin condensa-
(92a, b) . tions.
OH and JORDAN, 1984; CROUTet al., 1986; ABRA-

94 HAM and STUMPF,1987; BORNEMANN et al.,
I,
A
:
5
1993).
OH Several acyclic unsaturated aldehydes under-
went a condensation reaction in the presence
OH of fermenting Mucor circinelloides CBS
39468; (2S,3R)-diols (94%) (Fig. 41) were ob-
tained from the corresponding aldehydes, pre-
UY
R & sumably the reduction products of initially
OH
formed a-hydroxyketones (STUMPFand KIES-
LICH, 1991).
/ 96 Saccharomyces fermentati and S. delbrueckii
promoted the acyloin condensation between
R & benzaldehyde and pyruvic acid, giving product
OH
yields which were higher than with other mi-
Fig. 41. Mucor circinelloides CBS 39468 mediated CroorganismS, but did not offer any advantage
acyloin condensation and reduction products. over Saccharomyces cerevisiae when chal-
woH
97 D(-)-alloMuscarine 98 L-Amicetose 99 L-Mycarose 100 L-Olivomycose
H&OH @OH
H2N HONH2 HO N H 2
101 L-Acosamine 102 L-Daunosamine 103 L-Ristosamine 104 L-Vancosamine
--
105 4-Hexanolide &-
OH
107 (-)-Frontalin 38 (+)-exo-Brevicomin
106 (3S,4S)-4-Methyl-3-heptanol
Fig. 42. Natural products synthesized using the biotransformationproducts of cinnamaldehydes.

& 110
pyruvate
Bakers'yeast
decarboxylase
~ & 111
OH ~ W O
112
H
I
113 a-Tocopherol, Vitamin E
Fig. 43. Biocatalytic synthesis of a-tocopherol(113).
lenged with other aldehydes or oxoacids The synthesis of solerone (5-0x0-4-hexano-

(CARDILLO et al., 1991). The yeast catalyzed lide, (116)) was achieved using pyruvate decar-
acyloin condensation has been used as a key boxylase from bakers' yeast in a key step.
step in many syntheses of natural products, the Ethyl 4-oxobutanoate (114), a novel substrate
FUGANTI group having eminently demonstrat- for the enzymic acyloin condensation, yielded
ed that biotransformation of cinnamaldehyde ethyl 4-hydroxy-5-oxohexanoate(115), which
derivatives can provide useful chiral starting was readily converted into solerone (116) by
materials (FUGANTIand GRASSELLI,1977, acid (Fig. 44) (HARINGet al., 1997).
1985).The following are just some of the tar-
gets that have been prepared: D-( - )-do-mus-
carine (97) (FRONZAet al., 1978),L-amicetose
(98), L-mycarose (W),and L-olivomycose
I
(100) (FUGANTI and GRASSELLI, 1978;FUGAN-
TI et al., 1979),N-acyl derivatives of aminohex- 0 114
oses including L-acosamine (101), L-daunos-
amine (102),L-ristosamine (103) and L-vancos- Bakers' yeast
amine (104) (FRONZAet al., 1980,1981,1982, pyr uva te
1985, 1987; FUGANTI et al., 1983a), (+)- and decarboxylase
(-)-4-hexanolide (105) (BERNARDI et al., 1980;
FUGANTI et al., 1983b), (3S,4S)-4-methyl-3-
heptanol (106), a pheromone from Scolytus
QH-
multisfriutus (FUGANTI et al., 1982), (-)-fron-
talin (107) (FUGANTIet al., 1983c), (+)-em-
brevicomin (38) (BERNARDI et al., 1981; Fu-
GANTI et al., 1983b), LTB, (108) (FUGANTI et
al., 1983d), and (+)- and (-)-rhodinose (109)
(SERVI,1985) (Fig. 42).
Following an earlier synthesis, both the diol t
(111) and by-product alcohol (1l2), obtained
in 20% and 10% yield, respectively,from reac-
tion of a-methyl-~-(2-furyl)acrolein(110) in
fermenting yeast, were used in a synthesis of a-
tocopherol (vitamin E, (113)) (Fig. 43) (Fu-
GANTI and GRASSELLI, 1979,1982). Fig. 44. Biocatalytic synthesis of solerone (116).
9%yield OH
= (R)-117
1 Pig liver farnesyl pyrophosphate synthetase
2 Alkaline phosphatae
1 2 % yield OH
(S)-117
Steps
5 Enzymes from Terpenoid

and Steroid Biosynthesis
A
Examples of the laboratory use of enzymes
from the biosynthetic pathways which lead to
terpenes and steroids are relatively sparse, de-
spite abundant microscale biosynthetic stud-
ies. Pig liver farnesyl pyrophosphate synthet-
L+
0 119
ase has been used to prepare both enantiom- 2,3-oxidosqualene

ers of 4-methyldihomofarnesol (117). ( S ) - lanosterol cyclase
(117) was used in the synthesis of juvenile hor-
mone (118) (Fig. 45) (KOYAMAet al., 1985,
1987).
Several enzymes from the biosynthesis of
steroids are of use in organic synthesis. Pig
liver 2,3-oxidosqualene cyclase has long been
known to catalyze the cyclization of 2,3-oxi-
dosqualene (119) and derivatives substituted
at the Al8-19 double bond, to yield the expect- 1 2 0 Lanosterol
ed steroidal derivatives, in this case lanosterol
(120)(Fig. 46) (DJERASSI, 1981; GOAD,1981). Fig. 46. Polycyclization of 2,3-epoxy-squalene.
5 Enzymes from Terpenoid and Steroid Biosynthesis 29
Pig liver
2,3-osidosqualene
lanosterol cyclase
t
@
121
H
a R1 = Me, R2 =
b R1 = Et, R2 = Me
c R1 = Me, R2 = Et
124 R 3 = w R4= H
Fig. 47. Polycyclization of 2,3-epoxy-squaleneanalogs (121).
More recently, the enzyme has been used to

prepare steroids (l22b, c) or tricyclic com-
pounds (123) and (l24)from the correspond-
ing oxidosqualene analogs (l21a-c) which
possess the unnatural Z-configuration at the
A18-19 double bond (Fig. 47) (HERINet al.,
1979; KRIEFet al., 1987).
Bakers’ yeast has been used as a source of
sterol cyclase, allowing the efficient cyclization
of squalene oxide derivatives to the expected
Bakers‘ yeast
steroidal compounds.The cyclization is accom-
2,3-oxidosqualene
panied by a kinetic resolution and is curiously
promoted by ultrasonication; whether ultra- lanosterol cyclase
sound increases cyclase activity or simply dis-
tributes the substrate more efficiently is debat-
able (BUJONS et al., 1988; MEDINAand KYLER,
1988;MEDINA et al., 1989;X A O and PRESTWICH,
1991).Interestingly,in the transformation of ra-
cemic compound (125) to optically pure steroid
(U), the vinyl group rearranges from C-8 to C-
14 in the same way as a hydrogen does in the
natural substrate (l21a) (Fig. 48).
A comparison has been made between pig
liver 2,3-oxidosqualene cyclase and the ultra- Fig. 48. Epoxy-polyene cyclization.
Alder-ase”, could not be identified (LASCHAT,

1996).In fact, it may readily be concluded that
a Diels-Alder-ase does not exist, based upon
the difficulty encountered in isolating such an
enzyme. Several reports of biocatalytic Diels-
‘
Alder reactions have appeared in the litera-
ture. For example, in the presence of bakers’
yeast the reaction of maleic acid and cyclo-
127 2,3-Dihydrosqualene pentadiene in water gave exclusively the exo-
cycloadduct (129), whereas in the absence of
yeast the endo-cycloadduct (130)predominat-
Cyclase from ed (Fig. 50) (RAMARAOet al., 1990).Whether
T. pyriformis this effect may be attributed to a specific en-
zyme is, however, uncertain.
The long-awaited breakthrough came when
OIKAWA,ICHIHARA,and coworkers detected
enzymic activity for a Diels-Alder reaction in
a cell-free extract from Alternuria soluni, a
pathogenic fungus which causes early blight
disease in potatoes and tomatoes (OIKAWA et
al., 1995; ICHIHARA and OIKAWA,1997). Fol-
lowing on from previous work in which they
proposed that solanapyrones (131-134), phy-
Fig. 49. Polyene cyclization. totoxins produced by A. solani, were biosyn-
+
thesized via a [4 21 cycloaddition prosola-
napyrone 111 (135) was treated with the cell-
free extract at 30°C for 10 min to yield cyclized
sonicated bakers’ yeast preparation in cataly- products (131)and (132)with an endo :ex0 ra-
sis of the cyclizations mentioned above (KRIEF
et al., 1991).A protozoal cyclase from Tetrahy-
menu pyriformis has been used to synthesize
the unnatural steroid euph-7-ene (128)from
2,3-dihydrosqualene (127) (Fig. 49) (ABE and
ROHMER, 1991).
6 Other Enzyme Catalyzed

C-C Bond Forming
IQ
t
Reactions 129
It is well established that enzyme catalyzed
pericyclic reactions form part of many biosyn-
thetic pathways. The Diels-Alder reaction, un-
doubtedly one of the most powerful synthetic
transformations available to the organic chem- 4 0 2 H 130
ist, has long been speculated as being a key re- COzH
action in the biosynthesis of many natural
products but an enzyme responsible for f a d - fig. 50. Bakers’ yeast mediated Diels-Alder reac-
itating such a reaction, a so-called “Diels- tion.
6 OtherEnzj!meCatalyzed C-C Bond Forming Reactions 31
tio of 47:53 (Fig. 51). When compound (135)

was reacted in the absence of the cell-free ex-
tract, the uncatalyzed reaction delivered prod-
ucts (131) and (132) with an endo:exo ratio of
97:3; a similar endo:exo ratio was obtained
when a denatured cell-free extract was used as
the reaction medium. Overall, the enzyme cat-
alyzed Diels-Alder reaction proceeds with a
conversion of 15% and an endo:exo ratio of
13:87 (this translates to an ee of > 92% in fa-
vor of solanapyrone (132)). Such enzymic cy-
cloadditions are particularly interesting from a
mechanistic point of view: usually, the endo cy-
cloadduct predominates when Diels-Alder re-
actions are carried out in the absence ofcata-
lyst or if chemical methods of catalysis are
used. It must be noted that, at this stage, no
137 Macrophomic acid
single enzyme was isolated to which these re-
sults could be attributed. Fig. 52. Diels-Alder reaction of phosphoenolpyru-
Since the above report, the Japanese group vate?
has offered a second example of a bio-
catalyzed Diels-Alder reaction (OIKAWAet
al., 1997).Pyrone (136) was converted to mac-
rophomic acid (137) by reaction with phos- deliver the product (137) (Fig. 52). However,
phoenolpyruvate in a cell-free extract from the implied involvement of a Diels-Alder-ase
Macrophoma cornmelinae; the proposed in this reaction is not certain as an alternative
mechanism involves an initial [4 +21 cycload- biosynthetic route may be envisaged.
dition, followed by loss of carbon dioxide to C-C bond formation has been achieved
using certain enzymes from the biosynthesis
of amino acids. A variety of P-substituted
a-amino acid derivatives were prepared from
p-chloroalanine by using E. coli tryptophan
synthase and tyrosine phenol lyase as reaction
catalysts (NAGASAWA and YAMADA, 1986).
Reactions using yeast have delivered some
rather unexpected products. The cyclic hemi-
acetal (139) was isolated from a condensation
of cinnamaldehyde in the presence of ferment-
ing yeast with added acetaldehyde (BERTOLLI
et al., 1981). It is probably formed by Michael
131 R = C H O 132 R = CHO addition of the enolate of ketol (138) to cin-
133 R=CHiOH 134 R = CHzOH namaldehyde, followed by hemiacetal forma-
tion (Fig. 53).
?Me In another apparent Michael addition, a$-
unsaturated ketones and esters react with
2,2,2-trifluoroethanol in the presence of fer-
C H O 0 menting bakers' yeast to give products in high
enantiomeric excess, but unknown absolute
stereochemistry. For example, ethyl acrylate
135 Prosolanapyrone I11 (140) reacts to give lactone (142) in 47% yield
and 79% ee via the addition product (141)
Fig. 51. Intramolecular Diels-Alder reaction. (Fig. 54) (KITAZUME and ISHIKAWA, 1984).
I
Bakers’ yeast,
rt, 48h
Bakers’ yeast
t
144 145
Fig. 53. Bakers’ yeast mediated Michael addition

to cinnamaldehyde.
aCCN Et 146
Fig. 55. An unusual bakers’ yeast mediated alkyla-

tion.
I
0 140 nitrile intermediate (146)could be obtained if
the reaction if was terminated before it went to
CF3CH20H Bakers‘ yeast completion. A mechanism to account for these
observations was not proposed but alkylation
appears to precede the reductive process. One
possibility is C-acetylation by acetyl-CoA, fol-
lowed by reduction, elimination, and further
reduction of the alkene bond.
t
7 Conclusion
F3CG O 142
C-C bond formation is fast becoming the
Fig. 54. Bakers’ yeast mediated Michael addition. sole subject of many review articles in the pri-
mary chemistry literature, a fact which bears
witness to the steady increase in the number of
reports concerning the use of enzymes to per-
A strange enzymatic alkylation reaction was form such a biotransformation. The majority
observed during the reduction of 3-oxobuty- of organic chemists will thus recognize the use
ronitrile (143) using fermenting bakers’ yeast of, for example, bakers’ yeast as a laboratory
in ethanol (ITOHet al., 1989). The biotrans- reagent but, unfortunately, do not seek to use
formation did not deliver the expected 3-hy- it (likewise other enzymic systems), in the be-
droxybutyronitrile but gave, instead, the dia- lief that it is inconvenient and somewhat
stereomeric (3S)-2-ethyl-3-hydroxybutyroni- messy. However, as noted above, even lowly
triles (144)and (145)in a syn: anti ratio of 2: 1 bakers’ yeast can accomplish asymmetric C-C
(Fig. 55) each of > 99% ee. The alkylated keto bond formation reactions. While this present
8 References 33
work provides an account of the state of the Synthesis of 3-deoxy-~-manno-2-octulosonate-8-

art, a healthy combination of breakthroughs in phosphate (KDO-8-P) from D-arabinose - gener-
modern microbiology and a growing aware- ation of ~-arabinose-5-phosphateusing hexokin-
ness among chemists of the potential benefits ase, Tetrahedron Lett. 29,427-430.
BEDNARSKI, M. D., SIMON,E.S., BISCHOFBERGER,N.,
of using enzymes will give future reviewers FESSNER, W.-D., KIM,M.-J. et al. (1989), Rabbit
much to write about. muscle aldolase as a catalyst in organic synthesis,
J. Am. Chem. SOC.111,627-635.
BERNARDI, R., FUGANTI, C., GRASSELLI, P.,MARINO-
NI, G. (1980), Synthesis of the enantiomeric forms
of 4-hexanolide (y-caprolactone) from the opti-
cally active 5-phenyl-4-pentene-2,3-diol prepared
8 References from cinnamaldehyde and bakers’ yeast, Syn-
thesis, 50-52.
ABE,I., ROHMER, M. (1991), Enzymatic cyclization BERNARDI, R., FUGANTI,C., GRASSELLI, P.(1981), On
of 2,3-dihydrosqualene into euph-7-ene by a cell- the steric course of addition of Gngnard reagents
free system from the protozoan Tetrahymena on to a,&dialkoxy erythro and threo chiral alde-
pyriformis, J. Chem. SOC., Chem. Commun., hydes. Synthesis of (+)- and (-)-ex0 and endo-
902-903. brevicomin, TetrahedronLett. 22,40214024.
ABRAHAM, W.-R., STUMPF, B. (1987), Enzymatic acy- BERTOLLI, G., FRONZA, G., FUGANTI, C., GRASSELLI,
loin condensation of acyclic aldehydes, Z. Natur- P., MOJORI, L., SPREAFICO, F. (1981),On the cr-ket-
forsch. 42C, 559-566. 01s obtained from @unsaturated aromatic alde-
ALLEN,S. T., HEINTZELMAN, G. R., TOONE,E. J. hydes and bakers’ yeast, Tetrahedron Lett. 22,
(1992),Pyruvate aidolases as reagents for stereo- 965-968.
specific aldol condensation, J. Org. Chem. 57, BISCHOFBERGER, N., WALDMANN, H., SAITO,T., Sr-
426-427. MON,E. s.,LEES,W. et a]. (1988), Synthesis of ana-
AuGE, C., GAUTHERON, C. (1987),The use of an im- logs of 1,3-dihydroxyacetonephosphate and gly-
mobilized aldolase in the 1st synthesis of a natu- ceraldehyde-3-phosphate for use in studies of
ral deaminated neuraminic acid, J. Chem. SOC., fructose-1,6-diphosphatealdolase, J. Org. Chern.
Chem. Commun., 859-860. 53,3457-3465.
AuGE,C., DAVID,S., GAUTHERON, C. (19&4),Synthe- BOLTE,J.,DEMuYNcK,C., SAMAKI,H. (1987), Utiliza-
sis with immobilized enzyme of the most impor- tion of enzymes in organic chemistry: transketo-
tant sialic acid, Tetrahedron Lett. 25,4663-4664. lase catalyzed synthesis of ketoses, Tetrahedron
AuGE,C., DAVID, S., GAUTHERON, C., VEYRIBRES, A. Lett. 28,5525-5528.
(1985), Synthesis with an immobilized enzyme of BORNEMANN, S., CROUT,D. H. G., DALTON,H.,
N-acetyl-9-0-acetylneuraminic acid, a sugar re- HUTCHINSON, D. W., DEAN,G. et al. (1993), Ster-
ported as a component of embryonic and tumor eochemistry of the formation of lactaldehyde and
antigens, Tetrahedron Lett. 26,2439-2440. acetoin produced by the pyruvate decarboxylases
AuGE, C., GAUTHERON, C., DAVID,S. (1990), Sialyl of yeast (Saccharomyces sp.) and Zymomonus
aldolase in organic synthesis: from the trout egg mobilis - different Boltzmann distributions be-
acid, 3-deoxy-D-g~ycero-D-ga~acto-2-nonu~osonictween bound forms of the electrophile, acetalde-
acid (KDN), to branched-chain higher ketoses as hyde in the enzymatic reactions, J. Chem. Soc.,
possible new chirons, Tetrahedron46,201-214. Perkin Trans.I , 309-311.
BARBAS, C. F. I., WANG,Y.-F., WONG,C.-H. (1990), BRINGER-MEYER, S., SAHM,H. (1988), Metabolic
Deoxyribose- 5-phosphate aldolase as a synthetic shifts in Zymornonas mobilis in response to
catalyst, J. Am. Chem. SOC.1U,2013-2014. growth conditions, FEMS Microbiol. Rev. 54,
BEDNARSKI, M. D., WALDMANN, H. J., WHITESIDES, G. 131-142.
M. (1986), Aldolase-catalyzed synthesis of com- BUJONS, J.,GuAJARDo,R.,KYLER,K.S. (1988),Enan-
plex C-8 and C-9 monosaccharides, Tetrahedron tioselective enzymatic sterol synthesis by ultra-
Lett. 27,5807-5810. sonically stimulated bakers’ yeast, J. Am. Chern.
BEDNARSKI, M. D., CHENAULT, H. K., SIMON,E. S., SOC.110,604-606.
WHITESIDES, G. M. (1987), Membrane-enclosed B u n , S., ROBERTS, S. M. (1986), Recent advances in
enzymatic catalysis (MEEC) - a useful, practical the use of enzyme-catalyzed reactions in organic
new method for the manipulation of enzymes in research - the synthesis of biologically-active nat-
organic synthesis, J. Am. Chem. SOC. 109, ural products and analogs, Nut. Prod. Rep. 3,
1283-1 285. 489-503.
BEDNARSKI, M. D., CRANS,D. C., DICOSIMO, R., SI- CARDILLO, R., SERVI,S., TINTI,C. (1991), Biotrans-
MON,E. S., STEIN,P. D., WHITESIDES, G. M. (1988), formation of unsaturated aldehydes by micro-
organisms with pyruvate decarboxylase activity, DRUECKHAMMER, D. G., HENNEN, W. J., PEDERSON,
Appl. Microbiol. Biotechnol. 36,300-303. R. L., BARBAS111, C. F., GAUTHERON, C. M. et al.
CHEN,G. C., JORDAN, F. (1984), Brewers' yeast pyru- (1991), Enzyme catalysis in synthetic carbohy-
vate decarboxylase produces acetoin from acetal- drate chemistry, Synthesis, 499-525.
dehyde - a novel tool to study the mechanism of DUNCAN, R., DRUECKHAMMER, D. G. (I995),A pseu-
steps subsequent to carbon dioxide loss, Bio- doisomerization route to aldose sugars using al-
chemistry 23,3576-3582. dolase catalysis,J. Org. Chem. 60,7394-7395.
CHEN,L., DUMAS, D. P., WONG,C.-H. (1992), Deoxy- DUNCAN, R., DRUECKHAMMER, D. G. (1996), Prepar-
ribose-5-phosphate aldolase as a catalyst in asym- ation of deoxy sugars via aldolase-catalyzed syn-
metric aldol condensation, J. Am. Chem SOC.114, thesis of 1-deoxy-thioketoses,J. Org. Chem. 61,
741-748. 438-439.
CHENEVERT, R., LAVOIE, M., DASSER, M. (1997), Use DURRWACHTER, J. R., WONG,C.-H. (1988), Fructose
of aldolases in the synthesis of non-carbohydrate 1,6-diphosphate aldolase catalyzed stereoselec-
natural products. Stereoselective synthesis of as- tive synthesis of C-alkyl and N-containing sugars
picilin C-3-C-9 fragment, Can.J. Chem. 75,68-73. - thermodynamically controlled C-C bond for-
CHOU,W.-C., CHEN,L., FANG,J.-M., WONG,C.-H. mations,J. Org. Chem. 53,41754181.
(1994),A new route to deoxythiosugars based on M A , F., FUREY, W., SWAMINAWN, S., SAX,M., FAR-
aldolases,J. Am. Chem. SOC.116,6191-6194. RENKOPF, B., JORDAN, F. (1993), Catalytic centers
CHOU,W.-C., FOTSCH,C., WONG,C.-H. (1995), Syn- in the thiamine diphosphate dependent enzyme
thesis of nitrocyclitols based on enzymatic aldol pyruvate decarboxylase at 2.4 8,resolution, Bio-
reaction and intramolecular nitroaldol reaction, chemistry 32,6165-6170.
J. Org. Chem. 60,2916-2917. EBERT,C., GARDOSSI, L., GIANFERRARA, T., LINDA,
CROUT,D. H. G., LITTLECHILD, J., MORREY,S. M. P., MORANDINI, C. (1994),A multivariate reexam-
(1986),Acetoin metabolism - stereochemistry of ination of experimental condition effects on acy-
the acetoin produced by the pyruvate decarboxyl- loin-type condensation mediated by Saccharo-
ase of wheat-germ and by the a-acetolactate de- myces cerevisiae, Biocatalysis 10,15-23.
carboxylase of Klebsiella aerogenes, J. Chem. EFFENBERGER, F., NULL,V. (1992), Enzyme-cata-
SOC.,Perkin Trans. I , 105-108. lyzed reactions 13. A new, efficient synthesis of
CROUT,D. H. G., DALTON,H., HUTCHISON, D. W., fagomine, Liebigs Ann. Chem., 1211-1212.
MIYAGOSHI, M. (1991), Studies on pyruvate de- EFFENBERGER, F., STRAUB, A., NULL,V. (1992), En-
carboxylase: acyloin formation from aliphatic, ar- zyme-catalyzed reactions. 14. Stereoselective syn-
omatic and heterocyclic aldehydes,J. Chem. SOC., thesis of thiosugars from achiral starting com-
Perkin Trans. I , 1329-1334. pounds by enzymes, Liebigs Ann. Chem.,
CSUK,R., GLANZER, B. I. (1991),Bakers' yeast-medi- 1297-1301.
ated transformations in organic chemistry, Chem. EFFENBERGER, F., NuLL,V.,ZIEGLER,T. (1992),Prep-
Rev. 91,49-97. aration of optically pure L-2-hydroxyaldehydes
DALMAS, V., DEMUYNCK, C. (1993), Study of the with yeast transketolase, Tetrahedron Lett. 33,
specificity of a spinach transketolase on achiral 5157-5160.
substrates, Tetrahedron: Asymmetry 4, 2383- EYRISCH, O., FESSNER, W.-D. (1995), Disaccharide
2388. mimetics by enzymatic tandem aldol reaction,
DAVIES, H. G., GREEN,R. H., KELLY,D. R., ROBERTS, Angew. Chem. (Int. Edn. Engl.) 34,1639-1641.
S. M. (1989), Biotransformations in Preparative EYRISCH, O., SINERIUS, G., FESSNER, W.-D. (1993),Fa-
Organic Chemistry, pp. 221-231. London: Aca- cile enzymatic de novo synthesis and NMR spec-
demic Press. troscopic characterization of D-tagatose 1,6-bis-
DEMUYNCK, C., FISSON, F., BENNANI-BAITI, I., SAMA- phosphate, Carbohydr. Res. 238,287-306.
KI, H., MANI,J.-C. (1990a), Immunoaffinity purifi- FANG,J.-M., WONG,C.-H. (1994), Enzymes in organ-
cation of transketolases from yeast and spinach ic synthesis: alteration of reversible reactions to
leaves, Agric. Biol. Chem. 54,3073-3078. irreversible processes, Synlett, 393402.
DEMUYNCK, C., BOLTE,J., HECQUET, L., SAMAKI, H. FESSNER, W.-D., EYRISCH, 0. (1992), Enzymes in or-
(1990b), Enzymes as reagents in organic chemis- ganic synthesis. 2. One-pot synthesis of tagatose
try - transketolase-catalyzed synthesis of D-[1,2- 1,6-bisphosphate by diastereoselective aldol
'3C,]xylulose, Carbohydr. Res. 206,7945. addition, Angew. Chem. (Int. Edn. Engl.) 31,
DEMUYNCK, C., BOLTE,J., HECQUET, L., DALMAS,V. 56-58.
(1991), Enzyme-catalyzed synthesis of carbohy- FESSNER, W.-D., SINERIUS, G. (1994), Enzymes in or-
drates: synthetic potential of transketolase, Tetra- ganic synthesis. 7. Synthesis of dihydroxyacetone
hedron Lett. 32,5085-5088. phosphate (and isosteric analogs) by enzymatic
DJERASSI, C. (1981), Recent studies in the marine oxidation - sugars from glycerol, Angew. Chem.
sterol field, Pure Appl. Chem. 53,873-890. (Int. Edn. Engl.) 33,209-212.
8 References 35
FESSNER, W.-D.,WALTER, C. (1997), Enzymatic C-C formed from cinnamaldehyde in fermenting

bond formation in asymmetric synthesis, Top. bakers’ yeast, Carbohydr. Rex 136,115-124.
Curr. Chem. 184,97-194. FRONZA,G., FUGANTI,C., PEDROCCHI-FANTONI, G.,
FESSNER, W.-D., SINERIUS, G., SCHNEIDER, A., DREY- SERVI,S. (1987), Stereochemistry and synthetic
ER, M., SCHULZ, G. E. et al. (1991),Enzymes in or- applications of the products of yeast reduction
ganic synthesis. 1. Diastereoselective enzymatic of 3-hydroxy-3-methyl-5-phenylpent-4-en-2-one,
aldol additions - L-rhamnulose and L-fuculose 1- J. Org. Chem. 52,1141-1144.
phosphate aldolases from Escherichia coli, An- FUGANTI,C., GRASSELLI, P. (1977), Transformations
gew. Chem. (Int. Edn. Engl.) 30,555558. of non-conventional substrates by fermenting
FESSNER, W.-D., BADIA,J., EYRISCH, O., SCHNEIDER, bakers’ yeast: production of optically active
A., SINERIUS, G. (1992), Enzymes in organic syn- methyl-diols from aldehydes, Chem. Ind. (Lon-
thesis. 5. Enzymatic synthesis of rare ketose 1- don), 983.
phosphates, Tetrahedron Lett. 33,5231-5234. FUGANTI,C., GRASSELLI, P. (1978), Stereospecific
FINDEIS, M. A., WHITESIDES, G. M. (1984), Enzymic synthesis from non-carbohydrate precursors of
methods in organic synthesis, Ann. Rep. Med. the deoxy- and methyl-branched deoxy-sugars
Chem. 19,263-272. L-amicetose, L-mycarose and L-olivomycose, J.
FITZ,W., WONG,C.-H. (1994), Combined use of sub- Chem. Soc., Chem. Commun., 299-300.
tilisin and N-acetylneuraminic acid aldolase for FUGANTI, C., GRASSELLI, P. (1979), Efficient stereo-
the synthesis of a fluorescent sialic acid, J. Org. selective synthesis of natural a-tocopherol (vi-
Chem. 59,8279-8280. tamin E), J. Chem. SOC.,Chem. Commun.,
FITZ,W., SCHWARK, J.-R., WONG,C.-H. (1999, Aldo- 995-996.
tetroses and C(3)-modified aldohexoses as sub- FUGANTI,C., GRASSELLI, P. (1982), Synthesis of the
strates for N-acetylneuraminic acid aldolase - a C,, chromanyl moiety of natural a-tocopherol
model for the explanation of the normal and the (vitamin E), J. Chem. SOC., Chem. Commun.,
inversed stereoselectivity, J. Org. Chem. 60, 205-206.
3663-3670. FUGANTI, C., GRASSELLI, P. (1985), Stereochemistry
FLOYD,N. C.,LIEBSTER, M. H., TURNER,N. J. (1992), and synthetic applications of products of fer-
A simple strategy for obtaining both enantiomers mentation of a,punsaturated aromatic alde-
from an aldolase reaction - preparation of L-4- hydes by bakers’ yeast, in: Enzymes in Organic
hydroxy-2-ketoglutarate and ~-4-hydroxy-2- Synthesis, Ciba Foundation Symposium III (POR-
ketoglutarate, J. Chem. SOC., Perkin Trans. I, TER, R., CLARK,S., Eds.), pp. 112-127. London:
1085-1 086. Pitman.
FRONZA,G., FUGANTI,C., GRASSELLI, P. (1978), FUGANTI,C., GRASSELLI, P., MARINONI, G. (1979),
Noncarbohydrate-based enantioselective synthe- Further studies on the transformations of unsatu-
sis of D-(-)-allO-muscarine, Tetrahedron Lett. 19, rated aldehydes by fermenting bakers’ yeast: a fa-
3941-3942. cile synthesis of L-olivomycose,Tetrahedron Lett.
FRONZA, G., FUGANTI, C., GRASSELLI, P. (1980), Syn- 20,1161-1164.
thesis of N-trifluoroacetyl-L-acosamine and L- FUGANTI,C., GRASSELLI, P., SERVI,S., ZIROTTI,C.
daunosamine, J. Chem. Soc., Chem. Commun., (1982), Synthesis of the enantiomeric forms of cis
4424. and trans l-benzyloxy-2,3-epoxybutaneand of
FRONZA, G., FUGANTI, C., GRASSELLI, P.,PEDROCCHI- (3S,4S) 4-methyl-3-heptano1, Tetrahedron Lett.
FANTONI, G. (1981), Synthesis of the N-benzoyl 23,4269-4272.
derivatives of L-arabino, L-xylo, and L-lyxo FUGANTI, C., GRASSELLI, P., PEDROCCHI-FANTONI, G.
(L-vancosamine) isomers of 2,3,6-trideoxy-3-C- (1983a), Stereospecific synthesis of N-benzoyl-L-
methyl-3-aminohexose from a non-carbohydrate daunosamine and L-ristosamine,J. Org. Chem. 48,
precursor, Tetrahedron Lett. 22,5073-5076. 909-910.
FRONZA, G., FUGANTI, C., GRASSELLI, P., MAJORI, L., FUGANTI,C., GRASSELLI, P., PEDROCCHI-FANTONI,
PEDROCCHI-FANTONI, G., SPREAFICO, F. (1982), G., SERVI,S., ZIROTI-I, C. (1983b), Carbohydrate-
Synthesis of enantiomerically pure forms of N- like chiral synthons.Preparation of (R) y-hexano-
acyl derivatives of C-methyl analogs of the ami- lide, (5R,6S,7S) 6,7-isopropylidendioxy-&octa-
nodeoxy sugar L-acosamine from noncarbohy- nolide and (+)-exo-brevicomin from (2S,3S,4R)
drate precursors, J. Org. Chem. 47,3289-3296. 2,3-isopropylidendioxy-4-benzyloxyhept-6-ene),
FRONZA, G., FUGANTI, C., GRASSELLI, P., PEDROCCHI- Tetrahedron Lett. 24,3753-3756.
FANTONI, G. (1985), Carbohydrate-like chiral syn- FUGANTI, C., GRASSELLI, P., SERVI,S. (1983c), Syn-
thons. Synthesis of the N-trifluoroacetyl deriva- thesis of (-)-frontalin from the (2S,3R)-diol pre-
tives of 4-amino-2,4,6-trideoxy-~-lyxo, 4-amino- pared from a-methylcinnamaldehyde and fer-
2,4,6-trideoxy-~-arabino,and 4-amino-2,4,6-tri- menting bakers’ yeast, J. Chem. SOC., Perkin
deoxy-L-ribo-hexose from the (2S,3R) 2,3-diol Trans. I,241-244.
FUGANTI, C., SERVI,S., ZIROTTI, C. (1983d),Non-car- tion of key metabolites in sherry wine, J. Agric.
bohydrate based synthesis of natural LIB4, Tetra- Food Chem. 45,369-372.
hedron Lett. 24,5285-5288. HECQUET,L., BOLTE,J., DEMUYNCK, C. (1994a),
FUGANTI, C., GRASSELLI, P., SERVI,S., SPREAFICO, F., Chemoenzymatic synthesis of 6-deoxy-~-fructose
ZIROTTI, C. (1984), On the steric course of bakers’ and 6-deoxy-~-sorboseusing transketolase, Tetra-
yeast reduction of a-hydroxyketones, J. Org. hedron 50,867743684.
Chem. 49,40874089. HECQUET, L., LEMAIRE, M.,BoLTE,J., DEMUYNCK, C.
FUGANTI, C., GRASSELLI, P., POLI,G., SERVI,S., ZOR- (1994b), Chemo-enzymatic synthesis of precur-
ZELLA,A. (1988), Decarboxylative incorporation sors of fagomine and 1,4-dideoxy-1,4-imino-~-
of a-oxybutyrate and a-oxovalerate into (R)-a- arabitinol, Tetrahedron Lett. 35,8791-8794.
hydroxyethyl ketones and normal-propyl ketones HECQUET, L.,BoLTE,J.,DEMUYNCK, C. (1996),Enzy-
on reaction with aromatic and a#-unsaturated matic synthesis of “natural-labeled” 6-deoxy-~-
aldehydes in bakers’ yeast, J. Chem. Soc., Chem. sorbose precursor of an important food flavor,
Commun., 1619-1621. Tetrahedron 52,8223-8232.
GARCIA-JUNCEDA, E., SHEN,G.-J., SUGAI,T., WONG, HENDERSON, I., SHARPLESS, K. B., WONG,C.-H.
C.-H. (1995),A new strategy for the cloning, over- (1994a), Synthesis of carbohydrates via tandem
expression and one-step purification of 3 DHAP- use of the osmium-catalyzed asymmetric dihy-
dependant aldolases - rhamnulose 1-phosphate droxylation and enzyme-catalyzed aldol addition
aldolase, fuculose 1-phosphate aldolase and taga- reactions,J. Am. Chem. SOC. 116,558-561.
tose 1,6-diphosphate aldolase, Bioorg. Med. HENDERSON, I., LASLO,K., WONG,C.-H. (1994b),
Chem. 3,945-953. Chemoenzymatic synthesis of homoazasugars,
GHALAMBOR, M. A., HEATH,E. C. (1966), The Tetrahedron Lett. 35,359-362.
biosynthesis of cell wall lipopolysaccharide in HERBERT, R. B., WILKINSON, B., ELLAMES, G. J., Ku-
Escherichia coli. V.Purification and properties of NEC, E. K. (1993), Stereospecificlysis of a range of
3-deoxy-~-manno-octu~osonate aldolase, J. Biol. P-hydroxy-a-amino acids catalyzed by a novel al-
Chem. 241,3222-3227. dolase from Streptomyces amakusaensis,J. Chem.
GIJSEN, H. J. M., WONG,C.-H. (1994), Unprecedent- SOC.,Chem. Commun., 205-206.
ed asymmetric aldol reactions with three alde- HERBERT,R. B., WILKINSON, B., ELLAMES,G. J.
hyde substrates catalyzed by 2-deoxyribose-5- (1994), Preparation of (2R, 3s) P-hydroxy-a-ami-
phosphate aldolase, J. Am. Chem. SOC. 116, no acids by use of a novel Streptomyces aldolase
8422-8423. as a resolving agent for racemic material, Can. J.
GIJSEN,H. J. M., WONG,C.-H. (1995a), Synthesis of a Chem. 72,114-117.
cyclitol via a tandem enzymatic aldol - intra- HERIN,M., SANDRA, ,!I KRIEF,A. (1979), Stereospe-
molecular Homer-Wadsworth-Emmons reaction, cific enzyme cyclization of a synthetic 2,3-oxido-
Tetrahedron Lett. 36,7057-7060. squalene analog bearing an 182 carbon<arbon
GIJSEN,H. J. M., WONG,C.-H. (1995b), Sequential double bond, Tetrahedron Lett. 33,3103-3106.
one-pot aldol reactions catalyzed by 2-deoxyri- HOBBS,G. R., LILLY,M. D., TURNER, N. J., WARD,J.
bose-5-phosphate aldolase and fructose-1,6- M., WILLETS,A. J., WOODLEY, J. M. (1993), En-
diphosphate aldolase, J. Am. Chem. SOC. 117, zyme-catalyzed carbon-carbon bond formation:
2947-2948. use of transketolase from Escherichia coli, J.
GIJSEN,H. J. M., WONG,C.-H. (1995c), Sequential Chem. SOC.,Perkin Trans. I , 165-166.
three- and four-substrate aldol reactions cata- HOWMANN, N.(1996), Bakers’ yeast - a live reagent
lyzed by aldolases, J. Am. Chem. SOC. 117, for synthesis in organic chemistry, Chemie in Un-
7585-7591. serer Zeit 30,201-203.
GIJSEN,H. J. M., QIAO,L., FITZ,W., WONG,C.-H. HOLT,K. E., LEEPER,EJ., HANDA, S. (1994), Synthe-
(1996), Recent advances in the chemoenzymatic sis of P-1-homonorjirimycin and P-l-homoman-
synthesis of carbohydrates and carbohydrate mi- norjirimycin using the enzyme aldolase, J. Chem.
metics, Chem. Rev.%, 443-473. SOC.,Perkin Trans. I , 231-234.
GLANZER,B. I., FABER,K., GRIENGL,H. (1987), HUMPHREY, A. J.,TURNER, N. J., MCCAGUE, R.,TAY-
Enantioselective hydrolyses by bakers’ yeast. 3. LOR, S. J. C. (1995), Synthesis of enantiomerically
Microbial resolution of alkynyl esters using lyo- pure a-hydroxyaldehydes from the correspond-
philized yeast, Tetrahedron43,5791-5796. ing a-hydroxycarboxylic acids: novel substrates
GOAD,L. J. (1981), Sterol biosynthesis and metab- for Escherichia coli transketolase, J. Chem. Soc.,
olism in marine invertebrates, Pure Appl. Chem. Chem. Commun., 2475-2476.
53,837-852. HUNG,R. R., STRAUB,J. A., WHITESIDES, G. M.
HARING,D., SCHREIER, P., HERDERICH, M. (1997), (1991), a-Aminoaldehyde equivalents as sub-
Rationalizing the origin of solerone (5-0x0-4- strates for rabbit muscle aldolase - synthesis of
hexanolide): biomimetic synthesis and identifica- 1,4-dideoxy-~-arabitinol and 2(R),S(R)-bis(hy-
8 References 37
droxymethyl)-3(R),4(R)-dihydroxypyrrolidine, J. lute configuration of 4-methyljuvenile hormone I

Org. Chem. 56,3849-3855. (4-MEJH I) by a biogenetic approach - a combi-
ICHIHARA, A., OIKAWA, H. (1997), Biosynthesis of nation of enzymatic synthesis and biotransforma-
phytotoxins from Alternaria solani, Biosci. Bio- tion, J. Am. Chem. SOC.109,2853-2854.
tech. Biochem. 61,12-18. KRAGL,U., GYGAX, D., GHISALBA, O., WANDREY, C.
ITOH,T., TAKAGI, Y., FUJISAWA, T. (1989), A novel (1991), Enzymatic 2-step synthesis of N-acetyl-
carbon-carbon bond formation in the course of neuraminic acid in the enzyme membrane reac-
bakers’ yeast reduction of cyanoacetone, Tetrahe- tor,Angew. Chem. (Int. Edn. Engl.) 30,827-828.
dron Lett. 30,3811-3812. KREN,~., CROUT,D. H. G., DALTON, H., HUTCHINSON,
JONES,J. B. (1986), Enzymes in organic synthesis, D. W., KONIG,W. et al. (1993), Pyruvate decarbox-
Tetrahedron 42,3351-3403. ylase: a new enzyme for the production of acy-
JUNG,S.-H., JEONG,J.-H., MILLER, P., WONG,C.-H. loins by biotransformation, J. Chem. SOC., Chem.
(1994), An efficient multigram-scale preparation Commun., 341-343.
of dihydroxyacetone phosphate, J. Org. Chem. 59, KRIEF,A., SCHAUDER, J.-R., G U I ~ TE.,, HERVEDU
7182-7184. PENHOAT, C., LALLEMAND, J.-Y. (1987),About the
KAJIMOTO, T., CHEN,L., LIU,K. K.-C., WONG,C.-H. mechanism of sterol biosynthesis, J. Am. Chem.
(1991a), Palladium-mediated stereocontrolled re- SOC.109,791&7911.
ductive amination of azido sugars prepared from KRIEF,A.,PASAU, P., QuBRI~, L. (1991), Comparison
enzymatic aldol condensation - a general ap- of the behavior of oxidosqualene cyclases from
proach to the synthesis of deoxy azasugars,J.Am. pig liver and yeast to toward epoxysqualene ana-
Chem. SOC. 113,6678-6680. logs possessing a A18-19 Z or E C, C double
KAJIMOTO,T., LIU,K. K.-C., PEDERSON, R. L., ZHONG, bond, Bioorg. Med. Chem. Lett. 1,365-368.
Z., ICHIKAWA, Y. et al. (1991b), Enzyme-catalyzed LASCHAT, S. (1996), Pericyclic reactions in biological
aldol condensation for asymmetric synthesis of systems - does nature know about the Diels-Al-
azasugars -synthesis, evaluation, and modeling of der reaction? Angew. Chem. (Int. Edn. Engl.) 35,
glycosidase inhibitors, J. Am. Chem. SOC. 113, 289-291.
618741196. LEES,W. J., WHITESIDES, G. M. (1992),The enzymatic
KIM,M.-J., LIM,I. T. (1996), Synthesis of unsaturated synthesis of 1,5-dideoxy-l,5-diimino-D-talitol and
C8-C9 sugars by enzymatic chain elongation, 1-deoxygalactostatin using fuculose 1-phosphate
Synlett, 138-140. aldolase, Bioorg. Chem. 20,173-179.
KIM,M.-J., HENNEN, W. J., SWEERS, H. M., WONG,C.- LEES,W. J., WHITESIDES, G. M. (1993), Diastereose-
H. (1988), Enzymes in carbohydrate synthesis - lectivity (enantioselectivity) of aldol condensa-
N-acetylneuraminic acid aldolase catalyzed reactions catalyzed by rabbit muscle aldolase at C-2
tions and preparation of N-acetyl-2-deoxy-~-neu- of RCHOHCHO if R has an appropriately
raminic acid-derivatives,J. Am. Chem. SOC. 110, placed negatively charged group, J. Org. Chem.
6481-6486. 58,1887-1894.
KIM,M.-J., LIM,I.T., KIM,H.-J., WONG,C.-H. (1997), LIN,C.-H., SUGAI, T., HALCOMB, R. L., ICHIKAWA, Y.,
Enzymatic single aldol reactions of remote dial- WONG,C.-H. (1992), Unusual stereoselectivity in
dehydes, Tetrahedron:Asymmetry 8,1507-1509. sialic acid aldolase-catalyzed aldol condensations
KIMURA, T., VASSILEV, V. €?,SHEN,G.-J., WONG,C.-H. - synthesis of both enantiomers of high-carbon
(1997), Enzymatic synthesis of P-hydroxy-a- monosaccharides,J. Am. Chem. SOC. 114,lO138-
amino acids based on recombinant D- and L- 10145.
threonine aldolases, J. Am. Chem. SOC. 119, LIN,C.-C., LIN,C.-H.,WONG, C.-H. (1997), Sialic acid
11734-11742. aldolase-catalyzed condensation of pyruvate and
KITAZUME,T., ISHIKAWA, N. (1984), Induction of cen- N-substituted mannosamine: a useful method for
ter of chirality into fluoro compounds by micro- the synthesis of N-substituted sialic acids, Tetruhe-
bial transformation of 2,2,2-trifluoroethanol, dron Lett. 38,2649-2652.
Chem. Lett., 1815-1818. LINDQVIST, Y., SCHNEIDER, G., ERMLER, U., SUND-
KOBORI, Y., MYLES,D. C., WHITESIDES, G. M. (1992), STROM, M. (1992), 3-Dimensional structure of
Substrate specificity and carbohydrate synthesis transketolase, a thiamine diphosphate dependent
using transketolase, J. Org. Chem. 57,5899-5907. enzyme, at 2.5 A resolution, EMBO J. 11,
KOYAMA,T., MATSUBARA, M., OGURA, K. (1985), Iso- 2373-2379.
prenoid enzyme systems of silkworm. 11. Forma- LIU,K. K.-C., WONG,C.-H. (1992),A new strategy for
tion of the juvenile hormone skeletons by farne- the synthesis of nucleoside analogs based on en-
syl pyrophosphate synthetase 11, J. Biochem. Jpn. zyme-catalyzed aldol reactions, J. Org. Chem. 57,
98,457-463. 47894791.
KOYAMA,T., OGURA,K., BAKER, F. C., JAMIESON, G. LIU,K. K.-C., KAJIMOTO, T., CHEN,L., ZHONG,Z.,
C., SCHOOLEY, D. A. (1987), Synthesis and abso- ICHIKAWA, Y., WONG,C.-H. (1991), Use of dihy-
droxyacetone phosphate dependent aldolases in NICOTRA,F., PANZA,L., Russo, G., VERANI,A.

the synthesis of deoxyazasugars,J. Org. Chem. 56, (1993), Simple and stereoselective chemoenzy-
628M289. matic synthesis of an a-C-mannoside, Tetra-
LOBELL, M., CROUT, D. H. G. (1996),Pyruvate decar- hedron:Asymmetry 4,1203-1204.
boxylase: a molecular modeling study of pyruvate NIKOLOVA, P., WARD,0.P. (1994), Effect of support
decarboxylation and acyloin formation, J. Am. matrix on ratio of product to by-product forma-
Chem. SOC.118,1867-1873. tion in L-phenylacetyl carbinol synthesis, Biotech-
LOOK,G. C., FOTSCH,C. H., WONG,C.-H. (1993), nol. Lett. 16,7-10.
Enzyme-catalyzed organic synthesis - practical NISHIHARA, H., DEKKER, E. E. (1972), Purification,
routes to azasugars and their analogs for use as substrate specificity and binding, /3-decarboxyl-
glycoprocessing inhibitors, Acc. Chem. Res. 26, ase activity, and other properties of Escherichia
182-190. coli 2-keto-4-hydroxyglutaratealdolase, J. Biol.
LOTZ,B. T., GASPARSKI, C. M., PETERSON, K., MIL- Chem. 247,5079-5087.
LER,M. J. (1990), Substrate specificity studies of OGURA,K., KOYAMA, T. (1981), Applications of en-
aldolase enzymes for use in organic synthesis, zymes to organic synthesis - on the enzymatic re-
J. Chem. SOC.,Chem. Cornrnun., 1107-1109. actions of C-C bond formation, J. Synth. Org.
MATSUMOTO, K., SHIMAGAKI, M., NAKATA,T., OISHI, Chem. Jpn. 39,459-466.
T. (1993), Synthesis of acyclic polyol derivatives OIKAWA, H., KATAYAMA, K., SUZUKI,~., ICHIHARA,A.
via enzyme-mediated aldol reaction, Tetrahedron (1999, Enzymatic activity catalyzing exo-selective
Lett. 34,4935-4938. Diels-Alder reaction in solanapyrone biosynthe-
MEDINA,J. C., KYLER,K. S. (1988), Enzymatic cy- sis,J. Chem. SOC.,Chem. Commun., 1321-1322.
clization of hydroxylated surrogate squalenoids OIKAWA, H., YAGI,K., WATANABE, K., HONMA, M.,
with bakers' yeast, J. Am. Chem. SOC. 110, ICHIHARA, A. (1997), Biosynthesis of macro-
48184821. phomic: plausible involvement of intermolecular
MEDINA, J. C., GUAJARDO, R., KYLER,K. S. (1989), Diels-Alder reaction, J. Chem. SOC.,Chem. Com-
Vinyl group rearrangement in the enzymatic cy- mun., 97-98.
clization of squalenoids - synthesis of 30-oxyster- OLIVER,A. L., RODDICK, F. A., ANDERSON, B. N.
ols,J. Am. Chem. SOC.111,231~2311. (1997), Cleaner production of phenylacetyl carbi-
MOCALI,A., ALDINUCCI, D., PAOLETTI, F. (1985), no1 by yeast through productivity improvements
Preparative enzymic synthesis and isolation of and waste minimization, Pure Appl. Chem. 69,
~-threo-2-pentulose5-phosphate (D-XylUlOSe 5- 2371-2385.
phosphate), Carbohydr. Res. 143,288-293. PEDERSON, R. L., KIM,M.-J., WONG,C.-H. (1988), A
MORADIAN, A., BENNER, S. A. (1992), A biomimetic combined chemical and enzymatic procedure for
biotechnological process for converting starch to the synthesis of 1-deoxynojirimycinand l-deoxy-
fructose - thermodynamic and evolutionary con- mannojirimycin, Tetrahedron Lett. 29,4645-4648.
siderations in applied enzymology,J. Am. Chem. PEDERSON, R. L., LIU,K. K.-C., RUTAN, J. F., CHEN,L.,
SOC.114,6980-6987. WONG,C.-H. (1990), Enzymes in organic synthe-
MORfS-VARAS, F., QIAN,X. N., WONG, C.-H. (1996), sis - synthesis of highly enantiomerically pure
Enzymatickhemical synthesis and biological 1,2-epoxy aldehydes, epoxy alcohols, thiirane,
evaluation of 7-membered iminocyclitols,J. Am. aziridine, and glyceraldehyde-3-phosphate, J.
Chem. SOC.118,7647-7652. Org. Chem. 55,4897-4901.
MORRIS, K. G., SMITH, M. E. B., TURNER, N. J., LILLY, PROSEN, E., WARD,0. P. (1994), Optimization of re-
M. D., MITRA,R. K., WOODLEY, J. M. (1996), action conditions for production of S-(-)-2-hy-
Transketolase from Escherichia coli: a practical droxypropiophenone by Acinetobacter calcoacet-
procedure for using the biocatalyst for asymmet- icus, J. Ind. Microbiol. 13,287-291.
ric carbon-carbon bond synthesis, Tetrahedron: RACKER, E. (1961a), Cleavage and synthesis of car-
Asymmetry 7,2185-2188. bon to carbon bonds, in: The Enzymes (BOYER, P.
MYLES,D. C., ANDRULIS 111, P. J., WHITESIDES, G. D., LARDY, H., MYRBACK, K., Eds.), pp. 305-317.
M. (1991), A transketolase-based synthesis of New York: Academic Press.
(+)-exo-brevicomin, Tetrahedron Lett. 32, RACKER, E. (196lb),Transketolase, in: The Enzymes
4835-4838. (BOER, P. D., LARDY,H., MYRBACK, K., Eds.),
NAGASAWA, T., YAMADA, H. (1986), Enzymatic trans- pp. 407-412. New York: Academic Press.
formations of 3-chloroalanine into useful amino- RACKER, E. (1961c),Transaldolase,in: The Enzymes
acids,Appl. Biochem. Biotechnol. 13,147-165. (BOYER,P. D., LARDY,H., MYRBACK, K., Eds.),
NAGY,J. O., BEDNARSKI, M. D. (1991),The chemical- pp. 397406. New York: Academic Press.
enzymatic synthesis of a carbon glycoside of RAMARAO,A., SRINIVASAN, T. N., BHANUMATHI, N.
N-acetylneuraminic acid, Tetrahedron Lett. 32, (1990), A stereoselective biocatalytic Diels-Al-
3953-3956. der reaction, Tetrahedron Lett. 31,5959-5960.
8 References 39
ROSE,A. H. (1961), Industrial Microbiology. Lon- SPALTENSTEIN, A., WHITESIDES, G. M. (1991), Poly-
don: Butterworths. acrylamides bearing pendant a-sialoside groups
Rosso, R. G., ADAMS,E. (1967), 4-Hydroxy-2-keto- strongly inhibit agglutination of erythrocytes by
glutarate aldolase of rat liver - purification, bind- influenza virus,J. Am. Chem. SOC. 113,68&687.
ing of substrates and kinetic properties, J. Biol. SPEVAK, W., NAGY,J. O., CHARYCH, D. H., SCHAEFER,
Chem. 242,5524-5534. M. E., GILBERT, J. H., BEDNARSKI, M. D. (1993),
SAEED,A.,YOUNG,D. W. (1992), Synthesisof L-p-hy- Polymerized liposomes containing C-glycosides
droxyaminoacids using serine hydroxymethyl- of sialic acid -potent inhibitors of influenza virus
transferase, Tetrahedron 48,2507-2514. in vitro infectivity, J. Am. Chem. SOC. 115,
SANTANIELLO, E., FERRABOSCHI, P., GRISENTI,P., 1146-1147.
MANZOCCHI, A. (1992),~he biocatalytic approach SRERE,P., COOPER,J. R., TABACHNICK, M., RACKER,
to the preparation of enantiomerically pure chiral E. (1958), Oxidative pentose phosphate cycle.
building blocks, Chem. Rev. 92,1071-1140. I. Preparation of substrates and enzymes, Arch.
SCHMID, W., WHITESIDES, G. M. (1990), A new ap- Biochem. Biophys. 74,295-305.
proach to cyclitols based on rabbit muscle aldol- STRAUB, A., EFFENBERGER, F., FISCHER,P. (1990),
ase (RAMA), J. Am. Chem. SOC.112,9670-9671. Enzyme-catalyzed reactions. 4. Aldolase-cata-
SCHNEIDER, G., SUNDSTROM, M., LIDQVIST, Y. (1989), lyzed C-C bond formation for stereoselective
Preliminary crystallographic data for transketo- synthesis of nitrogen-containing carbohydrates,
lase from yeast, J. Biol. Chem. 264,21619-21 620. J. Org. Chem. 55,3926-3932.
SCHOLTZ, J. M., SCHUSTER, S. M. (1984),Substrates of STUMPF,B., KIESLICH, K. (1991), Acyloin condensa-
hydroxyketoglutarate aldolase, Bioorg. Chem. 12, tion of acyclic unsaturated aldehydes by Mucor
229-234. species,Appl. Microbiol. Biotechnol. 34,598-603.
SCHULTZ, M., WALDMANN, H., VOGT,W., KUNZ,H. SUGAI,T., SHEN,G.-J., ICHIKAWA, Y., WONG,C.-H.
(1990), Stereospecific C-C bond formation with (1993), Synthesis of 3-deoxy-D-manno-2-octulo-
rabbit muscle aldolase - a chemoenzymatic syn- sonic acid (KDO) and its analogs based on KDO
thesis of (+)-exo-brevicomin, Tetrahedron Lett. aldolase-catalyzed reactions, J. Am. Chem. SOC.
31,867-868. 115,413421.
SERVI,S. (1985), 2,2,5-Trimethyl-1,3-dioxolane-4-TAKAOKA, Y., KAJIMOTO,T., WONG,C.-H. (1993),
carbaldehyde as a chiral synthon: synthesis of the Inhibition of N-acetylglucosaminyltransfer en-
two enantiomers of methyl 2,3,6-trideoxy-a-~- zymes - chemical-enzymatic synthesis of new 5-
threo-hex-2-enopyranoside,key intermediate in membered acetamido azasugars,J. Org. Chem. 58,
the synthesis of daunosamine. and of (+)- and 48094312.
(-)-rhodinose, J. Org. Chem. 50,5865-5867. TAKAYAMA, S., MCGARVEY,G. J., WONG,C.-H.
SERVI,S. (1990), Bakers’ yeast as a reagent in organ- (1997a), Microbial aldolases and transketolases:
ic synthesis,Synthesis, 1-25. new biocatalytic approaches to simple and com-
SHIBATA, K., SHINGU,K., VASSILEV, V. P., NISHIDE, plex sugars,Ann. Rev. Microbiol. 51,285-310.
K., FUJITA,T. et al. (1996), Kinetic and thermo- TAKAYAMA, S., MCGARVEY,G. J., WONG,C.-H.
dynamic control of L-threonine aldolase cata- (1997b), Enzymes in organic synthesis:recent de-
lyzed reaction and its application to the synthesis velopments in aldol reactions and glycosylations,
of mycestericin D, Tetrahedron Lett. 37, Chem. SOC.Rev. 26,407-415.
2791-2794. TURNER, N. J. (1989), Recent advances in the use of
SHIMAGAKI, M., MUNESHIMA,H., KUBOTA, M., OISHI, enzyme-catalyzed reactions in organic synthesis,
T. (1993), Chemoenzymatic carbon+arbon bond Nat. Prod. Rep. 6,625-644.
formation leading to noncarbohydrate derivative TURNER, N. J. (1994), Recent advances in the use of
- stereoselective synthesis of pentamycin C-ll- enzyme-catalyzed reactions in organic synthesis,
C-16 fragment, Chem. Pharm. Bull. 41,282-286. Nut. Prod. Rep. 11,l-15.
SHIMAZU, Y. (1950), Formation and decomposition TURNER, N. J., WHITESIDES, G. M. (1989), A com-
of D-( -)-phenylacetylcarbinol by yeast, J. Chem. bined chemical-enzymatic synthesis of 2-deoxy-
SOC.Jpn. 71,503-505 (Chem.Abstr. 45,9004). D-arabino-heptulosonic acid 7-phosphate, J. Am.
SHIN,H. S., ROGERS, P. L. (1995), Biotransformation Chem. SOC.111,624-627.
of benzaldehyde to L-phenylacetyl carbinol, an UCHIDA, Y., TSUKADA, Y., SUGIMORI, T. (1984), Pur-
intermediate in L-ephedrine production, by im- ification and properties of N-acetylneuraminate
mobilized Candida utilis, Appl. Microbiol. Bio- lyase from Escherichia coli, J. Biochem. 96,
technol. 44,7-14. 507-522.
SHIN,H. S., ROGERS,P. L. (1996), Production of L- UCHIDA,Y.,TSUKADA,Y., SUGIMORI,T. (1985),Distri-
phenylacetylcarbinol (L-PAC) from benzalde- bution of N-acetylneuraminic lyase in bacteria
hyde using partially purified pyruvate decarbox- and its production by Escherichia coli,Agric. Biol.
ylase (PDC), Biotechnol. Bioeng. 49,5242. Chem. 49,181-187.
VON DER OSTEN,C. H., SINSKEY,A. J., BARBAS, C. F., WONG,C.-H.,WHITESIDES, G. M. (1994), Enzymes in
PEDERSON, R. L., WANG,Y.-F., WONG,C.-H. Organic Chemistry, Tetrahedron Organic Series
(1989), Use of a recombinant bacterial fructose- 12, pp. 195-251. Oxford: Pergamon Press.
1,6-diphosphate aldolase in aldol reactions - WONG,C.-H., SHENG, G. J., PEDERSON, R. L., WANG, Y.
preparative syntheses of 1-deoxynojirimycin, 1- F., HE”EN, W. J. (1991), Enzymatic catalysisin or-
deoxymannojirimycin, 1,4-dideoxy-l,4-imino-~- ganic synthesis, Methods Enzymol. 202,591620.
arabinitol, and fagomine, J. Am. Chem. SOC. 111, WONG,C.-H., HALCOMB, R. L., ICHIKAWA, Y., KAJI-
3924-3927. MOTO, T. (1995a), Enzymes in organic synthesis:
VASSILEV, V. P., UCHIYAMA, T., KAJIMOTO, T., WONG, application to the problems of carbohydrate rec-
C.-H. (1995a), L-Threonine aldolase in organic ognition (part l), Angew. Chem. (Int. Edn. Engl.)
synthesis:preparation of novel P-hydroxy-a-ami- 34,412432.
no acids, Tetrahedron Lett. 36,40814084. WONG, C.-H., GARCIA-JUNCEDA,E., CHEN, L., BLAN-
VASSILEV, V. P., UCHIYAMA, T., KAJIMOTO, T., WONG, co, O., GIJSEN,H. J. M., STEENSMA, D. H. (1995b),
C.-H. (1995b),An efficient chemo-enzymaticsyn- Recombinant 2-deoxyribose-5-phosphate aldo-
thesis of a-amino-P-hydroxy-ybutyrolactones, lase in organic synthesis: use of sequential two-
Tetrahedron Lett. 36,5063-5064. substrate and three-substrate aldol reactions,
WALDMANN, H. (1999, Enzymatic carbon-carbon J. Am. Chem. SOC.117,3333-3339.
bond formation, in: Organic Synthesis Highlights XIAO, X.-Y., PRESTWICH, G. D. (1991), Enzymatic
I1 (WALDMANN, H., Ed.), pp. 147-155. Weinheim: cyclizations of 26-hydroxy-2,3-oxidosqualenes
VCH. and 29-hydroxy-2,3-oxidosqualenes give 19-hy-
WARD,0. P. (1995), Application of bakers’ yeast in droxylanosterols and 21-hydroxylanosterols, Te-
bioorganic synthesis,Can.J. Bot. 73, S1043-Sl048. trahedron Lett. 32,68434846.
WILCOCKS, R., WARD,0.P. (1992), Factors affecting ZHOU,P., SALLEH, H. M., HONEK,J. F. (1993), Facile
2-hydroxypropiophenone formation by benzyl- chemoenzymaticsynthesis of 3-(hydroxymethy1)-
formate decarboxylase from Pseudomonas puti- 6-epicastanospermine,J. Org. Chem. 58,264-266.
da, Biotechnol. Bioeng. 39,1058-1063. ZIEGLER, T., STRAUB, A., EFFENBERGER, F. (1988),
WILCOCKS, R., WARD,0.P., COLLINS, S., DEWDNEY,N. Enzyme-catalyzed reactions. 3. Enzyme-cata-
J., HONG,Y. P., PROSEN, E. (1992), Acyloin forma- lyzed synthesis of 1-deoxymannonorjirimycin,
tion by benzylformate decarboxylase from Pseu- 1-deoxynorjirimycin and 1,4-dideoxy-1,4-imino-
domonas putida, Appl. Environ. Microbiol. 58, D-arabinitol, Angew. Chem. (Int. Edn. Engl.) 27,
1699-1704. 716-717.
2 Lyases
JASSEMG. MAHDI
DAVIDR.KELLY
Cardiff,Wales, UK
1 Introduction 43
2 Conventions 43
3 Enzyme Commission Classification 43
4 Examples of Lyases 47
4.1 Carbon-Carbon Lyases 47
4.1.1 Carboxy-Lyases 47
4.1.1.1 Pyruvate Decarboxylase 49
4.1.1.2 Oxalate Decarboxylase 55
4.1.1.3 Oxaloacetate Decarboxylase 55
4.1.1.4 Acetoacetate Decarboxylase 58
4.1.1.5 Acetolactate Decarboxylase 62
4.1.1.6 Aconitate Decarboxylase 64
4.1.1.7 Benzoylformate Decarboxylase 65
4.1.1.8 Oxalyl-CoA Decarboxylase 67
4.1.1.9 Malonyl-CoA Decarboxylase and Related Malonate Decarboxylating
Enzymes 68
4.1.1.10 Aspartate a-Decarboxylase 72
4.1.1.11 Aspartate 4-Decarboxylase 74
4.1.1.12 Valine Decarboxylase 76
4.1.1.13 Glutamate Decarboxylase 76
4.1.1.14 Ornithine Decarboxylase 78
4.1.1.15 Lysine Decarboxylase 79
4.1.1.16 Arginine Decarboxylase 80
4.1.1.17 Diaminopimelate Decarboxylase 80
4.1.1.18 Histidine Decarboxylase 81
4.1.1.19 Orotidine-5 ‘-Phosphate Decarboxylase 82
4.1.1.20 Tyrosine Decarboxylase 82
4.1.1.21 Aromatic L-Amino Acid Decarboxylase 83
4.1.1.22 Phosphoenolpyruvate Carboxylases and Carboxykinases 84
4.1.1.23 Phenylpyruvate Decarboxylase 85
42 2 Lyases
4.1.1.24 Tartronate Semi-Aldehyde Synthase 85

4.1.1.25 Dialkylglycine Decarboxylase 86
4.1.1.26 Indolepyruvate Decarboxylase 87
4.1.2 Aldehyde-Lyases 89
4.1.2.1 Threonine Aldolase 89
4.1.2.2 Mandelonitrile Lyase and Hydroxymandelonitrile Lyase 90
4.1.3 Oxo-Acid-Lyases 90
4.1.3.1 Isocitrate Lyase 90
4.1.3.2 Acetolactate Synthase 91
4.1.4 Other Carbon-Carbon Lyases 91
4.1.4.1 Tryptophanase 91
4.1.4.2 L-Tyrosine Phenol-Lyase 94
4.2 Carbon-Oxygen Lyases 98
4.2.1 Hydro-Lyases 98
4.2.1.1 Carbonic Anhydrase 99
4.2.1.2 Fumarase 100
4.2.1.3 Aconitase 109
4.2.1.4 a,P-Dihydroxy-Acid Dehydratase 111
4.2.1.5 3-Dehydroquinate Dehydratase 111
4.2.1.6 Enolase 112
4.2.1.7 L-Serine Dehydratase, D-Serine Dehydratase and L-Threonine
Dehydratase 113
4.2.1.8 Imidazoleglycerol Phosphate Dehydratase 114
4.2.1.9 Maleate Hydratase 114
4.3 Carbohydrate Lyases 115
4.3.1 Carbohydrate Hydro-Lyases 115
4.3.1.1 Monosaccharide Carboxylic Acid Dehydratases 115
4.3.1.2 3,6-Dideoxysugars 117
4.3.2 Lyases which Act on Polysaccharides 122
4.3.2.1 Pectin and Pectate Lyases 122
4.3.2.2 Pectate Lyases 124
4.3.2.3 Pectin Lyases 125
4.4 Carbon-Nitrogen Lyases 125
4.4.1 Ammonia Lyases 125
4.4.1.1 Aspartase 126
4.4.1.2 /3-Methylaspartase 129
4.4.1.3 Histidase 132
4.4.1.4 Phenylalanine Ammonia-Lyase 137
4.5 Other Carbon-Nitrogen Lyases 142
4.6 Carbon-Halide Lyases 142
4.7 Other Lyases 143
4.7.1 Alkyl Mercury-Lyase 143
5 References 143
1 Introduction not shown explicitly. The conventions for re-

ferring to figures, references and compounds
used throughout this, and the previous volume,
Lyases are defined as enzymes cleaving C-C, are adhered to in this chapter. However, if
C-0, C-N and other bonds by other means these are marked “cf.” the attribution refers to
than by hydrolysis or oxidation (Anonymous, a similar, related or parallel process, rather
1984,1992). In most cases the products are un- than that directly under discussion at the time.
saturated molecule (frequently an alkene) Tab. 1summarizes the principal classes of lyas-
plus an X-H species.The lyases are a disparate es.
group of enzymes, catalysing a wide range of
processes with few features in common, be-
yond their assignment to the same enzyme
commission group. Lyases utilize an extraordi-
nary range of prosthetic groups which include 3 Enzyme Commission
thiamine pyrophosphate (JORDAN, 1999;
LINDQVIST and SCHNEIDER, 1993), iron sulfur
Classification
clusters (FLINTand ALLEN,1996), NAD(P)
(H), pyridoxal5 ’-phosphate (JANSONIUS, 1998; Lyases are enzymes that cleave C-C, C-0,
JOHN,1995; HAYASHI,1995; ALEXANDER et C-N and other bonds by elimination to form
al., 1994), biotin (TOHet al., 1993) and back- multiple bonds or rings. In many cases this in-
bone dehydroalanine (GULZARet al., 1997), volves cleavage of C-X and C-H bonds on ad-
or 4-methylidene-imidazole-5-oneresidues jacent carbon atoms by an E l or E2 mecha-
(SCHWEDE et al., 1999). nism. Reactions which involve hydrolysis (but
They have been rarely (if ever) reviewed to- not hydration) or oxidation (e.g., desaturases)
gether and indeed one major biotransforma- are excluded. Lyases are assigned to Enzyme
tions text does not even mention them as a sin- Commission class 4. The subclass (1-6 and 99)
gle group in the index (DRAUZand WALD- is assigned according to the bond broken and
MA“, 1995).The fundamental biochemistry of the subsubclass according to the group elimi-
lyases (including protein crystallography) is a nated. As usual for enzyme commission codes,
subject of frenetic activity at present. Several the subsubsub class is a unique designator for
lyases are used in industrial processes, such as each enzyme. For example phenylalanine am-
the production of amino acids, however, labor- monia-lyase is assigned to EC 4.3.1.5. This in-
atory applications are very rare. It is hoped dicates a carbon-nitrogen lyase (EC 4.3),
that this review will bring this subject to a wid- which eliminates ammonia from the substrate
er audience and promote exploitation of these (EC 4.3.1).
fascinating enzymes. The systematic names for lyases are con-
structed according to the pattern substrate
group-lyase, e.g., phenylalanine ammonia-
lyase. The hyphen is an important component
2 Conventions of the systematic name because it distinguishes
this class of enzymes from others with similar
names, e.g., hydro-lyases and hydrolases. How-
Each lyase is discussed in a separate section, ever, this rule is relaxed for recommended
according to Enzyme Commission class num- names, e.g., aldolase, decarboxylase and dehy-
bers. Each section is presented in the se- dratase.
quence: definition of the biotransformation, In some cases elimination is followed imme-
background, enzymology and enzyme struc- diately by addition and hence overall the reac-
ture studies, stereochemistry, synthetic appli- tion is apparently a substitution. If there is ev-
cations, technological aspects. The last of these idence of an unsaturated intermediate the en-
subsections covers large scale reactions and zyme is nevertheless classified as a lyase.
methodology leading to manufacturing pro- The intramolecular lyases are a small group
cesses. In shorter sections these headings are of enzymes which are classified as isomerases
44 2 Lyases
Tab. 1. Representative Examples of Lyase Catalyzed Reactions

~~~
EC Code Reaction
Systematic Names
4.1 Carbonxarbon lyases

4.1.1 Carboxy-lyases 0
Pyruvate decarboxylase
0 0
1 Pyruvate COZ 2 Acetaldehyde
"
26 Oxalate COZ 27 Formate
0 Oxaloacetate 0
decarboxylase
EC4.1.1.3
0 0 0
28 Oxaloacetate COZ 1 Pyruvate
41 Acetoacetate
?@ decarboxylase
40 Acetoacetate 39 Acetone
0 0 Acetolactate 0
EC 4.1.1.5 HO
COZ
.65 (3-Acetolactate 5 (R)-Acetoin
78 Benzylformate 4 Benzaldehyde
Histidine
decarboxylase
NH, EC 4.1.1.22
N
_. N
H H
137 L-Histidine 138 Histamine
Tab. 1 (continued)
EC Code Reaction
Systematic Names
4.1.2 Aldehyde-lyases Orotidine 5'-phosphate

decarboxylase
139 R =coy *T , 140
EC 4.1.1.23
COZ
$
HO OH
,%
141 142
a R = H; L-Tyrosine a R = H; Tyramine
b R = OH; L-DOPA b R = OH; Dopamine
acid decarboxylase
N
H H
143 144
a R = H; L-Tryptophan a R = H; Tryptamine
b R = OH; 5-Hyhxy-L-tryptophan b R = OH; Serotonin
4.1.3 0x0-acid-lyases 0
A
H H$ACOY
166 L-Thonine
co2 2 Acetaldehyde 158 Glycine
4.1.4 Other carbonsarbon 0

lyases
HA COP
lsocitrate lyase 151 Glyoxylate

+
EC4.1.3.1
168 Isocitrate
198 Succinate
46 2 Lyases
Tab. 1 (continued)
EC Code Reaction
Systematic Names
4.2 Carbon-oxygen lyases

4.2.1 Hydrolyases Carbonic anhydrase
t HCOP
COZ
EC 4.2.1.1
H20
196 Fumarate 197 L-(S)-(-)-Malate
3-Dehydroquinate
dehydratase
EC4.2.1.10
0 0
-
OH OH
257 3-Dehydrcquinate 258 3-Dehydroshikimate
-
-
I
4.2.2 Acting on
polysaccharides
I
O C0,R Pectin and pectate lyases Ro

OH
RO
RO RO
321
- 323 ";"
Tab. 1 (continued)
EC Code Reaction
Systematic Names
4.3 Carbon-nitrogen lvases

4.3.1 Ammonia lyases
Aspartase
EC 4.3.1.1
196 Fumarate NH,O 101 L-(3-(+)-Aspartate
P-Methylaspartase
* Ooz& s co:
EC 4.3.1.2
NH,@
335 Mesaconate 336 L-threo-(21i,33)-3-Methylaspartate
137 L-Histidine 368 Urocanate
Phenylalanine 0
ammonia7 ~ r c 0 2
EC 4.3.1.5
NH,O
388 L-Phenylalanine 389 tram-Cinnamate
(EC 5). They catalyze reactions in which a

grow is eliminated from one Dart of a mole-
4 Examples of Lyases
cule 'to leave a multiple bond \;bile remaining
covalently attached to the molecule. 4.1 Carbon-Carbon Lyases
A remarkable number of lyases are involved (EC 4.1)
in central metabolism in the citric acid (Krebs
cycle), glycolysis and neoglucogenesis. These Many of the enzymes under this heading are
are summarized in Fig. l. covered in Chapter 1, this volume: Car-
bon-Carbon Bond Formation Using Enzymes.
4.1.1 Carboxy-Lyases (EC 4.1.1.X)

This subsubclass contains enzymes which
catalyze decarboxylation (IDINGet al., 1998;
CROUTet al., 1994). Most carboxy-lyases uti-
lize thiamine pyrophosphate (JORDAN,1999;
LINDQUIST and SCHNEIDER, 1993), pyridoxal
phosphate or biotin (TOHet al., 1993) as cofac-
tors.
48 2 Lyases
decarboxylase
1 Pyruvate 0 2 Acetaldehyde
C ~ A S HNAD@
,
74 Itaconate
Oxaloacetate
COZ
decarboxylase decarboxylase
56 Acetyl-CoA Citrate
Citrate SpthaSe Aconitase
EgDH'v
7
NADH
28 Oxaloacetate (33)
Malate
dehydrogenase
73 cis-Aconitate
Aconitase
Y\ H20
0
02
& -
:c 197 L-(S)- Malate (199,
200,205, u)6,210,214,
215,217,222,231,243)
0 151 Glyoxylate
H 168 Isocitrate (249)
Isocitrate Isocitrate
Fumarase dehydrogenase
NADH
"O~C\/K
H2O
0 a-Ketoglutarate c$
Ooz+COz 196 Fumarate
(213,218,221)
dehydrogenase
Succinyl CoA
synthetase NADH, Ho
0 Succinyl CoA
198 Succinate (169)
GTP GDP
Fig. 1. Lyases in the citric acid (Krebs) cycle and related biosynthetic sequences. Bold numbers in brackets
refer to labeled analogs.
4.1.1.1 Pyruvate Decarboxylase

(EC 4.1.1.1)
0 1Pyruvate
Introduction
Pyruvate decarboxylase catalyzes the decar-
boxylation of pyruvate (1)to acetaldehyde (2) Bakers' yeast
and acyloin type condensation reactions (Fig. (pyruvate
2) (OBAand URITANI, 1982).Synthetic applica- co2 decarboxylase)
tions of pyruvate decarboxylase (PDC) are de-
P
scribed in Chapter 1 of this volume and have
Of]
been reviewed recently elsewhere (SCHORKEN
and SPRENGER, 1998; FESSNER,1998; FESSNER
0
and WALTER,1997).This section will describe
mechanistic aspects and biotechnological ap-
plications. PDC is widely distributed in plants
and fungi, but is rare in prokaryotes and ab- 2 3
sent in animals (CANDYand DUGGLEBY, 1998;
VAN WAARDE, 1991).The major metabolic role
of PDC is as a component of the anaerobic Bakers' yeast
pathway from pyruvate to ethanol. Pyruvate (pymvate
(1, Fig. 2) undergoes decarboxylation to give decarboxy lase)
acetaldehyde (2) which is reduced by alcohol
dehydrogenase to ethanol. The NAD+ pro-
w
duced by the reductive step is then utilized in
cellular metabolism (PRONKet al., 1996). This
pathway is of course the basis of the brewing 0
industry and much effort has been made to en- 0
hance its productivity for both beverage pro-
duction and for ethanol for fuel (INGRAM et 5 circa 50%ee 6 99%ee
al., 1999; DENGand COLEMAN, 1999; SCOPES,
1997). The operation of this pathway is essen-
tial for the survival of crop plants which are
subjected to flooding, such as rice (TADEGEet
al., 1999; Su and LIN,1996; SACHSet al., 1996; Steps
PESCHKE and SACHS,1993).
Mechanism and Enzyme Structure

Pyruvate decarboxylase is of considerable
synthetic importance because the acetalde-
hyde a-anion equivalent (3) can be intercept-
ed by exogenous aldehydes to give acyloins
(e.g., 5 , 6 ) . Surprisingly,the reaction with acet-
aldehyde (2), reproducibly gives 3-hydroxy- ' 7 L-Ephedrine
butanon-2-one (acetoin) with a low enantio-
meric excess. Whole yeast and the purified Fig. 2. Pyruvate decarboxylase mediated decarboxy-
lation and acyloin condensation.
PDC from yeast both give (R)-3-hydroxybuta-
non-2-one (5) of about 50% enantiomeric ex-
cess, whereas Zymomonas mobilis PDC gives to racemic 3-hydroxybutanon-2-one, whereas
the opposite enantiomer, but with essentially in the presence of exogenous acetaldehyde,
the same enantiomeric excess (BORNEMANN et the (S)-enantiomer is produced with a low
al., 1993).Wheat germ PDC converts pyruvate enantiomeric excess (CROUTet al., 1986).
50 2 Lyases
None of these reactions are of appreciable a glutamate side chain (KILLENBERG-JABS et

practical value, however, interception by ben- al., 1997). The thiazolium ring, the aminopy-
zaldehyde (4) is highly stereoselective and the rimidine ring and the intervening methylene
(R)-phenylacetyl carbinol ( 5 ) so formed has group adopt an unusual V conformation which
been used in the manufacture of L-ephedrine brings C-2 of the thiazolium ring and the ami-
(7) since 1932 (Knoll process; SHUKLAand no substituent into close proximity. This ar-
KULKARNI 1999; NIKOLOVA and WARD,1991). rangement increases the rate of deprotonation
Similarly high enantiomeric excesses have by at least a factor of lo4, relative to that ob-
been achieved with other aromatic and hetero- served in solution. The ylide (9) (SCHELLEN-
aromatic aldehydes using both yeast PDC BERGER, 1998) undergoes nucleophilic addi-
(KRENet al., 1993, CROUTet al., 1991b; CAR- tion to the ketone group of pyruvate (1) to
DILLO et al., 1991) and Zymomonas mobilis give the zwitterion (lo), which evolves carbon
PDC (BORNEMANN et al., 1996).Moreover, ali- dioxide. The product (11) acts as an ena-
phatic aldehydes (Cz-Clz) are also good sub- minehinyl sulfide rather than an enol and
strates (MONTGOMERY et al., 1992). hence undergoes either protonation (12)or al-
The active site of PDC contains thiamine kylation (13) adjacent to the oxygen to give an
pyrophosphate (TPP, 8, Fig. 3), which is also imminium salt. Cleavage of the C-2 thiazolium
known as thiamin diphosphate (ThDP). Re- bond and restitution of the carbonyl group
cent advances in the study of TPP linked en- yields either acetaldehyde (2) or the acyloin
zymes are reported in a collection of articles in product (6).The stereochemistry of the inter-
volume 1385 of Biochimica et Biophysica Acta mediates has been inferred from molecular
(Various, 1998). TPP (8) mediates both decar- modeling studies (LOBELL and CROUT,1996b).
boxylation and the acyloin condensation A complete catalytic decarboxylation cycle re-
(SPRENGER and POHL,1999; SCHORKEN and quires the consumption of one proton, which is
SPRENGER, 1998). Magnesium ions or calcium appended to C-1 of acetaldehyde. Single turn-
ions are required for activity, as part of the py- over experiments with [2-3H]-TPP, demon-
rophosphate binding site (VACCAROet al., strate that 43% of the tritium label (*H, Fig. 5)
1995). Fundamental chemical aspects of the is incorporated into [l-3H]-acetaldehyde and
mechanism are well understood and have been 54% into [3H]-water (HARRISand WASHA-
engineered into abiotic chemical models (IM- BAUGH,1995a, b). It is beyond doubt that the
PERIALI et al., 1999;KNIGHT and LEEPER,1998; ylide (9) exists at the active site at some stage,
cf. KLUGERet al., 1995) and catalytic antibod- however, it has not been detected by 13C-NMR
ies (TANAKA et al., 1999). PDC catalyzes the (SCHELLENBERGER, 1998; LI and JORDAN,
rate of decarboxylation of pyruvate by a factor 1999). It is, therefore, reasonable to speculate,
of about 10’’ above the spontaneous rate, that protonation of the ylide is part of a relay
which is equivalent to transition state stabiliza- which brings the “consumed proton” into the
tion of some 70 kJ mol-’ (HUHTAet al., 1992). active site and that ylide formation is linked
TPP (8) is bound tightly, but non-covalently with binding of pyruvate as substrate or allos-
to PDC (Fig. 4) and is converted to the ylide terically. Further aspects of Fig. 5 are discussed
(9) by intramolecular deprotonation (HUBNER below.
et a1 1998) of C-2 of the thiazolium ring, by the S. cerevisiae, PDC consists of the products of
amino group of the aminopyrimidine substitu- the genes PDCl, PDCS and PDC6. The pre-
ent (KERNet al., 1997;FRIEDEMANN and NEEF, dominant isozyme monomer is the gene prod-
1998),which is involved in a proton relay, with uct of PDCl, which is 80% identical with the
Fig. 3. The structure of thiamine pyro-

phosphate, R’and R2are abbreviations
8 Thiamine pyrophosphate (TPP) used in the following two figures.
H 8 TPP bound to yeast

pyruvate decarboxylase
I
\ lPyruvate
R l H q R 2 ]
4
&
HO 0 HO
11-1 11-II 11-111
Fig. 4. “Minimal mechanism” for the pyruvate decarboxylase (PDC) catalyzed decarboxylation of pyruvate.
Stereochemical assignments are based on the molecular modeling studies of LOBELLand CROUT(1996b)
(cf. Fig. 3, for R’and R’).
PDCS gene product. Normally these mon- PDCl is unaffected, hence under thiamine
omers associate into mixed tetramers (a4, limiting conditions both are expressed (MULL-
a&, a& etc.; FARRENKOPF and JORDAN, ER et al., 1999).PDC6 is only expressed at very
1992) which can be separated by ion-exchange low levels and appears to be metabolically un-
chromatography, however, by using a non- important under normal circumstances (HOH-
PDC.5 expressing mutant, a homotetrameric MANN, 1991a, b). PDC2 is a regulatory gene
pdcl (MW 240,000 Da) has been isolated di- which controls basal expression of PDCl
rectly (KILLENBERG-JABS et al., 1996). The ex- (HOHMANN, 1993). pdcl and pdc5 both have
pression of PDC.5 is repressed by thiamine but four cysteine residues per monomeric unit,
52 2 Lyases
00
H Ph 13
Fig. 5. Complete catalytic sequence for the pyruvate decarboxylase (PDC) catalyzed decarboxylationof pyr-
uvate, incorporating stereochemical assignments (LOBELL and CROUT,1996b), [2-3H]-TPPlabeling studies,
(HARRISand WASHABAUGH, 1995a,b) and opening and closing of the active site (ALVAREZet al., 1995) (cf.
Fig. 3, for R' and R
').
whereas pdc6 only has one (Cys221; BABURINA pyruvate (1) or substrate surrogates such as
et al., 1996). This residue which is located on pyruvamide or ketomalonate. This may take
the surface of the protein at an interface seems several seconds to minutes and causes an ap-
to be involved in allosteric activation by pyru- proximately ten fold increase in activity. Each
vate and other carbonyl containing com- allosteric binding of a pyruvate molecule suf-
pounds, which triggers conformational chang- fices to activate several thousand catalytic cy-
es (LI and JORDAN, 1999; JORDAN et al., 1998; cles (ZENGet al., 1993; BABURINA et a1.,1994).
BABURINA et al. 1998a,b). It has been proposed that addition of the cys-
PDC undergoes slow allosteric activation by teine-221 thiol group (14) to pyruvate (l), give
4 Examples of Lyasrs 53
a hemithioketal(15) triggers the initial slow al- structure of Zyrnornonas mobilis is also a tet-
losteric activation of PDC (Fig. 6). However, ramer (DOBRITZSCH et al., 1998), but tight
recent results suggest that pyruvate binding at packing of the subunits and the absence of ap-
the regulatory site, without thiol addition caus- propriate cysteine residues precludes alloster-
es slow initial activation, and that hemithioke- ic activation by pyruvate and the enzyme is
tal formation occurs during the catalytic cycle, locked in an activated conformation (SUNet
rather than prior to it. In this model, thiol addi- al., 1995;FUREYet al., 1998; KONIG1998).
tion opens the active site for admission of pyr-
uvate and elimination closes it for the decar- Biotransformations
boxylation, protonation and acetaldehyde for- The Knoll process for the manufacture of
mation steps. Finally, addition again enables (R)-phenylacetyl carbinol (5) from benzalde-
release of acetaldehyde and carbon dioxide hyde (4) (Fig. 7) using yeast continues to be the
(ALVAREZ et al., 1995;Fig. 5). A closed confor- most efficient route to this material, neverthe-
mation for the decarboxylatiodprotonation less, there are still significant problems to be
stages of the cycle is consistant with the need solved (OLIVERet al., 1997).A high concentra-
to sequester the highly basic ylide (9) (pK, tion of benzaldehyde is essential for high pro-
17.5 in solution), away from solvent and the [2- ductivity in batch processes, but it is toxic to
3H]-TPP labeling study, which indicates mini- yeast and reduced to benzyl alcohol (NIKOLO-
mal hydrogen exchange with the solvent (cf. VA and WARD,1991; WARD,1995) which com-
the waterproof active site, LOBELLand CROUT, plicates the work-up. Increasing the supply of
1996a). benzaldehyde when PDC activity is maximal
The X-ray crystal structures of wild type and reducing the supply when alcohol dehy-
Saccharomyces cerevisiae PDC (from PDCl, drogenase activity is maximal minimizes these
a4),PDC from PDCl expressed in E. coli and effects (OLIVERet al., 1997). Immobilized and
S. uvariurn are PDC, have been determined semi-continuous production gives similar ben-
(Lu et al., 1997;ARJUNAN et al., 1996;DYDAet efits (TRIPATHIet al., 1997). Reduction of L-
al., 1990, 1993). Both enzymes have almost phenylacetyl carbinol (6) to (2R,3S)-phenyl-
identical sequences and are tetrameric. Each propan-2,3-diol (16) is also a significant side
monomeric unit consisting of a single peptide reaction (MOCHIZUKI et al., 1995), although
chain, is tightly associated into a dimer with the former can be isolated by bisulfite adduct
the TPPs situated at the interface. Two dimeric formation ( SHUKLA and KULKARNI, 1999).
pairs associate to give the tetramer (KONIG, In principle, use of purified PDC has the po-
1998;KONIGet al., 1998).Each monomeric unit tential to avoid all these problems, but thus far
consists of three domains: the N-terminal, a- this has not been achieved on a practical scale,
domain which binds the pyrimidine group of moreover benzaldehyde also inhibits PDC
TPP, the central p-regulatory domain and the (CHOWet al., 1995). Partially purified PDC
C-terminal y-domain which binds the pyro- from Candida utilis, was used to produce L-
phosphate group of TPP. The X-ray crystal phenylacetylcarbinol (6) at a final concentra-
tion of 28.6 g L-'(190.6 mM) (SHINand ROG-
ERS,1996a). When this enzyme was immobi-
lized in spherical polyacrylamide beads, higher
concentrations of benzaldehyde were tolerat-
ed (300 mM) and the half life of the enzyme
was increased to 32 days (SHINand ROGERS,
1996b). Similarly the thermal stability of
brewers' yeast PDC can be improved by cova-
lent conjugation with amylose via a glycylgly-
14 Closed 15 Open cine spacer (OHBAet al., 1995).
Fig. 6. It has been proposed that addition of cyste- Z. rnobilis is an anaerobic gram-negative
ine-221 to pyruvate opens a lid which enables ano- bacterium which is widely used in tropical re-
ther molecule of pyruvate to enter the active site gions for the fermentation of alcoholic bever-
(ALVAREZ et al., 1995;LOBELL
and CROUT, 1996b). ages (DOELLEet al., 1993). Unlike most other
54 2 Lyases
tion catalyst (1.7-lox) than yeast PDC, partic-

ularly at low pyruvate concentrations (SUNet
al., 1995).
The E. coli strain DH1 has been trans-
formed with the plasmid pLOI295, harboring
the gene encoding PDC from 2.mobilis ATCC
Bakers' yeast 31821.27% of the soluble cell protein consist-
(pyruvate ed of active recombinant Z. mobilis PDC,
decarboxylase) which was purified to homogenerity. The en-
zyme was somewhat less active than yeast
PDC, with benzaldehyde (Tab. 2, entry l), and
other aromatic aldehydes (Tab. 2, entries 2-9),
however, the relative reactivities were similar.
Ph& 0 Heteroaromatic aldehydes (Tab. 2, entries
6H 10-12) and propanal were poor substrates
(BORNEMANN et al., 1996). Cinnamaldehydes
6 99% ee 16
are good substrates for yeast mediated acyloin
formation. In virtually all cases the initally
1 Ph/' OH formed acyloins are stereospecifically reduced
to the corresponding diols. These substrates
1
17
are covered in detail in the chapter on C-C
Steps bond formation.
1 Fluoropyruvate (20)undergoes decarboxyl-
ation by yeast PDC to give acetate (21),rather
L
PhR
than fluoroacetaldehyde (22)(Fig. 8). Decarb-
oxylation proceeds normally (cf. Figs. 4,5) to
give the enol (23) (Fig. 9), which undergoes
elimination of fluoride to give the imminium
/N- alkene (U), which presumably undergoes hy-
dration (25) and cleavage of the C-2 thiazoli-
7 L-Ephedrine um bond to give acetate (21)and the ylide (9)
Fig. 7. Byproducts formed in the the Knoll process (GISHet al., 1988). Fluoropyruvate (20) also
for the preparation of L-phenyl acetyl carbinol (6), acts irreversibly at the allosteric site (SUNet
which is used in the manufacture of L-ephedrine (7). al., 1997) and hence it would be of great bene-
fit to investigate the kinetics of decarboxyla-
tion of fluoropyruvate by Z. mobilis PDC. The
plants and fungi it utilizes the Entner-Dou-
doroff pathway for the conversion of glucose
to pyruvate. This is much less efficient than gly-
colysis and hence large amounts of ethanol ac-
cumulate and PDC is one of the most abun-
dant proteins produced by the organism (GU-
NASEKARAN and RkT, 1999). Unlike yeast
PDC, Z . mobilis PDC maintains the tetrameric 0
form above pH 8, when catalytic action is lost
due to dissociation of TPP and magnesium 20 Fluoropyruvate
ions. It also has normal Michaelis-Menten ki- 0
netics ( K , pyruvate 0.3-4.4 mM), whereas all
other PDCs to date have sigmoidal kinetics 22 Fluoroacetaldehyde
(CANDYand DUGGLEBY, 1998; POHL et al., Fig. 8. The decarboxylation of fluoropyruvate(20) to
1995). Overall these factors render 2. mobilis acetate (21) (GISHet al., 1988; SUNet al., 1997) cata-
PDC a more effective pyruvate decarboxyla- lyzed by pyruvate decarboxylase.
Tab. 2. Acyloin Condensation Catalyzed by Whole Yeast, Yeast Pyruvate Decarboxlase (KRENet al., 1993)
and Z. mobih Pyruvate Decarboxylase (BORNEMANN et al., 1996)
Ar
AH SociiiiIpyte
1
0
pyruvate 0
18
decarboxylase
19
Entry Ar Yeast Yeast PDC” Z. mobilis PDC
% ee Yield % ee Yield % ee
1 Phenyl 97 - 99 15 98
2 2-fluorophenyl 87 60 99 60 98
3 3-fluorophenyl 95 25 99 30 97
4 4-fluorophenyl 97 31 99 35 98
5 2-chlorophenyl 81 32 98 5 98
6 3-chlorophenyl 86 25 99 20 98
7 4-chlorophenyl 77 - 99 35 98
8 2,3-difluorophenyl 97 40 99 - -
9 2,6-difluorophenyl 87 - 92 - -
10 2-fury1 - - - low 80-90
11 3-f~ryl - - - low 80-90
12 3-thienyl - - - 0 -
practical impact of this result is that pyruvates ploited, however, differential binding of car-
bearing potential nucleofuges are unsuitable boxylate substituted biomimetic dyes indicates
substrates for alkylation. that substrates other than oxalate may be ac-
cepted (LABROUand CLONIS,1995). Further
aspects of oxalate decarboxylation are covered
4.1.1.2 Oxalate Decarboxylase in Sect. 4.1.1.8,Oxalyl-CoA Decarboxylase.
(Oxalate Carboxy-Lyase,
EC 4.1.1.2) 4.1.1.3 Oxaloacetate
Oxalate decarboxylase catalyzes the decar- Decarboxylase (Oxaloacetate
boxylation of oxalate (26) to formate (27) (Fig. Carboxy-Lyase, EC 4.1.1.3)
10). Oxalate occurs as a byproduct of photo-
respiration in plants (spinach is a rich source) Oxaloacetate plays a central role in primary
and is produced by many microorganisms and metabolism as an intermediate in the citric ac-
fungi. Several species of Penicillium and As- id (Krebs) cycle (Fig. 1) and as the “starting
pergillus convert sugars into oxalic acid in high material” for gluconeogenesis.All amino acids
yields. Hyperoxaluria is a major risk factor in except for leucine and lysine can be converted
human urinary stone disease (SHARMA et al., to oxaloacetate. The majority are converted to
1993). The enzyme is readily available and is oxaloacetate via citric acid cycle intermedi-
used in kits for determining oxalate in urine ates. Aspartate and asparagine are converted
(SANTA-MARIA et al., 1993).The biotechnolog- via other pathways and the remainder are con-
ical potential of this enzyme remains to be ex- verted via pyruvate and carboxylation to oxa-
56 2 Lyases
Oxalate
9 Ytide
0
CO,
26 Oxalate 27 Formate
decarboxylase Fig. 10. The decarboxylation of oxalate (26) to for-
20 Fluoropyruvate mate (27) catalyzed by oxalate decarboxylase.
loacetate. There are two classes of enzymes

which are capable of the interconversion of
carbon dioxide and pyruvate (1) with oxalo-
I
acetate (28) (Fig. 11). Pyruvate carboxylases
(EC 6.4.1.1) are ligases and hence carboxyla-
tion (which is thermodynamically disfavored),
is coupled to the hydrolysis of ATP to ADP.
Whereas oxaloacetate decarboxylases (OAD,
F0
oxaloacetate carboxy-lyase, EC 4.1.1.3), cata-
lyzes the reverse and thermodynamically more
favorable reaction. The latter enzymes are not
able to catalyze the net carboxylation of pyru-
vate.
There are four classes of enzymes that cata-
lyze the decarboxylation of oxaloacetate. The
24 most important are the OADs that require
H20-l
HO
magnesium(I1) or manganese(I1) ions and are
consequently sensitive to EDTA (e.g., Micro-
coccus lysodeikticus OAD et al., 1999; Coryne-
bacterium glutamicum OAD et al., 1995) and
the biotinylated protein (TOHet al., 1993) lo-
cated on the cytoplasmic membrane, which
2s 0 0 28 Oxaloacetate
9nide
0
-
n 1 Pvruvate
Fig. 9. The mechanism for the decarboxylation of
fluoropyruvate (20) to acetate (21)by pyruvate de- Fig. 11.The decarboxylation of oxaloacetate (28) to
carboxylase (GISHet al., 1988; SUNet al., 1997); cf. pyruvate (1)catalyzed by oxaloacetate decarboxyl-
Figs. 3,4,5for R' and R2the sequence 11 012 09. ase.
acts as a sodium ion pump (DIMROTH, 1994;

DIMROTH and THOMER, 1993). In addition L-
malate dehydrogenase (L-malic enzyme, EC
1.1.1.38; EDENSet al., 1997; SPAMINATO and 0 0 28Oxaloacetate
ANDREO, 1995) and pyruvate kinase in muscle,
both have oxaloacetate decarboxylating activ- Oxaloacetate
ity, but oxaloacetate is not a substrate in vivo decarb0xy1ase
I q2+
(KRAUTWURST et al., 1998).
The mechanism of the OAD catalyzed de-
carboxylation of oxaloacetate (28) involves
the formation of a magnesium(I1) or manga- $.
nese(I1) a-ketoacid complex (29) (Fig. 12), 0
which undergoes retro-aldol cleavage to give
the magnesium enolate (30)plus carbon diox-
ide.This mechanism is quite different to that of
other P-ketoacid decarboxylases (e.g., acetoac-
etate decarboxylase) which involve imine for-
mation by the ketone to initiate decarboxyla-
tion. Imine based OADs, have been prepared
by rationale peptide design, but the rates of re-
action are much slower than those of compar-
able enzymes (ALLERT et al., 1998; JOHNSON
et al., 1993).
Oxaloacetate (28) enolizes rapidly in solu-
tion and hence special precautions are re-
quired to elucidate the stereochemistry of de-
carboxylation. This was achieved in a remark-
able sequence catalyzed by five enzymes.Incu-
bation of (2S)-[2-3H,3-3H2]-asparticacid (31)
with L-aspartase in deuterium oxide gave ster-
eospecifically labeled (2S,3S)-[2-3H,3-2H,3H]-
aspartic acid (32)via fumarate (Fig. 13).Trans-
amination yielded (3S)-[3-'H,3H]oxaloacetate
(33), which was immediately decarboxylated
in sifu with the OAD from Pseudomonas puti-
da to give (3S)-[3-lH,2H,3H]-pyruvate(34).To
prevent$enolization and loss of the radiolabels,
this was reduced with L-lactate dehydrogenase 0
to (2S,3S)-[3-lH,2H,3H]-lactate(35), with
which was isolated by anion exchange chroma-
tography. 0 1 Pyruvate
Oxidative decarboxylation with L-lactate
oxidase gave (2S)-[2-'H:H,3H]-acetate (36) Fig. 12. Mechanism for the decarboxylation of oxa-
(Fig. 14). The chirality of which was deter- loacetate (28) to pyruvate (1)catalyzed by oxaloace-
mined by CORNFORTH'S method (CORNFORTHtate decarboxylase. Magnesium(I1) bound to OAD
et al., 1969;LUTHY et al., 1969),which utilizes a is shown without ligands for the purposes of simplic-
further four enzymes. Decarboxylation by ity only. It is most likely that water or carboxylate li-
OAD proceeds with inversion of stereochem- gands are displaced when oxaloacetate is bound.
istry, whereas the corresponding reaction with
the biotin dependent pyruvate carboxylases
and malic enzyme all proceed with retention
of configuration (PICCIRILLI et al., 1987).
58 2 Lyases
I Aspartate
0 2
2H,3H]-Lactate
L-Lactate oxidase
CO,, H2O
32 (2S,3S)-[2-3H,
k
3-ZH,3H]-Aspartate 36 (2s)-[2-'H;H,3H]-Acetate
a-Ketoglutarate Fig. 14. Oxidative decarboxylation of lactate (35)
Glutamate-oxdoacetate yields acetate (36)of known stereochemistry.
transaminase
L-Glutamate
4.1.1.4Acetoacetate Decarboxylase
(Acetoacetate Carboxy-Lyase,
Oxdoacetate
EC 4.1.1.4)
Oxaloacetate Acetoacetate decarboxylase (AAD) cata-
decarboxylase lyzes the decarboxylation of acetoacetate to
acetone, a process which parallels the abiotic
co2 decarboxylation of acetoacetic acid (37s) (Fig.
15). The salts and esters of p-ketoacids are
generally stable to decarboxylation, whereas
the corresponding acids decarboxylate sponta-
neously. Consequently, this reaction is most of-
ten employed during the acid catalyzed hy-
Pyruvate drolysis of p-ketoesters (37c).The mechanism
NADH of the abiotic reaction is fairly well understood
L-Lactate dehydrogenase (HUANGet al., 1997; BACHand CANEPA, 1996).
Intramolecular proton transfer yields the enol-
NAD@ ic form of the ketone (%a), plus carbon diox-
ide, in a process which is in effect a retro-aldol
reaction. The obligatory nature of the proton
transfer can be inferred from the correspond-
ing reaction of trimethylsilyl p-ketoesters
(37b), which gives isolable trimethysilyl enol
ethers (38b). It might be anticipated that the
ZH,3H]-Lactate enzyme catalyzed process would simply in-
Fig. 13. Stereoselectivity of the decarboxylation of volve protonation of the p-ketoacid salts
labeled oxaloacetate (33) catalyzed by Pseudomo- which are the predominant form at physiolog-
nus putida OAD. ical pH. However, early experiments, demon-
strated that exchange of the ketonic oxygen

was an obligatory step in the decarboxylation
of acetoacetate by AAD (HAMILTONand
WESTHEIMER, 1959), which is not consistant
with a simple protonation mechanism. It is a R = H; Acetoacetic acid
now well established, that reaction of acetoac- b R = Me3Si
etate (40) (Fig. 16) with a lysine residue of c R = alkyl
A A D (41), gives a protonated imine (Schiff’s
base) derivative (42), which undergoes decar-
boxylation to give the enamine (43), which in
turn is hydrolyzed to acetone (39). The pH op-
timum for Clostridium acetobutylicum A A D is
+
5.95,whereas the pKa for the e-amino group of
lysine in solution is 10.5, hence the effective
pK, at the active site must be reduced by a fac-
tor of at least 20,000 to enable the &-amino 0 38
group of lysine to act as an effective nucle- aR=H
ophile (WESTHEIMER, 1995). Clostridium ace- I b R = Me3Si
tobutylicum A A D bears adjacent lysine resi-
dues at the active site. Lysine-115 acts as the
nucleophile, whereas the &-ammoniumgroup R=H
of lysine-116 serves to reduce the pKa of the
adjacent residue by electrostatic effects
(HIGHBARGER et al., 1996). This reduction in
1
pKa has also been exploited in the design of
1,3-diarninonorbornane decarboxylation cata-
lysts (OGINOet al., 1996). Catalytic antibodies
39Acetone
which are capable of catalysing aldol reactions
and decarboxylation, also bear deeply buried Fig. 15. Abiotic mechanism for the decarboxylation
lysine residues which are essential for catalytic of acetoacetic acid (37a).
activity (BARBAS I11 et al., 1997;BJORNESTEDT
et al., 1996)
The decarboxylation of (2R) and (2S)-[2- carboxylation as demonstrated by recovery of
3H]-acetoacetate in deuterium oxide catalyzed the (1s)-diastereomeric alcohols (51) (53) af-
by A A D gives racemic [2-’H,2H,3H]-acetate. ter sodium cyanoborohydride reduction. De-
A series of control experiments demonstrated carboxylation of the deuterio-derivative (54)
unambigously that this was a consequence of in water gives (2S)-[2-*H]-cyclohexanone (55)
the decarboxylation step and was not due to (Fig. 19), again with retention of stereochemis-
hydrogen exchange reactions with the solvent try (BENNERand MORTON,1981). The bio-
(ROZZELL Jr and BENNER,1984). In contrast transformations potential of A A D has thus far
the homolog, racemic 2-methyl-3-oxobutyrate only been investigated with a few “unnatural
(44) (45) (Fig. 17) is decarboxylated enantiose- substrates”. The ability to decarboxylate sub-
lectively.Treatment of the crude reaction mix- strates such as 2-oxocyclohexanecarboxylate
ture with sodium borohydride gives a mixture (49) (SO), which are structurally far removed
of diastereomeric alcohols (46) (48) which from the natural substrate (40) suggests it may
both have the (2S)-configuration and when the be applicable to a diverse range of P-ketoacids.
reaction is run in deuterium oxide, (3R)-[3- In the first half of the twentieth century, ace-
’H1-2-butanone (47) is produced, indicating tone was manufactured by fermentation, but
that decarboxylation occurs with retention of this technology was supplanted in the 1950s by
stereochemistry (BENNERet al., 1981).Similar- more cost effective abiotic processes based on
ly, racemic 2-oxocyclohexanecarboxylate(49) petrochemicals. With increasing concerns
(50) (Fig. 18) undergoes enantioselective de- about enviromental impacts and the need for
60 2 Lyases
40 Acetoacetate
I (-)-44 - I (+)-45
R- NH 2 Acetoacetate
decarboxylase
41 Acetoacetate
decarboxylase
NaBH4 (2H20)
'I
@,R H
Ico2
h
42Irnine
I 48
Fig. 17.Enantioselective decarboxylation of racemic
2-methyl-3-oxobutyrate (44)(45).
,R H
N'
I
A 43Enamine
(+)-49 (-)-SO
k HR-NH,
20 Acetoacetate
41 Acetoacetate decarboxylas
decarboxylase
A
0 NaCNBH3
oco:8
39Acetone 1
Fig. 16. Mechanism for the decarboxylation of ace- OH
toacetate (40)by acetoacetate decarboxylase.
the development of renewable resources, the (+)A 52

fermentation process is now being reexamined
(Reviews: DUERRE, 1998; GIRBALand Sou-
CAILLE, 1998;SANTANGELO and DUERRE, 1996;
WOODS,1995; DUERRE et al., 1992).The origi-
nal organism used for the starch (corn mash) (-)-53
based fermentation was Clostridium acetobu-
tylicum, however, later strains were grown on Fig. 18. Enantioselective decarboxylation of racemic
2-oxocyclohexanecarboxylate(49) (50).
sucrose (molasses) and this has led to some ge-
netic drift such that 39 cultures from various
collections can now be divided into four
species is product inhibition (acetate, butyrate

Acetoacetate and butanol), this is multifactorial and syner-
decarboxylase
gistic. Acetone and ethanol are not inhibitors
except at higher levels (YANGand TSAO,1994).
co2 However, the addition of acetate to MP2 me-
54 55
dia increases “solvent” production and induces
the expression of the sol operon in C. beije-
Fig. 19. Decarboxylation of the deuterio-derivative rincki (CHENand BLASCHEK, 1999a,b)
(54) in water gives (2S)-[2-2H]-cyclohexanone(55) In the initial exponentional growth phase of
with retention of stereochemistry. the fermentation, acetate and butyrate pro-
duction predominates and without external
groups based on DNA-DNA reassociation control the pH typically drops to 4.3. The fer-
(JONESand KEIS, 1995; JOHNSONand CHEN, mentation shifts to butanol, ethanol and ace-
1995; JOHNSON et al., 1997; TOTHet al., 1999). tone production, shortly before the stationary
The two most important groups are those phase (GIRBALet al, 1995; GRUPEand GOTT-
which are related to C. acetobutylicum, and C. SCHALK, 1992). Both nitrogen and phosphate
beijerincki; in addition two cultures (NRRL limited fermentation favor acetate and buty-
B643 and NCP 262) have 94% relatedness and rate formation, but not “solvent” formation. A
C. saccharoperbutylacetonicum forms a separ- two stage continuous fermentation, with a ni-
ate group on its own (JOHNSON and CHEN trogen limited first stage fermentation max-
1995). imized acid production, which was followed by
The so called “solvent producing microor- a second fermentation with supplemental glu-
ganisms” yield a mixture of acetone (39), buta- cose and nitrogen sources which maximized
no1 (63), plus less valuable metabolites such as butanol production (0.4 g L-’ h-I; LAI and
ethanol, butanoate (61) and isopropanol(64)), TRAXLER 1994). Acetone production without
which are produced by a sequence of steps concommitant butanol production is an im-
which resemble fatty acid metabolism (Fig. 20; portant objective. Plasmid pFNK6 contains a
BENNETT and RUDOLPH, 1995).The early steps synthetic operon (ace) in which the three ho-
in the sequence appear to be fairly similar in mologous acetone formation genes (adc, ctfA
all organisms examined thus far (STIM-HERN- and ctfB) are transcribed from the adc pro-
DON et al., 1995), however, a variety of alde- moter. C. acetobutylicum ATCC 824 (pFNK6)
hyde and alcohol dehydrogenases are em- gave the highest level of expression of AAD
ployed (CHEN,1995;REIDand FEWSON, 1994). and CoA-transferase at pH 4.5, but the highest
In C. acetobutylicum ATCC-824,the adc op- levels of “solvents” were produced at pH 5.5.
eron (encoding acetoacetate decarboxylase; Acetone, butanol and ethanol were produced
PETERSEN and BENNETT,1990;GERISCHER and at 95%, 37% and 90% higher concentrations
DUERRE,1990), is contiguous with structural those produced by the plasmid free strain
genes for acetoacetyl-coenzyme A:acetate/ (MERMELSTEIN et al., 1993). In the first study
butyrate:coenzyme A transferase (ctfB and of the expression of clostridial genes in a non-
ctfA), an alcohol/aldehyde dehydrogenase clostridial host, a synthetic operon (ace4) com-
(aad) (FISCHERet al., 1993; PETERSEN et al., posed of four C. acetobutylicum ATCC 824
1993), plus a repressor (solR) (NAIR et al., genes (adc, ctfA, ctfB and thl) under the con-
1999).These four genes form the sol operon, trol of the thl promoter was constructed and
which is induced or derepressed before solven- introduced into three strains of E. coli oh the
togenesis (SAUERand DUERRE, 1995) and does vector PACT. E. coli ER2275(pACT) and
not operate in strains which are unable to pro- ATCC 11303(pACT) both produced 40mM
duce “solvents” (STIM-HERNDON et al., 1996). acetone in shake cultures and addition of ace-
Two putative promoter sites are located up- tate and glucose further increased the titres. I n
stream of the sol operon (FISCHER et al., 1993; a bioreactor E. coli ATCC 11303(pACT) at pH
DUERREet al., 1995). 4.5,125-154 mM acetone accumulated, which
The primary limitation in the production of is equal to or higher than that achieved by wild
“solvents” by C. acetobutylicum and related C. acetobutylicum (BERMEJO et al., 1998).
62 2 Lyases
Acetoacetyl-CoA:
acetateibutyrate P-hydroxybutyvl-
CoA transferase e e CoA dehydrogenase HO 0
COASH
56 57 Acetoacetyl-CoA 58
Crotonase
CoASH
00 40 Acetoacetate dSCoA
59
Butyvl-CoA
dehydrogenase
co2
El 39 Acetone
Axo*
I I
CoA-acy lating
aldehyde
6o
Butanol
dehydrogenase
63 Butanol 62 Butyraldehyde
Butyraldehyde
dehydrogenase
61 Butyrate
Fig. 20. The production of acetone (39) and butanol(63) by C. acetobutylicum and related species. Isopropa-
no1 (64)is most frequently formed by C. beijerincki (CoASH = coenzyme A).
4.1.1.5 Acetolactate Decarboxylase lactate (65) to give (W-acetoin (5) (Fig. 21).
(2S)-a-Acetolactate (65) is decarboxylated
(2-Hydroxy-2-Methyl-3- with inversion of configuration (CROUTet al.,
Oxobutyrate Carboxyl-Lyase, 1984;ARMSTRONG et al., 1983) and the carbox-
EC 4.1.1.5) ylate group is substituted by a proton from the
solvent (DRAKEet al., 1987). Surprisingly,
Acetolactate decarboxylases from Klebsiel- (2R)-a-acetolactate (66) is also decarboxylat-
la aerogenes (formerly Aerobacfer aerogenes) ed to (R)-acetoin (5), but at a slower rate
catalyzes the decarboxylation of (S)-a-aceto- (CROUTet al., 1986).
Acetolactate
decarboxylase Acetolactate
decarboxylase
co2
co2
Fig. 21. Decarboxylation of a-acetolactate [(2-hy-

’0VHO E t
droxy-2-methyl-3-oxobutanoate] (65) (66) to (R)- p 70

acetoin (3-hydroxy-2-butanone) (5), catalyzed by ac-
etolactate decarboxylase.
Et
HO H 71 HO +
’
A clue to the mechanism was provided by Fig. 22. Decarboxylation of (2S)-a-acetohydroxy-
the decarboxylation of racemic a-acetohy- butyrate [(2S)-2-ethyl-2-hydroxy-3-oxobutanoate]
droxybutyrate (67) (68) with acetolactate de- (67),and tertiary ketol rearrangement of (2R)-a-ac-
carboxylase from a Bacillus sp. (Fig. 22). The etohydroxybutyrate(a), to (2S)-2-hydroxy-2-meth-
(S)-enantiomer (67) was decarboxylated rap- yl-3-oxopentanoate (70) and decarboxylation cata-
idly to give the ketol(69), which was followed lyzed by acetolactate decarboxylase.
by slow decarboxylation of the @)-enantiom-
er (68)to give the isomeric ketol (71). Both
ketols were formed with high enantiomeric ex- 4.1.3.181. The enzyme is TPP dependent and
cesses. This apparently anomolous result can hence the mechanism is very similar to that of
be rationalized by a stereospecific enzyme cat- pyruvate decarboxylase described in Sect.
alyzed tertiary ketol rearrangement of (68) 4.1.1.1 (CARROLL et al., 1999; CHIPMAN et al.,
with transfer of the carboxylate group to the 1998; HILLet al., 1997) (Fig. 23). a-Acetolac-
re-face of the ketone to give the a-propiolac- tate (65) is the biological precursor of diacetyl
tate (70). This compound which is a homolog (72), which is a desirable aroma in some fer-
of (S)-a-acetolactate (65) then undergoes de- mented diary products, but an off-flavor in
carboxylation by the “normal” pathway. When beer. Acetoin has no flavoriimpact on beer
(R)-a-acetolactate (66)is subjected to the ter- (HUGENHOLTZ, 1993).The conversion of a-ac-
tiary ketol rearrangement, the enantiomeric etolactate (65) to diacetyl (72) is an oxidative
(S)-a-acetolactate (65) is formed and hence decarboxylation. Plausibly the anionic inter-
this also explains the ability of this enzyme to mediate of decarboxylation of a-acetolactate
transform both enantiomers of a-acetolactate (65) is intercepted by oxygen (BOUMERDASSI
(CROUTand RATHBONE, 1988). An abiotic et al., 1996) or peroxide acting as electrophiles.
base catalyzed tertiary ketol rearrangement This process apparently does not occur during
(CROUTand HEDGECOCK, 1979) was excluded decarboxylation by acetolactate decarboxyl-
by control experiments. ase. a-Acetolactate (65) undoubtedly under-
a-Acetolactate (65) is produced biosynthet- goes spontaneous, extracellular oxidative de-
ically by the condensation of two molecules of carboxylation (SEREBRENNIKOV et al., 1999),
pyruvate (1) with concomittant decarboxyla- but the evidence is accumulating for a parallel
tion, catalyzed by acetolactate synthase [ace- intracellular enzyme (RONDAGS et al., 1997,
tolactate pyruvate-lyase (carboxylating); EC 1998; JORDAN et al., 1996) or quinone cata-
64 2 Lyases
The conversion of a-acetolactate (65) to ace-

toin (5) reduces the “pool” of a-acetolactate,
available for conversion to diacetyl, hence by
0 lpyruvate regulating the levels of acetolactate decarbox-
ylase, it should be possible to control the levels
of diacetyl (RENAULT et al., 1998; BENITEZ et
Acetolactate al., 1996; KOK,1996). However, selection for
synthase Lactobacillus rhamnosus mutants with low
co2 levels of acetolactate decarboxylase activity
had no affect on diacetyl levels (MONNET and
CORRIEU, 1998; PHALIP et al., 1994).Acetolac-
[a]
tate accumulates, but is not converted to di-
acetyl unless the redox potential is high (MON-
NET et al., 1994). In contrast incorporation of
3 the acetolactate decarboxylase gene from
Acetobacter aceti into the genome of brewers’
yeast successfully reduced the levels of diacet-
yl (TAKAHASHI et al., 1995; YAMANOet al.,
1994, 1995). Moreover the free enzyme from
Bacillus subtilis containing the structural gene
for ALDC production originating from a Ba-
1 Pyruvate t cillus brevis strain is now used directly in beer
brewing to reduce diacetyl levels (DEBOERet
al., 1993;GERMAN, 1992).
There is considerable unrealized potential
for the use of both acetolactate synthase and
acetolactate decarboxylase in synthesis
O,? (CROUTet al., 1994)
Acetolactate
decarboxylase
co2 coz 4.1.1.6 Aconitate Decarboxylase

(cis-Aconitate Carboxy-Lyase,
EC 4.1.1.6)
Aconitate decarboxylase from Aspergillus
terreus catalyzes the decarboxylation of cis-
aconitate (73) to itaconate (74) (Fig. 24).There
5 (R)-Acetoin 72 Diacetyl has been considerable interest in the produc-
tion of itaconate (74) by various strains of A .
Fig. 23. The biosynthesis of (2S)-c~-acetolactate[(S)-
2-hydroxy-2-methyl-3-oxobutanoate] (65) from pyr-
terreus for use as a monomer for plastics man-
uvate (l),catalyzed by acetolactate synthase. Non- ufacture. However, the enzymology has largely
oxidative decarboxylation to give @)-acetoin (5), is been neglected, because of the instability of
catalyzed by acetolactate decarboxylase. Oxidative the enzyme (BENTLEYand THIESSEN, 1957).
decarboxylation to diacetyl (72) occurs spontane- The generally accepted mechanism for the de-
ously, but may also be catalyzed by an unidentified carboxylation involves an allylic shift of the al-
kene bond with protonation on the (2-re,3-se)
face of cis-aconitate (73) (RANZIet al., 1981).
lyzed process (PARKet al., 1995). Conversion However, recent work in which the enzyme
of acetoin to diacetyl or vice versa does not was immobilized in a silicate matrix, has indi-
seem to be a significant pathway in most mi- cated that the initial decarboxylation yields ci-
croorganisms. traconate (75), which is subsequently isomer-
using A. terreus TN-484; a result which is al-

co: most equivalent to that achieved with glucose
O o 2 4 cz 73 cis-Aconitate (YAHIRO et al., 1997). Protoplast fusion
I \'H,A ' 0 *H
between A. terreus and A. usamii (a gluco-
amylase producer), produced fusant mutants
which were subcultured to confirm stability.
Aconitate The F-112 mutant maximally produced 35.9
decarboxylase g L-' of itaconic acid from 120 g L-' soluble
starch (KIRIMURA et al., 1997).The other ma-
jor factor in itaconate production is aeration.
Interuption of aeration for five minutes caused
the cessation of itaconate production and this
was only restored after a further 24 hours aer-
- ation. Moreover when protein synthesis was
2H 74 Itaconate also inhibited after interuption of aeration no
further itaconate production occurred (GYA-
MERAH et al., 1995; BONNARME et al., 1995).
Given these results it is not surprising that air
lift reactors have been favored for large scale
conversions (PARKet al., 1994; OKABEet al.,
75 Citraconate 1993) On a small scale a 10 mm air lift reactor
Fig. 24. Decarboxylation of cis-aconitate (73) to itac- has been monitored directly by 31P-NMR at
onate (74) catalyzed by aconitate decarboxylase. 161 MHz (LYNSTRAD and GRASDALEN 1993).
ized to itaconte (74) by a previously unknown

enzyme (BRESSLERand BRAUN,1996). This 4.1.1.7 Benzoylformate
mechanistically unlikely result remains to be
confirmed. Decarboxylase (Benzoylformate
cis-Aconitate is a citric acid (Krebs) cycle Carboxy-Lyase,EC 4.1.1.7)
intermediate (Fig. 1) which is produced pre-
dominantly in the mitochondria, whereas Benzoylformate decarboxylase (BFD) is a
aconitate decarboxylase is located exclusively rare enzyme which catalyzes the decarboxyla-
in the cytosol (JAKLITSCH et al., 1991). Much tion of benzoylformate (phenyl glyoxalate; 78)
work has been devoted to increasing the pro- to benzaldehyde (4) (Fig. 25). The most in-
ductivity and efficiency of production of itaco- tensely investigated example is the BFD from
nate (74) from carbohydrate foodstocks (BON- the mandelate pathway of Pseudomonas puti-
NARME et al., 1995). Selection on itaconic acid da.
concentration gradient plates yielded A. terre- Phenylacetate (76) is a common intermedi-
us TN-484, which gave 82 g L-' itaconic acid ate in the microbial metabolism of various ar-
from 160 g L-' glucose (51% efficiency) in a omatic compounds, including phenylalanine.
shaking flask (YAHIROet al., 1995). Although In Pseudomonas putida, phenylacetate is de-
this is a good level of productivity and efficen- graded by benzylic hydroxylation to mande-
cy, the challenge is to achieve the same results late (77), oxidation to benzoylformate (78)
with cheaper foodstocks. Corn starch gave the (LEHOUand MITRA,1999),decarboxylation to
best results for a range of starchy materials benzaldehyde (4) catalyzed by BFD and oxi-
with A. terreus NRRL 1960,but the productiv- dation to give benzoate (79), which is oxidized
ity was only 18 g L-' and the efficiency 34% further by ring fission(Ts0u et al., 1990).Some
(PETRUCCIOLI et al., 1999).Pretreatment of the other organisms utilize nominally similar path-
the corn starch with nitric acid enabled more ways, but with a different complement of en-
than 60 g L-' itaconic acid to be produced zymes. For example, the denitrifying bacterium
from 140 g L-' corn starch (50% efficiency) Thauera aromatica utilizes a membrane bound
66 2 Lyases
0 and FUCHS,1999). Another denitrifying bacte-

.O rium Azocarus evensii, catalyzes the oxidative
decarboxylation of benzylformate (78) to ben-
76 Phenylacetate zoyl-CoA with a six subunit iron-sulfur en-
zyme (HIRSCHet al., 1998).
BFD from Pseudomonas putida is a tetra-
meric TPP (thiamine pyrophosphate) depen-
dent decarboxylase composed of 57 kDa
CoA monomers (HASSON et al., 1995,1998).As with
derivatives
other TPP dependent decarboxylases the
I OH intermediate enamine can be intercepted by
exogenous aldehydes to give acyloins (cf. pyru-
vate decarboxylase, Sect. 4.1.1.1). The acyloin
condensation with acetaldehyde (2)gives (S)-
(-)-2-hydroxypropiophenone (80) with up to
NAD(P)H
92% enantiomeric excess (Fig. 26). Thus far,
(29-77
only p-substituted benzylformates have been
Mandelate shown to act as substrates and pyruvate; a-keto-
glutarate and a-ketobutryrate are not sub-
strates (REYNOLDS et al., 1988; WEISSet al.,
1998).The fairly limited synthetic applications
of BFD have been reviewed (IDINGet al., 1998;
SCHORKEN and SPRENGER,1998; SPRENGER
and POHL, 1999). [p-(Bromomethy1)ben-
0 78 Benzylformate zoyllformate (81s)reacts with BFD at about
1% of the rate of benzylformate (78) and caus-
Benzoylformate es inhibition which can be reversed by the ad-
lyase dition of TPP. The “enamine” (82) which is
CoA CO,
formed by the “normal” mechanistic sequence,
derivatives undergoes elimination of bromide to give a
n transient quinone-dimethide (83), which tau-
tomerizes to the acyl derivative and undergoes
slow hydrolysis via the hydrate (84) to give p-
methylbenzoate (85) (Fig. 27).This mechanism
of this reaction parallels the conversion of 2-
fluoropyruvate (20)to acetate (21)(Fig. 9) by
NAD(P) pyruvate decarboxylase, however, [p-(fluo-
Benzaldehyde romethyl)benzoyl]formate (81b) undergoes
dehydrogenase decarboxylation without elimination of fluo-
NAD(P)H ride, which suggests that the intervening phe-
-
nyl group imposes an energy barrier which im-
pedes elimination (DIRMAIER et al., 1986; RE-
YNOLDS et al., 1998).
&o@ The production of (S)-(-)-2-hydroxypropi-
ophenone from benzylformate (78) and acetal-
79 Benzoate
dehyde (2) by Acinetobacter calcoaceticus, has
Fig. 25. Generalized pathway for the catabolism of been optimized at pH 6.0 and 30 C. Maximal
O
phenylacetate (76). productivity was 8.4 g L-’ after two hours. In

one hour, 6.95 g L-’ of (S)-(-)-2-hydroxyprop-
molybdenium-iron-sulfur protein, which con- iophenone (80) was formed which corre-
verts phenylacetyl-CoA directly to benzylfor- sponds to a productivity of 267 mg per g of dry
mate (78) in the absence of dioxygen (RHEE cells per hour (PROSENand WARD,1994).
MR2
n
Rt N&S 9 Ylide
&O@ 78 Benzylformate
Benzoylformate
decarboxylase
Benzylformate
decarboxylase
fr
0
Goyo
co2 0 2 Acetaldehyde
81
aX=Br
bX=F
80 (9-(-)-2-Hydroxypropiophenone
Fig. 26. Acyloin condensation of benzylformate (78)
and acetaldehyde (2) catalyzed by benzylformate
Br@ /I 82
decarboxylase.
Whole cell and cell extracts of Pseudomonas

putida ATCC 12633 also catalyze this transfor-
mation, but benzaldehyde was a major by-
product together with small amounts of benzyl 83
alcohol (WILLCOCKS et al., 1992, WILLCOCKS
and WARD1992).
4.1.1.8 Oxalyl-CoA Decarboxylase

(Oxalyl-CoA Carboxy-Lyase,
EC 4.1.1.8)
Oxalyl-CoA decarboxylase (OCD) catalyz-
es the decarboxylation of oxalyl-CoA (86) to 84
formyl-CoA (87 Fig. 28) and is TPP depen-
dent. This offers the prospect that the “ena-
mine” intermedaite (cf. 11, Fig. 4), which is
functionally equivalent to a formate anion (88)
could be trapped by electrophiles, such as alde-
hydes (cf. Sect. 4.1.1.1, pyruvate decarboxyl-
ase). The most heavily investigated OCD is R1/
’ ’
‘LS 85 p-methylbenzoate
that from Oxalobacter formigenes, which is a 6 9 Ylide
gram-negative anaerobe found in the gut,
Fig. 27. The mechanism for the decarboxylation of
which is able to grow using oxalate as the sole [p-(bromomethyl)benzoyl]formate @la) to p-meth-
energy and carbon source, if small amounts of ylbenzoate (85) by benzylformate decarboxylase
acetate are also available (CORNICK and ALLI- (BFD) cf. Figs. 3,4,5for R’and R2and the sequence
SON,1996;CORNICK et al., 1996). In humans the 9 -+ 10 --t 11 + 12 -+ 9 and Figs. 8,9 for the corre-
absence of 0.formigenes, in the gut is a major sponding reaction of fluoropyruvate (20).
68 2 Lyases
tate. Carbonate is assimilated but not formate.

Apparently, there are multiple pathways for
the assimilation of oxalate (CORNICK and AL-
LISON,1996; CORNICK et al., 1996).The strictly
anerobic, obligatory oxalotrophic bacterium,
Bacillus oxalophilus, utilizes tartronate semi-
Oxalyl-CoA aldehyde synthase (EC 4.1.1.47; Sect. 4.1.1.24)
decarboxylase or the serine pathway to assimilate oxalate and
COZ OCD and formate dehydrogenase for oxida-
tion (ZAITSEV et al., 1993).
0
CoASA H 87 Formyl-CoA 4.1.1.9 Malonyl-CoA

Decarboxylase (Malonyl-CoA
Carboxy-Lyase,EC 4.1.1.9) and
Related Malonate Decarboxylating
Enzymes
Fig. 28.Oxalyl-CoA decarboxylase.
Malonyl-CoA decarboxylase (MCD) cata-
lyzes the decarboxylation of malonyl-CoA
risk factor for hyperoxaluria and calcium oxa- (90) to acetyl-CoA (56;Fig. 29). Some forms of
late kidney stone disease (SIDHUet al., 1998, this enzyme are also able to act as malonate-
1999). CoA transferase (EC 2.8.3.3), which catalyzes
OCD in 0.formigene is located in the solu- the transfer of coenzyme A from acetyl-CoA
ble cytoplasmic fraction (BAETZand ALLISON, (56) to malonate (89). MCD is not able to cat-
1992) and is linked to a transport system alyze the net carboxylation of acetyl-CoA.
(OxlT; RUANet al., 1992),which exchanges ex- This requires the biotin dependent enzyme,
tracellular oxalate for intracellular formate. acetyl-CoA carboxylase, in which the thermo-
Decarboxylation of oxalyl-CoA (86) to for- dynamically disfavored carboxylation is linked
myl-CoA (87), followed by hydrolysis con- to the hydrolysis of ATP to ADP (EC 6.4.1.2).
sumes a proton and hence transport of for- The mechanism for the abiotic decarboxyla-
mate out of the cell develops an internally neg- tion of malonic acid (92) proceeds via a six-
ative membrane potential. In effect, formate is membered transition state (Fig. 30; HUANG et
acting as a proton carrier and hence transport al., 1997) in which a proton is transferred from
plus decarboxylation performs the function of the carboxylate group undergoing decarboxy-
an indirect proton pump (Fu and MALONEY, lation to the incipient carboxylate group of ac-
1998). However, there is no obligatory rela- etate (21)in a concerted sequence of bond mi-
tionship between decarboxylation and the grations (GOPOLAN, 1999). This mechanism is
transport system, because functional OCD was essentially identical to that of the decarboxyla-
produced when a PCR fragment containing tion of acetoacetate (37a; Fig. 15). Despite the
the gene (oxc) was overexpressed in E. coli relative ease of the abiotic reaction and the po-
(BAETZand PECK,1992; cf. SIDHUet al., 1997; tential to catalyze it by protonation and aug-
LUNGet al., 1994). mented proton transfer, there do not appear to
It is interesting to speculate if the formate be any decarboxylases in which malonate
anion equivalent (88) is involved in the biosyn- undergoes direct decarboxylation. The enzy-
thesis of common cellular constituents such as matic decarboxylation of malonate apparently
Citric acid (Krebs) cycle intermediates (Fig. 1) requires obligatory formation of the corre-
and amino acids. 14Clabeling studies indicate sponding thioester to facilitate the decarboxyl-
that some 54 % of the total cell carbon is de- ation. The ability of the sulfur atom of the thi-
rived from oxalate and at least 7% from ace- oester to acts as an electron sink and hence fa-
xH
0 0
CoAS 0" 90 Malonyl-CoA

II
Malonyl-CoA HO
decarboxylase 0 93
COZ
00
CoAS 91 Acetyl-CoA enolate
Fig. 30. Abiotic mechanism for the decarboxylation

of malonic acid (37a).
CoAS A 56 Acetyl-CoA
Fig. 29. Malonyl-CoA decarboxylase catalyzes the
al., 1999). In mammals, MCD and acetyl-CoA
carboxylase regulate the levels of malonyl-
decarboxylation of malonyl-CoA (90) to acetyl- CoA in muscular tissues as part of a complex
CoA enolate (91) which undergoes protonation to system regulating glucose and fatty acid me-
give acetyl-CoA (56). Some forms of the enzyme are tabolism (GOODWIN and TAEGTMEYER, 1999;
also able to catalyze metathesis of malonate (89) and
acetyl-CoA (56) with malonyl-CoA (90) and acetate
ALAM and SAGGERSON, 1998).
MCD activity has been described for Myco-
(21).
bacterium tuberculosis, Pseudomonas ovalis
(TAKAMURA and KITAYAMA, 198l), Pseudo-
cilitate the reaction is well established (BACH monas fluorescens (KIMet al., 1979), Pseudo-
and CANEPA,1996), nevertheless, the absence monas putida (CHOHNAN et al., 1999), Sporo-
of enzymes able to catalyze the direct decar- musa malonica, Klebsiella oxytoca and Rho-
boxylation of malonate is surprising. dodbacter capsulatus (DEHNING and SCHINK,
MCDs have been found in mammalian, 1994), Citrobacter divs. (JANSSENand HAR-
avian and plant tissues, plus various microor- FOOT, 1992), Acinetobacter calcoaceticus (KIM
ganisms (KOLA-I-I-UKUDY et al., 1981). In hu- and BYUN,1994), Malonomonas rubra (DEH-
mans, MCD deficiency results in mild mental NING and SCHINK, 1989) and Klebsiella pneu-
retardation, seizures, metabloic acidosis and moniae.
excretion of malonate in the urine (GAOet al., There is some controversy over the exact
1999b;FITZPATRICK et al., 1999;SACKSTEDER et nature of the MCD activity in microorganisms,
70 2 Lyases
which has arisen from work with two species kJ mol-l) can be “harvested” and it is lost as
that utilize malonate as sole energy source heat. This is in any case, unnecessary because
(DIMROTHand HILBI,1997). Malonomomas more than sufficient energy is created by the
rubra is a microaerotolerant fermenting bacte- aerobic oxidation of acetate to carbon dioxide
rium which can grow by decarboxylation of and water in the citric acid cycle and respirato-
malonate to acetate under anaerobic condi- ry chain.
tions. It is phylogenetically related to the sulfur The decarboxylation system of the anerobe
reducing bacteria (KOLBet al., 1998).Klebsiel- M. rubra consists of water soluble cytoplasmic
la pneumoniae is able to grow aerobically on components (some of which resemble those of
malonate, or anaerobically if supplemented K. pneurnoniae) plus membrane bound com-
with yeast extract. Both of these species are ponents which are involved in energy harvest-
able to decarboxylate malonate without the ing. Acetate and ATP are required for the
intermediacy of malonyl-CoA. In each case, priming step in which ACP-SH (94a) is con-
malonate is decarboxylated as the thioester of verted to the acetyl form (94b) (Fig. 33). This
an acyl-carrier protein (ACP), which bears undergoes metathesis with malonate to give
an acetylated 2‘-(5 ”-phosphoribosyl)-3 ‘-de- malonyl-ACP (94c) and decarboxylation is
phosphocoenzyme A prosthetic group (94b) linked to the transfer of carbon dioxide to
(Fig. 31) (BERG et al., 1996; SCHMIDet al., MadF, the biotin carrier protein (BCP) (96)
1996).This group was previously identified as with regeneration of acetyl-ACP (94b). The
a component of K. pneumoniae citrate (pro- carboxybiotin protein (95) is believed to dif-
3s)-lyase (ROBINSON et al., 1976).The K. pneu- fuse to the membrane, where it is decarboxyl-
moniae malonate decarboxylase consists of ated by MadB in an exogonic reaction which is
four subunits (a-8) involved in the catalytic linked to sodium ion pumping across the
cycle (Fig. 32), plus a further enzyme (MdcH) membrane. The Na+ gradient so formed is
which transfers malonyl-CoA (90) to the thiol then exploited for ATP synthesis by the FlFO
form of the ACP (94a) (HOENKE and DIMROTH ATP synthases. This process has been termed
1999). Decarboxylation then yields the acetyl decarboxylative phosphorylation and is re-
derivative (94b), which undergoes trans-acyla- sponsible for all ATP synthesis in several an-
tion with malonate (89) to commence the cata- aerobic bacteria (DIMROTH and SCHINK, 1998).
lytic cycle (HOENKEet al., 1997). In this se- It is claimed that the apparent MCD activity
quence, there is no means by which the energy of Acinetobacter calcoaceticus, Citrobacter
released by decarboxylation (DG” ’ = - 17.4 divs., K. oxytoca, and some Pseudomonas spp.
bR=Ac
c R = malonyl
Fig. 31.2‘45 ” -phosphoribosyl)-3‘-dephosphocoenzyme A and derivatives (94a-c)esterified with a serine

residue of the acyl camer protein. This is the prosthetic group of the acyl carrier protein of the malonate
decarboxylases of Malonomomas rubra (BERGet al., 1996) and Klebsiella pneumoniae (SCHMID et al., 1996).
It was first identified as the prosthetic group of Klebsiella pneumoniae citrate (pro-3S)-lyase
(ROBINSON et al., 1976).
0
MdcA (a) MdcD. E (P, r)
89 Malonate
21 Acetate
MdcH 1
HS-ACP
'
94c
HSCoA
0
0u.SCa4
94a
0
90 Malonyl-CoA
Fig. 32. Proposed reaction mechanism for malonate decarboxylation by Klebsiella pneurnoniae. The gene
cluster cosists of eight consecutive genes which have been termed rndcABCDEFGH and the divergently or-
ientated rndcR gene.The anticipated functions of the gene products are as follows (functional subunits of the
enzyme are shown in brackets): MdcA, acetyl-S-acyl carrier protein: malonate acyl carrier protein transferase
(a); MdcB, involved in the synthesis and attachment of the prosthetic group; MdcC, acyl carrier protein
(ACP)(8); MdcD, E , malonyl-S-acyl carrier protein decarboxylase (p, 7);MdcF, membrane protein possibly
involved in malonate transport; MdcC, involved in the synthesis and attachment of the prosthetic group;
MdcH, malonyl-CoA:acyl carrier protein-SH transacylase; MdcR is a protein of the LysR regulator family. It
is probably a transcriptional regulator of the rndc genes (HOENKE et al., 1997).
HS-ACP 94a 0
0 MadB
Ma&
0 H@
A A C P
89 Malonate
@O 8, BCP
96
co2
21 Acetate
94c
Fig. 33. Proposed reaction mechanism for malonate decarboxylation by Malonornonas rubra. The gene clus-
ter contains 14 consecutive genes which have been termed rnadYZGBAECDHKFLMN.7he functions of the
gene products are as follows: MadA, acetyl-S-acyl carrier protein: malonate acyl camer protein-SH transfe-
rase; MadB, carboxybiotin decarboxylase; MadC, D carboxy-transferase subunits; MadE acyl carrier protein
(ACP); MadF, biotin carrier protein (BCP); MadC may be involved in the biosynthesis of MadHl MadH, de-
acetyl acyl carrier protein: acetate ligase; Mad,!. and MadM are membrane proteins which could function as
a malonate carrier.The function of rnadl: Z, K and N is currently unknown (BERGet al., 1997).
72 2 Lyases
is due to the use of assays in which malonate is electron withdrawing substituents were
present in addition to malonyl- and acetyl- present on the the aromatic ring (MIYAMOTO
CoA. This remains to be established definitive- et al, 1992).The generally poorer results with
ly, however, there are striking parallels all substrates bearing aromatic rings with elec-
between some of the subunits identified in the tron donating substituents (e.g., OMe) is prob-
MCDs of these species and those from M. ru- ably only partially a function of slower decar-
bra and K. pneumoniae (DIMROTH and HILBI, boxylation, but is also due to the presence of
1997). alternative degradation pathways (MIYAMOTO
The stereochemistry of decarboxylation of and OHTA,1990, 1991. The purified recombi-
(R)-[l-13C, 2-3H]-malonate by the biotin de- nant enzyme quantitatively converts a-fluoro-
pendent “MCD” of M. rubra (MICKLEFIELD et a-phenylmalonic acid (99) to enantiomerically
al., 1995) and the biotin independent “MCDs” pure (R)-a-fluorophenylacetic acid (100) (Fu-
of l? fluorescens and Acinetobacter calcoaceti- KUYAMA et al., 1999).
cus (HANDAet al., 1999) in deuterium oxide
have been determined. In every case the car-
boxylate group was replaced by hydrogen with 4.1.1.10 Aspartate a-Decarboxylase
retention of configuration. Methods for the
synthesis of chiral malonates used in this study (L-Aspartate 1-Carboxy-Lyase,
are described in the section on fumarases EC 4.1.1.11)
(Sect. 4.2.1.2).
The decarboxylation of malonate to acetate Aspartate a-decarboxylase (AaD) catalyzes
has few biotechnological merits other than for the decarboxylation of L-aspartate (101) to p-
the removal of malonate from situations in alanine (102) (Fig. 35) (WILLIAMSON, 1985). p-
which it may be viewed as a contaminant. Nev- Alanine (102) is a biosynthetic precursor of
ertheless the organisms discussed above pro- pantothenate in bacteria (DUSCHet al., 1999)
duce large amounts of the decarboxylase and is a degradation product of uracil in plants
system and there is great potential for their use and fungi (GANIand YOUNG,1983).
with “unnatural substrates”. A a D is a tetramer in which each monomer
There has been considerable interest in the consists of a six stranded double $ p-barrel
decarboxylation of 2,2-disubstituted malo- capped by small a-helices (ALBERTet al.,
nates, which can potentially give chiral carbox- 1998). This motif is found in several protein
ylic acids (cf. MUSSONS et al., 1999; for related superfamilies and includes enzymes such as
abiotic catalysts). OHTA’Sgroup screened mi- DMSO reductase, formate dehydrogenase and
croorganisms from soil samples on phenylma- the aspartic proteinases (CASTILLOet al.,
lonic acid. This study yielded Alcaligenes bron- 1999). In the X-ray crystal structure catalytic
chisepticus KU 1201,which is capable of asym- pyruvoyl groups were found in three subunits
metric decarboxylation of arylmalonates with and an ester in the fourth. The enzyme is in-
good to excellent enantiomeric excesses (Tab. itially produced as an inactive proenzyme (T-
3) (MIYAMOTO and OHTA,1990,1991). protein) (103; Fig. 36), which undergoes N O -
The gene for the arylmalonate decarboxyl- acyl migration between Gly-24 and Ser-25 to
ase was identified and expressed in E. coli give the amino ester (104). p-elimination of
(MIYAMOTO and OHTA,1992). Remarkably, the p-protein (105) and hydrolysis yields the
the amino acid sequence had no significant ho- catalytically active a-subunit with a terminal
mologies with known proteins and the thiol pyruvoyl residue (107). Purified recombinant
nucleophile was furnished by a cysteine resi- enzyme consisted predominantly of T-protein
due rather than coenzyme A (KAWASAKI et al., (103). Incubation of this at 50 C for 49 hours
O
1995). Hydrophobic interactions with the aro- gave a fully processed tetrameric enzyme con-
matic ring were shown to be especially impor- taining three subunits bearing pyruvoyl
tant for substrate recognition (KAWASAKI et groups. Unchanged serine was found at the
al., 1996a, 1997;OHTA, 1997).Whole cell medi- terminus of some of the a-subunits (106), in
ated decarboxylation gave good results with a- the tetramer, but the exact proportion could
fluoro-a-phenylmalonates, particularly when not be determined (RAMJEEet al., 1997).
Tab. 3. Decarboxylation of a-Aryl-a-Methylmalonates(MIYAMOTO and OHTA,1990)

Alcaligenes bronchisepticus KU 1201
Ar kyiL *? Ar
97 COZ 98
aR=H
bR=CH3
2 CH2Nz
No. Substrate Substrate Yield ee Configuration
Concentration
% % %
1 0.3 87 91 R
2 0.4 93 96 R
3 0.5 90 98 R
4 0.1 48 99 R
5 0.2 35 97 R
6 0.3 95 >95 R
7 0.5 96 >95 R
8 0.3 95 98 R
9 0.5 85 97 R
10 0.3 98 95 S
11 0.5 97 91 S
It has been known for over a hundred years azomethine ylide (111 to 125) which has been
that a-ketoacids catalyze the decarboxylation trapped in abiotic model studies (GRIGGet al.,
of a-amino acids, nevertheless some aspects of 1989). AaD has not yet found applications in
the reaction are still controversial. In principle, biotransformations, however, developments
two zwitterionic imine rotomers (108) (109) such as the the X-ray crystal structure determi-
can be formed. The “syn” rotomer (108) bene- nation and the isolation of large amounts of
fits by an intramolecular hydrogen bond enzyme, should encourage its exploitation.
(BACH and CANEPA,1997), whereas the Histidine decarboxylase, S-adenosylmethio-
“anti”rotomer is able to undergo cyclization to nine decarboxylase and phosphatidylserine
the uncharged oxazolidin-5-one (110),which is decarboxylase all bear catalytic pyruvoyl
an intermediate in the abiotic reaction. Both groups and hence AaD provides an exemplar
rotomers and the oxazolidin-5-one are capable of this class of enzymes.
of eliminating carbon dioxide to give the
(y::
74 2 Lyases
99
mlmalonate
decarboxylase
expressed N.0-acyl migration
co2 in E. coli
0 104
Fig. 34. Alcaligenes bronchisepticus KU 1201 aryl-
malonate decarboxylase expressed in E. coli (MIYA- P-Elimination Ester hydrolysis
MOTO and OHTA,1992) catalyzes the decarboxyla-
tion of a-fluoro-a-phenylmalonic acid (99) to enan-
tiomerically pure (R)-a-fluorophenylacetic acid
(100) in quantitative yield! (FUKUYAMA et al., 1999).
cop
0
/1,
COY 101 L-Aspartate
H3N
coz
I Aspartate a-decarboxylase
105 P-Protein
(2.8 KDa)
@-Elimination?
- &L
t
H3N 102 0-Alanine
Fig. 35. L-Aspartate a-decarboxylase catalyzes the 0 107 a-Protein

decarboxylation of L-aspartate (101) to p-alanine (11.8 kDa)
(102).
Fig. 36. Processing of a-aspartate decarboxylase (T-
protein) (103) to catalytically active a-protein.
4.1.1.11 Aspartate 4-Decarboxylase
(L-aspart ate P-Carboxylase,
tion has been used in various forms for the
L-aspartate 4-Carboxy-Lyase, manufacture of L-alanine, which is difficult to
Desulfinase,EC 4.1.1.12) produce by fermentation. The process has
been optimized with resting cells of Pseudo-
Aspartate 4-decarboxylase catalyzes the de- monas dacunhae grown at pH 7.0-7.5 on gluta-
carboxvlation of L-amartate (101)to L-alanine mate (CALIKet al., 1997) and immobilized on
(111)(Fig. 38) ( C H A ~et
G al.,' 1982).Th'is reac- -
K-carrageenan (CALIKet al., 1999). By using- , -
101 L-Aspartate H
RZ
H2O
@O---H 0 108 H 0 109
0
107 a-Protein 5-endo-trig
cyclisation
0
o,c*o R2
NH3
H 110
102 p-Alanine
H2O
H 0 125 Azomethineylide
Fig. 37. Mechanism of decarboxylation by a-aspartate decarboxylase (107).

D,L-aspartate as substrate both L-alanine and ported on acylonitrile activated silica gel
D-aspartate were produced using whole cells (ABELYAN, 1999; ABELYAN et al., 1991; SENU-
immobilized in carrageenan or enzyme sup- MA et al., 1989). Coimmobilized aspartase and
cells with aspartate decarboxylase activity,
converted fumarate to aspartate which was de-
carboxylation in sifu (ABELYANand AFRIK-
YAN,1997).Remarkably the combined catalyst
was stable for 450-460 days. Aspartate 4-de-
101L-Aspartate carboxylase contains a pyridoxal5 ‘-phosphate
prosthetic group, which is discussed in detail in
Sect. 4.1.1.13, L-Glutamate Decarboxylase.
Aspartate 4-decarboxylase All a-amino acid decarboxylases and most
other amino acid decarboxylases,rely on imine
formation between the amino group of the
amino acid and the carbonyl group of a pyru-
voyl (108) (109), pyridoxal 5’-phosphate or
some other group to promote decarboxyla-
tion. Imine formation is also the first step in
transamination catalyzed by aminotransferas-
Fig. 38. Aspartate-4-decarboxylase. es.?hus by impeding the hydrogen shift step in
76 2 Lyases
transamination and promoting the protona- 40). GABA plays a role in pH regulation, ni-
tion required for decarboxylation, it should be trogen storage and defence in plants (SHELPet
possible to switch an enzyme from transamina- al., 1999) and as a neurotransmitter in mam-
tion to decarboxylation. This has been mals (WAAGEPETERSEN et al., 1999; SCHWARTZ
achieved with an E. coli aspartate aminotrans- et al., 1999). GAD also decarboxylates L-as-
ferase triple mutant (Y225R/R292K/R386A), partate (101)to p-alanine (102).
which catalyzes the 4-decarboxylation of The prosthetic group of GAD is nominally
aspartate eight times as fast as transamination. pyridoxal 5’-phosphate (PLP) (116a),but in
This is a greater than 25 million fold increase common with many other PLP dependent en-
in decarboxylation relative to the wild type enzymes, the usual form of the holoenzyme con-
zyme (GRABERet al., 1999) tains the cofactor bonded to the peptide chain
via an aldimine (116b)formed with an cami-
no group of a lysine residue (reviews, JANSON-
4.1.1.12 Valine Decarboxylase IUS, 1998; JOHN, 1995; HAYASHI, 1995; ALEX-
ANDER et al., 1994).
(L-Valine Decarboxylase, The mechanism and stereochemistry of re-
EC 4.1.1.14) actions catalyzed by E. coli GAD have been
determined by detailed isotope studies (Fig.
Valine decarboxylase catalyzes the decar- 41). The “normal” decarboxylation pathway is
boxylation of L-valine (112)to 2-methylpropan- initiated by imine (117)formation between the
amine (113) (Fig. 39) and also acts on L-leu- PLP-GAD aldimine derivative (116b) and
cine, norvaline and isoleucine.It has a pyridox- glutamate (114). Decarboxylation yields a
a1 5 ’-phosphate (PLP) (116)prosthetic group, quinoid type intermediate (118)which can re-
but seems to have been largely overlooked protonate at two sites. Protonation of the for-
since its discovery (SUTTONand KING,1962). mer C-a-center occurs on the same face as the
C4’-Si side of the quinoid intermedaite and
hence the carboxylate group is replaced by the
4.1.1.13 Glutamate Decarboxylase incoming proton with retention of configura-
(L-Glutamate l-Carboxy-Lyase, tion.The imine (119) so formed, undergoes
metathesis to give the PLP-GAD aldimine de-
EC 4.1.1.15) rivative (116b)and GABA (115).Decarboxyl-
ation may also occur concommitantly with
Glutamate decarboxylase (GAD) catalyzes
the decarboxylation of L-glutamate (114)to 4-
aminobutanoate, which is more widely known
as y-aminobutyric acid (GABA) (115) (Fig.
coz 1 Valine decarboxylase

coz Glutamate decarboxylase
H
$
’ 113 2-Methylpropanamine
Fig. 39. Valine decarboxylase. Fig. 40.L-Glutamate decarboxylase.

H yx H3N @ 114 L-Glutamate H
!E
0pi* 116
Glutamate
decarboxylase
0/
N
I
a X = 0, PLP
b X = N-&-lysine -7- u n,.
I
H,N@ 115 GABA
0
HzOor H3N-E-lysine coz
H\Ht/JIO o
I
C-aprotonation
Non-oxidative
I I
118
H 119 decarboxylation H
f?
. oo
121 Succinate
semialdehyde
2 0
03p
H 122 PMP H 120

Fig. 41. The mechanism of decarboxylation by L-glutamate decarboxylase. Abbreviations: GABA, y-amino-
butyric acid (115);PLP, pyridoxal 5'-phosphate (116);PMP, pyridoxamine 5'-phosphate (122). In this and
other diagrams showing PMP derivatives, the phenolic hydroxyl group-imine interaction [(117)-(120)] is
shown as a hydrogen bond (dotted line) for the purposes of simplicity. On the basis of solution phase pK,'s, a
protonated imine-phenoxide interaction would be a more accurate depiction.
78 2 Lyases
transamination (cf. KHRISTOFOROV et al., racemase from Lactobacillus brevis ATCC-

1995).C-4 '-%face protonation of the quinoid 8287. The L-glutamate was then converted to
intermedaite (119) gives the imine (120), GABA using GAD from E. coli ATCC-11246
which hydrolyzes to succinate semialdehyde which enabled the unreactive D-glUtamate to
(121) and stereospecifically labeled PMP (122) be isolated (YAGASHIand OZAKI,1998).
in a single turnover process (TILLEYet al.,
1992,1994). A similar pathway occurs with a-
methylglutamate (123) (Fig. 42), which is oxi-
datively deaminated to levulinate (124) in a 4.1.1.14 Ornithine Decarboxylase
multi-turnover catalytic process which re- (EC 4.1.1.17)
quires dioxygen (BERTOLDI et al., 1999).
PLP dependent aminotransferases have a Ornithine decarboxylase (ODC) is a PLP
Ser-X-Ala-Lys sequence in the active site, dependent enzyme, which catalyzes the decar-
whereas decarboxylases have a Ser-X-His-Lys boxylation of L-ornithine (127) to putrescine
sequence. The lysine residue is responsible for (128)(1,4-diaminobutane) (Fig. 43). It also de-
aldimine formation and C-4 '%-face protona- carboxylates L-lysine, but more slowly (SWAN-
tion of the quinoid intermedate (118),whereas SON et al., 1998). ODC has been heavily inves-
the histidine binds the a-carboxylate groups tigated because putrescine (128) and the next
and protonates at C-a (GANI,1991, SMITHet highest homolog, cadaverine, (which is derived
al., 1991). Human GAD consists of two iso- from L-lysine) are precursors of polyamines
forms (GAD65 and GAD67; SCHWARTZ et al., (e.g., spermideine and spermine; MORGAN,
1999), which closely resemble aspartate trans- 1999), which are accumulated in cancer cells
aminase and ornithine decarboxylase (Qu et and stimulate proto-oncogene expression (TA-
al., 1998). BIB and BACHRACH, 1999). ODC is the rate
GAD has been used extensively for the the limiting enzyme in polyamine biosynthesis and
stereospecific synthesis of GABA hydrogen its activity is down regulated by increasing
isotopomers (115) (YOUNG,1991; BA'ITERSBY polyamine levels which accelerate degradation
et al., 1982b) and for the synthesis of D-gluta- (TOTHand COFFINO,1999; DI GANGIet al.,
mate. L-glutamate produced by fermentation 1987). ODC is widely distributed and well es-
was racemized with recombinant glutamate tablished methods are available for its isola-
tion from E. coli (MORRISand BOEKER, 1983),
Physarum polycephalum (MITCHELL,1983),
yeast (TYAGIet al., 1983), germinated barley
seeds (KYRIAKIDIS et al., 1983),mouse kidney
(SEELYand PEGG,1983), rat liver (HAYASHI
and KAMEJI,1983)
CO'i> 123 a-Methylgiutamate X-ray crystal structures have also been de-
termined for mouse ODC (KERNet al., 1999),
Lactobacillus-30a ODC (L30a OrnDC; Mo-
Glutamate decarboxylase MANY et al., 1995) and Trypanosoma brucei
ODC as the native enzyme and as a complex
(GRISHIN et al., 1999) with the suicide inhibitor
a-difluoromethylornithine (SEELYet al., 1983).
Trypanosoma brucei is the causative agent of
African sleeping sickness and its ODC is a rec-
ognized drug target (MCCANNet al., 1983).
These are large enzymes with disparate, com-
plex, multimeric structures.The active site lies
at the interface of a dimers and PLP is bound
as an aldimine with the &-aminogroup of a ly-
Fig. 42. Oxidative decarboxylation of a-methylgluta- sine residue (e.g., Lys-60 for Trypanosoma bru-
mate (123) by glutamate decarboxylase. cei O D C OSTERMAN et al., 1999, 1997) as is
?NH3 FNH3
“/t- Cop 129 a-Methylomithine
I
H3N
Omithine decarboxylase
Omithine decarboxylase
co2
0
L
ol
INH3 f-NH3
H3@4
H1N
128 Putrescine
Fig. 43. Ornithine decarboxylase (ODC) catalyzed

0 6 130
decarboxylation of L-ornithine (127) to putrescine
(128).
found for GAD and most other a-amino acid

decarboxylases.
L-Ornithine (127) undergoes decarboxyla-
CL
tion by ODC, such that the carboxylate group
is replaced by hydrogen with retention of con-
figuration (ORRand GOULD,1982) This reac- N 1312-Methyl- I-pyrroline
tion has been for the stereospecific ‘yn- fig. 44.Ornithine decarboxylase catalyzed oxidative
thesis of putrescine hydrogen isotopomers decarboxylation of a-methylornithine (129) to 2-
(YOUNG,1991). a-Methylornithine (129) (Fig. methyl-l-pymoline (131).
44) undergoes oxidative decarboxvlation with
ODC in t i e presence of dioxygen to give the
ammonium ketone (130) which cyclizes to 2-
methyl-l-pyrroline (131) (BERTOLDIet al., Selenomonas ruminantium lysine decarboxyl-
1999). ase, catalyzes both reactions with similar ki-
netics parameters (TAKATSUKAet al., 1999a,
b). Most workers have utilized lvsine decar-
4.1.1.15 Lysine Decarboxylase boxylase from Bacillus cadaveris-or the con-
stitutive enzyme from E. coli (BOEKER and
(L-Lysine Carboxy-Lyase, FISCHER,1983), but a second form has been
EC 4.1.1.18) identified recently (LEMONNIER and LANE,
1998; YAMAMOTO et al., 1997). Lysine decar-
Lysine decarboxylase is a PLP dependent boxylases decarboxylates L-lysine (132) such
enzyme, which catalyzes the decarboxylation that the carboxylate group is replaced by hy-
of L-lysine (132) to cadaverine (133) (Fig. 45) drogen with retention of configuration (ORR
in a reaction which is homologous with that of et al., 1982;BATTERSBY et al., 1982a).This reac-
ornithine decarboxylase (Fig. 43). Most forms tion has been used for the stereospecific syn-
of both enzymes are capable of catalysing both thesis of cadaverine hydrogen isotopomers
reactions, to some degree, however, unusually (YOUNG,1991).
80 2 Lyases
("'H
Lysine decarboxylase
COZ Arginine decarboxylase
I "
i-
COZ
("'H
133 Cadaverine
Fig. 45. Lysine decarboxylase (ODC) catalyzed de-

carboxylation of L-lysine (127) to cadaverine (128)
(1,5-diaminopentane).
0
H,N
J 135 Agmatine
Fig. 46. Arginine decarboxylase (ADC) catalyzed

decarboxylation of L-arginine (134) to agmatine
4.1.1.16 Arginine Decarboxylase (135)(4-aminobut~lguanidine).
(L-Arginine Carboxy-Lyase,
EC 4.1.1.19) elate (136)to L-lysine (132)(Fig. 47), which is
the last step in the biosynthesis of L-lysine
Arginine decarboxylase catalyzes the decar- from L-aspartate and pyruvate (SCAPINand
boxylation of L-arginine (134) to agmatine BLANCHARD, 1998; C H A ~ R J E E1998).
, meso-
(135)(4-aminobutylguanidine) (Fig. 46). It is a 2,6-Diaminopimelate (136) is a cross-linking
PLP dependent enzyme which decarboxylates constituent of the peptidoglycans of virtually
L-arginine such that the carboxylate group is all gram-negative and some gram-positive bac-
replaced by hydrogen with retention of config- teria. L-Lysine is an essential dietary amino ac-
uration (ORR et al., 1982). As with the other id for mammals, because they lack the di-
basic amino acid decarboxylases, it has been aminopimelate pathway, hence inhibitors of
used to prepare agmatine hydrogen isotopom- the enzymes of this pathway could have anti-
ers (YOUNG,1991; RICHARDSand SPENSER, microbial or herbicidal properties with low
1983). mammalian toxicity (SONGet al., 1994).
Incubation of rneso-2,6-diaminopimelate
(136)with diaminopimelate decarboxylase in
4.1.1.17 D iaminopimelate deuterium oxide yields (2S,6R)-[6-*Hl]-lysine
Decarboxylase (meso-2,6- and hence the decarboxylation occurs such
that the incoming hydrogen replaces the car-
Diaminoheptanedioate Carboxy- boxylate group with inversion of stereochem-
Lyase, EC 4.1.1.20) istry (ASADA et al., 1981; KELLARDet al.,
1985). This result is unusual because PLP de-
Diaminopimelate decarboxylase catalyzes pendent enzymes, such as diaminopimelate de-
the decarboxylation of meso-2,6-diaminopim- carboxylase generally catalyze decarboxyla-
H 137 L-Histidine
Histidine decarboxylase
COZ
Diaminopimelate decarboxylase
C 0 2 1
H 138 Histamine
Fig. 48. The histidine decarboxylase catalyzed decar-
boxylation of L-histidine (l37)to histamine (138).
tamine (138) (Fig. 48). Most forms of the en-

Fig. 47. Diaminopimelate decarboxylase catalyzed zyme have a pyruvoyl group at the active site,
decarboxylation of meso-2,6-diaminopimelate(me- however, PLP dependent forms are present in
so-2,6-diaminoheptanedioate)(136) to L-lysine Klebsiella planticola, Enterobacter aerogenes
(132). (KAMATHet al., 1991) and Morganella morga-
nii (SNELLand GUIRARD, 1986).
Pyruvoyl-dependent HDCs are produced by
tion with retention of configuration. However, Lactobacillus buchneri, Clostridium perfring-
the center undergoing decarboxylation has the ens, Micrococcus sp.n., Leuconostoc oenos
(R)-configuration rather the (S)-configuration 9204 (COTONet al., 1998) and Lactobacillus
which is typical of most natural amino acids, 30a (SNELL,1986) All of these enzymes show
consequently with a similar mode of binding high sequence homology and have probably
for the two enantiomers the hydrogen is deliv- evolved from a common ancestral protein.
ered from the same side. Stereospecific syn- Lactobacillus 30a HDC has been studied ex-
thetic routes to meso-2,6-diaminopimelate tensively and the X-ray crystal structure deter-
(136) and other stereoisomers (WILLIAMS and mined (PARKSet al., 1985; GALLAGHER et al.,
YUAN, 1992) have been reported and decar- 1993). Lactobacillus 30a HDC is formed from
boxylatian has been used to prepare a range of hexameric prohistidine decarboxylase ( n6;
hydrogen isotopomers (ASADAet al., 1981; SNELLand HUYNH,1986), by autoproteolysis
KELLARD et al., 1985;YOUNG,1991), but other between Ser-81 and Ser-82 and elimination to
synthetic opportunities remain to be exploit- give a “N”-terminal pyruvoyl group derived
ed. from Ser-82 (the a-chain; cf. Fig. 36.), plus the
remainder of the peptide chain with a normal
terminal carboxylate group (the P-chain). The
4.1.1.18 Histidine Decarboxylase a- and P-chains are tightly bound together and
three of these subunits form a trimer, which
(Histidine Carboxy-Lyase, binds to a second trimeric unit to give a dumb-
EC 4.1.1.22) bell shaped hexamer; (ab)6 (GALLGGHERet
al., 1993).Each pyruvoyl group lies in an active
Histidine decarboxylase (HDC) catalyzes site at the interface between two subunits in a
the decarboxylation of L-histidine (137) to his- trimer (GELFMAN et al., 1991;PISHKOand RO-
82 2 Lyases
BERTUS, 1993). Decarboxylation of L-histidine is higher than that of any other enzyme de-
(137) by HDC occurs with retention of config- scribed thus far. To appreciate the magnitude
uration (BATTERSBY et al., 1980; BATTERSBY,of catalysis;consider that orotic acid is estimat-
1985; SANTANIELLOet al., 1981;YOUNG,1991). ed to have a half life for decarboxylation of
some 78 million years, in neutral aqueous solu-
tion at room temperature (MILLERet al.,
4.1.1.19 Orotidine-5'-Phosphate 1998). The precise origin of the catalytic effi-
ciency is currently an enigma (EHRLICHet al.,
Decarboxylase (ODCase, Orotidine 1999).
5 '-Monophosphate Decarboxylase
[OMP], Orotidine-5 '-Phosphate
4.1.1.20 Tyrosine Decarboxylase
Carboxy-Lyase,EC 4.1.1.23)
(L-Tyrosine Carboxy-Lyase,
Orotidine-5 '-phosphate decarboxylase EC 4.1.1.25)
(OPD) catalyzes the decarboxylation of oroti-
dine 5'-phosphate (139) to uridine 5 '-phos- Tyrosine decarboxylase (TDC) catalyzes the
phate (140) (Fig. 49), which is the final step in decarboxylation of L-tyrosine (141a) to tyra-
de n o w pyrimidine biosynthesis (GAO et al., mine (142a) and L-DOPA (141b) to dopamine
1999a). This reaction is especially notable be- (142b).(Fig. 50). TDC is a common plant en-
cause OPD catalysis increases the rate by a zyme involved in the synthesis of numerous
factor of 1017over the spontaneous rate, which secondary metabolites. Tyramine (142a) is a
desirable flavoring in small amounts a range of
food products including wine, cheese and sau-
sages (MORENO-ARRIBAS and LONVAUD-Fu-
NEL,1999),and (together with dopamine) a bio-
synthetic precursor of numerous alkaloids in
. .$
HO OH 139 Orotidine
5'-phOsphate
141
a R = H; L-Tyrosine
Orotidine 5'-phosphate b R = OH;L-DOPA
decarboxylase
COZ
C O 2 1 Tyrosine decarboxylase
142
J .+ aR = H; Tyramine
HO OH 140Uridine b R = OH; Dopamine
5'-phosphate
Fig. 50. The tyrosine decarboxylase catalyzed decar-
Fig. 49. The orotidine 5 '-phosphate decarboxylase boxylation of L-tyrosine (1411) to tyramine (142a)
(ODC) catalyzed decarboxylation of orotidine 5 '- and L-DOPA (3,4-dihydroxyphenylalanine) (141b)
phosphate (l39)to uridine 5'-phosphate (140). to doparnine (142b).
plants (FACCHINI, 1998).TDC is a PLP depen- 4.1.1.21 Aromatic L-Amino Acid

dent enzyme and catalyzes decarboxylation
such that the departing carboxylate group is
Decarboxylase (DOPA
replaced by hydrogen with retention of config- D ecarboxylase, Tryptophan
uration. This reaction has been used to prepare Decarboxylase, Hydroxytryptophan
tyramine hydrogen isotopomers (BELLEAU et
al., 1960; BELLEAUand BURBA,1960; YOUNG, Decarboxylase, EC 4.1.1.28)
1991).
TDC has been utilized in a multi-enzyme Aromatic L-amino acid decarboxylase
process for the production of dopamine (142b) (AAAD) catalyzes the decarboxylation of L-
from catechol. Condensation of catechol, pyru- tryptophan (143a) to tryptamine (144a); 5-hy-
vate and ammonia catalyzed by tyrosine phe- droxy-L-tryptophan (143b) to serotonin (144b)
nol-lyase gave L-DOPA (14lb),which was de- (Fig. 51) and L-DOPA (3,4-dihydroxyphenylal-
carboxylated with rat liver L-DOPA decarbox- anine) (141b) to dopamine (142b) (Fig. 50).
ylase or Streptococcus fueculis TDC. The L- Prior to 1984 the enzyme commission recog-
DOPA decarboxylase was inhibited by L- nized DOPA decarboxylase (EC 4.1.1.26) and
DOPA concentrations greater than 1 mM, tryptophan decarboxylase (EC 4.1.1.27). How-
whereas TDC was unaffected up to 40 mM, ever, these distinctions are not warranted by
consequently TDC was selected for further de- the selectivity of the enzymes and they have
velopment. Decarboxylation was carried out now been incorporated into the AAAD sub-
in an enzyme reactor at 37 “ C for 12 h, with pH subsubclass.AAADs also generally,have some
control by addition of hydrochloric acid and phenylalanine decarboxylase (EC 4.1.1.53) ac-
supplements of PLP to compensate for decar- tivity, and conversely,phenylalanine decarbox-
boxylative transamination. At 100 mM L- ylases generally have some activity with L-
DOPA (141b), conversion to dopamine (142b) DOPA (141b), tryptophan (143a) and 5-hy-
was quantitative. When the decarboxylation droxy-L-tryptophan (143b). AAADs are also
was run with in situ synthesis of L-DOPA, the
productivity was much lower than with two
consecutive “single pot” reactions. (LEE et al.,
1999a, b). The same process has also been run
with whole cells expressing the relevent en-
zymes. Erwiniu herbicolu cells with phenol ty-
rosine-lyase activity and Streptococcus faeculis H 143
cells with TDC activity (ANDERSONet al., a R = H; L-Tryptophan
1987) were coimmobilized in glutaraldehyde
crosslinked porcine gelatin beads and placed
in a packed bed reactor together with catechol,
I b R = OH; 5-Hydr0xy-L-tryptophan
Aromatic L-amino
pyruvate and ammonia, Dopamine was pro- acid decarboxylase
duced but the conversion was low (ANDERSON
et al., 1992a,b). These processes are discussed
in greater detail in the section describing phe-
nol tyrosine lyase (Sect. 4.1.4.2).
I
H 144
a R = H; Tryptamine
b R = OH; Serotonin
Fig. 51. The aromatic L-amino acid decarboxylase
catalyzed,decarboxylationof L-tryptophan (143a) to
tryptamine (144s) and 5-hydroxy-L-tryptophan
(143b) to serotonin (5-hydroxytryptamine)(144b).
84 2 Lyases
frequently described as L-DOPA decarboxyl-

ases. Typically, the ratio of activity of an cop
AAAD between L-DOPA (141b) and 5-hy-
HO
droxy-L-tryptophan (143b) is 5: 1 (JEBAIet al.,
1997). The plurality of substrates decarboxyl- 145 a-Methyl-L-DOPA
ated by AAADs suggests that a mixtures of
enzymes or isozymes may be responsible for Aromatic L-amino
the activity,but at least with the well character- acid decarboxylase
ized enzymes from pig kidney and rat liver the co2
vast majority of the data indicates that activity
is due to a single protein.
AAAD is present in fungi (NIEDENDet al.,
1999), plants, insects, fish (NAGAIet al., 1996)
and mammals (ZHU and JUORIO, 1995;
POUPONet al., 1999). In mammals, AAAD
clearly plays a role in the biosynthesis of the
neurotransmitters; serotonin (144b) and L- 146 a-Methyldopamine
DOPA (141b), but other roles have been sug-
gested including the prevention of apoptosis Aromatic L-amino
acid decarboxylase
(BERRYet al., 1996;ZHUand JUORIO,1995).
There are reliable methods for the extrac- 0 2
tion of pig kidney AAAD (VOLTATTORNI et
al., 1987; DOMINICI et al., 1993),but instability
and low specific activity limit the availability.
Expression of the gene in E. coli gives protein
with twice the specific activity of the extracted
enzyme and each dimer binds two molecules
of PLP rather than one as with the extracted 147 3.4-Dihydroxyphenylacetone
enzyme. It appears that the latter contains PLP
bound covalently in an non-catalytically active Fig. 52. The oxidative deamination of a-methyl-DO-
PA (145) produces 3,4-dihydroxyphenylacetone
form (MOOREet al., 1996) and the differences (147),which deactivates AAAD.
between the two forms are apparent in recent-
ly reported preliminary crystal structure data
(MALASHKEVICH, 1999).Extraction of rat liver acetone (147), which irreversibly inactivates
or kidney AAAD (SOURKES, 1987) has also the enzyme by formation of a ternary adduct
been supplanted by expression of the gene in with PLP and an active site lysine residue
E. coli, but in this case the recombinant pro- (BERTOLDI et al., 1998).
tein is kinetically identical to the extracted
protein (JEBAIet al., 1997).
As with all other PLP dependent, L-amino 4.1.1.22 Phosphoenolpyruvate
acid a-decarboxylases, decarboxylation occurs
such that the carboxylate group is replaced by Carboxylases and Carboxykinases
hydrogen with retention of configuration (e.g., (EC 4.1.1.31,32,38,49)
5-hydroxy-~-tryptophan,(143b) BATERSBY et
al., 1990).Despite the ability of AAAD to ac- There are four lyases which catalyze the car-
comodate a wide ring off substrates it has boxylation of phosphoenolpyruvate (PEP)
barely been exploited for biotransformations, (148) (Fig. 53) to oxaloacetate (28) and the re-
presumably because of its limited availability verse reaction (Tab. 4). PEP is an excellent
until recently. a-Methyl-L-DOPA (145) under- phosphate donor which is frequently used for
goes decarboxylation as expected to give a- recycling ADP to A n . An efficient mole scale
methyldopamine (146) (Fig. 52), this is oxida- chemical synthesis has been reported
tively deaminated to give 3,4-dihydroxyphenyl- (HIRSCHBEIN et a1,1982).
lize four nucleotides with the following

V,,/K, values (M-ls-') ATP ( 6 4 , GTP
(1.30), CTP (0.87), ITP (0.66). Decarboxyla-
tion is fully reversible and hence it may be
used to incorporate isotopic labels (e.g., "C)
into oxaloacetate (28) (SALVARREY et al., 1995;
enolpyruvate TARIet al., 1996).
It
4.1.1.23 Phenylpyruvate
Decarboxylase (Phenylpyruvate
Carboxy-Lyase,EC 4.1.1.43)
Phenylpyruvate decarboxylase catalyzes the
decarboxylation of phenylpyruvate (149) to
0 0 28Oxaloacetate phenylacetaldehyde (150) (Fig. 54) and also
Fig. 53. The carboxylation of phosphoenolpyruvate has Some activity with indole pyruvate (see
(14) to give oxaloacetate (28) catalyzed by phos- Sect. 4.1.1.26). This reaction is the second step
phoenolpyruvate carboxylases (PEP-CL) and car- in the catabolism of phenylalanine, which com-
boxykinases (PEP-CK). Cofactors are not shown, mences with transamination to form phenyl-
see Fig. 54. pyruvate. Moreover the decarboxylation is ho-
Tab. 4. Phosphoenolpyruvate Carboxylases and Carboxykinases
ECNo. Name Phosphate Donor Other Products

Phosphoenolpyruvate-
4.1.1.31 -carboxylase Orthophosphate H20

4.1.1.32 -carboxykinase GTP GDP
4.1.1.38 -carboxylase Pyrophosphate Orthophosphate
4.1.1.49 -carboxykinase ATP ADP
PEP-carboxylases (CL) are present in mologous to benzoylformate decarboxylation

plants, algae and bacteria, but the properties which is a later step in the same pathway (Sect.
vary widely depending on the source (YANOet 4.1.1.7) (SCHNEIDER et al., 1997; BARROWMAN
al., 1995). PEP-CL is especially important in and FEWSON, 1985). This reaction is virtually
C, plants, where it catalyzes the initial step of unexplored, but there is the prospect that trap-
photosynthetic carbon fixation (Hatch-Slack ping with an aldehyde could be used to form
pathway; LEPINIECet al., 1994). PEP-CL will an acyloin as observed with benzylformate de-
accept phosphate donors other than PEP, such carboxylase (Fig. 26).
as 2-phosphoenolbutyrate and phosphoenol-3-
fluoropyruvate, but dephosphorylation with-
out carboxylation is the predominant reaction 4.1.1.24 Tartronate Semi-Aldehyde
(GONZALEZ and ANDREO,1988).
The carboxykinases (CK) are assigned on Synthase [Glyoxylate Carboxy-
the basis of their ability to utilize GTP or ATP, Lyase (dimerizing), EC 4.1.1.471
but both nucleotides or others may show some
activity with a given enzyme. An extreme ex- Tartronate semi-aldehyde synthase catalyz-
ample is provided by the PEP-CK from the es the decarboxylation of glyoxylate (El)and
halophile Vibrio costicolu, which is able to uti- condensation with another molecule of glyox-
86 2 Lyases
synthase or the serine pathway to assimilate

oxalate and oxalyl-CoA decarboxylase and
formate dehydrogenase for oxidation of oxa-
late (ZAITSEV et al., 1993).Glycine fed to Pseu-
domonas fluoresens, is converted to glyoxy-
late, and proccessed to the antibiotic obafluor-
enolpyruvate
in via the tartronate semi-aldehyde pathway
(HERBERT and KNAGGS, 1992).
4.1.1.25 Dialkylglycine
Decarboxylase [2,2-Dialkylglycine
Decarboxylase (Pyruvate),
EC 4.1.1.641
0 0 280xaloacetate
Dialkylglycine decarboxylase (DAGD)
Fig. 54. The phenylpyruvate decarboxylase catalyzed
decarboxylation of phenylpynwate (28) to phenyl- from Pseudomonas cepacia catalyzes the oxi-
acetaldehyde (148). dative decarboxylation of dialkyl glycines
(153) to ketones (39) (Fig. 56) and the PMP
ylate to give tartronate semi-aldehyde (152) (122) form of the enzyme.Transamination with
(Fig. 55),in a reaction analogous to the acyloin a-ketoacids such as pyruvate (1) regenerates
condensation of pyruvate (Fig. 2). The enzyme the “internal imine” (116b) and an amino acid
is reported to be a flavoprotein, although a such as L-alanine (111).Thus this enzyme cata-
TPP prosthetic group would be expected. This lyzes two classical PLP-dependent reactions
reaction forms part of the tartronate pathway, (cf. Fig. 41), with different substrates.
which is utilized by many organisms for the DAGD is a tetramer which resembles apar-
metabolism of glyoxylate. The strictly anerob- tate aminotransferase. In solution, it consists of
ic, obligatory oxalotrophic bacterium, Bacillus two conformers of differing activity (ZHOU
oxalophilus, utilizes tartronate semi-aldehyde and TONEY,1999). The equilibrium between
the two conformers is perturbed by alkali met-
n al ions. Li+ and Na+, act as inhibitors, whereas
K+ and Rb+ are activators. Similarly the en-
zyme adopts two different conformational
forms in the crystalline state, depending on the
alkali metal ion present (TONEYet al., 1995;
Tartronate I HOHENESTER, et al., 1994). It is generally pre-
semi-aldehyde
synthase
sumed that the conformers observed in the
crystal structures correspond to those in solu-
tion. However, crystal structures of DAGD
COZ 0 151 Glyoxalate bound to other inhibitors (e.g., l-aminocyclo-
propane carboxylate (162)), show only the “ac-
tive” K+/Rb+ conformer (MALASHKEVICH,
H
1999).
As with other PLP-dependent decarboxyl-
on ases, non-oxidative decarboxylation may also
occur with DAGD. The ratio between non-oxi-
152 Tattronate semi-aldehyde dative and oxidative decarboxylation is deter-
Fig. 55. The acyloin condensation of glyoxalate (151) mined by the propensity of the enzyme to pro-
to give tartronate semi-aldehyde (152),catalyzed by tonate the quinoid intermediate (118 Fig. 41)
tartronate semi-aldehyde synthase. at C-a and C-4’, which in turn is a function of
153 Dimethylglycine 39 Acetone (entries 4,5), which has low and comparable
reactivity to L-phenylglycine(157) (entry 6). D-
Phenylglycine is not a substrate.
Most extraordinarily, 1-aminocyclopropane
carboxylate (162), forms an imine with the
PLP group, but does not undergo decarboxyla-
tion. The X-ray crystal structure of this adduct
shows the aldimine bond is out of the plane of
the pyridinium ring (cf.117, Fig. 41) and thus is
unable to act as an electron sink for the pair of
electrons produced by decarboxylation (MAL-
ASHKEVICH, 1999).
This enzyme has tremendous potential for
the resolution of a-methyl and other a-alkyl
I t - amino acids, which are poor substrates with
amidases and proteases.
4.1.1.26 Indolepyruvate
Decarboxylase (EC 4.1.1.72)
H 116 H 122PMP
a X = 0,PLP Indolepyruvate decarboxylase (IDPC) cata-
b X = N-E-lysine lyzes the decarboxylation of indole-3-pyruvate
(163) to indole-3-acetaldehyde (164) (Fig. 57).
Phenylpyruvate decarboxylase (EC 4.1.1.43)
also catalyzes this reaction. In bacteria, L-tryp-
tophan (143a) is converted to indole-3-acetic
acid (165) by two pathways; the indole-3-acet-
amide pathway (EMANUELE and FITZPATRICK,
1995) and the indole-3-pyruvate pathway
(MANULIS et al., 1998). The latter commences
with the transamination of L-tryptophan
(143a)to indole-3-pyruvate (163) (KOGAet al.,
1994; GAOet al., 1997), followed by decarbox-
ylation to indole-3-acetaldehyde (164) and ox-
111 L-Alanine 1 Pyruvate idation to indole-3-acetic acid (165).In yeast, a
Fig. 56. Dialkylglycine decarboxylase (DAGD) cata- similar pathway is followed except that indole-
lyzed oxidative decarboxylation of dimethylglycine 3-acetaldehyde (164) is reduced to indole-3-
(153) to acetone (39). Pyruvate (1)is the preferred ethanol (tryptophol, IRAQUIet al., 1999;FURU-
substrate for transaminating the PMP-form of the KAWA et al., 1996).The biosynthesis of indole-
enzyme to the “internal” imine (116b). 3-acetic acid (165) in plants has been exten-
sively investigated because of its importance
the fit of the substrate to the active site. Di- as a plant growth regulator, nevertheless im-
methylaminoglycine (153) is the best substrate portant aspects of this pathway remain to be
for DAGD (Tab. 5, entry 1). Larger alkyl elucidated (KAWAGUCHI et al., 1996). Conse-
groups can be accommodated (entries 2 and quently, much of the discussion that follows
3), but replacement of an a-alkyl group by hy- will deal with bacterial species, particularly
drogen (entries 4-7) or carboxylate (entries 9, those that are plant pathogens or are root as-
10) results in appreciable non-oxidative decar- sociated. Many of these organisms overpro-
boxylation (SUN et al., 1998a, b). L-Alanine duce indole-3-acetic acid (165) in culture when
(111) is more reactive than D-alanine (156) fed supplementary L-trytophan (143a) and
Tab. 5. Decarboxylation and Transamination Catalyzed by Dialkylglycine Decarboxylase m
m
Entry Substrate Decarboxylation Non-Oxidative Transamination

Decarboxylation
h,
kca; (s-l) kcat/& (M-lS-') (%) kc,; 6-7 k,;& (M-k')
1 153 25 (1) 7.2 (0.5). lo3 < 0.001 na na

2 154 0.98 (0.03) 2.2 (0.2) . 102 < 0.01 na na
3 155 2.3 (0.2) 43 (3) < 0.01 na na
4 111 3.3 (0.3). lo-' 4.7 (0.7) 9.8 (3.0) 21 (2) 3.5 (0.6) . 103
5 156 0.20 (0.02) 28 (5) 3.7 (0.2) < 10-5 nd
6 157 0.20 (0.03) 24 (5) 5.8 (0.8) nd nd
7 158 1.2 (0.1). 1 0 - ~ 5.2 (0.9). < 1.5 2.5 (0.3). 10-4 1.1(0.2). 10-3
8 159 na na na 7.2 (0.5) . 7.7 (1.0) . lo-'
9 160 7.98 (0.8). 10-3 1.1(0.2) 56 (9) na na
10 161 25 (6) . 0.11 (0.03) 94 (6) nd nd
Estimated errors are shown in brackets (SUN et al., 1998a,b)
H3N"Xc0y H3N
0 2
C 00 H3N
OQcoF H3
dCO-
F H30
H3:Acoy YCO?
153 Dimethylglycine 154 1-Aminocyclopentane 155 1-Aminocyclohexane 111L-Alanine 156 D-Alanine 157 L-Phenylglycine
carboxylate carboxylate
u
161 Aminomalonate 162 1-AminocycIopropane
carboxylate
ONH, 1998),the plant gall inducer, Erwinia herbicola

(BRANDL and LINDOW, 1996,1997), seven spe-
cies of Enterobacteriaceae (ZIMMERet al.,
1994) and Enterobacter cloacae (KOGAet al.,
1991) and IDPC activity has been detected in
Bradyrhizobium elkanii (MINAMISAWA et al.,
1996).The IDPC gene from the plant associat-
H 143a L-Tryptophan
ed bacterium Enterobacter cloacae, has been
expressed in E. coli and the enzyme character-
ized. It is a tetramer which is TPP and magne-
sium dependent. IDPC is inactive with indole-
3-lactate and oxaloacetate (33), but does de-
carboxylate pyruvate (1)(19% activity relative
to indolepyruvate) (KOGA,1995; KOGAet al.,
1992).Although there have been no synthetic
applications of this enzyme thus far, the activ-
O0 ity with pyruvate suggests the enzyme should
be fairly substrate permissive and clearly there
are excellent prospects for acyloin formation.
Whole organism multi-enzyme processes may
H 163 Indole-3-pyruvate also be possible. The aminotransferase from
Candida maltosa accepts a range of fluoro-
and methyl-tryptophans (BODE and BIRN-
4
Indolepyruvate lyase BAUM, 1991). Indolepyruvate ferredoxin oxi-
doreductase catalyzes the oxidative decarbox-
ylation of arylpyruvates (SIDDIQUI et al., 1997,
co2 1998).
4.1.2 Aldehyde-Lyases (EC 4.1.2)

Aldehyde lyases are enzymes which cata-
lyze the cleavage of alcohols to carbanions and
H 164 Indole-3-acetaldehyde aldehydes. The vast majority are aldolases, in-
volved in carbohydrate metabolism. Two ex-
amples (involving non-carbohydrates) are
provided here for illustrative purposes.
4.1.2.1 Threonine Aldolase

(L-Threonine Acetaldehyde-Lyase,
EC 4.1.2.5)
Threonine aldolase is a PLP-dependent en-
zyme which catalyzes the retro-aldol cleavage
H
O
& of L-threonine (166) to acetaldehyde (2) and
H 165 Indole-3-acetic acid glycine (158) (Fig. 58). A similar reaction oc-
curs with serine, but the enzyme is both PLP
Fig. 57. The indole-3-pyruvate pathway for the con- and tetrahydrofolate dependent and is classi-
version of L-tryptophan (143a) to indole-3-aceticac- fied as serine (or glycine) hydroxymethyl-
id (165).
transferase (EC 2.1.2.1). This enzyme also acts
90 2 Lyases
4 aR=H 167
bR=OH
Threonine aldoiase
COZ Fig. 59. The mandelonitrile lyase or hydroxymande-
lonitrile lyase catalyzed addition of cyanide to benz-
aldehyde (4a) or p-hydroxybenzaldehyde (4b) to
give mandelonitrile (167a) or (p-hydroxy)mande-
lonitrile (167b).
H 2 Acetaldehyde
of cyanogenic glycosides which are utilized for
protection against predators (WAGNERet al.,
1996). The synthetic potential of this reaction
has been reviewed in Chapter 6 of Volume 8a
Fig. 58. The threonine aldolase catalyzed retro-aldol of the Biotechnology series (BUNCH, 1998) and
cleavage of L-threonine (166) to acetaldehyde (2)
and glycine (158). elsewhere (POCHLAUER, 1998; FESSNER, 1998;
FESSNER and WALTER,1997; EFFENBERGER,
1999).
on L-threonine (166) (OGAWAand FUJIOKA,
1999). Perhaps surprisingly, enzymes have
been isolated that can transform all four ster- 4.1.3 0x0-Acid-Lyases (EC 4.1.3)
eoisomers of threonine. In most cases, recogni-
tion of the a-amino acid center (i.e., D- or L-) is 0x0-acid-lyases catalyze the cleavage of a-
fairly specific, but recognition of the stereo- hydroxy carboxylic acids to a-carbonyl car-
chemistry of the carbon bearing the hydroxyl boxylic acids and carbanions in a retro-aldol
group is more relaxed (WADAet al., 1998; KA- type reaction. This subsubclass includes sever-
TAOKA et al., 1997). These enzymes are dis- al enzymes from the citric acid (Krebs) cycle
cussed in detail in Chapter 1, this volume: Car- and related pathways.
bon-Carbon Bond Formation Using Enzymes.
4.1.3.1 Isocitrate Lyase (Isocitrate

4.1.2.2 Mandelonitrile Lyase Glyoxylate-Lyase,Isocitrase,
(EC 4.1.2.10) and EC 4.1.3.1)
Hydroxymandelonitrile Lyase Plants (but not animals) are able to convert
(EC 4.1.2.11) acetyl-CoA (56) to oxaloacetate (33) via the
glyoxylate pathway. The first step in this path-
Mandelonitrile lyase and hydroxymande- way is the cleavage of isocitrate (168) to glyox-
lonitrile lyase catalyzes the addition of cyanide ylate (151) and succinate (169) catalyzed by
to benzaldehyde (4a) or p-hydroxybenzalde- isocitrate lyase, which can be rationalized as a
hyde (4b) to give mandelonitrile (167a) or (p- retro-aldol reaction (Fig. 60) (REHMANand
hydroxy)mandelonitrile (16%) respectively MCFADDEN, 1996). When the reaction is car-
(Fig. 59). These enzymes are oftern termed ried out in deuterium oxide, (2S)-[2-2H,]-suc-
oxynitrilases. They occur predominantly in cinate (169) is produced, hence C-C bond
plants (WAJANT and EFFENBERGER, 1996), cleavage occurs with inversion of configura-
where catalyze the formation and elimination tion (DUCROCQ et al., 1984).
0 1 Pvruvate
168 Isocitrate
1 2H20
woo
-
HO
t
‘*
65 (2S)-cc-Acetolactate
169 (2S)-[2-’H, 1-Succinate 151 Glyoxylate Fig. 61. Acetolactate synthase catalyzes the decar-
Fig. 60. The isocitrate lyase catalyzed retro-aldol boxylative aldol condensation of two molecules of
cleavage of isocitrate to succinate and glyoxylate in pyruvate (l), to give (2s)-a-acetolactate (65).
deuterium oxide.
4.1.3.2 Acetolactate Synthase

Acetolactate Pyruvate-Lyase
(carboxylating),EC 4.1.3.181
H 143a L-Tryptophan
a-Acetolactate (65) is produced biosynthet-
ically by the condensation of two molecules of
pyruvate (1) with concommittant decarboxyla-
tion, catalyzed by acetolactate synthase (Fig. Tryptophanase
61). The enzyme is TPP dependent and hence N H ~
the mechanism is very similar to that of pyru-
vate decarboxylase described in Sect. 4.1.1.1
(CARROLLet al., 1999; CHIPMAN et al., 1998;
HILLet al., 1997) (Fig. 23).
H 0
4.1.4 Other Carbon-Carbon Lyases 170 Indole 1 Pyruvate
Fig. 62.Tryptophanase catalyzed cleavage of L-tryp-

4.1.4.1 Tryptophanase tophan (143a) to indole (170),pyruvate (1)and am-
[L-Tryptophan Indole-Lyase monia.
(deaminating), EC 4.1.99.21
P-replacement and a-hydrogen exchange with
Tryptophanase is a PLP-dependent enzyme, various L-amino acids.The p-subunit of trypto-
which catalyzes the cleavage of L-tryptophan phan synthase or desmolase (EC 4.2.1.20) cat-
(143a) to indole (170),pyruvate (1) and am- alyzes similar reactions and the coupling of in-
monia (Fig. 62). It also catalyzes the net re- dole with serine to give L-tryptophan. Howev-
verse reaction, as well as a,p-elimination, er, this is a bifunctional enzyme which utilizes
92 2 Lyases
the a-subunit to cleave 3-indolyl-~-glycerol (Fig. 63), between the substrate and the tryp-
3’-phosphate to indole and glyceraldehyde 3‘- tophanase bound PLP group (116b). Proton
phosphate (WOEHL and DUNN,1999). Tryp- transfer between the a-carbon atom and pro-
tophanase is unable to accomplish this latter tonation of the indole gives the quinoid inter-
reaction. mediate (172), which is poised for cleavage of
Tryptophanase is a tetramer, consisting of the exocyclic indole C-C bond to give the ami-
identical units (52,000 Da) each of which con- noacrylate (173). This undergoes hydrolysis to
tains one molecule of PLP. It is activated by complete the cycle and yield the initial form of
potassium ions and inactivated by cooling, the enzyme (116b), pyruvate (1) and ammoni-
which causes release of the PLP and dissocia- um ions (IKUSHIRO et al., 1998;PHILLIPS, 1989).
tion into dimers (EREZet al., 1998).The X-ray The transfer of hydrogen from the C-a center
crystal structure resembles that of aspartate to the 3-position of the indole ring involves a
aminotransferase and tyrosine phenol-lyase, base with pKa = 7.6 and deprotonation/proto-
with the active site at a dimer interface (Isu- nation of the indolic nitrogen involves a base
POV et al., 1998). with pKa = 6.0. The mechanism of action of
The mechanism of cleavage proceeds via tryptophanase has a number of similarities to
formation of an “external” aldimine (171) that of tyrosine phenol-lyase and the section
A
H@
H
HYx 143a L-Tryptophan
0
H,O or H,N-E-lysine
H 170 Indole
173 H 172
Fig. 63.Minimal mechanism for the tryptophanase catalyzed cleavage of L-tryptophan (143a) to indole (170),
pyruvate (1)and ammonia.Tryptophanase also catalyzes the net reverse reaction, but this is not indicated for
the purposes of clarity.
on the latter (Sect. 4.1.4.2) should be consulted salts and coenzymes were passed through a
for further details. column packed with immobilized alanine racem-
Currently, tryptophan is resolved industrial- ase, D-amino acid oxidase and tryptopha-
ly by the enzyme catalyzed hydrolysis of ra- nase. The alanine racemase ensures that the
cemic N-carbamoyl or hydantoinyl derivatives, [3-"C]-~-alanine (175) is equilibrated with
but more direct routes would be desirable. The [3-11C]-~-alanine(174),which is oxidatively
Enterobacter aerogenes tryptophanase gene decarboxylated to [3-"C]-pyruvate (176)and
was expressed in the pyruvate producing E. ammonium ions. Both of these then react with
coli strain W14851ip2. After 32 hours in culture 5-hydroxyindole (177)catalyzed by tryptophan-
the 28.6 g L-' of pyruvate had been produced. ase to give [3-"C]-5-hydroxy-~-tryptophan
Addition of ammonia and indole initiated L- (178) (Fig. 64) in 60% yield (IKEMOTO et al.,
tryptophan production which reached 23.7 1999; AXELSON et al., 1992). Tryptophanase
g L-' after a further 36 hours (KAWASAKI et al., from E. coli has been assayed with a broad
1996b). range of "tryptophans" in which the benzene
The synthesis of compounds containing llC ring has been replaced by pyridine or thio-
is particularly demanding because of the short- phene. 4-Aza, 5-aza, 6-aza and 7-aza-~-trypto-
half life (tl,z = 20.34 minutes) and the limited phan (143a)(Fig. 65) were all very slow sub-
availability of costly labeled precursors. These strates (kcat < 1% of L-tryptophan), whereas
and a number of other problems were solved P-indazoyl-L-alanine (179)was a better sub-
in a neat synthesis of [3-"C]-5-hydroxy-~-tryp- strate and the thiophene analogs approached
tophan (178).Racemic [3-"C]-alanine (174) the reactivity of L-tryptophan (SLOANand
(175),5-hydroxyindole (177)plus ammonium PHILLIPS, 1996;PHILLIPS, 1989).
H,N
1 ;c
-
Of---
CO,
Alanine
racemase
,)B
H,N
"C
0
CO,
174 [3-"C]-D-Alanine 175 [3-"C]- L-Alanine
H 2 0 ~ c ~ D-A$; acid oxidase
"C
I
H H
177 5-Hydroxyindole 178 [3'-"C]- 5-Hydroxy-L-tryptophan
Fig. 64. Multi-enzyme system for the preparation of [3-1'C]-5-hydroxy-~-tryptophan

(178).
b"
94 2 Lyases
a R = H;Phenol
R = OH;Catechol
b180
H
143a L-Tryptophan
- N-
I
H
179 P-Indazoyl-L-alanine
GI NH,@
Tyrosine phenol-lyase
Fig. 65. L-Tryptophan substitution and analogs
4.1.4.2 L-Tyrosine Phenol-Lyase

a R = H;L-Tyrosine
(deaminating) (TPL, P-Tyrosinase, H3N
0J 9 0 H 1 4 b1 R = OH;L-DOPA
EC 4.1.99.2)
0
Tyrosine phenol-lyase (TPL, P-tyrosinase) is
Fig. 66. Tyrosine phenol-lyase catalyzes the synthesis
a PLP dependent enzyme, which catalyzes the of L-tyrosine (141a) from phenol (18Oa), ammonia
racemization, a,p-elimination and P-substitu- and pyruvate (1). By using catechol (18Ob) in place
tion of L-tyrosine (141a) and other amino acids of phenol L-DOPA (141b, 3-(3,4-dihydroxyphenyl)-
such as L- or D-serine ( M a ) , S-alkyl L-cys- L-alanine) can also be prepared.
teines (184c,d) and p-chloro-L-alanine (184e)
(SUNDARARAJU et al., 1997). It also catalyzes
the net synthesis of L-tyrosine from pyruvate latter reaction has attracted considerable at-
( l ),ammonia and phenol (lma, Fig. 66) at high tention because TPL accepts a range of aro-
concentrations of ammonium pyruvate. This matic substrates in place of phenol (Tab. 6).
Tab. 6. Products from Tyrosine Phenol-Lyase (TPL) Catalyzed Reactions
Product Reference
L-Tyrosine (141a) cf. SUNDARARJU et al., 1997

~-[P-'~C]-tyrosine AXELSON et al., 1992
L-DOPA (141b) LEEet al., 1999a; SUZUKI et al., 1992
L-(/~-"C]-DOPA IKEMOTO et al., 1999;
Dopamine (142b) LEEet al., 1999a, ANDERSON et al., 1992a, b
(2S,3R)-/3-methyltyrosine KIMand COLE,1999
Fluorinated tyrosines PHILLIPS et al., 1997;VONTERSCH et al., 1996;FALEEV
et al., 1995,1996; URBAN and VON TERSCH, 1999
2-Chloro-~-tyrosine FALEEV et al., 1995:
2-Methyl- and 3-methyl-~-tyrosine FALEEV et al., 1995:
2-Azido-~-tyrosine HEBELet al, 1992
l-Amino-2-(4-hydroxyphenyl)ethylphosphinic acid KHOMUTOV et al., 1997
For example, substitution of catechol (18Ob) tolerant of catechol, was identified in a ther-
enables the synthesis of L-DOPA (141b), mophile, Symbiobacterium sp. SC-1, however,
which is used in the treatment of Parkinson’s this only grows in coculture with Bacillus sp.
disease (LEEet al., 1999a). SK-1, which makes large scale cultivation ex-
TPL is found primarily in enterobacteria tremely difficult. The gene for TPL was identi-
plus a few arthropods and plays a role in the fied and overexpressed in E. coli (15% of solu-
biosynthesis of shikimates (DEWICK1998). ble proteins) and isolated in 48% yield (LEEet
TPL‘s have been identified in Erwinia herbico- al., l996,1997).The enzyme is a tetramer (MW
la (and expressed in E. coli, FOOR et al., 1993), 202 kDa), consisting of four identical subunits,
Citrobacter freundii (POLAKand BRZESKI, each of which contains one molecule of pyri-
1990), Citrobacter intermedius (NAGASAWA,doxal 5 ’-phosphate (PLP). Remarkably, the
1981) and Symbiobacterium sp. (LEE et al., enzyme retains full activity at 70 ” C for at least
1997). X-ray crystal structures have been de- 30 minutes (LEEet al., 1999b). Symbiobacteri-
termined for the TPLs from Erwina herbicola um thermophilum is another obligate, symbiot-
(PLETNEV,1997, 1996) and that from Citro- ic, thermophile that only grows in coculture
bacter freundii with bound 3-(4 ’-hydroxyphe- with a specific thermophilic, Bacillus sp., strain
ny1)propionic acid (SUNDARARAJU et al., 1997) S. It produces both tryptophanase and TPL
and without (ANTSON et al., 1992,1993). (SUZUKIet al., 1992). Expression of the gene
The mechanism of action of tyrosine phe- for TPL in E. coli yielded a 375 times increase
nol-lyase is similar to that of tryptophanase. in TPL production relative to that of S. thermo-
Aldimine formation between the “internal” philum (HIRAHARA et al., 1993).The amino ac-
PLP-aldimine (116) (Fig. 67) and L-tyrosine id sequences of the TF’Ls from the two Symbi-
(141a) yields an aldimine which is deprotonat- obacterium sp. differ at only three positions
ed by “base-1’’ (pK, = 7.6) to give the qui- (LEEet al., 1997).
nomethide (181). Concurrent deprotonation Symbiobacterium sp. SC-1TPL has been uti-
of the phenolic hydroxyl group by “base-2’’ lized in a multi-enzyme process for the pro-
(pK, = 8.0) and C-4 protonation of the phenol duction of dopamine (142b) from catechol.
by “base-1-H+”gives the quinone (182),which Condensation of catechol(180b), pyruvate (1)
undergoes protonation by “base-2-H+ ” and and ammonium salts catalyzed by TPL gave L-
rate limiting bond cleavage to phenol (MOa), DOPA (141b) (Fig. 69), which was decarboxy-
plus the pyruvate enamine derivative of PLP lated with rat liver L-DOPA decarboxylase or
(173) (cf. Fig. 63). Hydrolysis restores the rest- Streptococcus faecalis tyrosine decarboxylase.
ing state of the enzyme (AXEUSON et al., The L-DOPA decarboxylase was inhibited by
1992). The elimination and substitution reac- L-DOPA concentrations greater than 1 mM,
tions of serine derivatives bearing a p-nucleo- whereas tyrosine decarboxylase was unaffect-
fuge (184) may be rationalized by an abbrevi- ed up to 40 mM, consequently tyrosine decar-
ated form of this mechanism. In this case aldi- boxylase was selected for further develop-
mine (185) (Fig. 68), formation and deprotona- ment. Decarboxylation was carried out in an
tion results in p-elimination to give the the py- enzyme reactor at 37 “ C for 12 hours, with pH
ruvate enamine derivative of PLP (173) direct- control by addition of hydrochloric acid and
ly (CHENand PHILLIPS,1993).The identity of supplements of PLP to compensate for decar-
base-1 remains uncertain despite the X-ray boxylative transamination. At 100 mM L-
crystal structure data. In Citrobacter freundii, DOPA (141b), conversion to dopamine (142b)
TPL it is probably Lys-257 or a water molecule was quantitative. When the decarboxylation
bound to Lys-256. Base-2 is almost certainly was run with in situ synthesis of L-DOPA, the
Arg-381 (SUNDARARAJU et al., 1997). productivity was much lower than with two
TPL has been identified in several species consecutive “single pot” reactions. (LEEet al.,
(mainly Enterobacteriaceae), grown on media 1999a, b). Erwinia herbicola TPL and Strepto-
containing L-tyrosine (lBOa), but TPLs are coccus faecalis tyrosine decarboxylase have
generally inhibited by catechol (180b) which been investigated as components of a multi-
limits their application to the synthesis of L- enzyme system. Kinetic studies were run at pH
DOPA (141b). A thermostable TPL, which is 7.1 which is a compromise value dictated by
:TOH
96 2 Lyases
2 0
____) 0 3 0 ' 19 H H.0

H/N \
OH
H' I 141a L-Tyrosine
I
116
a X = 0;
PLP
b X = N-E-lysine t Tyrosine phenol-
Base-2
Base-1
2 0
181
I
I
003P 182
HI
NH,O-,
2 0
0 0 3 p y 183
1 Pyruvate
Fig. 67. Mechanism of action of tyrosine phenol-lyase (TPL) with L-tyrosine.

4 Examples of L y a m 97
184
0 aR=OH
bR=OBz
cR=SMe
H O dR=SEt
116 eR=CI
-H,O
a X = O ; PLP
b X = N-&-lysine Tyrosine phenol-
Base-2
Base-1
2 0
185
0
'
0
Tyrosine phenol-
\ lyase
0
1 Pyruvate
186
I 173
Fig. 68. Mechanism of action of tyrosine phenol-lyase (TPL) with p-substitutedL-alanines (184).
differing values for the pH optima. The TPL 2.8 mm). The beads were placed in a packed
followed pseudo 1st order kinetics with cate- bed reactor together with catechol, pyruvate
chol, pyruvate and ammonium salts, whereas, and ammonia. Dopamine was produced, but
the tyrosine decarboxylase was inhibited by the conversion was low (ANDERSONet al.,
dopamine and combinations of pyruvate and 1992b). Whole Erwinia herbicola cells were
catechol (ANDERSON et al., 1992a). The same microencapsulated in alginate-poly-L-lysine-
process has also been run with whole cells ex- alginate membraned microcapsules,and tested
pressing the relevent enzymes. Erwinia herbi- for TPL activity in a rotary shaker incubator.
cola cells with phenol tyrosine-lyase activity An agitation rate of at least 240 rpm was re-
and Streptococcus faecalis cells with tyrosine quired to ensure that the microencapsulated
decarboxylase activity (ANDERSON et al., 1987) cells achieved the activity of the free cells
were co-immobilized in glutaraldehyde cross- (LLOYD-GEORGE and CHANG,1993,1995).
linked porcine gelatin beads (mean diameter
98 2 Lyases
b"
?H
Toluene dioxygenase
HO 180b Catechol
+
0
Po;
187
Toluene cis-glycol
dehydrogenase
OH
coy 0
H3N TPL .OH
HO 0
Pyruvate 1
141b L-DOPA
141b L-DOPA NH4@ 180b Catechol
Rat liver L-DOPA Fig. 70. Hybrid pathway for the synthesis of L-
decarboxylase or DOPA (141b), expressed in E. coli and Pseudomo-
Streptococcusfaecalis nus aeruginosa (PARKet al., 1998).
tyrosine decarboxylase
expressing TPL reduced 100 mM phenol to

8 mM within 24 hours at 37 C (LEE et al.,
O
HO 1996).
142b Dopamine
Fig. 69. The multi-enzyme synthesis of dopamine
4.2 Carbon-Oxygen Lyases
(142b) (LEEet al., 1999). (EC 4.2)
Carbon-oxygen lyases catalyze the cleavage
of a carbon-oxygen bond, with the formation
In a neat approach, toluene dioxygenase,to- of unsaturated products. The vast majority of
luene cis-glycol dehydrogenase and TPL from enzymes in this subclass are hydro-lyases (EC
Citrobacter freundii (BAI and SOMERVILLE,4.2.1) which catalyze the elimination of water.
1998) have been coexpressed in E. coli. The Elimination of sugars from carbohydrates (EC
maximum concentration of L-DOPA (141b) 4.2.2) and a few other (mostly complex) cases
(Fig. 70) achieved in 4 hours was only 3 mM (EC 4.2.99) complete the subclass
due to the toxicity of benzene (187). However,
with Pseudomonas aeruginosa 14 mM L-
DOPA was achieved in 9 hours (PARKet al.,
4.2.1 Hydro-Lyases (Hydratases
1998). and Dehydratases, EC 4.2.1)
TPL have been suggested as a means for re-
moving phenol (166a) from waste water by Hydro-lyases are a group of enzymes that
conversion to L-tyrosine (141a) which is insol- catalyze cleavage of carbon-oxygen bonds
uble. Optimal concentrations of substrates with the elimination of water and typically
were 60 mM phenol, 0.1 M pyruvate and 0.4 M (but not exclusively) the formation of an al-
ammonia and the reaction was effective up to kene. In most cases the elimination of water
70 C, pH 6.5-9.0. Intact or acetone dried cells occurs adjacent to a carboxylic acid, ketone or
O
ester (189) (Fig. 71). Deprotonation occurs ad- 4.2.1.1 Carbonic Anhydrase
jacent to the carbonyl group to give an enolate
(190) which undergoes @-eliminationto give (Carbonate Dehydratase,
an a,@-unsaturatedcarbonyl compound (191). EC 4.2.1.1)
This is the common ElcB mechanism (mono-
molecular elimination from the conjugate Carbonic anhydrase (CA) is a zinc depen-
base) or in Guthrie-IUPAC nomenclature dent metalloprotein which catalyzes the hy-
AxhDH+ DN (GUTHRIEand JENCKS,1989). dration of carbon dioxide to carbonate. It is a
When there is a hydroxyl group adjacent to the ubiquitous enzyme present in animals, plants,
carbonyl group (as commonly occurs in sug- algae and some bacteria and is frequently
ars), tautomerization of the enol (191, X = present as several different forms in the same
OH) occurs to give the 2-ketocarboxylic ester organism. There are at least 14 different forms
(192). in human tissues (THATCHER et al., 1998) and
There are two stereochemical classes of hy- much effort has been devoted to efforts to de-
dratase-dehydratase enzymes.Those that cata- velop inhibitors, principially for eye conditions
lyze the addition of water to a,@-unsaturated (DOYONand JAIN,1999;KEHAYOVA et al., 1999;
thioesters have syn-addition-elimination ster- WOODRELL et al., 1999). Three evolutionarily
eochemistry, whereas those that catalyze the distinct classes (a,@, 7 ) have been defined and
addition of water to a,@-unsaturatedcarboxyl- were originally thought to be characteristic of
ates have unti-stereochemistq. In a limited in- animals, plants and bacteria, however, as more
vestigation of the spontaneous reaction, addi- have been discovered, it has emerged that they
tion of deuterium oxide to a$-unsaturated are distributed indiscriminately (LINDSKOG,
thioesters was moderately selective for unti- 1997; HUANGet al., 1998; ALBERet al., 1999).
over syn-addition (4.3 :l ) , whereas a,@-unsatu- Extraction of bovine CA has been recom-
rated esters only showed a minute preference mended as an undergraduate experiment
(1.3: 1) (MOHRIGet al., 1995).Thus the stereo- (BERINGet al., 1998).
chemical preferences of the enzyme catalyzed The CA catalyzed hydration of carbon diox-
reaction do no reflect the innate stereochemi- ide is one of the fastest known enzyme reac-
cal preferences of the solution phase reaction. tions. Typical kinetics parameters are Khl 1.2 .
lo-' M, k,,, 1.0 . 106 S-', VM,,/K,, 8.3 . 10'
M-ls-'. Although KM is unremarkable, the
value for k,,, is extremely high and only ex-
ceeded by a few enzymes (e.g., catalase). The
active site of CA consists a shallow depression
containing a zinc ion bound to three histidines
and a hypernucleophilic hydroxide ligand
(193) (Fig. 72). This adds to carbon dioxide to
generate bicarbonate (194),which is displaced
by water (195) and deprotonated in the rate
189 I 190
limiting step to regenerate the hydroxide li-
gand (193) (QIANet al., 1999; EARNHARDT et
al., 1999;MUGURUMA, 1999).CA also catalyzes
the hydration of aldehydes and ketones, and
the hydrolysis of esters, phosphates (SHERIDAN
and ALLEN,1981) and cyanamide (BRIGANTI
et al., 1999).There is considerable unrealized
0 0 potential for the use of CA as an esterase. Bo-
191
vine CA I11 increases the rate of decarboxyla-
192
tion of amino acids by L-arginine, L-lysine or L-
Fig. 71.Mechanisms for the elimination of P-hydrox- ornithine decarboxylases used in a biosensor
yl-esters (189)to @unsaturated esters (191)and a- (BOTREand MAZZEI,1999).
ketoesters (192).
100 2 Lyases
196 Fumarate
0
0
02
& COF 197 L-(8-(-)-Malate
I Fig. 73. Fumarase catalyzes the interconversion of

9
Hzol
Imd- Zn- fumarate (1%)and L-malate (197).
194
fmd H
1991; VALLEEet al., 1999), even though it

shares 90% sequence homology with argino-
succinase (SIMPSON et al., 1994; cf. Wu et al.,
HCOY 1998).
Fumarase is a remarkably efficient enzyme.
It has been estimated that the rate enhance-
ment relative to spontaneous hydration of fu-
imd- Zn- 9
-
marate is some 3.5 1015fold which equates to
I a transition state stabilization of -30 kcal
Imd H 19' mol-'. On this basis it is the second most effi-
cient enzyme known (BEARNEand WOLFEN-
Fig. 72. Minimal mechanisms for the hydration of DEN,1995) after orotidine 5 '-monophosphate
carbon dioxide by carbonic anhydrase. Zinc is
present as Zn(I1). Hydroxide, bicarbonate and water decarboxylase (-32 kcal mol-', EHRLICH et
ligands are depicted without charge transfer to the al., 1999).
zinc atom. Fumarase is widely distributed in animals,
plants (BEHALand OLIVER,1997; KOBAYASHI
et al., 1981), yeast (KERUCHENKO et al., 1992),
fungi and bacteria (BATTATet al., 1991) and ar-
4.2.1.2 Fumarase (EC 4.2.1.2) chaebacteria (COLOMBO et al., 1994). In hu-
mans, mutations of fumarase (COUGHLIN et al.,
Introduction 1998) are associated with diseases such as fu-
Fumarase catalyzes the addition of water to maric aciduria and progressive encephalopa-
the alkenic bond of fumarate (1%) to give L- thy (DEVIVO,1993;BOURGEN et al., 1994).
malate (197,Fig. 73). It is one of a number of In E. coli, fumarase activity arises from
related enzymes which catalyze additions to three distinct genes, fumA, fumB and fumC
the alkene bond of fumarate, such as aspartase (BELLet al., 1989).The gene products offumA
(EC 4.3.1.1, ammonium, SHI et al., 1997), and andfurnB are fumarase A (FUMA) and fuma-
the amidine lyases; arginosuccinase (EC rase B (FUMB), which are examples of class I
4.3.2.1, L-arginine, COHEN-KUPEIC et al., 1999; fumarases. These are iron dependent (4Fe-4S),
TURNERet al., 1997) and adenylsuccinase (EC heat labile, dimeric enzymes (MW 120 kDa,
4.3.2.2, AMP, LEE et al., 1999). Many of these UEDAet al., 1991),whereas fumC yields fuma-
enzymes have high sequence homology, even rase C (FUMC) a class I1 fumarase. These are
though they catalyze different reactions or iron-independent, heat stable, tetrameric en-
none at all (WOODS et al., 1986,1988a).For ex- zymes (MW 200 kDa), which include yeast fu-
ample 81-crystallin from duck lens is catalyti- marase, Bacillus subtilis fumarase (citC) and
cally inactive (PIATIGORSKY and WISTOW, mammalian fumarases. Class I1 fumarases
have high sequence homology and have been that fumarase C may act as a back-up to fuma-
extensively studied, mechanistically and kinet- rase A under conditions of iron deprivation
ically (WOODSet al., 1988b). (HASSETT et al., 1997). The amino acid se-
quences of fumarase A and fumarase B have
Class I Fumarases 90% sequence homology to each other, but al-
In E. coli, fumarase A and fumarase C are most no homology to the class I1 fumarases.
expressed under aerobic cell growth condi- Each monomeric unit of fumarase A and B
tions, whereas fumarase B is more abundant contains a [4Fe-4S] cluster as do Euglena gruc-
during anaerobic growth (TSENG, 1997; ilis fumarase (SHIBATA et al., 1985; RIKINand
WOODSand GUEST,1987). Fumarase A (and SCHWARTZBACH, 1989) and Rhodobacter cap-
C) act in the citric acid cycle during aerobic sulutus fumarase. Other hydrolyases which
metabolism, whereas fumarase B enables fu- contain a non-redox active [4Fe-4S] cluster
marate to act as an anaerobic electron accep- (review,FLINTand ALLEN,1996) include acon-
tor in the reductive sequence leading from ox- itase (GRUERat al., 1997;BEINERT et al., 1996),
aloacetate (28) to succinate (198) (Fig. 74) dihydroxy-acid dehydratase (FLINTet al., 1996;
(WOODSet al., 1988b).There is some evidence LIMBERGand THIEM,1996), isopropylmalate
isomerase, phosphogluconate dehydratase,
0 tartrate dehydratase, maleate dehydratase, lac-
tyl-CoA dehydratase, 2-hydroxyglutaryl-CoA
0 dehydratase and Peptostreptococcus asacchar-
0 2 28 Oxdoacetate olyticus serine dehydratase (HOFMEISTER et
NADH + H@ al., 1994).There is little or no sequence homol-
ogy between aconitase and fumarase A, al-
Malate dehydrogenase though both bear the dipeptide moiety
NAD@ Cys-Pro which is often found in the sequences
of iron-sulfur proteins. Both are oxidized by
oxygen, but fumarase A is more susceptible to
OH further oxidation and “reactivation” by iron
and a reductant takes longer (FLINTet al.,
197 L-Mdate
1992b). Fumarase A, fumarase B, aconitase
and E. coli di-hydroxy-acid dehydratase are in-
activated by superoxide ( O F )with release of
iron and by hyperbaric oxygen (FLINTet al.,
1993; UEDAet al., 1991).
The addition of water to fumarate catalyzed
by fumarase A is stereospecific (Fig. 75). The
hydroxyl group and the hydrogen undergo
trans-addition with the incoming hydrogen
0 added to the (3R)-position (199).Prolonged
0 2 incubation does not result in the formation of
196 Fumarate [’HI-fumarate, which testifies to the stereo-
chemical fidelity of the reaction (FLJNTet al.,
FADHZ 1994).There is no hydrogen isotope effect and
hence hydrogen abstraction is not the rate de-
Succinate dehydrogenase termining step.
FAD Fumarase A catalyzes the transfer of l80
from (2S)-[2-’80,]-malate (200) (Figs. 76, 77)
and ’H from (2S,3R)-[3-2H,]-malate (206) to
198 Succinate acetylene dicarboxylate (202) to give “0 and
*H labeled oxaloacetate enol (203) (208)
Fig. 74. The role of fumarase in anaerobic metab- (FLINTet al., 1992a; FELLet al., 1997), which
olism. isomerizes to the keto-form of oxaloacetate
102 2 Lyases
0 H "0
'02& 'O2 196 Fumarate
200 (2S)-[2-'801]-Malate
Fumarase A
H
.oz&co,.
H 196Fumarate
201 Fumarase A-['801]
H 'H 199 (2S,3R)-[3-'H1]-Malate
Fig. 75. Fumarase A, catalyzed addition of the ele-
ments of water occurs stereospecificallyin the trans- @o,c-cEc-co,o
orientation. 252 Acetylene dicarboxylate
Fumarase A
(204) (209). Further oxygen or hydrogen ex-

change was prevented by reduction with sodi-
um borodeuteride to the malates (205) (210).
It was calculated that at an infinite concentra-
tion of acetylene dicarboxylate (202), some
33% of the l80and 100% of the 'H would be
Fumarase A
transfered. This indicates that these atoms are
strongly bound at the active site, presumably
with the oxygen acting as a ligand to the [4Fe-
4S]-cluster and the hydrogen bound to a basic
I
residue (211) (Fig. 78. FLINTand MCKAY,
1994). Moreover fumarase also catalyzes the
isomerization of oxaloacetate enol(208) to the
ketone form (209), at the same active site
which is responsible for hydration-dehydra-
tion. The reaction occurs with retention of the N&H,
enolic oxygen and is stereoselective with the
hydrogen delivered to the 3-pru-(S)-position
(FLINT,1993).
Fumarase A has high substrate specificity
H180 2H
which is typical of fumarases in general. The 205 rac-[2-*HI,2-'*0,]-
only substrates which have reactivity which is 02c
Malate
comparable to fumarate (relative rate = 100,
10 mM substrate) are L-malate (41), acetylene Fig 76. The hydration of acetylene dicarboxylate cat-
dicarboxylate (97) and (2S,3S)-tartrate (11). 2- alyzed by fumarase A-["Ol] (201) from E. coli.
Fluorofumarate (13) is a reasonably reactive
substrate. It undergoes addition of the hydroxy
group at the 2-position to give a 2,2-fluorohy-
drin which spontaneously eliminates hydrogen In summary, class I fumarases are rare, un-
fluoride to give oxaloacetate. This reaction is stable enzymes bearing a [4Fe-4S] cluster
identical to that catalyzed by the class I1 fuma- which has a non-redox role.The stereochemis-
rases and is described in detail in the subse- try of hydration of fumarate is identical to that
quent section. of the class I1 fumarases
OH
206 (2S,3R)[3-'H1]-Malate
H 'H
211
0 0,c- ecop
202 Acetylene dicarboxylate
F u m eA
I
'A 208 [3-ZH,]-Oxaloacetateenol
Fumarase A
B
I
.r.Ahr
0 2 , Fig. 78. Outline mechanism for the hydration of fu-

2w(3R)-[3-ZH1]-0xaloacetate marate (1%) by a [4Fe-4S]-cluster.
1
2H
N ~'
BH.,
a single nuclear gene FUM1.The mitochondri-
a1 enzyme is produced with a 23-residue trans-
location sequence, which is responsible for di-
recting it to the mitochondria and is removed
during importation into the mitochondria
(KNOXet al., 1998). Similar systems are em-
H 'H 210 (2RS,3R)-[2JHl, 3-'Hl]- ployed in humans, pigs (O'HARE and Doo-
Malate NAN, 1985), rats (SUZUKI et al., 1989; TUBOI et
Fig 77. The hydration of acetylene dicarboxylate catal., 1990) and mice, which apparently only uti-
alyzed by fumarase A-['H,] (Un)from E. coli. lize class I1 fumarases. In S. cerevisiue, some
30% of the enzyme activity is associated with
the mitochondria1 fraction and the remaining
70% with the post-ribosomal fraction, al-
Class I1 Fumarases though the specific activity of the former is
In S. cerevisiue both cytoplasmic and mito- some 3-4 fold higher. (Wu and TZAGOLOFF,
chondrial fumarases (class 11) are encoded by 1987).
104 2 Lyases
Stereochemistry nary report of crystallization and diffraction

Early work demonstrated that the addition data for this enzyme was reported, however,
of deuterium oxide to fumarate catalyzed by thus far there has been no crystal structure
fumarase was stereospecific (FISHERet al., (SACCHETTINI et al., 1986).
1955).Initially the evidence suggested that the The extreme stereochemical fidelity of fu-
addition occumed with syn-stereochemistry marase catalysis has enabled it to be used in
(FARRARet al., 1957; ALBERTY and BENDER, the synthesis of stereospecifically labeled mal-
1959).However, the synthesis of stereospecifi- ates (review, YOUNG,1991).As has been noted
cally labeled standards, clearly indicated anti- previously, (2S,3R)-[3-2Hl]-malate (199) can
stereochemistry with the hydrogen atom in the be prepared by fumarase catalyzed addition of
(3R)-position (GAWRONand FONDY,1959; deuterium oxide to fumarate (1%) (AXELSSON
ANET,1960; GAWRON et al., 1961), which was et al., 1994) (Fig. 75). The converse reaction in
confirmed by a neutron diffraction study (BAU which deuterated fumarate (213)is hydrated
et al., 1983). This stereochemical outcome is by water gives (2S,3S)-[2,3-’H2]-malate (214)
identical to that of the class I fumarases (Fig. (Fig. 79) (ENGLARD and HANSON 1969;AXELS-
75). SON et al., 1994).Alternatively, this can be pre-
pared by malate dehydrogenase catalyzed
Enzymology and Structures stereospecific reduction of fully deuterated ox-
Kinetic analysis of fumarase hydration is aloacetate (216),with (4R)-[4-’H1]-NADH, to
complex.At low substrate concentrations, clas- give fully deuterated malate (215) and ex-
sical Michaelis-Menten kinetics are followed, change of the (3-pro-R)-deuteron with hydro-
at substrate concentrations greater than five gen ions catalyzed by fumarase (CLIFFORDet
times K M substrate activation occurs and al., 1972;YOUNG,1991). In contrast stereospe-
above 0.1 M inhibition occurs. Although the cific reactions of the dideuteromalate (217)
conversion of substrate is fast, recycling of the gave a mixture of products (Fig. 80). Fumarase
enzyme to the active state is slow and is cata- catalyzed dehydration in tritiated water ster-
lyzed by anions, including the substrates (Ro- eospecifically gave the monodeuterofumarate
SE,1997,1998;BEHALand OLIVER,1997).Thus, (216).However, this can bind in the active site
although there is no deuterium isotope effect in two different orientations, thus hydration
in the hydration reaction, k,, is reduced if deu- was non-selective and a mixture of isotopom-
terium oxide is used in place of water as sol- ers (219)(220)were formed (LENZet al., 1976;
vent. X-ray crystal structures for E. coli YOUNG,1991).
(WEAVER and BANASZAK, 1996;WEAVERet al., Malonate (89)(Fig. 29) is proprochiral, ie. at
1995) and yeast (WEAVERet al., 1998; KERU- least two groups attached to the central carbon
CHENKO et al., 1992) fumarases have revealed a atom must be labeled to render it chiral and
binding site for anions, structurally close to the hence amenable to stereochemical studies of
active site, which acts allosterically and is ap- decarboxylation or homologation (FLOSSet
parently responsible for the unusual kinetics al., 1984). This has been achieved in an ex-
noted above. Mutation of a histidine residue to tremely neat way by the fumarase catalyzed
asaparagine in the active site (H188N), result- hydration of [1,4-13C,]-fumarate(221)to give
ed in a large decrease in specific activity, but labeled malate (222),which can be stored for
the same change at the second site (H129N) prolonged periods (Fig. 81). Rapid cleavage
had essentially no effect, however, both muta- with permanganate, at pH 10, gives chiral mal-
tions reduced the affinity for carboxylic acids onate (223),with minimal opportunity for ex-
at the respective sites (WEAVERet al., 1997). It change of the acidic hydrogens (HUANGet al.,
may be that the asparagine residue at the sec- 1986; JORDAN et al., 1986). This methodology
ond site in the mutant acts as a surrogate for has been used in studies of decarboxylation
the ligand’s carboxylate group and hence com- (MICKLEFIELD et al., 1995;HANDA et al., 1999),
pensates for the lack of normal allosteric ac- fatty acid (JORDANet al., 1986; JORDAN and
tion. The pig liver enzyme also has a second SPENCER, 1991),6-methylsalicyclic acid (SPEN-
site, as deduced from a kinetics study (BEECK- CER and JORDAN, 1990; JORDAN and SPENCER,
MANS and VAN DRIESSCHE, 1998). A prelimi- 1990, SPENCER and JORDAN, 1992b) and orsel-
2H
0
217 (2S)-[3,3-’Hz]-Malate
4 213 [2,3-ZH2]-Fumarate
Fumarase
H2O
Fumarase 2~~~
H ZH
0
214 (2S,3s)-[2,3-2H2]-Malate 2H H
t
218 [2-2H,]-Fumarate
I I
Fumarase
0
215 (2s)-[2,3,3-ZH3]-Malate
tI
r
219 220
Malate dehydrogenase Fig. 80. Stereospecific dehydration-hydration yields
(~R)-[~-’H,]-NADH a mixture of isotopomers (219) (2u)) (LENZet al.,
1976).
reaction rates are much slower. Pig liver fuma-

0 rase catalyzed hydration of 2-chlorofumarate
0 2
216 [3-ZH2]-Oxaloacetate (224), yields enantiomerically pure L-threo-
chloromalate (>99.5% ee) (225) (Fig. 82). Un-
Fig. 79. Two routes to (2S,3S)-[2,3-”Hz]-malate (214) fortunately, the reaction has an unfavorable
(ENGLARD and HANSON, 1969;CLIFFORD et al., 1972; equilibrium constant (Keq= 6.2), which limits
YOUNG,1991). the theoretical yield to 86%. However, using
PAN gel immobilized fumarase, 63.7 g of chlo-
rofumaric acid was converted to 54.5 g (76%
yield) of L-fhreo-chloromalicacid, in two reac-
tiodisolation cycles, over two weeks. The re-
linic acid biosynthesis (SPENSERand JORDAN, covered immobilized fumarase retained 60%
1992a). of the initial activity (FINDEISand WHITE-
SIDES,1987). Interestingly, the corresponding
Non-Natural Substrates fluorofumarate (228) reacts with the opposite
Fumarases are highly specific for fumarate regiochemistry to give an unstable fluoroalco-
(1%) and L-malate (197). A limited range of hol (229),which spontaneously eliminates hy-
other unsaturated dicarboxylic acids undergo drogen fluoride to give the tritiated oxaloace-
hydration, but with the exception of 2-fluoro- tate (230)(Fig. 83). The stereochemistry of the
fumaric acids and 2,3-difluorofumaric acid, the tritium label was determined by reduction
106 2 Lyases
\&31 13c0,0
0 2
I 221 [1,4-13C2]-Fumarate
OH
-
'H 222 (2S,3R)-[1,4-'3C,,3-2H]-Malate
cl 225 L-threo-Chloromalate
= (2R,3X)-3-chloromalate
KMn04, pH 10,
H20, OOC, 5 mins
I
J Steps t
-
i
'H 223 (R)-[l-'3C,2-2H]rnalonate
Fig. 81. The synthesis of chiral malonate
(HUANGet al., 1986).
with malate dehydrogenase and treatment

with fumarase, which yielded unlabeled fumar-
ate (196).Consequently the tritium label must 226 D-(+)-erythro- 227 2-Deoxy-D-ribose
have been located at the (3R)-position. (MAR- Sphingosine
LETTA et al., 1982).The hydration of 2,3-difluo-
rofumaric acid (233) also proceeds with elimi- Fig. 82. Fumarase catalyzed hydration of 2-chlorofu-
nation of hydrogen fluoride, but in this case in marate (224).
situ reduction yields L-threo-fluoromalic acid
(235) which was isolated as the dimethyl ester
in 49% yield (Fig. 84) (FINDEISand WHITE- from D,L-malic acid manufacture. Maleic anhy-
SIDES, 1987). Fumarase binds the nitronates dride (239) is produced on a very large scale by
(237a,b) more tightly than fumarate (1%), oxidation of butane (238) or crude benzene or
whereas the nitrocompounds (236a,b) are naphthalene fractions (Fig. 86). The majority
barely inhibitory. Similarly the nitonates of this is used in the production of plastics and
(237b,c,d) binds to aspartase, more strongly paints and detergents. Hydrolysis of maleic an-
than aspartate. Although, all of the analogs are hydride gives maleic acid (240), fumaric acid
inhibitors but not substrates, the fact that they (241)or D,L-malic acid (242).All of these acids
bind so well indicates there are prospects for are used as acidulants (preservatives) for
designing unnatural substrates (PORTERand canned fruit, preserves, soft drinks, cosmetics
BRIGHT, 1980). and pharmaceuticals. However, there is con-
siderable (and increasing) demand for L-malic
Biotechnology acid, which is the naturally occurring enan-
Fumaric acid has been manufactured by fer- tiomer (apple acid).The current world produc-
mentation of glucose by Rhizopus nigricans tion of L-malic acid is about 500 tonnes per
but nowadays most is produced as a byproduct year, most of which is used in food and phar-
228 2-Fluorofurnarate F 232 2,3-Difluorofumarate
i Spontaneous
HF I-
n
Spontaneous
HF
F H 234(35')-3-FlUOKO-
Oxaloacetate I oxaloacetate
NADH + H@ NADH + H@
Malate dehydrogenase Malate dehydrogenase
NAD@ NAD @
1'-
0
H 3H 231 (2S,3R)- L-rhreo-Fluoromalate
[3-3H,]-Malate = (2R,35')-3-fluorornalate
Fig. 84. Fumarase catalyzed hydration of 2,3-difluor-
ofumarate (232).
H maceuticals. It has been used in organic syn-

thesis as a chiral starting material (e.g., Clozy-
lacon (24%) (Fig. 87), BUSER,et al., 1991;Pyr-
A 196Fumarate rolam A (247) (Fig. 88), HUANG et al., 1999),
however, such applications are rare because it
Fig. 83. Fumarase catalyzed hydration of 2-fluorofu- is less versatile than the tartaric acids, which
marate (226). have a G-axis of symmetry (GAWRONSKI and
GAWRONSKI, 1999).
Most of this demand for L-malate (197) is
satisfied by the fumarase catalyzed hydration
of fumarate (196) (Fig. 75). This has been ac-
108 2 Lyases
aX=H
bX=OH a C13CCH0,HzS04 (81% yield);
cX=NHZ b BH3.SMez,THF,
d X = NH3@ c aq NaHC03 (20-55% yield)
H 237
Fig. 85. Fumarase inhibitors (PORTER
and BRIGHT,
1
1980).
a (CF3SO2),0, pyridine, CCI,;
b 2,6-Dimethylaniline, K2C03 (49%yield);
c MeOCH,COCl, DMF, PhMe (96%yield)
238Butane
?Me
a R = H (88.6% ee);
b R = C1; Clozylacon
Fig. 87. Synthesis of the fungicide CGA 8oo00,Clo-
0 239Maleicanhydride zylacon (245b) (Ciba-Geigy) from L-malic acid (243)
(BUSER,et al., 1991).
HO,C
kHZ0
rnC02H 240 Maleic acid
complished with immobilized whole cells of
Brevebacterium ammoniagenes or laterly B.
flavum (CHIBATA, et al., 1987b; WANG,et al.,
1998).Various immoblized gels have been ap-
plied in the continuous process such as poly-
acrylamide and rc-carrageenan (CHIBATA,et
al., 1995,1987a).Fumarase activity (unit mL-
gel) and relative productivity (%) of cell im-
H 0 2\
6 COZH 241 Fumaxic acid mobilized Brevibacterium flavum increased
&
respectively from 10.2 and 273 on polyacryl-
amide to 15.0 and 897 on K-carrageenan.The
HOZ COzH 242 DL-Malic acid immobilized B. flavum on either gel showed
higher fumarase activity and relative produc-
Fig. 86. ?he manufacture of C,-dicarboxylic acids. tivity compared to B. ammoniagenes cells on
polyacrylamide gel (TOSAet al., 1982;TANAKA
et al., 1983a, 1983b, 1983c, 1984). Many other
organisms have been investigated for im-
COZH ate salts. Therrnus thermophilus fumarase
showed optimum activity of 85 O C and over
80% of the activity remained after a 24-h incu-
bation at 90°C. Furthermore, the enzyme
showed good chemostability; 50% of the initial
activity was detected in assay mixtures con-
a AcCI;
taining 0.8% M guanidine hydrochloride (MI-
b PMB-NH,;
ZOBATA, et al., 1998).The fumC genes from an-
c AcCl(93% yield); other T therrnophilus strain (KOSAGEet al.,
d AcCl, EtOH, 5OoC,(91%yield) 1998) and Sulfolobus solfataricus (COLOMBO,
et al., 1994) have been expressed in E. coli.
Both retain full activity at 70 "Cand in the lat-
ter case this is despite an 11 amino acid C-ter-
minal deletion.
0 246 (S)-a-Hydroxy-N-
4.2.1.3 Aconitase (Aconitate
@-methoxy benzy 1)malimide Hydratase, CitrateDsocitrate
Hydro-Lyase,EC 4.2.1.3) and
Steps
Citrate Dehydratase (EC 4.2.1.4)
t
Aconitase catalyzes the dehydration of cit-
H rate (248) to cis-aconitate (73)and hydration
to isocitrate (249) (Fig. 89). The prosthetic
group is a [4Fe-4S] cluster and hence the fun-
damental chemistry, resembles that of class I
fumarases (BEINERT et al., 1996; GRUERet al.,
1997). Aconitase has significant sequence ho-
Fig. 88. Synthesis of the pyrrolizidine alkaloid, (-)-
(R)-pyrrolam A (247) from L-malic acid (243)
mology with iron regulatory factor or iron-re-
(HUANGet al., 1999) using the method of LOUWRIER sponsive element binding protein and indeed
et al. (1996) for the preparation of the malimide the major difference between them seems to
(246). be the presence or absence of the [4Fe-4S]
cluster (BEINERT and KENNEDY,1993). Citrate
dehydratase was reported to dehydrate citrate
to cis-aconitate, but not isocitrate to cis-aconi-
trate.
proved fumarase activity including Coryne- The conversion of citrate (248) to isocitrate
bacterium equi, Escherichia coli, Microbacteri- (249) catalyzed by aconitase is a key step in the
urn flavurn, Proteus vulgaris, Pichia farinosa, citric acid (Krebs) cycle (Figs. 1,89). The first
Leuconostos brevis (MIALL, 1978; DUFEY, step is the trans-elimination of the hydroxyl
1980) and yeast (WANGet al., 1998) but the group and the (pro-R)-hydrogen of the (pro-
highest levels of process intensification (high- R)-methylene carboxylate group of citrate
er space-time yields) will require the use of en- (248) to give cis-aconitate (73).In the reverse
zymes (CHIBATA, et al., 1995). direction, this can be regarded as the addition
B. flavurn immobilized in K-carrageenanand of a proton to the re-face of C-2 and a hydrox-
Chinese gallotannin has a operational half life yl group to the re-face of C-3. Hydration of cis-
of 310 days at 37 "C.Although the half life is aconitate (73) proceeds by trans-addition of
excellent by any measure, productivity could hydroxyl to the re-face of C-2 and a proton to
be increased by a higher working tempera- the re-face of C-3.Thus each addition or elimi-
tures, moreover this would be an advantage for nation of a proton or a hydroxyl from the two
poorly soluble magnesium or calcium fumar- carbons centres, occurs on the same side for
110 2 Lyuses
pro-R
0 250 Fluoroacetate
Acetate
thiokinase
I [2-3Hl]-Citrate
AMP, HP04 CoASH
HO'
4
COP 73 cis-Aconitate
28 Oxaloacetate b Hydrolysis
Ser-642;: Aconitase
t
0
Fluorocitrate
249 (2R,3S)-
[3-3HI]-Isocitrate
Fig. 89. The aconitase catalyzed isomerization of cit-

rate (248)to isocitrate (249). For the purposes of
brevity, no distinction is made in the text, between
labeled and unlabeled citrate and isocitrate.
1
each carbon centre. Remarkably, the proton
(tritium) abstracted from C-2 of citrate (prob-
ably by Serine-642) is delivered back to the op- Aconitase
posite face of cis-aconitate to give H-3 of isoci-
trate, whereas the hydroxyl group is ex-
changed with solvent. Hence either cis-aconi- 0
tate must flip in the active site so that the re-
tained proton can be transferred to the oppo-
site face or less likely the proton must be
transferred from one face to the other. This is bop 254 (4R)-4-hydroxy-
all the more extraordinary, because it occurs trans-aconitate
without dissociation of cis-aconitate (73) from Fig. 90. The biosynthesis of fluorocitrate (252) from
aconitase. fluoroacetate and oxaloacetate (28) and the lethal
Fluoroacetate (250) (Fig. 90) is one of the biosynthesis of (4R)-4-hydroxy-truns-aconitate (254)
most toxic small molecules known (LDS0rat catalyzed by aconitase.
0.2 mg kg-l). It is converted in vivo to
(2R,3R)-fluorocitrate (252), which acts as both

a competitive and semi-irreversible inhibitor
of aconitase. Aconitase catalyzed elimination
proceeds normally (253), but rehydration oc-
@02VOHH ,OH
curs with SN2‘ displacement of fluoride, to 255

give (4R)-4-hydroxy-truns-aconitate (254) aR=H
which binds very strongly. It cannot be dis- bR=CH3
placed with a 20-fold molar excess of citrate
u,a-Dihydroxyacid
(248), but with a lo6 fold molar excess of isoci- dehydratase
trate (249) lag kinetics are observed indicating HZO
displacement. X-ray crystal structures have
been determined for aconitase binding trans- n
aconitate, nitrocitrate (LAUBLEet al., 1994)
and (4R)-4-hydroxy-truns-aconitate (254) @ 0 2&R H ‘* 256
(LAUBLEet al., 1996). Further aspects of fluo-
roacetate and fluorocitrate metabolism are aR=H
discussed in Chapter 3, this volume: Halocom- bR=CH3
pounds.
Fig. 91. The a$-dihydroxyacid dehydratase cata-
lyzed dehydration of (2R)-2,3-dihydroxy-3-methyl-
butanoate (2%) and (2P,3P)-2,3-dihydroxy-3-
4.2.1.4 a$-Dihydroxy Acid methylpentanoate (25%) to 2-0x0-3-methylbuta-
Dehydratase (2,3-Dihydroxy-Acid noate (256a) and (3S)-2-oxo-3-methylpentanoate
(256b),respectively.
Hydro-Lyase,EC 4.2.1.9)
a#-Dihydroxyacid dehydratase (DHAD) in both cases it has been demonstrated that the
catalyzes the dehydration of (2R)-2,3-dihy- a-proton is lost to the solvent during the
droxy-3-methylbutanoate (255a) (Fig. 91) to 2- course of dehydration.
0x0-3-methylbutanoate (256a) and (2R,3R)- Substrate homolog rate study results (Tab.
2,3-dihydroxy-3-methylpentanoate(25%) to 7) demonstrate that substituents larger than
(3S)-2-0~0-3-methylpentanoate (256b), These methyl are better accommodated at the R’po-
are the penultimate intermediates in the bio- sition than the R2 position (255e,f and g,h),
synthesis of L-valine and L-isoleucine, respec- however, if only one methyl group is present,
tively. Unusually the last four steps in these rates of dehydration are faster when the meth-
pathways are all catalyzed by a common set of yl group is located in the R2 position than the
enzymes. DHAD has an absolute requirement R1 position (255ij). One interpretation, is that
for the (2R)-configuration, but substrates with the binding site for R2is tight and responsible
both the (3R)- and (3S)-configurations are de- for steering the stereochemistry of elimina-
hydrated stereospecifically. Thus (2R,3S)-2,3- tion, whereas the R1binding site is loose and
dihydroxy-3-methylpentanoateundergoes de- accommodates larger groups (ARMSTRONG et
hydration to give the enantiomer of the “nor- al., 1985;cf. LIMBERG and THIEM,1996). Com-
mal” product (ent-256b),which is a precursor parable result have been obtained with spin-
of L-alloleucine. ach DHAD (PIRRUNG et al., 1991).
DHAD has been found in bacteria, yeast, al-
gae and higher plants (PIRRUNG et al., 1991).E.
coli DHAD contains a [4Fe-4S] cluster pros- 4.2.1.5 3-Dehydroquinate
thetic group (FLINTet al., 1996),whereas spin- Dehydratase (EC 4.2.1.10)
ach DHAD contains a [2Fe-2S] cluster (FLINT
et al., 1993; FLINTand EMFTAGE, 1988). Most 3-Dehydoquinate dehydratase (DHQD)
substrate studies have been performed with catalyzes the dehydration of 3-dehydoquinate
Salmonella typhimurium (by CROUT’Sgroup) (257) to give 3-dehydroshikimate (258) (Fig.
and spinach DHAD (by PIRRUNG’S group) and 92).This is the central step in the catabolic qui-
112 2 Lyases
Tab. 7. The Salmonella typhimurium a,P-Dihy-

droxyacid Dehydratase Catalyzed Dehydration of
Substrate Homologs (ARMSTRONG et al., 1985)
S or pro-S
-
OH 257
3-Dehydroquinate
R or pro-R dehydratase
HZO
op0
a$-Dihydroxyacid 0O2C
dehydratase
H2O
HO\"'
OH 258
Fig. 92. The 3-dehydroquinate dehydratase cata-
lyzed dehydration of 3-dehydoquinate (257) to give
255 Substituents Relative 3-dehydroshikimate (258).
R' R2 rate %
a Me Me 100
b Et Me 44-46 4.2.1.6 Enolase (2-Phospho-~-
C Me Et -48
d Et Et 19-20 Glycerate Hydro-Lyase,
e Pr Me 7-9
f Me Pr 2-3
EC 4.2.1.11)
g Bu Me 1-2
h Me Bu 0-1 Enolase catalyzes the dehydration of 2-
i Me H 7-10 phospho-D-glycerate (259) to phosphoenolpyr-
j H Me 45-47 uvate (PEP) (148) (Fig. 93). Enolase lends its
k H H 34 name to a superfamily of enzymes which cata-
lyze deprotonation adjacent to carboxylate
groups. The active sites are located in P-barrel
(TIM barrel) domains and contain Mg2+,
nate pathway and the biosynthetic shikimate bound to a conserved sequence. Examples in-
pathway (MA", 1987, MA" et al, 1994). clude yeast enolase, muconate lactonising en-
DHQDs are divided into two types. The type I zyme, mandelate racemase, D-gluconate dehy-
enzymes are heat labile, anabolic enzymes dratase from E. coli and D-glucarate dehydra-
which catalyze syn-elimination, via a imine de- tases from several eubacteria. The enolase
rived from lysine, whereas the type I1 enzymes superfamily is divided into three subfamiles,
are heat stable and catalyze an anri-elimina- mandelate racemase, muconate lactonizing en-
tion via an unknown mechanism (FLOROVA et zyme (WILLIAMS et al., 1992) and enolase. All
al., 1998). members of the enolase subfamily of the eno-
lase superfamily bear a conserved lysine,
which abstracts protons from centres with (R)-
stereochemistry, adjacent to a carboxylate
group (BABBITT et al., 1995,1996).Thisnomen-
clature is discussed further in connection with
‘O& H OH00
4”’
0 =\
0 00 2592-Phospho-
D-glycerate
L-serine dehydratase
HZO
Enolase
H2O
JL
Hzol
H,N0 C02 261
0
&P’ 00
0” ‘0° 148 Phosphoenol- NH4@
pyruvate
Fig. 93. The enolase catalyzed dehydration of 2-

phospho-D-glycerate (259) to phosphoenolpyruvate
(PEP) (148). 0A C 0G
2 lPyruvate
Fig. 94. The L-serine dehydratasecatalyzed dehydra-

tion of L-serine (259 to 260) to pyruvate (1).
D-gluconate dehydratase and D-glucarate de-
hydratase (Sect. 4.3.1.1).
4.2.1.7 L-Serine Dehydratase

(EC 4.2.1.13), D-Serine H 166 L-Threonine
Dehydratase (EC 4.2.1.14) and

L-Threonine Dehydratase L-Thonine dehydratase
(EC 4.2.1.15)
L-Serine dehydratase catalyzes the dehydra-
tion of L-serine (259 to 260) to pyruvate (1)
(Fig. 94) and L-threonine dehydratase catalyz-
es the dehydration of L-threonine (166) to 2-
oxobutanoate (262) (Fig. 95). Both enzymes al- OACOF 262 2-Oxobutanoate
so catalyze the other reaction more slowly
than with the “native” substrate. Similarly D- Fig. 95. The L-threonine dehydratase catalyzed de-
hydration of L-threonine (166) to 2-oxobutanoate
serine dehydratase also has some activity with (262).
D-threonine. Most forms of these enzymes are
PLP-dependent, but no bacterial L-serine de-
hydratase has been shown to be PLP depen-
dent. The L-serine dehydratase from Pepto- et al., 1994; GRABOWSKI et al., 1993) and hence
streptococcus asaccharolyticus serine dehydra- is related to fumarase and a,p-dihydroxyacid
tase contains a [4Fe-4S] cluster (HOFMEISTERdehydratase.
114 2 Lyases
4.2.1.8 Imidazoleglycerol cop

Phosphate Dehydratase
(EC 4.2.1.19)
b “E5 Maleate
Imidazoleglycerol phosphate dehydratase

catalyzes the dehydration of imidazoleglycerol
phosphate (263)to imidazoleacetol phosphate
(264) (Fig. 96), which is a late step in the bio-
synthesis of L-histidine in plants and microor-
ganisms. L-Histidine is an essential nutrient for
animals, because they lack the requisite bio-
synthetic pathway. The elimination is fairly un-
usual because the proton lost is essentially
non-acidic, moreover no co-factor has been Fig. W.Stereochemistry of the hydration of maleate
identified other than Mn2+ ions. Elimination (265) to D-malate (266) catalyzed by maleate hydra-
proceeds with inversion of configuration at tase. For the purposes of brevity, no distinction is
made in the text, between labeled and unlabeled D-
C-3 and the proton is derived from the solvent malate.
(PARKER et al., 1995).
dration has remarkable similarities to that of

4.2.1.9 Maleate Hydratase fumarase. Both enzymes catalyze the trans-ad-
dition of the elements of water to the alkene
[(R)-Malate Hydro-Lyase, bond, with the hydrogen introduced into the
EC 4.2.1.311 (3R)-position of malate. Consequently fuma-
rase gives (2S)-~-malate(197)(Fig. 73) where-
Maleate hydratase catalyzes the addition of as maleate dehydratase gives the enantiomer,
water to maleate (265) to give D-malate (266) (2R)-~-malate(265 to 266).
(Fig. 97). 2-Methyl- and 2,3-dimethylmaleate Maleate hydratase has been purified from
are also substrates. The stereochemistry of hy- rabbit kidneys, Arthrobacter sp. strain
MC12612 and Pseudomonas pseudoalcaligenes
(VAN DER WERFet al., 1992).The rabbit kidney
and Arthrobacter sp. strain MCI2612 forms
contain an iron-sulfur cluster (DREYER, 1985),
whereas that from Pseudomonas pseudoalcali-
genes does not (VANDER WERFet al., 1993).
L-Malate (197)is a valuable bulk commod-
ity (see Sect.4.2.1.2, Fumarase), whereas D-mal-
lmidazolegly cerol ate (266)has only found a few minor applica-
phosphate
dehydratase tions in organic synthesis. Nevertheless poten-
tially, the most efficient and cheapest way to
prepare it, is by maleate hydratase catalyzed
hydration of maleate. Kinetic analysis of D-
malate production by permeabilized Pseudo-
monaspseudoaligenes has shown that the reac-
tion suffers from product inhibition and bio-
0 catalyst inactivation. Optimal production oc-
264 curred at pH 8 and 35 C, but this was accom-
O
Fig. 96. The imidazoleglycerol phosphate dehydra- panied by complete biocatalyst deactivation
tase catalyzed dehydration of imidazoleglycerol over 11hours (MICHIELSEN et al., 1998). Clear-
phosphate (263) to imidazoleacetol phosphate ly, considerable development is required to
(264). make this a practical method.
4 Examples of Lyasm 115
4.3 Carbohydrate Lyases OH
(EC 4.2.X.Y)
OH OH 270 D-Arabinonate
The lyases are involved in the metabolism of
carbohydrates may be separated into two
classes: the hydro-lyases which catalyze the
elimination of water and the dissacharide and D-habinonate dehydratase
higher lyases which catalyze the the cleavage H2O
of glycosidic bonds
0
4.3.1 Carbohydrate Hydro-Lyases O*z OH
(EC 4.2.1.X) OH OH 288Enol
4.3.1.1 Monosaccharide Carboxylic

Acid Dehydratases
The monosaccharide carboxylic acid dehy-
dratases (Tab. 8), catalyze the a,p-elimination 0
of water to give enols which isomerize to the
Oz- OH
corresponding ketone (e.g., Fig. 98). The stere-
ochemistry at C-2 and C-3 is lost during the 0 OH 271 2-Dehydro-3-
course of the elimination, comequently, D-al- deoxy-D-arabinonate
tronate (274), D-mannonate (276), D-gluconate Fig. 98. D-Arabinonate dehydratase catalyzes the
(280) and D-glucosaminate (279) all give the a,p-elimination of water from D-arabinonate (270)
same product; 2-dehydro-3-deoxy-~-gluconateto give an enol(288) which tautomerizes to 2-dehy-
(275) (Fig. 99). In general enzyme catalyzed dro-3-deoxy-~-arabinonate (271).
eliminations which involve a$-unsaturated
esters, proceed with anti-stereochemistry
(MOHRIGet al., 1995; PALMER et al., 1997),
hence the enol (289) derived from D-manno-
nate (276), will be the (E)-rather than the (2)- from E. coli bears histidine-285 and aspartate-
stereoisomer formed by the other substrates. 258, which act as the base and histidine-185
Galactonate dehydratase is a member of the which acts as a general acid catalyst to pro-
enolase superfamily of enzymes, which in- mote elimination (WIECZOREK et al., 1999).
cludes yeast enolase, muconate lactonking en- Protonation of the enol, occurs such that hy-
zyme and mandelate racemase.The active sites drogen is incorporated in the (3-pro-S)-posi-
are located in @barrel (TIM barrel) domains tion (PALMER et al., 1997). Other members of
and contain Mg2+, bound to a conserved se- this group include L-rhamnonate dehydratase
quence. The prototype enzyme is mandelate from E. coli and D-glucarate dehydratases
racemase from Pseudomonas putida which has from several eubacteria (HUBBARDet al.,
been structurally characterized. Lysine-166 1998).
acts as a (,!+selective base (LANDROet al., Glucarate dehydratase from Pseudomonas
1994) and histidine-297 as a (R)-selective base. putida acts on D-glucarate (281) and L-idarate
All members of the mandelate racemase sub- (294) (epimers at C-5) to give exclusively 5-de-
group of the enolase family have either one of hydro-4-deoxy-~-glutarate (297) (Fig. 101).
both of these residues (BABBITTet al., 1995, The two substrates are interconverted via the
1996). enol (295), which partitions between epimer-
C-2 of D-galactonate (272) has the (R)-con- ization (reprotonation) and dehydration in a
figuration (Fig. 100). Galactonate dehydratase ratio of 1:4. Early experiments suggested that
116 2 Lyuses
Tab. 8. Monosaccharide CarboxylicAcid Dehydratases (EC 4.2.1.X)
X Substrate, Product Reference

5
OH OH 0 OH
270 D-h&inonate 271 2-Dehydro-3-deoxy-D-arabinonate
6 DAHMSet al., 1982;

WIECZOREK et al., 1999
@0 2 - Ooz& OH
OH OH OH
272 D-Galactonate 273 2-Dehydro-3-deoxy-D-galactonate
7 OH OH ROBERT-BAUDOUY
et al., 1982;
DREYER,
1987
00, OH
OH OH OH
274 D-Altronate 275 2-Dehydo-3-deoxy-D-gluconate
8
00, &yo,
-
OH
HO
OH
HO
Q02GO OH
ROBERT-BAUDOUY
DREYER,1987
et al., 1982;
276 D-Mannonate 275 2-Dehydo-3-deoxy- D-gluconate
25
OH OH 0 OH
277 L-Arabinonate 278 2-Dehydro-3-deoxy-L-arabinonate
26 IWAMOTOet al., 99
279 D-Glucosaminate 275 2-Dehydo-3-deoxy- D-gluconate
OH OH
39 GOTTSCHALK
and BENDER,
1982
' O 2 W OH @ 0 2&OH
HO HO OH
280 D-Gluconate 275 2-Dehydo-3-deoxy-D-gluconate

Tab. 8. (continued)
X Substrate, Product Reference
40 OH OH PALMER
et al., 1998
@02+co,e-
HO HO
281 D-Glucarate 282 5-Dehydo-4-deoxy-D-glucarate
42
283 D-Galactarate 282 5-Dehydro-4-deoxy-D-glucarate
67
284 D-Fuconate 285 2-Dehydro-3-deoxy-D-fuconate
68
@
@F &
0 2 02
-
ANDERSON and HAIJSWALD,
1982; VEIGAand GIIIMARAES,
1991
OH OH OH
286 L-Fuconate 287 2-Dehydro-3-deoxy-L-fuconate
~ _ _ _ _ _
All 1982 references in this table are taken from Methods in Enzymology
the dehydration of D-glucarate (281)was only and the (R)-specific base as histidine-297 and
partially regioselective, based on the partial aspartate-270 (GULICK, et al., 1998).
scrambling of a radiochemical label from C-1
to C-6. However, epimerization of D-glucarate
to D-idarate which has &-symmetry renders 4.3.1.2 3,6-Dideoxysugars
C-1 and C-6 equivalent (PALMERand GERLT,
1996; PALMER et al., 1998). Elimination of the 3,6-dideoxyhexoses are found, (with a few
4-hydroxyl group gives an a-hydroxyacrylate exceptions) exclusively in the cell wall lipo-
(296) which is stereospecifically reprotonated polysaccharides of gram-negative bacteria of
by water. The hydrogen is incorporated exclu- the family, Enterobacteriaceae, where they act
sively with (4-pro-S) stereochemistry (PALMER as the dominant O-antigenic determinants
et al., 1997). Given that glutarate dehydratase (JOHNSON and LIU, 1998; KIRSCHNING et al.,
is capable of deprotonating both D-glucurate 1997; LIU and THORSON, 1994).There are five
(281) and L-idarate (294), the model for the 3,6-dideoxysugars known in nature: D-abe-
enolase family predicts that two bases should quose (298), L-ascarylose (299), L-colitose
be present. An X-ray structure determination (300),D-paratose (301) and D-tyvelose (302)
enabled the assignment of the (S)-specificbase (Fig. 102).Many organisms produce most or all
as lysine-213 (which is activated by lysine-211) of these simultaneously and all except for col-
118 2 Lyuses
OH OH OH OH OH
0
0 2 OH ‘
0 OH OH
H20j
OH OH HO HO HO HO
H20d
274 D-Altronate 276 D-Mannonate 280 D-Gluconate
H20f deqfy:z ~ EG%g ~

Gluconate
dehydratase
OH I)H
*
2
0‘ OH
279 D-Gluconaminate 275 2-Dehydo-3-deoxy-D-gluconate
H2O
HO 290 Protonated enamine
Fig. 99. D-Altronate (274), D-mannonate (276) and D-glUCOnate (280) undergo cY,p-eliminationof water to
give an enol(289) which tautomerkes to 2-dehydro-3-deoxy-~-gluconate (275). Dehydration of D-glucosam-
inate (279) also gives the same product.
itose (W), are produced biosynthetically by has a trivial, but conveniently short designa-
via a complex pathway commencing with tion which is used in all the figures, except Fig.
CDP-D-glucose (30%). Colitose (300) is 103 where the full name is shown for reference
formed biosynthetically from CDP-D-man- purposes. The full enzyme commission desig-
nose. nation is shown in the text.
The biosynthesis of CDP-ascarylose (299c) Biosynthesis commences with D-glucose
from D-glucose (303a) by Yersinia pseudotu- (303a) which is converted sequentially into the
berculosis has been investigated in consider- 1-phosphate (303b) and the 1-0-cytidylyl
able detail (Fig. 103; review HALLIS and LIU, (30%) derivatives catalyzed by a-D-glucose-1-
1999b).The pathway employs two dehydratas- phosphate cytidylyltransferase (E,) (THORSON
es (one with a “hidden” redox function), plus et al., 1994a).
two oxidoreductases and an epimerase to de- CDP-D-glucose 4,6-dehydratase (Eod) [EC
liver a product in which two stereocentres 4.2.1.451 catalyzes the transformation of CDP-
have been retained, two inverted and two re- D-glucose (30%) to CDP-6-deoxy-~-threo-~-
duced (Fig. 103). Three overlapping clones glycero-4-hexulose (304c).[4-*Hl]-CDP-~-glu-
containing the entire gene cluster required for cose (306)(Fig. 104) has been used to investi-
CDP-ascarylose biosynthesis have been iden- gate the pathway. It consists of three distinct
tified (THORSON et al., 1994b). Each enzyme steps; oxidation of the 4-hydroxy group to a
00, 00,
"j;I
OH -*11 OH 2or5 -IIOH
OH OH 272 D-Galactonate
HO co: OH cop
D-Galactonate dehydratase
281 D-Glucarate 294 L- Idarate
@0 2
+J OH
OH 291Enol
I
2H20
f OH OH 295
'H OH 292
0
OH OH 296
' H a d 2H20
OH
4
&@
293 (3S)-[3-*Hl]-2-Dehydro-3-
deoxy-D-galactonatehemiketal
Fig. 100. D-Galactonate dehydratase catalyzes the 0 0
a,p-elimination of water from D-galactonate (272)
to give an enol (291) which tautomerizes to 2-dehy-
0 2
-
dro-3-deoxy-D-galactonate (273) (Tab. 8). In deuteri- OH 0
um oxide, (3S)-[3-2H,]-2-dehydro-3-deoxy-~-galac-
tonate (292) is formed which cyclizes to the pyrano- 297 (4S)-4-2Hl]-5-Dehydro-
syl hemiketal(293). 4-deoxy-D-glucarate
Fig. 101. Glucurate dehydratase catalyzes the dehy-
dration of D-ghCUrate (281)and L-idarate (294).
ketone (307) and reduction of NAD to
NADH, deprotonation and P-elimination of
the 6-hydroxyl group (308) and conjugate ad- from C-4 to C-6 to give the 6-deoxy-sugar
dition of the hydride ion which originated (309). The replacement of the 6-hydroxyl
120 2 Lyases
HO .,OH
aR=OH
HO
OH
I
E,, a-D-glucose-1-phosphate
298 D-Abequose 299 L-Ascarylose
cytidylyltransferase
Ed,CDP-D-glucose 4.6-dehydratase
H2O
+
4
300 L-Colletose 301 D-Paratose
,.
E CDP-6-deoxy-L-threo-D-glycero-
E..
4-hexulose-3-dehydre
H2O
302 D-Tyvelose PMP 122, Pyridoxamine 5’-phosphate
Fig. 102. Naturally occurring 3,6-dideoxyhexoses. NADH E,, CDP-6-deoxy-L-threo-

D-glycero-4-hexulose-3-
Nm@ dehydrase reductase
group by hydride occurs with inversion of con-
PMP (CDP-6-deoxy-A3’-
figuration (Yu et al., 1992; RUSSELLand Yu,
122
H20$ glucoseen reductase)
1991). This stereochemical course is also fol-
lowed by the GDP-D-mannose dehydratase
from the soil organism (ATCC 19241) (Oms
et al., 1990) and the TDP-D-glucose 4,6-dehy-
dratase from E. coli (WANG and GABRIEL,
1970; SNIPESet al, 1977).The basic features of
the mechanism are nicely confirmed by the be-
havior of the difluoro-analog substrate (310) NAD(P)H
(Fig. 105). After traversing the reaction se- Ered
quence shown above (Fig. loo), the monofluo- NAD(P)
ro-derivative (311) so formed undergoes a fur-
Q-qR
HO
ther p-elimination of fluoride to give the al-
kene (308), which is the normal intermediate
in the sequence. However, there is no further
hydride to donate and instead addition of a nu- OH
299
cleophile located on the protein backbone oc-
curs to give an isolatable covalent derivative R = OH; L-Ascarylose
(312) (CHANGet al., 1998). cR=OCDP
The facial selectivity of hydride donation Fig. 103. The biosynthesis of CDP-ascarylose ( 2 9 9 ~ )
from NADH is rather difficult to determine from D-glucose (303a) by Yersiniu pseudotuberculo-
for this class of enzymes, because NADH is on- sis (122, PMP, pyridoxamine 5 ’-phosphate).
ly present during the catalytic cycle. Neverthe-
less it has been demonstrated that the product
(304c)is reduced by [4S-’H,]-NADH with in- NADH hydride donation to the a,p-unsaturat-
corporation of label when incubated with apo- ed ketone (308)might occur from the other
E,, and no label is transferred from [4R-*H,1- face. but this is imdausible (HALLIS and LUI.
NADH (Fig. 106). It is conceivable that 1998). (pro-S) Hyd;ide donation has also been
demonstrated for TDP-D-glucose4,6-dehydrat-

ase (WANGand GABRIEL, 1970), L-myo-inosi-
tol-1-phosphate synthase (BRYUNand JEN-
NESS,1981; LOEWUS et al., 1980) and UDP-D-
glucose-4-epimerase (NELSESTUEN and KIRK-
WOOD, 1971),which all utilize NAD and act on
sugars.
Most of the 4,6-dehydratases belong to a
rare group of enzymes which contain a tightly
bound NAD(H). As demonstrated above, this
is responsible for the redox process and is re-
tained throughout the catalytic cycle as a pros-
thetic group, rather than a co-substrate
(THOMPSON,et al., 1992; NAUNDORFand
309 308 KLAFFKE,1996). However, CDP-D-glucose 4,6-
dehydratase is a dimer of identical sub-units
Fig. 104. The isomerhation of [4-2H,]-CDP-D-glu- (42,500 Da), which only binds one equivalent
cose (306)to [6-ZH,]-CDP-6-deoxy-~-threo-~-glyce- of NAD, despite the presence of two binding
ro-Chexulose (309)by CDP-D-glucose 4,6-dehydra- sites and there is a large anti-co-operative ef-
tase (Eod)from Yersinia pseudotuberculosis. fect for binding a second molecule of NAD.
NADH is bound much more strongly and is re-
leased when the substrate binds indicating that
this may be the normal “resting” state of the
HO%HO enzyme in vivo (HE et al., 1996).
The deoxygenation at C-3 is catalyzed by
R R CDP-6-deoxy-~-threo-~-gZycero-4-hexulose-3-
310 I 311 dehydrase (El) a pyridoxamine 5 ’-phosphate
(PMP)-linked, [2Fe-2S] containing protein and
R = OCDP CDP-6-deoxy-~-threo-~-gZycero-4-hexulose-3-
dehydrase reductase (formerly designated
CDP-6-deo~y-A~~~-glucoseen reductase) (E3) a
[2Fe-2S]-containing flavoprotein (Lo et al.,
1994). In the first step CDP-6-deoxy-~-threo-
~-glycero-4-hexulose(304c)(Fig. 107) under-
goes condensation with PMP (122) to form the
corresponding imine (313) which undergoes
312 308
1,4-eliminationof water to give the protonated
Fig. 105. Biotransformation of an affinity label by 2-aza-1,4-diene (314). Both steps are rever-
CDP-D-glucose 4,6-dehydratase (Ed)from Yersinia sible and the elimination is stereospecific;only
pseudotuberculosis. the (4-pro-S)-hydrogen of PMP undergoes ex-
change (WEIGELet al., 1992). The reaction
stops at this stage, unless CDP-6-deoxy-~-
threo-~-gZycero-4-hexulose-3-dehydrasere-
3
ductase is present. This forms a tight complex
with the dehydrase (CHENet al., 1996) and me-
HOlL diates a reduction in which electrons are trans-
‘1” .
R
R
ferred within the reductase from NADH to
FAD to the [2Fe-2S]-centerand from there to
304c R = OCDP 306 the [2Fe-2S]-center of the dehydrase. The de-
Fig. 106. Reduction of CDP-6-deoxy-~-threo-~-gZy- tails of the transfer of electrons from there to
cero-4-hexulose (304c)by CDP-D-glucose 4,6-dehy- the PMP-sugar adduct are somewhat specula-
dratase (Ed)from Yersinia pseudotuberculosis. tive. It is likely to involve stepwise addition of
122 2 Lyases
single electrons and this is supported by the

detection of an ESR signal for a phenoxy radi-
cal (JOHNSONet al., 1996). One attractive pos-
sibility is that electron transfer occurs to an u-
quinomethide formed by protonation at C-3 of
the sugar (PIEPERet al., 1997).This occurs ster-
R=OCDP I# 122 PMP
eospecifically with incorporation of a proton
from water exclusively at the C-3 equatorial
position (316) (PIEPERet al., 1995).
Reduction steps
CDP-3,6-dideoxy-~-glyceru-~-glyceru-4-
hexulose is the common intermedaite for D-
abequose (298) (LINDQUIST et al., 1994), L-as-
carylose (299),D-paratose (301) (HALLISet al.,
1998) and D-tyvelose (302) (HALLISand LUI,
1999a) by reduction and/or epimerization (Fig.
108). The gene encoding CDP-paratose syn-
thase (rfbS) in Salmonella typhi has been iden-
tified, sequenced, amplified (PCR) and cloned
into a PET-24(+) vector. Expression and pur-
ification of the enzyme enabled it to be fully
charactorized. This homodimeric oxidoreduc-
tase transfers the pro-S hydrogen from
NADH, and has a 10-fold preference for
NADPH over NADH. (HALLISet al., 1998).
4.3.2 Lyases which Act on

Polysaccharides (EC 4.2.2)
4.3.2.1 Pectin and Pectate Lyases

Pectin, pectins or pectic substances are ge-
neric names used to describe a group of heter-
ogenous acidic polysaccharides found widely
in primary plant cell walls and intercellular
layers. They make up for example, 30% of the
dry weight of apples, but are usually present in
much smaller amounts in woody tissues. The
principal sugar residue is D-galacturonic acid
El-PMP4 which may be partially esterified (pectinic ac-

ids) or present as the free acid or calcium salt
(pectic acids) (Fig. 109).The pectinic acids are
freely soluble in water and are good gelling
O2H
m agents, which are used as pharmaceutical exci-
HO I pients and as gelling agents for fruit jellies
R 316 (cf. 30%)
(PILNIKand VORAGEN, 1992). Pectic acids are
Fig. 107. The El, CDP-6-deoxy-~-threo-~-glycero- much less soluble and usually require ligands
4-hexulose-3-dehydrase catalyzed reduction (R = for the counterions of the carboxylates (e.g.,
OCDP). EDTA) to solubilize them. The most common
HO pectins are heteropolysaccharides containing
neutral and acidic sugars, but there are also
more rare homopolysaccharides such as D-ga-
lactans, D-galacturonans and L-arabinans
I
R (KENNEDY and WHITE,1990).Pectinic and pec-
tic acids are cleaved by different classes of en-
CDP-Abequose 317 CDP-D-Abequose
zymes (Tab. 9).
synthase Pectolytic enzymes are essential in the food
R = OCDP
industry for the clarification of fruit juices and
wines. For example, in freshly pressed apple
juice, pectins act as solubilising agents for oth-
erwise insoluble cell debris. Hydrolysis of the
pectin causes floculation of the insoluble com-
ponents. Pectolytic enzymes are also useful for
dehulling, extractive, pressing (sugar beet and
t olives) and fermentation (cocoa) processes be-
cause they weaken the cell walls and increase
1
yields (ALKORTAet al., 1998). Commercial
pectolytic enzymes are almost invariably mix-
R OH 319 tures which also contain cellulases, hemicellu-
lases and proteases and only part of the pecto-
318 CDP-D-Paratose
NAD(P)H lytic activity is due to lyases (NAIDUet al.,
CDP-tyvelose
epimerase F:AD(p) 1998).
Enzymes that degrade pectic substances are
Hoq
frequently the first cell wall degrading en-
zymes produced by plant pathogens. Depoly-
merization of pectins not only provides nutri-
H o q R ents for the invading organidm, but also expos-
es other cell wall components to degradation.
OH
Pectate and pectin lyase activities have been
R
detected in the white rot fungus Trametes tro-
gii (LEVINand FORCHIASSIN, 1998), Colletotri-
320 CDP-D-Tyvelose 299c CDP-L-Ascarylose
chum gloeosporiodes (ORTEGA, 1996), Botryis
Fig. 108. The El, CDP-6-deoxy-~-threo-~-glycero-4- cinerea (MOVAHEDRI and HEALE, 1990;KAPAT
hexulose-3-dehydrase catalyzed reduction (R = et al., 1998a, b), Aspergillus niger (VAN DEN
OCDP). CDP-D-tyvelose 2-epimerase (HALLISand HOMBERGH et al., 1997), Pseudocercosporella
LUI,1999a), CDP-paratose synthase (HALLISet al., herpotrichoides infecting wheat plants (MBWA-
1998). GA et al., 1997), Amycoluta sp. (BRUHLMANN,
Tab. 9. Lyases (EC 4.2.2.X) Acting on Poly-D-Galacturonates(321)

~
X Name Regioselectivity Occurrence Conditions
2 Pectate lyase endo bacteria and pathogenic fungi Caz+,pH 9-10,

long chains
6 Oligogalacturonidelyase exo Erwinia carotovoransand -
E. aroideae
9 Exopolygalacturonate exo rare, Clostridium,Streptomyces, Ca2 ,pH 9-10
+
lyase Erwinia,Fusarium
10 Pectin lyase endo common in fungi pH 5-6, long
chains
124 2 Lyases
I
“WY
] D-Galacturonic acid residue
R’= metal ions, eg. Naf3Cazo; Pectates

RO R = Me; Pectins
RO
D-Galacturonic acid residue
RO
R = H, acetyl, L-arabinose,
L-fucose, D-galactose,
RO
-
mu
D-glucose, D-xylose, I
araban, galactan
Q
I
Fig. 109. Generalized structure for pectic substances.The distance between “branching”rhamnose residues
depends on the source, e.g., in citrus pectin there are typically 25 intervening D-galaCtUrOniC acid residues and
16 in tomato pectin.
1995),Pseudomonas marginalis N6031 (NIKAI- tially with long chain pectates. Care must be
DOU et al., 1995) and a variety of organisms on taken when using pectate lyases to get obtain
rottern cocoyams (UGWUANYI and OBETA, material free from esterases, which will enable
1997) cleavage of pectins.
Pectate lyases have been identified in many
bacteria and pathogenic fungi. The X-ray crys-
4.3.2.2 Pectate Lyases [Poly(l,4-a- tal structures for pectate lyase C (PelC) and
D-Galacturonide)Lyase,Pectate pectate lyase E (PelE) from Erwinia chrystha-
nemi and from Bacillus subtilis (BsPel) (PICK-
Transeliminase, EC 4.2.2.2, formerly ERSGILL et al., 1994) are very similar to each
EC4.2.99.31 other and that of Aspergillus niger pectin lyase
(MAYANSet al., 1997).The structures are com-
Pectate lyases catalyzes the cleavage of pec- posed of all parallel P-strands wound into an
tate (321a) to give D-galacturonate (332a) and unusual right-handed parallel P-helix (JENKINS
4-deoxy-cr-~-gluc-4-enuronate (323a) termi- et al., 1998; PICKERSGILL et al., 1994 and cf.
nated oligomers. The cleavage reaction is a 1998).The activekalcium binding site is locat-
trans-a,p-elimination, operates at pH 8.0-10 ed in a cleft between this feature and two T3-
and has an absolute requirement for Ca2+ loops, which also contains a highly basic region
counterions. As with the pectin lyases, attack is which is presumably responsible for deproto-
random, endo-selective and occurs preferen- nation adjacaent to the carboxylate group.
The genes for Butyrivibrio fibrisolvens en- 4.4 Carbon-Nitrogen Lyases

do-p-1,4-glucanase plus the Erwinia pectate
lyase and polygalacturonase were each insert- (EC 4.3)
ed between a yeast expression secretion cas-
sette and yeast gene terminator and cloned 4.4.1 Ammonia Lyases
into yeast centromeric shuttle vectors. Coex-
pression in Saccharomyces cerevisiae success- (EC 4.3.1.X)
fully resulted in secreted activity for all three
enzymes (VANRENSBURG et al., 1994). The ammonia lyases have achieved consid-
erable industrial importance because of their
use in the manufacture of amino acids.This ar-
4.3.2.3 Pectin Lyases ea has been spurred by the development of
[Poly(Methoxygalacturonide)Lyase,
Aspartame (325), (Nutrasweet@,a-L-aspartyl-
L-phenylalanine methyl ester, Fig. l l l ) , which
EC 4.2,2.10] is an artificial sweetener that is some 200 times
sweeter than sucrose. Unlike many other arti-
Pectin lyase only acts on poly(methy1 D-gal- ficial sweetness its has no bitter after taste and
acturonate esters) (321b) (Fig. 110) and has no it is used extensively in soft drinks, confection-
activity with the corresponding acids.The main ery and many other processed foods. The pat-
source of this enzyme is Aspergillus sp. which ent for its use ran out in the 1980s and hence
releases pectin lyases A and B types when for producers to remain competitive they must
grown on pectin (DELGADO, et. al., 1993; VAN develop new, cheaper and patentable ways to
DEN HOMBERGH et al., 1997).Pectin lyases are manufacture it (OYAMA, 1992).
endo-selective for cleavage of poly(methy1 D-
galacturonate esters) (321b) at random posi-
tions and show very little activity with di- and
trisaccharides. pH optima range from 5.5 to 8.6
and are generally lower than those for the pec-
tate lyases. However, pectin lyase A activity
drops above pH 7 due to conformational
changes at the active site triggered by the H
. f e
proximity of aspartate residues (MAYANS et al.,
1997). H O
- 101 L-Aspartate 324 L-Phenylalanine
k k
methyl ester
I 1
JIMT
RO R
RO w
325 Aspartame
Fig. 110. The cleavage of pectic substances (321) by Fig. 111. The manufacture of Aspartame (325) re-
pectic lyases to give terminal 4-deoxy-a-D-gluc-4- quires cost effective routes to L-aspartate (101) and
enuronosyl residues (323). L-phenylalanine methyl ester (324) (OYAMA,1992).
126 2 Lyases
4.4.1.1 Aspartase (L-Aspartase, Bacterium cadaveris, Brevibacterium ammoni-

agenes and Brevibacterium fZavum (DRAUZ
Aspartase Ammonia-Lyase; and WALDMANN, 1995). L-Aspartase is postu-
EC 4.3.1.1) lated to play a significant role in the mineral-
ization of soils, by the release of ammonium
Aspartase catalyzes the addition of ammo- ions (SENWO and TABATABAI, 1996,1999).
nia to the alkene bond fumarate (1%)to give Aspartase is one of a number of related en-
L-aspartate (101) (Fig. 112).The reaction is for zymes which catalyze additions to the alkene
all practical purposes, absolutely specific for bond of fumarate, such as class I1 fumarases
fumarate and L-aspartate (FALZONEet al., (EC 4.3.1.2, water, WOODSet al., 1986),and the
1988), but hydroxylamine can substitute for amidine lyases; arginosuccinase (EC 4.3.2.1, L-
ammonia (KARSTENand VIOLA,1991). The arginine, COHEN-KUPEIC et al., 1999; TURNER
equilibrium constant for the reaction heavily et al., 1997) and adenylsuccinase (EC 4.3.2.2,
favors aspartate formation over the reverse AMP, LEEet al, 1999).These enzymes have sig-
process (Keq 5 . D G ” 3.2 kcal mol-l). nificant sequence homology (WOODSet al.,
Carbon-nitrogen bond cleavage is at least par- 1988a) and catalyze the addition-elimination
tially rate limiting, but carbon-hydrogen bond reactions with identical stereochemistry, i.e.
cleavage is not. This can be rationalized as a trans, with the hydrogen added to the (3-pro-
conventional conjugate addition (Michael) re- R-) position (Fig. 113) (GAWRON and FONDY,
action to give a stabilized carbanion which is 1959). The reaction is fully reversible and
rapidly protonated. In the reverse reaction this hence can be used to prepare hydrogen isotop-
equates to efficient deprotonation adjacent to omers of aspartate (328) from, for example
the carboxylate group of L-aspartate followed pertritiated-aspartate (327) (Fig. 114) (PICCI-
by slow p-elimination (PORTERand BRIGHT, RILLI et al., 1987;cf. YOUNG,1991).Large scale
1980;NUIRYet al., 1984) syntheses of of 15N-labeled L-aspartate
Aspartase was discovered by Harden (1901) (SOOKKHEO et al., 1998) and (2S,3S)-[2,3-’H2]-
in Bacillus coli communis over one hundred and (2S,3R)-[3-’H]-aspartate (LEEet al., 1989)
years ago, and in 1932 it became the first mi- have been achieved using immobilized aspart-
crobial enzyme to be used in the synthesis of ase.
an amino acid. It is widely distributed in bacte- Asparatase from E. coli (and most other
ria as well as in fungi, higher plants and ani- sources) is a tetramer of identical 50 kDa sub-
mals but not in mammals. The enzyme has units (50 kDa). It is in a pH dependent equilib-
been purified and characterized from microor-
ganism including Bacillus fluorescens, B. subti-
lis, B. strearothermophilus, Pseudomonas fluo- $ 2 ~ c o ’ 196 Fumarate
rescens, r! trefolii, Escherichia feundii, E. coli,
41
0
ao,& “2 196 Fumarate
I1
ONH,
Asp-e ,H
326 (2S,3R)-[3-’H,]-Aspartate
101 L-(3-(+)-Aspartate Fig. 113. The stereochemistry of the aspartase cata-
lyzed addition of ammonia in deuterium oxide to fu-
Fig. 112. The aspartase catalyzed the addition of am- marate (1%) to give (2S,3R)-[3-2H1]-aspartate(326)
monia to fumarate (1%) to give L-aspartate (101). (GAWRON and FONDY, 1959).
all of these, thus far (JAYASEKERAet al., 1997).

For example, L-aspartate P-semialdehyde
(329), undergoes deamination by aspartase to
give fumaric P-semialdehyde (330), which
reacts with cysteine-273 to give a catalytically
inactive covalent adduct with the putative
structure (331)(Fig. 115) (SCHINDLER and VI-
OLA, 1994). Inhibition of inactivation by fu-
marate and divalent metal ions, indicates that
b HZO inactivation by L-aspartate P-semialdehyde
(329), occurs at the active site. However, muta-
genesis of Cysteine-273, yielded mutants
(C273A, C273S) which were still catalytically
active, but less sensitive to inactivation (GIOR-
GIANNI et al., 1995). Similarly, treatment of
aspartase with N-ethylmaleimide caused loss
3-ZHl,3Hl]-Aspartate of activity due to modification of cysteines-140
Fig. 114. Stereospecific exchange of the (3-pro-R)- or 430, but mutagenesis (C430W) increased
tritium of (2s)- [2-3H,3-3H2]-aspartate(327) to give activity (MURASEet al., 1991).Analysis of con-
(2S,3S)-[2-3H,3-2H1,3H1]-aspartate (328)(PICCIRILLI served residues and comparisons with the
et al., 1987). structure of fumarase, provided a further list of
rium between two forms.At pH 7.5 and above,

divalent metal ions (e.g., Mg2+) are required
for activity, and in the amination direction a
lag time is observed which is eliminated by the
addition of L-aspartate (101) or structural ana-
logs. At lower pH values there is no require- 1 329 L-Aspartate
P-semialdehyde
ment for metal ions and no lag time (KARSTEN
and VIOLA,1991). In contrast, the aspartase
from BaciZZus sp. YM55-1 is insensitive to mag-
NH4@ /I Aspartase
nesium ions over the complete pH range Aspme 1
I
(KAWATA, et al., 1999) and the aspartase from
H. alvei is activated by magnesium ions at all
pHs (YOONet al., 1995;cf. NUIRYet al., 1984).
In contrast to the absolute substrate specific-
ity, aspartase is activated by a range of metal 330 Fumarate
semialdehyde
ions. Transition metal ions are bound better
than alkali earth metals, but they are inhibito-
ry above 100 pM, whereas there is no signifi-
cant inhibition by alkali earth metals. Electron
paramagnetic resonance measurements indi-
cated that at higher pH, Mn” is bound more Aspartase
tightly (FALZONE et al., 1988). I
cys-273-s
The X-ray crystal structure of aspartate am-
monia-lyase from E. coli has been determined
to 2.8 A. A putative active site was identified
4JH
0 2
331
but the precise residues involved in catalysis
could not be assigned (SHIet al., l993,1997).A Fig. 115. Covalent modification of aspartase by fu-
succession of candidate residues have been marate semi-aldehyde (330) formed by aspartase
postulated as active site acids and bases, but catalyzed deamination of L-aspartate semi-aldehyde
site specific mutagenic studies have excluded (329).
128 2 Lyases
candidates for mutagenesis (C389S, C389A,

H123L), but these caused only minor reduc-
tions in activity. However, these studies result-
ed in the identification of lysine-327 as a bind-
332 a-Ketoacid 333 L-Amino acid
ing site for one of the carboxylate groups of
the substrate and the other is probably bound
Aminotransferase
by Arginine-29 (SARIBAS et al., 1994;JAYASEK-
ERA et al., 1997). In summary, the role of the
active site residues in aspartase is subtle and
quite different to that of fumarase. Their full
identification will probably require an X-ray
crystal structure with a substrate analog.
Biotechnology
The major use for L-aspartate (101) is an im-
portant food additive. It is also used in many
medicines, as a precursor of the artifical sweet-
ner, Aspartame (325; Fig. 112), and as a chiral 114 L-Glutamate 334 2-Ketoglutarate
synthon. L-Glutamate (114) and L-aspartate
(101) are the most important amino donors in
transamination in nature. L-Aspartate is the
most common donor in the manufacture of
amino acids by transamination (Fig. 116), but
there are a few transaminases which do not ac-
cept it as an amino donor. However, by ex-
ploiting a L-glutamate (114)la-ketoglutarate
(334) couple, it can be used with virtually all
transaminases. Moreover the unfavorable
equilibrium constant (Keg= circa 1) can be dis-
placed by decarboxylation of a-ketoglutarate
(334) to pyruvate (1) (STIRLING, 1992).
L-Aspartate has been produced in batch cul- 28 Oxaloacetate 101 L-Aspartate
ture since 1960, using free, intact E. coli cells
with high aspartase activity. In 1973,a continu-
ous process was introduced which used E. coli Oxaloacetate
cells entrapped in polyacrylamide gel, packed decarboxylase
into a column. Such columns have a half-life of
120 days at 37 C. Immobilization in k-carra-
O c02
geenan, hardened with glutaraldehyde and
hexamethylene diamine extended the half life
to almost two years and this system was intro-
duced into production in 1978. Using a 1,000 L
column packed with hardened k-carrageenan
immobilized E. coli some 3.4 tonnes of L- 1 Pyruvate
aspartate can be produced per day and 100
tonnes per month. E. coli EAPc7 produces Fig. 116. L-aspartate (101) is an amino donor for
transaminationwith most a-ketoacids (332).When it
seven times higher aspartase activity than the cannot act as a direct donor, the amino group can be
parent strain (E. coli ATCC 11303), but also donated via L-glutamate (114).The equilibrium con-
has fumarase activity.This can be abolished by stant is typically about 1,but may be displaced to-
incubating the culture broth with 50 mM, L- wards product (333) formation by in situ decarboxy-
aspartate at 45 "C for 1 hour. After immobil- lation of oxaloacetate (28) to give pyruvate (l),
ization, the productivity of L-aspartate treated which is a less reactive substrate.
E. coli EAPc7 was some six times the parent

strain and the half life was 126 days. This
system was commercialized in 1982 (CHIBATA, I 335 Mesaconate
et al., 1995).The activity of L-aspartase from E.
41
NH4@-4
k
coli has also been enhanced 2 to 3 fold by site-
directed mutagenesis (C430W) (MURASE et
al., 1991), limited C-terminal proteolysis and NHp
acetylation of amino groups by acetic anhy-
dride (MURASEand YUMOTO, 1993).
The amination of fumarate to give aspartate
I1 PMethylaspartase
is exothermic, which means that on a large

scale, an expensive heat exchanger system is
required to minimize thermal degradation of
the enzyme. Consequently, there has been 1 336 L-thre0-(2Ss.3S)-
3-Methylaspartate
much interest in aspartases from thermostable
organisms, which will tolerate operation at Fig. 117. The p-methylaspartase catalyzed addition
higher temperatures. A thermostable aspart- of ammonia to mesaconate ((E)-2-methylfumarate)
ase has been purified from the thermophile, (335) to give ~-threo-(2S,3S)-3-methylaspartate
Bacillus sp. YM55-1, which has an activity 3 to (336).
4 times higher than those from Escherichia co-
li and Pseudomonas fluorescens respectively at
30 “ C (KAWATA, et al., 1999). robacter sp. strain YG-0505 and Morganella
morganii strain YG-0601 (KATo and ASANO,
1995a), Citrobacter amalonaticus strain Y G-
4.4.1.2 P-Methylaspartase 1002 (ASANOand KATO, 1994a, b; KATO and
ASANO,1995b) have been purified and crystal-
(Methylaspartase Ammonia-Lyase, lized. The gene for p-methylaspartase in Citro-
EC 4.3.1.2) bacter amalonaticus strain YG-1002, has been
cloned, sequenced and expressed in E. coli, but
p-Methylaspartase catalyzes the addition of synthetic applications have barely been ex-
ammonia to mesaconate ((E)-Zmethylfumar- plored (&TO and ASANO,1998).
ate) (335) to give ~-threo-(2S,3S)-3-methyl- The remainder of this section will deal ex-
aspartate (336) (Fig. 117).The stereochemistry clusively with the p-methylaspartase from the
of addition is anti. Ammonia adds to the si-face Clostridium tetanomorphum, unless indicated
of C-2 and hydrogen to the re-face of C-3.This otherwise. The gene has been cloned, se-
reaction is the second step in the catabolism of quenced and expressed in E. coli. The open
L-glutamate (114)under anaerobic conditions reading frame, codes for a polypeptide of 413
(KATo and ASANO,1997). In the prior step, L- amino acids (45,539 Da), which would exist as
glutamate (114) undergoes an extraordinary a homodimer in solution (GODAet al., 1992).
rearrangement to give ~-threo-3-methylaspar- The deduced sequence for Citrobacter amalo-
tate (336),which is catalyzed by coenzyme BIZ- naticus YG-1002 p-methylaspartase is identi-
dependent glutamate mutase (EC 5.4.99.1). cal in length and has 62.5% identity (KATO
The p-methylaspartase from the obligate and ASANO,1998).
anaerobe Clostridium tetanomorphum has It has long been assummed (on the basis of
been extensively investigated. Intimate details substantial circumstantial evidence) that p-
of the mechanism have been deduced in a long methylasparatase, histidine ammonia-lyase
series of studies (GANIet al., 1999) and the (HAL) and phenylalanine ammonia-lyase
gene has been cloned, sequenced and ex- (PAL) all bear a dehydroalanine group at the
pressed in E. coli (GODAet al., 1992).The pre- active site, which acts as an electrophilic “trap”
liminary data on enzymes from other sources, for ammonia during the catalytic cycle (GUL-
suggests that they are fairly similar. p-methyl- ZAR et al., 1995). However, a recent X-ray
aspartases from the facultative anaerobes, Cit- structure of catalytically active Pseudomonas
130 2 Lyases
putida HAL has revealed a 4-methylene-imid- usuable yields of products. P-Methylaspartase

azole-5-one group at the active site (cf. Fig. is much more tolerant of variation of the nu-
123;SCHWEDE et al., 1999). It is not clear at the cleophile. Alkyl amines (entries 1-43), hydra-
time of writing, if this is a general or unique zines (9-13), hydroxylamines (15-17) and me-
phenomenon. Nevertheless, the gross mecha- thoxylamines (entries 18-20) are all accepted
nisms of action of dehydroalanine and 4-meth- to some extent. Overall, structural deviation
ylene-imidazole-5-one group, are sufficiently from the natural substrates reduces the rate in
similar, that a discussion of the chemistry of an additive way. The cyclopropyl methyl- and
the former, provides a fair approximation to bromo-derivatives (Mia, b) are a potent com-
that of the latter. Both of the P-methylaspar- petive inhibitors (Ki 20 and 630 pmol L-' and
tases bear the Ser-Gly-Asp sequence (Tab. 10) respectively) (Fig. 118;BADIANI et al., 1996). It
which is conserved in all putative dehydroala- would be of great interest to discover if the
nine bearing proteins, however, none of the amino derivative (341c) would yield the corre-
other conserved residues found in HAL'S or sponding cyclopropene and if this reaction
PAL'S are found in the p-methylaspartases.Al- could be extended to higher cyclic homologs.
beit that the conserved glycine in the -5 posi- P-Methylaspartase catalyzes the exchange
tion may be a conservative replacement for of the C-3 proton of ~-threo-3-methylaspartate
proline. (336) with solvent, faster than deamination
p-Methylaspartase has attracted much at- (BOTTINGet al., 1987). This was originally
tention because (unlike aspartase), it accepts a interpreted as indicating a carbanion interme-
fair range of alternative alkenic substrates diate, but 15N/14N-2H/1Hisotope fractionation
(Tab. 11) and nucleophiles (Tab. 12) (BOTTING
et al, 1988a). Substitution of the methyl group
of mesaconate (335,entry 2) by alkyl groups
(entries 3-5) reduces the rate, but nevertheless
adequate yields of products can be obtained.
Amination of the halo-derivatives (entries
7-10), is complicated by enzyme deactivation Fig. 118. Cyclopropyl inhibitors (341)of p-methyl-
and only the chloro-fumarate (entry 8) gives asparatase (BADIANI et al., 1996).
Tab. 10. Amino Acid Sequences of Enzymes Bearing Dehydroalanine/4-Methylene-Imidazole-5-One Pre-

cursor Motifs (entry 1, GODAet al., 1992;entry 2, KATO and ASANO,
1998;entries 3-15, LANGER
et al., 1994b)
Entry Enzyme Species Range Residues

5 4 3 2 1 0 1 2 3 4 5 6
1 BMA Clostridium tetanomorphum 168-179 P V F A Q S G D D R Y D

2 BMA CitrobacteramalonaticusYG-1002 168-179 P L F G Q S G D D R Y I
3 HAL Pputida 138-149 G S V G A S G D L A P L
4 HAL S. griseus 142-153 G S L G C S G D L A P L
5 HAL B. subtilis 137-148 G S L G A S G D L A P L
6 HAL R.norvegicus 250-261 G T V G A S G D L A P L
7 HAL M.musculus 250-251 G T V G A S G D L A P L
8 PAL R. toruloides 205-216 G T I S A S G D L S P L
9 PAL R.rubra 211-222 G T I S A S G D L S P L
10 PAL 0.sativa 184-195 G T I T A S G D L A P L
11 PAL Pcrkpum 197-208 G T I T A S G D L P V L
12 PAL G.max 194-205 G T I T A S G D L P V L
13 PAL I. batates 187-198 G T I T A S G D L P V L
14 PAL L.esculentum 204-315 G T I T A S G D L P V L
15 PAL P vulgaris 193-204 G T I T A S G D L P V L
BMA, p-methylaspartase; HAL, histidine ammonia-lyase;PAL, phenylalanine ammonia-lyase

Tab. 11.The P-MethylaspartaseCatalyzed Addition of Ammonia to Substitu-

ted Fumarates (AKHTAR et al., 1986,1987a,b)
ONH,
p-Methylaspartase
R R
338 339
Entry R Yield Rate, Comments

%
1 H 90 very fast, (1% + 101)

2 Me 61 fast (335 + 336)
3 Et 60 moderately fast
4 "Pr 49 very slow
5 'Pr 54 very slow
6 "Bu 0 none
7 F - very slow
8 C1 60 moderately fast
9 Br - moderately fast, inhibitor
10 I - not a substrate
measurements demonstrate that elimination is nine residue (most likely with cysteine = B,)
concerted and that product release from the and no bound metal ions (343). Binding of
enzyme occurs in a slower step. The C-3 proton magnesium ions (344),promotes addition of L-
exchange reaction has a primary deuterium ki- fhreo-3-methylaspartate (336) and binding of
netic isotope of circa 1.6 in the range pH potassium ions promotes the P-elimination of
6.5-9.0, but this is reduced to 1at high and low B, (346)to reveal the dehydrhydroalanine res-
concentrations of potassium ions. Magnesium idue (347). Conjugate addition of the amino
ions are also essential for activity (BOTTINGet group of ~-threo-3-methylaspartate (336),
al., 1988b, 1989;BOTTINGand GANI,1992). gives the adduct (349) which undergoes con-
The elimination of ammonia from the 3-epi-
mer of the natural substrate i.e., ~-erythro-3-
methylaspartate (342),occurs at about 1% of
the rate of the natural substrate (Fig. 119). Iso-
tope studies have demonstrated that epimer-
ization does not occur prior to elimination and 342 L-erythro-(2S,3R).
3-Methylaspartate
hence the process must be a syn-elimination.
In the addition direction, the threo-stereoiso-
p-Methylaspartase
mer (336) is formed first and then the erythro-
stereoisomer is formed very slowly (ARCHER
et al., 1993a,b; ARCHER and GANI,1993;BEAR
et al., 1998).
The mechanism of action of p-methylaspart-
ase has undergone a series of refinements as
the evidence has accumulated (Fig. 120). The
current model for the catalytic cycle encom-
002(+rcoF 335 Mesaconate
Fig. 119.The P-methylaspartase catalyzed syn-elimi-

passes 16 intermediates and 23 kinetic param- nation of ammonia from ~-erythro-(2S,3R)-3-meth-
eters. The resting state of the enzyme contains ylaspartate to give (342) mesaconate ((E)-2-methyl-
a conjugate addition adduct of the dehydroala-
132 2 Lyases
Tab. 12.The P-MethylaspartaseCatalyzedAddition of Amines to Substituted

Fumarates (GULZAR et al., 1994,1997;BOTTING
et al., 1988a)
RZ, ,R3
N
I H
H 340 R2, I ,R3
\ &?KO,
B-Methylaspartase 0 2 &coy
R' R'
Substituents
Entry Alkene 338 Amine 340 Conversion , Yield

R' R2 R3 % %
1 H Me H 55 45
2 Me Me H 54 40
3 Et Me H 60 35
4 "Pr Me H NR -
5 'Pr Me H NR -
6 H Me Me 70 38
7 Me Me Me NR -
8 H Et H 5 -
9 H NH2 H 89 42
10 Me NHz H 91 41
11 Et NH2 H 90 57
12 "Pr NHZ H 90 31
13 'Pr NH2 H 90 33
14 c1 NHz H NR -
15 H OH H 90 28
16 Me OH H 90 19
17 Et OH H 60 12
18 H OMe H 80 31
19 Me OMe H 70 34
20 Et OMe H NR -
NR, no reaction
certed elimination (350).A sequence of proton found in mammals (TAYLOR, et al., 1990) and
transfers then promotes the p-elimination of in fact uroconate was first discovered in dog
ammonia (352) and the readdition of B2 to the urine in 1874. Histidase is found in plants and
dehydroalanine residue (354), which is fol- numerous microorganisms, e.g., Pseudomonas
lowed by product (336) and cofactor release testosteroni, Bacillus subtilis and Streptomyces
(POLLARD et al., 1999; GANIet al., 1999; BOT- griseus (Wu, et al., 1992). Several organisms
TING et al., 1992). are capable of growth by utilising exogenous
histidine. The majority of researchers have
studied the enzyme from Pseudomonas ATCC
4.4.1.3 Histidase (Histidine 11299, which has been described at various
Ammonia-Lyase, EC 4.3.1.3) times as l? putida, l? jluorescens, but is now
classified as l? acidovorans (CONSEVAGE and
Histidase catalyzes the addition of ammonia PHILLIPS, 1985). We will follow the consensus
to uroconate (368) to give L-histidine (137) usauge which is l? putida.
(Fig. 121). Unlike the P-methylasparatase and Histidase is the first enzyme in the major ca-
phenylalanine ammonia-lyase, histidase is tabolism of histidine. A deficiency of histidase
343
Q 0 2 q
367
H"0 fl
366 347
Fig. UO.
134 2 Lyases
Ser Gly Asp
0 0
Histidase
NH,@
137 L-Histidine
Fig. 121. The histidase catalyzed addition of ammo-
Enz J H
Enz
nia to urocanate (368)to give L-histidine (137). 0
370
Fig. 122. Formation of dehydroalanine residues in
activity in humans causes accumulation of his- peptides.
tidine in body fluids (histidinemia, TAYLOR, et
al., 1991). The amino acid sequence is 93%
conserved with rat and mouse sequences in- 1985), [14C]-nitromethane,cysteine (HERNAN-
cluding four N-glycosylation consensus sites. DEZ et al., 1993),phenyl hydrazine and sodium
Histidase activity has been detected primarily bisulfite. Double inhibition experiments and
in the liver and epidermis as well as in kidney, protection by L-histidine established that these
adrenal gland and skin. (SUCHIet al., 1993;SA- reagents react at the same catalytically signifi-
NO,et al., 1997). cant site. The adduct formed with [3H]-sodium
It has long been assummed that the catalytic borohydride and [‘“CI- cyanide were shown to
activity of histidase results from the presence be [3-3H]-~-alanineand [4-14C]-aspartatere-
of a dehydroalanine residue (370),formed by spectively (HANSONand HAVIR,1972; CON-
p-elimination of the hydroxyl group of a serine SEVAGE and PHILLIPS, 1985).
residue (369) (Fig. 122). This would plausibly This work enabled the serine precursor of
act as a Michael acceptor for the conjugate ad- the putative dehydroalanine to be assigned as
dition of ammonia and or the amino group of serine-143 in l? putida histidase (HERNANDEZ
histidine. The conjugate addition adduct acts in and PHILLIPS, 1994;LANGER, et al., 1994a) and
effect as an immobilization device, around serine-254 in rat histidase (TAYLORand
which the other components of the reaction MCINNES, 1994)
can be optimally orientated to promote cataly- Mutation of the key serine residue residue
sis (cf. Fig. 120). Putative dehydroalanine resi- to alanine abolishes activity (TAYLORand
dues are found in a conserved sequence; MCINNES,1994; LANGERet al., 1994b; HER-
GXXXXSGDLXPL in histidase and phenylal- NANDEZ and PHILLIPS,1994), whereas muta-
anine lyase, whereas P-methylaspartase only tion to cysteine, yields active enzyme, suggest-
has the key SGD motif (Tab. 10).There are no ing that the catalysis of post-translational is
X-ray crystal structures of enzymes bearing a sufficiently robust to tolerate other nucleofug-
dehydroalanine residue. Consequently iden- es (LANGERet al., 1994a). There is also some
tification of such residues, hangs on the detec- evidence that the thiol group of a cysteine res-
tion of the conserved sequence and label- idue close to the putative dehydroalanine resi-
inghhibition reactions with nucleophiles such due may undergo conjugate addition to give a
as [14C]-cyanide (CONSEVAGE and PHILLIPS, protected or resting state of the enzyme (CON-
SEVAGE and PHILLIPS,1990). The activity of lized. The presence of a 4-methylidene-imida-

histidase is increased by 2-10 fold by Mn2+, zole-5-one residue (372), rather than a dehy-
Fez+,Cd2+ and Zn2+ and this correlates with droalanine residue (370), equally explains all
the excellent coordinating properties of dehy- of the chemistry previously attributed to the
droamino acids towards metal ions (JEZOWS- latter (SCHWEDE, et al., 1999). In addition, it
KA-BOJCZUC and KOZLOWSKI 1991;1994).Fur- explains the former puzzling observation that
thermore, theoretical calculations showed that Edman degradation stops two residues before
all dehydroamino acids except dehydroalanine the serine (HERNANDEZet al., 1993). It remains
tend to bent a peptide chain towards a turn to be seen if the 4-methylidene-imidazole-5-
conformation which has a strong impact on the one residue (372) of histidase is a unique ab-
co-ordination ability of the dehydropeptide liberation or the first member of a new family of
gand (JEZOWSKA-BOJCZUC, et al., 1996). enzymes.
Methyl- and phenyl-glyoxal inhibit histidase The mechanism of interconversion of L-his-
by reaction with arginine residues. Alignment tidine (137) and urocanate (368) provides a
of four histidase and twelve phenylalanine number of puzzles. The most of pressing of
lyase sequences revealed a single completely which is, how is the non-acidic proton removed
conserved arginine residue and another con- in the presence of an ammonium group. The
served in 15 of the sequences, but not l? putidu stereochemistry of addition-elimination is
histidase (WHITEand KENDRICK, 1993). stereospecifically trans with exchange of the
The preceding edifice of data and deduc- (3 ’-pro-@-hydrogen (YOUNG, 1991). Ex-
tions has been shaken by the publication of the change of the proton at C-5 with solvent pro-
X-ray crystal structure of histidase, which tons provides a clue to the mechanism. This oc-
shows that dehydroalanine is not present at curs much more rapidly with labeled uroca-
the active site, but a previously unknown 4- nate (388a,b to M a ) than L-histidine (376 to
methylidene-imidazole-5-one residue (372) 137a) and is not an obligatory step in the
(SCHWEDE, et al., 1999),which is formed by an mechanism. However, an analogous reaction
intramolecular condensation and elimination of an electrophile with L-histidine (376),pro-
of water. The authors postulate intramolecular vides an imminium ion (377),which is ideally
nucleophilic attack to give the amidine (371), placed to facilitate loss of the 3‘-proton. The
followed by a,p-elimination. One objection to enamine (378) so formed can then eject am-
this proposal, is that the nucleophile is an monia to give another imminium ion (379),
amidic nitrogen, which is only weakly nucle- which is restored to neutrality by loss of the
ophilic. Conversely, elimination of water first original electrophile. Alternatively, release of
to give dehydroalanine (370),reduces the con- the electrophile from the enamine (378)yields
jugation between the amidic nitrogen and the urocanate (288a to 368) directly. This mecha-
carbonyl group and changes the conforma- nism was originally postulated with a proton as
tional preferences of the peptide chain, so as to an electrophile (FURUTAet al., 1990, 1992),
promote condensation. The 4-methylidene- then dehydroalanine (LANGER et al., 1995) and
imidazole-5-one residue (372) has a curious finally with a 4-methylidene-imidazole-5-one
conformational feature. The substituent at- residue (372) (Fig. 126) (SCHWEDE,et al.,
tached to the “amidic” nitrogen is out of the 1999).
plane of the ring (0-C-N-C, is 54”) and Mutants of histidase that lack the serine res-
hence the nitrogen lone pair is sp3-hydridized. idue (e.g., S143A), which is the progenitor of
This renders the carbonyl, ketone like, and the 4-methylidene-imidazole-5-one moiety
hence more susceptible to nucleophilic addi- (372)(Fig. 123),retain a minute amount of ac-
tion. In this conformation, the adduct is able tivity with L-histidine (137) and K,,, is essen-
utilize canonical forms (373) and (374) (Fig. tially unchanged. More surpisingly, the kinetic
124), but not the aromatic 6welectron canoni- parameters for 5-nitro-~-histidine(385to 383)
cal form (375). It is conceivable that addition are virtually identical for the wild type and
triggers a conformational change which ren- mutant! This can be rationalized by assum-
ders the nitrogen substituent co-planar and ming that the nitro group plays the role of the
hence enable this canonical form to be uti- prosthetic moiety in the enzyme. Thus the
136 2 Lyases
Ma Ser Gly Asp

- - A -
Enz’ Enz
‘ H O H O
Enz’
Enz 369 (extended)
Enz NH
372 4-Methylidene-imidazole-5-one. En;
Fig. 123. Formation of 4-methylene-imidazole-5-one

residues (372) in peptides.
137
372
Nu>
'H
377
R=H
~ R = ~ H
375
Fig. 124. Canonical forms for the addition adducts of HS

4-methylene-imidazole-5-one residues (372) in pep- Y
tides. The stereochemistry of the nitrogen substitu-
ent controls access to the aromatic form (375).
'H 378
E
canonical form (384)is ideally set up for loss of
the 3'-proton, and the elimination of the am-
monia is driven by the enamine (385) as before
(LANGER et al., 1997a;LANGERet al., 1995). N H , ~
Histidase has not found large scale practical
applications as yet, although it has been used
for the preparation of (3R)-[3-3H1]-histidine
ZN+. co:
GN
by exchange with tritium oxide (YOUNG,
1991).Urocanic acid acts as a hydroxyl radical
scavenger in skin and like histamine (138)it is
an immunosuppressant (KAMMEYERet al, E 379
1999).
4.4.1.4 Phenylalanine Ammonia-

Lyase [PAL, EC 4.3.1.51
Phenylalanine ammonia-lyase (PAL) cata-
lyzes the deamination of L-phenylalanine coy
(388)to give trans-cinnamate (389) (Fig. 128).
PAL is widely distributed in higher plants, 368
some fungi, yeasts and a single prokaryote,
Streptomyces,but is not found in true bacteria Fig. 125. Generalized mechanism for the histidase
or animals. PAL is of prodigous importance in catalyzed deamination of labeled L-histidine (376 to
plants, because some 3045% of all plant 137a) and C-5 proton exchange.
138 2 Lyases
organic material is derived from L-phenylala-

nine (388)and to a lesser extent L-tyrosine
through the cinnamate pathway (JONES,1984).
The ammonium ions released in the formation
of cinnamate are recycled by conversion of
J 137 L-Histidine
glutamate to glutamine catalyzed by glutamine
synthetase (RAZALet al., 1996). The ultimate
products of the cinnamate pathway are lignins,
lignans, flavanoids, benzoic acids, coumarins
and suberins (MA", 1987, MANNet al, 1994)
and phenols (NICHOLSON and HAMMERSCH-
MIDT,1992). PAL levels are increased in plants,
in response to environmental stress and patho-
gen infection (REGLINSKI, et al., 1998;ORCZYK
et al., 1996; KIM et al., 1996). In microorgan-
isms, PAL acts as the first step in the catabo-
lism of the exogenous phenylalanine as a car-
bon source. The enzyme has been purified
from numerous sources, including potato tu-
bers, maize, sunflower hypocotyls (JORRINet
al., 1988), S. pararoseus and the "smut" fungal
pathogens, Ustilago hordei (HANSON and HA-
VIR,1972) and U.maydis (KIMet al., 1996) and
381
two forms from leaf mustard, Brmsica juncea
var. integrifolia (LIMet al., 1997,1998).
L-Phenylalanine is an essential nutrient for
human nutrition and is used widely in the food
and pharmaceutical industries. Currently, most
L-phenylalanine is manufactured by fermenta-
tion using an overproducing strain of E. coli,
cultivated on glucose.The demand for L-phen-
ylalanine methyl ester (324)for the manufac-
ture of the artifical sweetner Aspartame (325)
(Fig. 111) assures continuing efforts to develop
improved methods of manufacture (OYAMA,
1992; KINOSHITA and NAKAYAMA, 1978; DUF-
FY, 1980).
NH3j
382 PAL is a member of the putative dehydroa-
lanine family, which also contains p-methyl-
aspartase and histidase. It has been shown re-
cently that the active site of histidase does not
372
contain dehydroalanine (370,Fig. 122), but a 4-
methylidene-imidazole-5-one (372) (Fig. 123)
hr"
moiety instead (SCHWEDE, et al., 1999). The
H
high sequence homology between PAL and
histidase (Tab. 10) suggests that it almost cer-
N tainly contains the same functional residue.
Labeling studies indicated that serine-202 is
368 Urocanate the progenitor residue in parsly PAL (Petro-
Fig. 126. Mechanism for the histidase catalyzed de- selinum crispum L.). The PAL1 gene was ex-
amination of L-histidine (376 to 137) to urocanate pressed in E. coli and when serine-202 was mu-
(368). tated to alanine, virtually all activity was lost
383 5-Nitro-L-histidine 384 385 I
387 386
Fig. 127. The mechanism for deamination of 5-nitro-~-histidine(383),with histidase mutants (e.g., S143A),
which lack the 4-methylidene-imidazole-5-oneresidue (372).
which had activity, identical to the wild type

(LANGER et al., 1997b).
Potato tuber PAL catalyzed deamination of
L-phenylalanine (388),to give trans-cinnamate
I
L-Phenylalanine (389) is stereospecific. The (3-pro-S)-proton is
lost, hence elimination occurs with trans-stere-
Phenylalanine ochemistry (HANSON, et al., 1971; WIGHTMAN,
ammonia-lyase et al., 1972) (Fig. 129). This is exactly as ob-
served with /I-methylaspartase and histidase.
Intriguingly, PAL from Rhodotorula glutinis
(and potato tubers) also catalyzes the deami-
nation of D-phenylalanine to trans-cinnamate
(389), albeit at 0.02% of the rate of L-phenylal-
anine (388). Rhodotorula glutinis PAL cata-
trans-Cinnamate lyzed deamination of D-phenylalanine results
in preferential (but not exclusive) loss of the
Fig. 128. The phenylalanine ammonia-lyase (PAL) (3-pro-R)-proton, which is consistant with
catalyzed deamination of phenylalanine (388) to
give trans-cinnamate (389). tram-stereochemistry for the overall elimina-
tion (EASTONand HUITON,1994).
Deamination of [2H,]-~-phenylalaninedeu-
terated in the aromatic ring shows a kinetic
(SCHUSTER and RETEY,1995).However, activ- isotope effect of 1.09, relative to L-phenylala-
ity was retained with 4-nitro-phenylalanine, nine (388)(Fig. 129) (GLOGEet al., 1998).This
which parallels the results achieved with 5 4 - can be rationalized by postulating a Frie-
trohistidine (383) and histidase (LANGER et al., dels-craft type reaction with an electrophile
1997a, 1995). Mutation to cysteine (which is [presumably 4-methylidene-imidazole-5-one
able to undergo elimination), yielded a mutant (372)] to give the conjugated carbonium ion
140 2 Lyuses
HO ONH3 141a
L-Tyrosine
L-Phenylalanine
Phenylalanine
ammonia-Iyase
-1
390
L-Cyclohexyl-
alanine
H@
0°C"; @NH3 DL-CVCIOOCta-
394
mc8
-1
X' 395
.-
aR=OH
E? NH3 bR=NH,
Fig. 130. Alternative substrates and inhibitors of

phenylalanine ammonia-lyase (PAL).
hydroxy-group is capable of promoting the

Friedels-Craft reaction, whereas the 4-hydrox-
trans-Cinnamate yl group of L-tyrosine is not (SCHUSTER and
Fig. 129. The mechanism for the phenylalanine am-
RETEY,1995). Cyclohexylalanine (393) does
monia-lyase (PAL) catalyzed deamination of phenyl- not undergo deamination with PAL, but it is a
alanine (388a to 388) to give trans-cinnamate (389b good inhibitor, which indicates binding is not
to 389). impaired, Cyclooctatetraenyl alanine (394)
would not be expected to be able to participate
in the Friedels-Craft reaction, but both bind-
(390). Deprotonation yields the triene (391), ing and turnover were impaired and hence it is
which undergoes 1,Celimination to urocanate not possible to make a wholly electronic argu-
(389). L-tyrosine (141a) is a poor substrate for ment for the lack of reactivity. Substrates in
PAL, whereas racemic 3-hydroxyphenylala- which the amino substituent has been replaced
nine (392) (D,L-rneta-tyrosine)is a slightly bet- or substituted (395) are good inhibitors (Mu-
ter substrate than L-phenylalanine,despite the NIER and BOMPEIX, 1985; JONESand NORTH-
presence of the D-enantiomer (Fig. 130).The 3- COTE, 1984).
The 2-, 3- and 4-pyridylalanines (397) (Fig. centrations of ammonium salts the reverse re-
131) were prepared by PAL catalyzed amina- action is also feasible, particularly if the amino
tion of the corresponding cinnamates (3%) us- acid precipitates from solution. This is the di-
ing a high concentration of aqueous ammonia, rection of interest for the vast majority of in-
partially neutralized with carbon dioxide. In dustrial processes. Ammonia concentrations
the reverse direction, the 2-, 3- and 4-pyridylal- up to 8 M have been utilized for L-phenyala-
anines (397) are also good substrates for PAL, nine production (TAKAC,et al., 1995),but 5 M
with higher KM’sand similar or slightly higher suffices for most purposes (YAMADAet al.,
Vmax’sthan L-phenylalanine. From the stand- 1981;EVANS,et al., 1987; GLOGE,1998).
point of classical solution phase chemistry,this trans-Cinnamic acid is very cheap because it
result is unexpected. Pyridines undergo Frie- is easily prepared by aldol condensation of
del-Craft reactions more slowly than benzene. benzaldehyde and a host of acetic acid enolate
But this is because under solution phase condi- equivalents (e.g., diethyl malonate). Unfortu-
tions they are present as the protonated form, nately, trans-cinnamate (389) is a competitive
in which the pyridinium group acts as an elec- inhibitor of of most forms of PAL (Ustilago
tron withdrawing group. The enzyme catalyzed maydis PAL is an exception, KIMet al., 1996),
reaction occurs without protonation, and which limits the reactor concentration and
hence under these circumstances the pyridyl hence productivity. P-cyclodextrin (398) (Fig.
nitrogen acts as an activating group (GLOGEet 132) has been advocated as a sequestrant for
al., 1998). trans-cinnamate in the deamination direction,
The pH optima for PAL is circa 8.7 (depend- but it remains to be seen if it is beneficial for
ing on source). Activity drops off quickly at amination (EASTONet al., 1995).
lower pH, but higher pH is sometimes benefi- Despite the widespread abundance of PAL,
cial. Most PALS are deactivated by thiols, but industrial processes have almost exclusively
only a few by metals ions, e.g., Ag+, Cu2+, used PAL from Rhodotorula glutinis, because
Hg2+ and Zn2+ (KIM,et al., 1996; LIM,et al., the organism is easily cultivated, PAL levels
1997;1998).The thermodynamically preferred are high and the enzyme is easily purified in
mode of action of PAL is deamination of L- high yield (KANEand FISKE, 1985;D’CUNHAet
phenylalanine (388) to give trans-cinnamate al., 1996b). Sporidiobolus pararoseus, Rhodo-
(389). However, in the presence of high con- sporidium toruloides (WATANABE et al., 1992),
Rhodotorula rubra (EVANSet al., 1987), Rho-
dotorula graminis and Cladosporium dado-
sporioides are unproven alternatives (TAKAC,
et al., 1995,DRAUZand WALDMANN, 1995).
The production of L-phenylalanine (388) by
whole Rhodotorula glutinis cells has been opti-
mized at pH 10.5,30 c , 8 M ammonia and a
5M NHJICO2
Phenylalanine loading of 2 g of substrate per g of dry cells.
ammonia-lyase Using a fed batch operation, the maximum
concentration of L-phenylalanine reached
12.57 g L-l (70.19 mM) from 14.8 g L-’ (100
mM) cinnamate (389). Sodium glutamate and
penicillin increased PAL activity (TAKAC et al.,
1995).
Thus far the unfavorable equilibrium and in-
hibition by cinnamate have made the produc-
2-Pyridyl, 63% yield tion of L-phenylalanine using PAL, uncompet-
3-Pyridyl, 59% yield itive compared to manufacture by fermenta-
4-Pyridyl, 75% yield tion. However, PAL also catalyzes the amina-
Fig. l31. Pyridyl cinnamates (395) are good sub- tion of trans-methyl cinnamate (which is
strates for phenylalanine ammonia-lyase (PAL) cat- cheaper than cinnamic acid) at 90% of the rate
alyzed amination. of the natural substrate. The product L-phenyl-
142 2 Lyases
398 P-Cyclodextin 399 P-Cyclodextin complex

with trans-cinnamate 389
Fig. 132. P-Cyclodextrin is a cyclic hepta-saccharide ,which preferentailly binds trans-cinnamate (389) over
L-phenylalanine (388),to give the complex (399) (EASTON et al., 1995).
alanine methyl ester is more valuable than L- 4.5 Other Carbon-Nitrogen Lyases
phenylalanine, because it is a direct precursor
of Aspartame (325). The amination was run The gram-negative bacterium DSM 9103 is
with whole Rhodotorula glutinis cells, in a two able to grow on ethylenediaminetetra-acetic
phase heptane: water system to overcome the acid (EDTA) (400) (Fig. 133) as the sole
low solubility of trans-methyl cinnamate in wa- source of carbon and nitrogen. The initial step
ter. The conditions were optimized at pH 9.0, in the degradation is stepwise removal of the
30' C, 16-18 h, 0.1 M substrate and 1M ammo- acetate groups as glyoxylate by an oxidative
nium sulfate and 70% conversion was process (WITSCHEL et al., 1997).The same spe-
achieved (D'CUNHAet al., 1994).But the activ- cies also grows on (S,S)-ethylenediaminedisuc-
ity of the cells declined rapidly during the bio- cinate (401)and cell free extracts, without add-
conversion and they were not resuable. By ed cofactors, degrade this substrate. An en-
adding small amounts of magnesium ions and zyme was purified 41-fold that catalyzed rever-
10% glycerol, the cells could be recycled up to sible formation of fumarate (1%) and W ( 2 -
nine times with a total yield of 92g L-' (D'- aminoethyl) aspartic acid (402). (S,S)- and
CUNHAet al., 1996a). PAL from the red basi- (S,R)-ethylenediaminedisuccinate were ac-
domyces yeast Rhodosporidium toruloides has cepted as substrates, but the (R,R)-stereoiso-
been purified (REES and JONES,1996) and mer was unchanged in both cell free and puri-
used in a single phase octanol: water mixture. fied enzyme assays (WITSCHELand EGLI,
At least 2% water was required for activity. 1997). This data clearly indicates a stereospe-
The best result was obtained with freshly lyo- cific lyase system.
philized PAL, in a 96.4 :3.6, v/v, mixture which
retained, up to 17% of the activity in aqueous
media (REESand JONES, 1997).The use of en- 4.6 Carbon-Halide Lyases
zymes in organic solvents offers the prospect (EC 4.5.1.X)
of using hydrophobic substrates at higher con-
centrations than would otherwise be possible This subclass was originally conceived for
in aqueous media (GUPTA,1992; TRAMPER, et the enzyme which catalyzes the elimination of
al., 1992) hydrogen chloride from DDT (DDT-dehy-
5 References 143
mercaptide (GUPTAet al., 1999). Plants and

microorganisms are extraordinarily adept at
handling materials that are toxic to higher or-
ganisms (BALDI,1997). Toxic alkyl mercury
compounds are transformed either by alkyl
@o,& 400 EDTA mercury-lyase or by a reductase which produc-
es metallic mercury. There are considerable
prospects for the use of such microorganisms
and enzymes in organometallic chemistry, but
at present the main use of these enzymes is for
land remediation (GHOSHet al., 1996;HEATON
et al., 1998).
5 References
ABELYAN, V. A. (1999), Simultaneous production of
D-aSpartiC acid and L-alanine,Appl. Biochem. Mi-
crobiol. 35,152-156.
196Fumarate f ABELYAN, V. A., AFRIKYAN, E. G. (1997), One step
synthesis of L-alanine from fumaric acid, Appl.
Biochem. Microbiol. 33,554-556.
ABELYAN,~. A., BAGDASARYAN, S. N., AFRIYAN, E. G.
(1991), Intracellular L-aspartate-0-decarboxylase
of Pseudomonas sp. and Alcalignes sp. and its im-
mobilization, Biochemistry (Moscow) 56, 899-
Fig. 133. The degradation of (S,S)-ethylenediami- 905.
nedisuccinate (401). AKHTAR, M., COHEN,M. A., GANI,D. (1986), Enzy-
matic synthesis of 3-halogenoaspartic acids using
Pmethylaspartase - inhibition by 3-bromoaspar-
tic acid,J. Chem. Soc., Chem. Commun. 1290-1291.
AKHTAR, M., COHEN,M. A., GANI,D. (1987a), Ster-
drochlorinase, EC 4.5.1.1). The other early eochemical course of the enzymatic amination of
member of this class is 3-chloro-~-alaninede- chlorofumaric acid and bromo-fumaric acid by 3-
hydrochlorinase (EC 4.5.1.2), which is a pyri- methylaspartate ammonia-lyase, Tetrahedron
doxal 5 '-phosphate dependent protein, that Lett. 28,2413-2416.
also catalyzes p-replacement reactions. Fur- AKHTAR, M., BOTIING, N. F,! COHEN,M. A., GANI,D.
(1987b), Enantiospecific synthesis of 3-substitut-
ther aspects of these enzymes are covered in ed aspartic acids via enzymic amination of substi-
detail in Chapter 3, this volume and in reviews tuted fumaric acids, Tetrahedron43,5899-5908.
(FETZNER,1998; FETZNERand LINGRENS, ALAM,N., SAFFERSON, E. D. (1998), Malonyl-CoA
1994). and the regulation of fatty acid oxidation in sole-
us muscle, Biochem. J. 334,235241,
ALBER,B. E., COLANGELO, C. M., DONG,J., STAL-
4.7 Other Lyases HANDSKE, C. M.V., BAIRD,T.T.,et al. (1999), Ki-
netic and spectroscopic characterization of the 'y-
carbonic anhydrase from the methanoarchaeon
4.7.1 Alkyl Mercury-Lyase Methanosarcina thermophila, Biochemistry 38,
13119-13128.
(EC 4.99.1.2) ALBERT,A., DHANARAJ,~., GENSCHEL, U., KHAN,G.
L., RAMJEE, M. K. et al. (1998), Crystal structure
Alkylmercury lyase catalyzes the cleavage of aspartate decarboxylase at 2.2 A resolution
of alkylmercury bonds in the presence of a thi- provides evidence for an ester in protein self pro-
01 to give a hydrocarbon and mercury (11) as a cessing,Nature Struct. Biol. 5,289-293.
144 2 Lyases
ALBERTY, R. A., BENDER, P. (1959),Proton magnetic (2S,3R)-3-methylaspartic acid by methylaspar-

resonance spectra of malic acid and its salts in tase,J. Chem. SOC.,Chem. Commun. 14C142.
deuterium oxide,J. Am. Chem. SOC.81,542-546. ARCHER, C. H., THOMAS, N. R., GANI,D. (1993a),
ALLERT, M., KJELLSTRAND, M., BROO,K., NILSSON, Syntheses of (2S,3R)-3-methylaspartic and
A., BALTZER, L. (1998), A designed folded poly- (2S,3R)[3-H2]-3-methylaspartic acids - slow sub-
peptide model system that catalyzes the decar- strates for a syn-eliminationreaction catalyzed by
boxylation of oxaloacetate, J. Chem. SOC.,Perkin methylaspartase, Tetrahedron Asymmetry 4,
Trans II, 2271-2274. 1141-1152.
ANET,F. A. L. (1960),The configuration of deuterio- ARCHER, C. H.,THOMAS, N. R., GANI,D. (1993b), Ki-
L-malic acid produced enzymatically.Synthesis of netics and mechanism of syn-elimination of am-
thre0-3-deuterio-~~-malic acid. J. Am. Chem. SOC. monia from (2S,3R)-3-methylaspartic acid by
82,994-995. methylaspartase, J. Chem. Soc., Chem. Commun.,
ALEXANDER, F. W., SANDMEIER,E., MEHTA,P. K., 140-142.
CHRISTEN, P. (1994), Evolutionary relationships ARMSTRONG, F. B., LIPSCOMB, E. L., CROUT, D. H. G.,
among pyridoxal-5‘-phosphate - dependent en- MORGAN, P. J. (1985), Structure-activity studies
zymes - regiospecific a-family, P-family and y- with the a$-dihydroxyacid dehydratase of Sal-
family,Eur. J. Biochem. 219,953-960. monella typhimurium, J. Chem. SOC.Perkin Trans.
ALKORTA, I., GARBISU, C. LLAMA, M. J., SERRA,J. L. I, 691-696.
(1998), Industrial applications of pectic enzymes: ARMSTRONG,F. B.,HEDGECOCK, C. J. R.,REARY, J. B.,
a review, Process Biochem. 33,21-28. WHITEHOUSE, D., CROUT, D. H. G. (1974), Stereo-
ALVAREZ, F. J., ERMER, J., HUBNER, G., SCHELLEN- chemistry of the reductoisomerase and a,P-dihy-
BERGER, A., SCHOWEN, R. L. (1995), The linkage droxyacid dehydatase steps in valine and isoleu-
of catalysis and regulation in enzyme action, sol- cine biosynthesis,J. Chem. SOC.,Chem. Commun.,
vent isotope effects as probes of protonic sites in 351-352.
the yeast pyruvate decarboxylase mechanism, J. ARMSTRONG, F. B., LIPSCOMB, E. L., CROUT, D. H. G.,
Am. Chem. SOC.117,1678-1683. MITCHELL, M. B., PRAKASH, S. R. (1983) Biosyn-
ANDERSON, R. L., HAUSWALD, C. L. (1982), D-galac- thesis of valine and isoleucine: synthesis and bio-
tonateb-fuconate dehydratase, Methods Enzy- logical activity of (2S)-a-acetolactic acid (2-hy-
mol.90,299-302. droxy-2-methyl-3-oxobutanoicacid) and (2R)-
ANDERSON, W. A., MOO-YOUNG, M., LEGGE, R. L. and (3S)-a-acetohydroxybutyric acid (2-ethyl-2-
(1987a), Optimization of growth conditions for hydroxy-3-oxobutanoic acid), J. Chem. SOC., Per-
the induction of tyrosine decarboxylase in Strep- kin. Trans.l,ll97-1201.
tococcusfaecalis, Biotechnol. Lett. 9,685-690. ARJUNAN, P., UMLAND, T., DYDA, F., SWAMINATHAN,
ANDERSON, W. A., MOO-YOUNG, M., LEGGE,R. L. S.,FUREY, W. et al. (1996), Crystal structure of the
(1992a), Development of a multienzyme reactor thiamin diphosphate-dependent enzyme pyru-
for dopamine synthesis. 1.Enzymology and kinet- vate decarboxylase from the yeast Saccharomyc-
ics, Biotechnol. Bioeng. 39,781-789. es cerevisiae at 2. 3 angstrom resolution, J. Mol.
ANDERSON, W. A., MOO-YOUNG, M., LEGGE, R. L. Biol. 256,590400.
(1992b), Development of a multienzyme reactor ASADA,Y., TANIZAWA, K., SAWADA, S., SUZUKI, T.,
for dopamine synthesis. 2. Reactor engineering MISINO, H., SODA,K. (1981), Stereochemistry of
and simulation, Biotechnol. Bioeng. 40,388-395. rneso-a,cdiaminopimelate decarboxylase reac-
Anonymous (1984, 1992), Enzyme Nomenclature: tion - The 1st evidence for pyridoxal 5’-phos-
Recommendations of the Nomenclature Commit- phate dependent decarboxylation with inversion
tee of the International Union of Biochemistry on of stereochemistry,Biochemistry 20,6881-6886.
the Nomenclature and Classification of Enzyme- ASANO,Y., KATO, Y. (1994a), Crystalline 3-methyl-
Catalyzed Reactions. Orlando, FL: Academic aspartase from a facultative anaerobe, Escheri-
Press. chia coli strain YG1002, FEMS Microbiol. Lett.
ANTSON,A. A., STROKOPYTOV, B. V.,MURSHUDOV, G. 118,255-258.
N., ISUPOV, M. N., HARUTYUNYAN, E. H. et al. ASANO, Y., KATO,Y. (1994b), Occurrence of 3-meth-
(1992), The polypeptide-chain fold in tyrosine ylaspartase ammonia lyase in facultative an-
phenol-lyase, a pyridoxal-5’-phosphate-depen- aerobes and their application to synthesis of 3-
dent enzyme,FEBS Lett. 302,256-260. substituted (S)-aspartic acids, Biosci. Biotech. Bi-
ANTSON, A. A., DEMIDKINA, T. V., GOLLNICK, P., ochem. 58,223-224.
DAUTER, Z., VONTERSCH, R. et al. (1993) 3-Di- AXELSSON, B. S., BJURLING, P., MATSSON, O., LANG-
mensional structure of tyrosine phenol-lyase, STROM, B. (1992), 11C/14Ckinetic isotope effects in
Biochemistry 32,4195-4206. enzyme mechanism studies, J. Am. Chem. SOC.
ARCHER, C. H., GANI,D. (1993), Kinetics and mech- 114,1502-1503.
anism of syn-elimination of ammonia from AXELSSON, B. S., O’TOOLE, K. J., SPENCER, P. A,,
5 References 145
YOUNG,D. W. (1994), Versatile synthesis of ster- oxalyl-coenzymeA decarboxylase and formyl-co-
eospecifically labeled D-amino acids via labeled enzyme A transferase in Oxalobacter formigenes
aziridines - Preparation of (2R, 3S)-[3-H-’H1]-se- cells, Systemat. Appl. Microbiol. 15,167-171,
rine and (2R, 3R)-[2, 3-2H2]-serine;(2S, 2‘S, 3S, BAI,Q., SOMERVILLE, R. L. (1998), Integration host
3’S-[3, 3’-’H2]- and (2S, 2’S, 3R, 3’R)-[2,2’, 3, factor and cyclic AMP receptor protein are re-
3’-’&]-cystine and; (2S, 3S)-[3-’H1]- and (2S, quired for ’QrR-mediated activation of TPL in
3R)-[2,3-’H,]-pchloroalanine, J. Chem. SOC.,Per- Citrobacter freundii, J. Bacteriol. 180,61734186.
kin Trans I.,807-815. BALDI,F. (1997),Microbial transformation of mercu-
BABBITT, P. C., MRACHKO, G.T., HASSON, M. S., HUIS- ry species and their importance in the biogeo-
MAN, G. W., KOLTER, R. et al. (1995), Functionally chemical cycle of mercury, Metal Ions Biol.
diverse enzyme superfamily that abstracts the a- Systems 34,213-257.
protons of carboxylic acids, Science 267, No. 5201, BARBAS111, C. F., HEN, A., ZHONG,Ci. F., HOW-
1159-1 161. M A ” , T., GRAMATIKOVA, S. et al. (1997), Immune
BABBIIT, P. C., HASSON,M. S., WEDEKIND, J. E., versus natural selection: Antibody aldolases with
PALMER, D. R. J., BARRETT, W. C. et al. (1996),The enzymatic rates but broader scope, Science 278,
enolase family: a general strategy for enzyme cat- NO.5346,2085-2092.
alyzed abstraction of the a-protons of carboxylic BARROWMAN, M. M., FEWSON,C. A. (1985), Phenyl-
acids, Biochemistry 35,16489-16501. glyoxylate decarboxylase and phenylpyruvate de-
BABURINA, I., GAO,Y. H., Hu, Z. X., JORDAN,F., carboylase from Acinetobacter calcoaceticus,
HOHMANN, S., FUREY,W. (1994), Substrate activa- Curr. Microbiol. 12,235-239.
tion of brewers yeast pyruvate decarboxylase is BATTAT, E., PELEG,Y., BERCOWTZ, A., ROKEM,J. S.,
abolished by mutation of cysteine-221 to serine, GOLDBERG, I. (1991), Optimization of L-malic ac-
Biochemistry 33,5630-5635. id production by Aspergillus fravus in a stirred
BABURINA, I., MOORE,D. J., VOLKOV, A., KAHYAO- fermenter, Biotechnol. Bioeng. 37,1108-1116.
GLU, A., JORDAN,F., MENDELSOHN, R. (19%), BATTERSBY, A. R. (1985), Enzymic synthesis of la-
Three of four cysteines,including that responsible belled chiral substances, in: Enzymes in Organic
for substrate activation, are ionized at pH 6.0 in Synthesis, Ciba Foundation Symposium 111 (POR-
yeast pyruvate decarboxylase: Evidence from TER, R., CLARK, S., Eds), pp. 22-30. London: Pit-
Fourier transform infrared and isoelectric focus- man Press.
ing studies, Biochemistry 35,10249-10255. BAITERSBY,A. R., N I C O L E ~M., I , STAUNTON, J.,
BABURINA, I., LI, H. J., BENNION, B., FUREY, W., JOR- VLEGGAAR, R. (1980), Studies of enzyme mediat-
DAN, F. (1998a), Interdomain information transfer ed reactions. Part 13. Stereochemical course of
during substrate activation of yeast pyruvate de- the formation of histamine by decarboxylation of
carboxylase: The interaction between cysteine (2s)-histidine with enzymes from Clostridium
221 and histidine 92, Biochemistry 37,1235-1244. welchii and Lactobacillus 30a, J. Chem. SOC.,Per-
BABURINA, I., DIKDAN,G., Guo, F. S., Tous, G. I., kin Trans. I., 43-51.
ROOT,B., JORDAN,F. (1998b), Reactivity at the BATTERSBY, A. R., MURPHY, R., ST,4UNTON, J.
substrate activation site of yeast pyruvate decar- (1982a), Studies of enzyme mediated reactions.
boxylase: Inhibition by distortion of domain 14. Stereochemical course of the formation of ca-
interactions, Biochemistry 37,1245-1255. daverine by decarboxylation of (2S)-lysine with
BACH,R. D., CANEPA, C. (1996), Electronic factors lysine decarboxylase (EC 4.1.1.18) from Bacillus
influencing the decarboxylation of pketoacids. A cadaveris,J. Chem. SOC.,Perkin I , 449-453.
model enzyme study,J. Org. Chem.61,6346-6353. BAITERSBY, A. R., STAUNTON, J., TIPPETT, J. (1982b),
BACH,R. D., CANEPA, C. (1997), Theoretical model Studies of enzyme mediated reactions. 15.Stereo-
for pyruvoyl dependent enzymatic decarboxyla- chemical course of the formation of y-aminobu-
tion of a-amino acids, J. Am. Chem. SOC. 119, tyric acid (GABA) by decarboxylation of (2s)-
11725-11733. glutamic acid with glutamate decarboxylase from
BACH,R. D., CANEPA,C., GLUKHOVTSEV, M. N. Escherichia coli, J. Chem. SOC.,Perkin I , 455-459.
(1999), Influence of electrostatic effects on acti- BAITERSBY, A. R., SCOIT, A., STAUNTON, J. (1990),
vation barriers in enzymatic reactions: Pyridoxal Studies of enzyme mediated reactions. 16. Stereo-
5 ’-phosphate dependent decarboxylation of a- chemical course of the formation of 5-hydroxy-
amino acids, J. Am. Chem. SOC.121,6542-6555. tryptamine (serotonin) by decarboxylation of
BADIANI, K., LIGHTFOOT, P., GANI,D. (1996),Synthe- (2S)-S-hydroxytryptophanwith the aromatic L-
sis and mode of action of 1-substituted trans-cy- amino acid decarboxylase (EC 4.1.1.28) from hog
clopropane 1,2-dicarboxylic acids: inhibitors of kidney, Tetrahedron46,4685-4696.
the methylaspartase reaction, J. Chem. Soc., BAU,R., BREWER,I., CHIANG, M.Y., FUJITA,S., HOFF-
Chem. Commun. 675-677. MAN, J. et al. (1983), Absolute configuration of a
BAETZ,A. L., ALLISON, M. J. (1992), Localization of chiral CHD group via neutron diffraction - con-
146 2 Lyases
formation of the absolute stereochemistry of the ribosyl)-3’-dephosphocoenzymeA as a prosthet-

enzymatic formation of malic acid, Biophys. Res. ic group, Biochemistry 35,46894696.
Cornmun. 115,1048-1052. BERG,M., HILBI,H., DIMROTH,P. (1997), Sequence
BEAR,M. M., MONNE,C., ROBIE,D., CAMPION, G., of a gene cluster from Malonomonas rubra en-
LANGLOIS,~. et al. (1998), Synthesis and polymer- coding components of the malonate decarboxy-
ization of benzyl(3R,4R)-3-methylmalolactonate lase Na+ pump and evidence for their function,
via enzymatic preparation of the chiral precursor, Eur. J. Biochem. 245,103-115.
Chiralily 10,727-733. BERMEJO, L. L., WELKER, N. E., PAPOUTSAKIS, E. T.
BEARNE,S. L., WOLFENDEN, R. (1995), Enzymatic (1998), Expression of Clostridium acetobutylicum
hydration of an olefin: The burden borne by fu- ATCC 824 genes in Escherichia Cali for acetone
marase, J.Am. Chem. SOC.117,9588-9589. production and acetate detoxification, Appl. En-
BEECKMAN, s.,VAN DRIESSCHE, E. (1998), Pig heart viron. Microbiol. 64,1079-1085.
fumarase contains two distinct substrate binding BERING, C. L., KUHNS, J. J., ROWLETT, R. (1998), Pur-
sites differing in affinity, J. Biol. Chem. 273, ification of bovine carbonic anhydrase by affinity
31661-31669. chromatography - an undergraduate experiment,
BEHAL,R, T., OLIVER, D. J. (1997), Biochemical and J. Chem. Ed. 75,1021-1024.
molecular characterization of fumarase from BERRY,M. D., JURIO,A. V., LI, X. M., BOULTON, A.
plants: purification and characterization of the A., (1996),Aromatic L-amino acid decarboxylase:
enzyme cloning, sequencing, and expression of a neglected and misunderstood enzyme, Neuro-
the gene, Arch. Biochem. Biophys. 348,65-74. chem. Res. 21,1075-1087.
BEINERT, H., KENNEDY, M. C. (1993), Aconitase, a BERTOLDI, M., DOMINICI, P., MOORE,P. S., MARAS, B.,
two faced protein-enzyme and iron regulatory VOLTATTORNI, C. B. (1998),reaction of DOPA de-
factor, FASEB J., 7,1442-1449. carboxylase leads to an oxidative deamination
BEINERT, H., KENNEDY, M. C., STOUT,C. D. (1996) producing 3,4-dihydroxyphenylacetone, Bio-
Aconitase as iron-sulfur protein, enzyme and chemistry 37,6552-6561.
iron regulatory protein, Chem. Rev. %, 2335-2373. BERTOLDI, M., CARBONE, V., VOLTATTORNI, C. B.
BELL,P. J.,ANDREWS, S. C., SIVAK, M. N., GUEST,J. R. (1999), Ornithine and glutamate decarboxylases
(1989), Nucleotide sequence of the FNR regulat- catalyze an oxidative deamination of their a-
ed fumarase gene (fumB) of Escherichia coli K- methyl substrates, Biochem. J. 342,509-512.
12,J. Bacteriol. 171,3494-3503. BJORNESTEDT, R., ZHONG,G. F., LERNER, R. A., BAR-
BELLEAU, B., BURBA,J. (1960), The stereochemistry BAS,c.F. (1996), Copying nature’s mechanism for
of the enzymatic decarboxylation of amino acids, the decarboxylation of P-keto acids into catalytic
J. Am. Chem. SOC.82,5751-5752. antibodies by reactive immunization, J. Am.
BELLEAU, B., FANG, M., BURBA, J., MORAN,J. (1960), Chem. SOC. 118,11720-11724.
The absolute optical specificity of monoamine BODE,R., BIRNBAUM, D. (1991), Enzymatic produc-
oxidase,J.Am. Chem. SOC.82,5752-5753. tion of indolepyruvate and some of its methyl and
BENITEZ,T., GASENT-RAMIREZ, J. M, CASTREJON, F., fluoro-derivatives,Acta Biotechnol. 11,387-393.
CODON,A. C. (1996), Development of new (yeast) BOEKER, E. A., FISCHER, E. H. (1983), Lysine decar-
strains for the food industry, Biotechnol. Progr. boxylase (Escherichia coli-b),Methods Enzymol.
12,149-163. 94,180-184.
BENNER, S.A., MORTON,T. H. (1981),Analogs for ac- BONNARME, P., GILLET, B., SEPULCHRE,A. M., ROLE,
etoacetate as an enzyme substrate. Stereochemi- C., BELOEIL, J. C., DUCROCQ, C. (1995), Itaconate
cal preferences, J. Am. Chem. SOC. 103,991-993. biosynthesis in Aspergillus terreus, J. Bacteriol.
BENNER, S. A., ROZZELL, J. D., MORTON,T. H. (1981), 177,3573-3578.
Stereospecificity and stereochemical infidelity of BORNEMANN, S., CROUT,D. H. G., DALTON,H.,
acetolactate decarboxylase (AAD), J.Am. Chem. HUTCHINSON, D. W., DEAN,G. et al. (1993), Ster-
SOC. 103,993-994. eochemistry of the formation of lactaldehyde and
BENNEIT,G. N., RUDOLPH, F. B. (1995), The central acetoin produced by the pyruvate decarboxylases
metabolic pathway from acetyl-CoA to butyryl- of yeast (Saccharomyces sp.) and Zymomonas
CoA in Clostridium acetobutylicum, FEMS Mi- mobilis - different Boltzmann distribuons be-
crobiol. Rev. 17,241-249. tween bound forms of the electrophile, acetalde-
BENTLEY, R., THIESSEN, C. P. (1957), Biosynthesis of hyde, in the 2 enzymatic-reactions,J. Chem. SOC.,
itaconic acid in Aspergillus terreus. 111.The prop- Perkin Trans.1,309-311.
erties and reaction mechanism of cis-aconiticacid BORNEMANN, S., CROUT,D. H. G., DALTON,H.,
decarboxylase,J. Biol. Chem. 226,703-. KREN,V., LOBELL, M. et al. (1996), Stereospecific
BERG,M., HILBI,H., DIMROTH,P. (1996), The acyl formation of R-aromatic acyloins by Zyrnomonas
carrier protein of malonate decarboxylase of mobilis pyruvate decarboxylase, J. Chem. Soc.,
Malonomonas rubra contains 2’-(5 ”-phospho- Perkin Trans. 1,425-430.
5 References 147
BOTRE,F. MAZZEI,F. (1999), Interactions between signals modulate the expression of an indole-3-
carbonic anhydrase and some decarboxylating acetic acid biosynthetic gene in Erwinia herbico-
enzymes as studied by a new bioelectrochemical la, Mol. Plant Microbe Interact. 10,499-505.
approach, Bioelectrochem. Bioenerget. 48, 463- BRANDL, M.T., LINDOW, S. E. (1998), Contribution of
467. indole-3-acetic acid production to the epiphytic
BOTTING, N. P., AKHTAR, M., COHEN,M. A., GANI,D. fitness of Erwinia herbicola, Appl. Environ. Mi-
(1987),Mechanism of the elimination of ammonia crobiol. 64,32563263.
from 3-substituted aspartic acids by 3-methylaspar- BRESSLER, E., BRUAN,S. (1996), Use of gel entrap-
tase,J. Chem. Soc., Chem. Commun. 1371-1373. ment techniques for the resolution of itaconic ac-
BOTTING, N. P., AKHTAR, M., COHEN, M. A., GANI,D. id acid biosynthetic pathway in Aspergillus terre-
(1988a), Substrate specificity of the 3-methyl- us,J.Sol Gel Sci. Technol.7,129-133.
aspartate ammonia-lyase reaction - Observation BRIGANTI,F., MANGANI, S., SCOZZAFAVA, A., VER-
of differential relative reaction rates for substrate NAGLIONE, G., SUPURAN, c. T. (1999), Carbonic
product pairs, Biochemistry 27,2953-2955. anhydrase catalyzes cyanamide hydration to
BOTTING,N. P., COHEN,M. A., AKHTAR, M., GANI,D. urea: is it mimicking the physiological reaction, J.
(1988b), Primary deuterium isotope effects for Biol. Inorg. Chem. 4,52%536.
the 3-methylaspartase catalyzed deamination of BROEK,A. V., LAMBRECHT, M., EGGERMONT, K,,
(2s)-aspartic acid, (2S,3S)-3methylaspartic acid VANDERLEYDEN, J. (1999), Auxins upregulate ex-
and (2S,3S)-3-ethylasparticacid, Biochemistry 27, pression of the indole-3-pyruvate decarboxylase
29562959. gene in Azospirillum brasilense, J. Bacteriol. 181,
BOTTING, N. l?, JACKSON,A.A., GANI,D.(1989), 15N- 1338-1342.
isotope and double isotope fractionation studies BRUHLMANN, F. (1995), Purification and character-
of the mechanism of 3-methylaspartase - concert- ization of an extracellular pectate lyase from an
ed elimination of ammonia from (2S,3S)-3-meth- Amycolata sp., Appl. Environ. Microbiol. 61,
ylaspartic acid, J. Chem. Soc., Chern. Commun. 3580-3585.
1583-1585. BRYUN, S. M., JENNESS, R. (1981),Stereospecificityof
BOTTING, N. P.,GANI,D. (1992), Mechanism of C-3 L-myo-inositol-1-phosphate synthase for nicotin-
hydrogen-exchange and the elimination of am- amide adenine dinucleotide, Biochemistry 20,
monia in the 3-methylaspartate ammonia-lyase 5174-5177.
reaction, Biochemistry 31,1509-1520. BUNCH, A. (1998), Nitriles, in: Biotechnology Vol. 8a,
BOTTING, N. P., AKHTAR, M., ARCHER, C. H., COHEN, Biotransformations (REHM, H.-J., REED, G.,
M. A., THOMAS, N. R. et al. (1992), in: Molecular PUHLER, A., STADLER, P. J. W., Eds.), pp. 277-326.
Recognition: Chemical and Biochemical Prob- Weinheim: WILEY-VCH.
lems II (ROBERTS, S. M., Ed.) Special Publication BUSER,H. P., PUGIN,B., SPINDLER, F., SUITER,M.
No. 111.Cambridge: RSC. (1991), 'livo enantioselective syntheses of a pre-
BOUMERDASSI, H., DESMAZEAUD, M., MONNET, C., cursor of the biologically most active isomer of
BOQUIEN,C. Y., CORRIEU,G. (1996), Improve- CGA 8oooO (Clozylacon), Tetrahedron 47,5709-
ment of diacetyl production by Lactococcus lactis 5716.
ssp lactis CNRZ 483 through oxygen control, J. CALIK,G., VURAL,H., CALIK,P., OZDAMAR, T. H.
Dairy Sci. 79,775-781. (1997), Bioprocess parameters and oxygen trans-
BOURGEN, T., CHRETIEN, D., POGGI-BACH, J., Doo- fer effects in the growth of Pseudomonas dacun-
NAN, s.,RABIER, D. et a]. (1994), Mutation of the hue for L-alanine production, Chem. Eng. J. 65,
fumarase gene in two siblings with progressive 109-116.
encephalopathy and fumarase deficiency,J. Clin. CALIK,G., SAVASCI, H., CALIK,P., OZDAMAR, T. H.
Invest. 93,2514-2518. (1999), Growth and -carrageenan immobilization
BOYNTON, Z. L., BENNETT,G. N., RUDOLPH, F. B. of Pseudomonas dacunhae for L-alanine produc-
(1996), Cloning sequencing and expression of tion, Enzyme Microb. Technol. 24,67-74.
clustered genes encoding P-hydroxybutyryl-co- CANDY,J. M., DUGGLEBY, R. G. (1998),Structure and
enzyme A (CoA) dehydrogenase, crotonase and properties of pyruvate decarboxylase and site-di-
butyryl-CoA dehydrogenase from Clostridium rected mutagenesis of the Zymomoizas mobilis
acetobutylicum ATCC 824, J. Bacteriol. 178, enzyme, Biochim. Biophys. Acta. 1385,323-338.
3015-3024. CARDILLO, R., SERVI,S., TINTI,C. (1991), Biotrans-
BRANDL, M. T., LINDOW,S. E. (1996), Cloning and formation of unsaturated aldehydes by microor-
characterization of a locus encoding an indolepy- ganisms with pyruvate decarboxylase activity,
ruvate decarboxylase involved in indole-3-acetic Appl. Microbiol. Biotechnol. 36,300-303.
acid synthesis in Erwinia herbicola, Appl. Envi- CARROLL, N. M., Ross, R. P., KELLY,S. M., PRICE,N.
ron. Microbiol. 62,4121-4128. C., SHEEHAN, D., COGAN,T. M. (1999), Character-
BRANDL, M.T., LINDOW, S. E. (1997), Environmental ization of recombinant acetolactate synthase
148 2 Lyases
from Leuconostoc lactis, Enzyme Microb. Tech- synthases and acetohydroxyacid synthases, Bio-
nol. 25,6147. chim. Biophys. Acta. 1385,401-419.
CASTILLO, R. M., MIZUGUCHI, K., DHANARAJ,~., AL- CHOHNAN, S., KURUSU,Y., NISHIHARA, H., TAKAMU-
BERT,A.,BLUNDELL,T. L., MURZIN,A. G. (1999) A RA, Y. (1999), Cloning and characterization of
six stranded double psi pbarrel is shared by sev- mdc gnes encoding malonate decarboxylase of
eral protein superfamilies,Structure with Folding Pseudomonus putida, FEMS Microbiol. Lett. 174,
& Design 7,227-236. 311-319.
CHANG,C. C., LAGHAI, A., O’LEARY,M. H., FLOSS, CHOW,Y. S., SHIA,H. S., ADESINA, A. A., ROGERS, F?
H. G. (1982), Some stereochemical features of L. (1995),A kinetic model for the deactivation of
aspartate P-decarboxylase, J. Biol. Chem. 257, pyruvate decarboxylase (pdc) by benzaldehyde,
3564-3569. Biotechnol. Lett. 17,1201-1206.
CHANG,C.-W. T., CHEN,X. H., LIU, H.-W. (1998), CLIFFORD, K. H., CORNFORTH, J. W., DONNINGER, C.,
CDP-6-deoxy-6,6-difluoro-~-glucose:A mecha- MALLABY, R. (1972), Stereochemical course of
nism based inhibitor for CDP-D-glucose 4,6-de- the decarboxylation of S-malate on malic en-
hydratase,J. Am. Chem. SOC. 120,9698-9699. zyme, Eur. J. Biochem. 26,401-406.
CHAITERJEE, M. (1998), Lysine production by Brev- COHEN-KUPEIC, R., KUPIEC,M., SANDBECK, K.,
ebacterium linenes and its mutants: Activities and LEIGH, J. A. (1999), Functional conservation
regulation of enzymes of the lysine biosynthetic between the argininosuccinate lyase of the ar-
pathway, Folia Microbiol. 43,141-146. chaeon Methanococcus maripaludis and the cor-
CHEN,J. S. (1995), Alcohol dehydrogenase - multi- responding bacterial and eukaryal genes, FEMS
plicity and relatedness in the solvent producing Microbiol. Lett. 173,231-238.
Clostridia, FEMS Microbiol. Rev. 17,263-273. COLOMBO, S., GRISA,M., TORTORA, P., VANONI,M.
CHEN,C. K., BLASCHEK, H. P. (1999a), Effect of ace- (1994), Molecular cloning, nucleotide sequence
tate on molecular and physiological aspects of and expression of a Sulfolobus solfataricus gene
Clostridium beijerinckii NCIMB 8052, solvent encoding a class I1 fumarase, FEBS Lett. 337,
production and strain degeneracy,Appl. Environ. 93-98 (correction 1994,340,151-153).
Microbiol. 65,499-505. CONSEVAGE, M. W., PHILLIPS, A. T. (1985), Presence
CHEN,C. K., BLASCHEK, H. P. (1999b), Examination and quantity of dehydroalanine in histidine am-
of the physiological and molecular factors in- monia-lyase from Pseudomonas putida, Biochem-
volved in the enhanced solvent production by istry 24,301-308.
Clostridium beijerinckii BAlO1, Appl. Environ. CONSEVAGE, M. W., PHILLIPS, A. T. (1990), Sequence
Microbiol. 65,2269-2271. analysis of the huth-gene encoding histidine am-
CHEN,H., PHILLIPS, R. S. (1993), Binding of phenol monia-lyase in Pseudomonas putida, J. Bacteriol.
and analogs to alanine complexes of tyrosine phe- 172,2224-2229.
nol-lyase from Citrobacter freundii: Implications CORNFORTH, J. W., REDMOND, J. W., EGGERER, H.,
for the mechanism of a$-elimination and alanine BUCKEL, W., GUTSCHOW, C. (1969), Asymmetric
racemization, Biochemistry 32,11591-11599. methyl groups and the mechanism of malate syn-
CHEN,X. M. H., PLOUX,O., LIU, H.-W. (1996) Bio- thase, Nature 221,1212-1213.
synthesis of 3,6-dideoxyhexoses:Zn vivo and in vi- CORNICK, N. A., ALLISON, M. J. (1996),Assimilation
tro evidence for protein-protein interaction of oxalate, acetate and C 0 2 by Oxalobacter for-
between CDP-6-deoxy-~-threo-~-glycero-4-hexu- migenes, Can J. Microbiol. 42,1081-1086.
lose 3-dehydratase (E(1)) and its reductase CORNICK, N. A., YAN,B., BANK,S., ALLISON, M. J.
(E(3)), Biochemistry 35,16412-16420. (1996),Biosynthesisof amino acids by Oxalobact-
CHIBATA, I., TOSA, T., SATO,T., TANAKA,T. (1987a), er formigenes. Analysis using C-13-NMR, Can J.
Immobilization of cells in carragenan, Methods Biochem. 42,1219-1224.
Enzymol. 135,189-198. COTON,E., ROLLAN,G. C., LONVAUD-FUNEL, A.
CHIBATA, I., TOSA,T., YAMAMOTO, K., TANAKA, T. (1998), Histidine decarboxylase of Leuconostoc
(1987b), Production of L-malic acid by immobi- oenos 9204: Purification, kinetic properties, clon-
lized microbial cells, Methods Enzymol. 136,455- ing and nucleotide sequence of the hdc gene, J.
463. Appl. Microbiol. 84,143-151.
CHIBATA, I, TosA,T., SHIBATANI,T. (1995),The indus- COUGHLIN, E. M., CHRISTENSEN, E., KUNZ,F? L.,
trial production of optically active compounds by KRISHNAMOORTHY, K. S., WALKER,^ et al. (1998),
immobilized biocatalysis, in: Chirality in Zndustry Molecular analysis and prenatal diagnosis of hu-
(COLLINS, A. N., SHELDRAKE, G. N., CROSBY J., man fumarase deficiency,Mol. Genet. Metab. 63,
Eds.), pp. 352-370. Chichester: John Wiley & 254-262.
Sons. CROUT,D. H. G., HEDGECOCK, C. J. R. (1979), The
CHIPMAN, D., BARAK,Z., SCHLOSS, J. V. (1998), Bio- base catalyzed rearrangement of a-acetolactate
synthesis of 2-aceto-2-hydroxy-acids:acetolactate (2-hydroxy-2-methyl-3-oxobutanoate): a novel
5 References 149
carboxylate ion migration in a tertiary ketol rear- lyase from Rhodotorula glutinis, Phytochernistry
rangementJ Chem.SOC.,Perkin.Trans 11982-1989. 42,17-20.
CROUT, D. H. G., RATHBONE, D. L. (1988), Biotrans- DE BOER, A. s.,MARSHALL, R., BROADMEADOW, A.,
formations with acetolactate decarboxylase: un- HAZELDEN, K. (1993),Toxicological evaluation of
usual conversions of both substrate enatiomers acetolactate decarboxylase, J. Food. Protect. 56,
into products of high optical purity, J. Chem. SOC., 510-517.
Chem. Commun. 98-99. DEHNING, I., SCHINK, B. (1989), Malonomonas rubra
CROUT, D. H. G., LITIZECHILD, J., MITCHELL, M. B., gen. nov. sp. nov., a microaerotolerant bacterium
MORREY, S. M. (1984) Stereochemistry of the de- growing by decarboxylation of malonate, Arch.
carboxylation of a-acetolactate (2-hydroxy-2- Microbiol, 151,427433.
methyl-3-oxobutanoate) by the acetolactate de- DEHNING, I., SCHINK, B. (1994), Anaerobic degrada-
carboxylase of Klebsiella aerogenes,J. Chem. SOC., tion of malaonate via maloyl-CoA by Sporomusa
Perkin. Trans.12271-2276. mabnica, Klebsiella oxytoca and Rhododbacter
CROUT,D. H. G., LITTLECHILD, J., MORREY, S. M. capsulatus,A . Van Leeuwenhoek Int. f. Gen. Mol.
(1986) Acetoin metabolism: stereochemistry of Microbiol. 66,343-350.
the acetoin produced by the pyruvate decarboxy- DELGADO, L., TREJO, B. A., HUITRON, C. AGUILAR,
lase of wheat germ and by the acetolactate decar- G. (1993), Pectin lyase from Aspergillus sp. CH-Y-
boxylase of Klebsiella aerogenes, J. Chem. SOC., 1043.Appl. Microbiol. Biotechnol. 39,515-519.
Perkin. Trans.l,105-108. DENG, M. D., COLEMAN, J. R. (1999), Ethanol synthe-
CROUT, D. H. G., LEE,E. R., RATHBONE, D. L. (199O), sis by genetic engineering in cyanobacteria, Appl.
Absolute-configuration of the product of the ace- Environ. Microbiol. 65,523-528.
tolactate synthase reaction by a novel method of DE VIVO(1993),The expanding clinical spectrum of
analysis using acetolactate decarboxylase, J. mitochondria1diseases, Brain Dev. l5,1-22.
Chem. SOC., Perkin Trans. 11367-1369. DEWICK, P.M. (1998),The biosynthesis of shikimate
CROUT, D. H. G., MCINTYRE, C. R., ALCOCK, N. W. metabolites, Nut. Prod. Rep. 15,17-58.
(1991a), Stereoelectronic control of the tertiary DI GANGI, J. J., SEYZADEH, M., DAVIS, R. H. (1987),
ketol rearrangement - implications for the mech- Ornithine decarboxylase from Neurospora cras-
anism of the reaction catalyzed by the enzymes of sa, purification, characterization and regulation
branched-chain amino-acid-metabolism, reduc- by inactivation, J. Biol. Chem. 262,7889-7893.
toisomerase and acetolactate decarboxylase, J. DIMROTH, P., (1994) Bacterial sodium ion coupled
Chem. SOC.,Perkin Trans. 2,53-62. energetics A . Van Leeuwenhoek Znt. J. Gen. Mol.
CROUT, D. H. G., DALTON, H., HUTCHINSON, D. W., Microbiol. 65,381-395.
MIYAGOSHI, M. (1991b), Studies on pyruvate de- DIMROTH, P., HILBI, H. (1997), Enzymatic and genet-
carboxylase - acyloin formation from aliphatic, ic basis for bacterial growth on malonate, Mol.
aromatic and heterocyclic aldehydes, J. Chem. Microbiol. 25,3-10.
SOC.,Perkin Trans. 1,1329-1334. DIMROTH, P., SCHINK, B. (1998),Energy conservation
CROUT, D. H. G, DAVIES, S., HEATH, R. J., MILES, C. in the decarboxylation of dicarboxylic acids by
O., RATTIBONE, D. R.et al. (1994),Applications of fermenting bacteria, Arch. Microbiol. 170,69-77.
hydrolytic and decarboxylating enzymes in bio- DIMROTH, P., THOMER,A. (1993), On the mechanism
transformations, Biocatalysis 9,l-30. of sodium ion translocation by oxaloacetate de-
DAHMS, A. S., DONALD, A. (1982), D-xylo-Aldonate carboxylase of Klebsiella pneumoniae, Biochem-
dehydratase, Methods Enzymol. 90,302-305. istry 32,1734-1739.
DAHMS, A. S., SIBLEY, D., HUISMAN, W., DONALD, A. DIRMAIER, L. J., GARCIA, G. A., KOZARICH,J. W.,
(1982),D-Galactonate dehydratase, Methods En- KENYON,G. L., (1986), Inhibition of benzylfor-
zymol. 90,294-298. mate decarboxylase by [p-(bromomethy1)ben-
D’CUNHA,G. B., SATYANARAYAN, V., NAIR,P. M. zoyllformate - enzyme catalyzed modification of
(1994), Novel direct synthesis of L-phenylalanine thiamine pyrophosphate by halide elimination
methyl ester by using Rhodotorula glutinis phen- and tautomerizationJ Am. Chem. SOC.108,3149-
ylalanine ammonia lyase in an organic-aqueous 3150.
biphasic system, Enzyme Microb. Technol. 16, DOBRITZSCH, D., KONIG,S., SCHNEIDER, G., Lu, G. G.
318-322. (1998), High resolution crystal structure of pyru-
D’CUNHA,G. B., SATYANARAYAN, V., NAIR,P. M. vate decarboxylase from Zymomonas mobilis -
(1996a), Stabilization of phenylalanine ammonia implications for substrate activation in pyruvate
lyase containing Rhodotorula glutinis cells for the decarboxylases,J. Biol. Chem. 273,20196-20204.
continuous synthesis of L-phenylalanine methyl DOELLE, H. W., KIRK,L., CRIITENDEN, R., TOH,H.,
ester, Enzyme Microb. Technol. 19,421427. DOELLE, M.B. (1993), Zymomonas mobilis - sci-
D’CWHA,G. B., SATYANARAYAN, V., NAIR,P. M. ence and industrial application, Crit Rev. Biotech-
(1996b), Purification of phenylalanine ammonia nol. 13,57-98.
150 2 Lyases
DOMINICI, P., MOORE,P. S., VOLTAITORNI, C. B. DYDA, F., FUREY,W., SWAMINATHAN, S., SAX,M.,
(1993), Modified purification of L-aromatic ami- FARRENKOPF, B., JORDAN,F. (1993), Catalytic cen-
no acid decarboxylase from pig kidney, Protein ters in the thiamin diphosphate dependent en-
Expr. Purq. 4,345-347. zyme, pyruvate decarboxylase at 2.4-angstrom
DOYON, J. B., JAIN,A. (1999),The pattern of fluorine resolution, Biochemistry 32,61656170.
substitution affects binding affinity in a small li- EARNHARDT, J. N., Tu C., SILVERMAN, D. N. (1999),
brary of fluoroaromatic inhibitors for carbonic Intermolecular proton transfer in catalysis by car-
anhydrase, Org. Lett. 1,183-185. bonic anhydrase, Can. J. Chem. 77,726732.
DRAUZ,K., WALDMANN, H. (1995), Enzyme Cataly- EASTON, C. J., HUITON,C. A. (1994), Synthesis of
sis in Organic Synthesis, A Comprehensive Hand- each stereoisomer of [3-ZH,]phenylalanine and
book, pp. 481483,1050. Weinheim: WILEY-VCH. evaluation of the stereochemical course of the re-
DRAKE, A. F., SILIGARDI, G., CROUT, D. H. G., RATH- action of (R)-phenylalanine with (S)-phenylala-
BONE, D. L. (1987),Applications of vibrational in- nine ammonia lyase, J. Chem. SOC.,Perkin Trans.
frared circular dichoism to biological problems: 1,3545-3548.
Stereochemistry of the proton exchange in ace- EASTON, C. J., HARPER, J. B., LINCOLN, S. (1995), Use
toin (3-hydroxybutan-2-one) catalyzed by acetol- of cyclodextrins to limit product inhibition of (S)-
actate dehydrogenase,J. Chem. SOC.,Chem. Com- phenylalanine ammonia lyase, J. Chem. SOC., Per-
mun. 1834-1835. kin Trans. 1,2525-2526.
DREYER,J. L. (1985), Isolation and biochemical EDENS,W. A. A., URBAUER, J. L., CLELAND, W. W.
characterization of maleic-acid dehydratase, an (1997) Determination of the chemical mechanism
iron containing hydro-lyase, Eur. J. Biochem. 150, of malic enzyme by isotope effects, Biochemistry
145-154. 36,1141-1147.
DREYER, J. L. (1987), The role of iron in the activa- EFFENBERGER, F. (1999), Enzyme catalyzed prepara-
tion of mannonic and altronic acid hydratases, tion and synthetic applications of optically active
two Fe-requiring hydro-lyases, Eur. J. Biochem. cyanohydrins, Chimica 53,3-10.
166,623-630. EHRLICH, J. I., HWANG, C.-H., COOK,€? F., BLAN-
DUCROCQ, C., FRAISSE, D., TABET, J. C.,AZERAD, R. CHARD, J. s.(1999), Evidence for a stepwise mech-
(1984), An enzymatic method for the determina- anism for OMP decarboxylase, J. Am. Chem. SOC.
tion of enantiomeric composition and absolute 121,6966-6967.
configuration of deuterated or tritiated succinic EMANUELE, J. J. FITZPATRICK, P. F. (1995), Mechanis-
acid, Anal. Biochem. 141,418-422. tic studies of the flavoprotein tryptophan 2-
DUERRE, P.(1998), New insights and novel develop- monooxygenase. 1.Kinetic mechanism, Biochem-
ments in Clostridial acetonelbutanollisopropanol istry 34,3710-3715.
fermentation, Appl. Microbiol. Biotechnol. 49, ENGLARD, S., HANSON, K. R. (1969), Stereospecifi-
639-648. cally labeled citric acid ccyle intermediates, Meth-
DUERRE, P., BAHL,H., GOITSCHALK, G. (1992),Ace- ods Enzymol. 13,567-601.
tone-butanol fermentation - Basis of a modern EREZ,T., GDALEVSKY, G. Y., TORCHINSKY, Y. M.,
biotechnological process, Chem. Ing. Tech. 64, PHILLIPS, R. S., PAROLA,A. H. (1998), Cold inacti-
491498. vation and dissociation into dimers of Escherichia
DUERRE, P., FISCHER, R. J., KUHN,A., LORENZ, K., coli tryptophanase and its W330F mutant form,
SCHREIBER, W. et al. (1995), Solventogenic genes Biochim. Biophys. Acta. 1384,365-372.
of Clostridium acetobutylicum - catalytic proper- EVANS, C. T., HANNA, K., PAYNE, C., CONRAD, D. W.,
ties, genetic organization and transcriptional reg- MISAWA, M. (1987), Biotransformation of trans
ulation, FEMS Microbiol. Rev. 17,251-262. cinnamic acid to L-phenylalanine: Optimization
DUFFY, J. I. (1980), Chemicals by enzymatic and mi- of reaction conditions using whole yeast cells, En-
crobial processes, Chemical Technol. Rev. 161, zyme Microb. Technol.9,417421.
107-109. FACCHINI, P. J. (1998), Temporal correlation of tyra-
DUSCH, N., PUEHLER, A., KALINOWSKI, J. (1999), Ex- mine metabolism with alkaloids and amide bio-
pression of the Corynebacterium glutamicum synthesis in elicited opium poppy cultures, Phyto-
panD gene encoding L-aspartate-a-decarboxy- chemistry 49,481-490.
lase leads to pantothenate overproduction in Es- FALEEV, N. G., SPIRINA, S. N., PERYSHKOVA, 0. E.,
cherichia coli, Appl. Environ. Microbiol. 65,153& SAPOROVSKAYA, M. B., TSYRYAPKIN, V. A., BELI-
1539. KOV, V. M. (1995),The synthesis of L-tyrosine and
DYDA, F., FUREY,W., SWAMINATHAN, S., SAX,M., its aromatic ring substituted analogs by microbial
FARRENKOPF, B., JORDAN, F. (1990), Preliminary cells containing tyrosine phenol-lyase, Appl. Bio-
crystallographic data for the thiamin diphosphate- chem. Microbiol. 31,155-160.
dependent enzyme pyruvate decarboxylase from FALEEV, N. G., SPIRINA,S. N., IVOILOV, V. S., DEMID-
brewers’ yeast,J. Biol. Chem. 265,17413-17415. KINA, T. V., PHILLIPS, R. S. (1996), The catalytic
5 References 151
mechanism of tyrosine phenol-lyase from Erwi- FLINT,D. H., EMPTAGE,M. H. (1988), Dihydroxy ac-
nia herbicola:The effect of substrate structure on id dehydratase from spinach contains a [2Fe-2S]
pH-dependence of kinetic parameters in the re- cluster, J. Biol. Chem. 263,3558-3564.
actions with ring-substituted tyrosines, Zt. Natur- FLINT, D. H, MCKAY,R. G. (1994) Escherichia coli fu-
forsch. C 51,363-370. marase A catalyzed transfer of 0-18 from C-2
FALZONE, C. J., KARSTEN, W. E., CONLEY, J. D., VIO- and H-2 from C-3 of malate to acetylene-dicar-
LA, R.E. (1988). L-Aspartase from Escherichia co- boxylate to form 0-18-labeled and H-2-labeled
li: Substrate specificity and role of divalent metal oxalacetate, J. Am. Chem. SOC. 116,5534-5539.
ions, Biochemistry 27,9089-9093. FLINT, D. H., NUDELMAN, A., CALABRESE, J. C.,
FARRAR, T. C., GUTOWSKY, H. S., ALBERTY,R. A., GO~IEB H.,E. (1992a), Enol oxalacetic acid ex-
MILLER, W. G. (1957),The mechanism of the ster- ists in the Z-form in the crystalline state and in so-
eospecific enzymatic hydration of fumarate to L- lution, J. Org. Chem. 57,7270-7274.
malate,J. Am. Chem. SOC. 79,3978-3980. FLINT,D. H., EMFTAGE, M. H., GUEST,J. R. (1992b),
FARRENKOPF, B. C., JORDAN, F. (1992), Resolution of Fumarase A from Escherichia coli: Purification
brewers' yeast pyruvate decarboxylase into mul- and characterization as an iron-sulfur cluster con-
tiple isoforms with similar subunit structure and taining enzyme, Biochemistry 31,10331-10337.
activity using high-performance liquid-chroma- FLINT, D. H., TUMINELLO, J. F., EMPTAGE,M. H.
tography, Protein Expr. Purq 3,101-107. (1993),The inactivation of Fe-S cluster containing
FELL,L. M., FRANCIS, J. T., HOLMES, J. L., TERLOUW, hydro-lyases by superoxide, J. Biol. Chem. 268,
J. K. (1997), The intriguing behavior of (ionized) 22369-22376.
oxalacetic acid investigated by tandem mass spec- FLINT, D. H., TUMINELLO, J. F., MILLER,T. J. (1996),
trometry, Znt. J. Mass Spectrom. 165,179-194. Studies on the synthesis of the Fe-S cluster of di-
FESSNER, W. D. (1998), Enzyme mediated C-C bond hydroxy-acid dehydratase in Escherichia coli
formation, Curr. Opin. Chem. Biol. 2,85-97. crude extract - Isolation of 0-acetylserine sulfhy-
FESSNER, W.-D., WALTER, C. (1997) Enzymatic C-C drylases A and B and P-cystathione based on
bond formation in asymmetric synthesis. Topics their ability to mobilize sulfur from cysteine and
Curr. Chem. 184,97-194. to participate in Fe-S cluster synthesis, J. Biol.
FETZNER, S. (1998), Bacterial dehalogenation, Appl. Chem. 271,16053-16067.
Microbiol. Biotechnol. 50,633457. FLOROVA, G., DENOYA, C. D., MORGENSTERN, M. R.,
FETZNER, S., LINGRENS, E (1994), Bacteriol dehydro- SKINNER, D. D., REYNOLDS, K. A. (1998), Cloning,
genases - biochemistry, genetics and biotechno- expression, and characterization of a Type I1 3-
logical applications, Microbiol. Rev. 58,641485. dehydroquinate dehydratase gene from Strepto-
FINDEIS, M. A., WHITESIDES, G. M. (1987) Fumarase myces hygroscopicus, Arch. Biochem. Biophys.
catalyzed synthesis of L-threo-chloromalic acid 350,298-306.
and its conversion to 2-deoxy-~-riboseand D- FLOSS,H. G., TSAI,M. D., WOODARD, R. W. (1984),
erythro-sphingosine,J. Org. Chem. 52,2838-2848. Stereochemistry of biological reactions at pro-
FISHER,H. L., FRIEDEN, C., MCKEE,J. S. M., ALBER- prochiral centres, Topics Stereochem. 15,253-321.
TY, R. A. (1955), Concerning the stereospecificity FOOR,F., MORIN, N., BOSTIAN, K. A. (1993), Produc-
of the fumarase reaction and the demonstration tion of L-dihydroxyphenylalaninein Escherichia
of a new intermediate,J. Am. Chem. SOC. 77,4436. coli with the tyrosine phenol-lyase gene cloned
FISHER,R. J., HELMS,J., DUERRE,P. (1993), Cloning, from Erwinia herbicola, Appl. Environ. Microbi-
sequencing and molecular analysis of the sol op- 01.59,3070-3075.
eron of Clostridium acetobutylicum,a chromoso- FRIEDEMANN, R., NEEF,H. (1998), Theoretical stud-
mal locus involved in solventogenesiqJ. Bacteriol. ies on the electronic and energetic properties of
175,69594969. the aminopyrimidine part of thiamin diphos-
FITZPATRICK, D. R., HILL,A., TOLMIE,J. L., THOR- phate, Biochim. Biophys. Acta. 1385,245-250.
BURN, D. R., CHRISTODOULOU, L. (1999),The mo- Fu, D. X., MALONEY, P.C. (1998), Structure-function
lecular basis of malonyl-CoA decarboxylase defi- relationships in OxlT, the oxalate-formate trans-
ciency, Am. J. Human Genet. 65,318-326. porter of Oxalobacter formigenes - topological
FLINT,D. H. (1993), Escherichia coli fumarase A cat- features of transmembrane helix 11 as visualized
alyzes the isomerization of enol and keto oxala- by site directed fluorescent labeling, J. Biol.
cetic acid, Biochemistry 32,799-805. Chem. 273,17962-17967.
FLINT,D. H. (1994), Initial kinetic and mechanistic FUKUYAMA, Y., MATIOSHI, K., IWASAKI, M., TAKI-
characterization of Escherichia coli fumarase A, ZAWA, E., MNAZAKI,M. et al. (1999), Preparative
Arch. Biochem. Biophys. 311,509-516. scale synthesis of (R)-a-fluorophenylacetic acid,
FLINT, D. H., ALLEN,R. M. (1996), Iron-sulfur pro- Biosci. Biotech. Biochem. 63,1664-1666.
teins with non-redox functions, Chem. Rev. %, FUREY, W., ARJUNAN, P., CHEN,L., SAX,M., Guo, F.,
2315-2334. JORDAN,F. (1998), Structure-function relation-
152 2 Lyases
ships and flexible tetramer assembly in pyruvate GAWRONSKI, J., GAWRONSKI (1999), Tartaric and
decarboxylase revealed by analysis of crystal Malic Acids in Organic Synthesis:A Source Book
structures, Biochim. Biophys. Acta. 1385, 253- OfBuilding Blocks, Ligands, Auxilaries and Re-
270. solving Agents. Chichester: John Wiley & Sons.
FURUKAWA, T., KOGA,J., ADACHI, T., KISHI,K., SYO- GELFMAN, C. M., COPELAND, W. C., ROBERTUS, J. D.
NO, K. (1996), Efficient conversion of L-trypto- (1991), Site directed alteration of 4 active site res-
phan to indole-3-acetic acid andor tryptophol by idues of a pyruvoyl-dependent histidine decar-
some species of Rhizoctonia, Plant Cell Physiol. boxylase, Biochemistry 30,1057-1062.
37,899-905. GERISCHNER, U., DUERRE,P. (1990), Cloning, se-
FURUTA, T., TAKAHASHI, H., KASUYA, Y., (1990), Evi- quencing, and molecular analysis of the acetoace-
dence for a carbanion intermediate in the elimi- tate decarboxylase gene region from Clostridium
nation of ammonia from L-histidine catalyzed by acetobutylicum, J. Bacteriol. 172,6907-6918.
histidine ammonia-lyase,J. Am. Chem. SOC. 112, GERMAN,A. (1992), Use of a-acetolactate decarbox-
3633-3636. ylase from a recombinant strain of Bacillus subti-
FURUTA,T., TAKAHASHI, H., SHIBASAKI, H., KASUYA, lis for the production of beer and alcohol, Bull.
Y. (1992), Reversible stepwise mechanism involv- Acad. Natl. Med. 176,1175-1176.
ing a carbanion intermediate in the elimination of GHOSH,S., SADHUKHAN, P. C., CHAUDHURI, J.,
ammonia from L-histidine catalyzed by histidine GHOSH, D. K., MANDAL,A. (1996), Volatilization
ammonia-lyase,J. Biol. Chem. 267,12600-12605. of mercury by immobilized mercury resistant
GALLAGHER, T., ROZWARSKI, D. A., ERNST,S. R., bacterial cells,J. Appl. Bacteriol. 81,104-108.
HACKETT, M. L. (1993), Refined structure of the GIORGIANNI,F., BERANOVA, S., WESDEMIOTIS, C., VI-
pyruvoyl dependent decarboxylase from Lactob- OLA, R. E. (1995),Elimination of the sensitivity of
acillus 30a, J. Mol. Biol. 230,516-528. L-aspartase to activate site directed inactivation
GANI,D. (1991), A structural and mechanistic com- without alteration of catalytic activity.Biochemis-
parison of pyridoxal5 ’-phosphate dependent de- try 34,3529-3535.
carboxylase and transaminase enzymes, Phil. GIRBAL, J., SAINT-AMANS, I. V. S., SOUCAILLE, P.
Trans.Royal SOC.B. 332,131-139. (1995), How neutral red modified carbon and
GANI,D., YOUNG, D. W. (1983) Stereochemistry of electron flow in Clostridium acetobutylicum
the dihydouracil dehydrogenase reaction in the grown in chemostats at neutrel pH, FEMS Micro-
metabolism of uracil to palanine, J. Chem. Soc., biol. Lett. 16,151-162.
Chem. Commun.,576-578. GIRBAL, L., SOUCAILLE, P.(1998), Regulation of sol-
GANI,D., ARCHER, C. H., B O ~ N G N. P.,POLLARD,
, J. vent production in Clostridium acetobutylicum,
R. (1999), The 3-methylapartase reaction probed TZBS 16,ll-16.
using H-2 and N-15 isotope effects for three sub- GISH,G., SMYTH,T., KLUGER, R. (1988), Thiamin
strates: A flip from a concerted to a carbocationic diphosphate catalysis. Mechanistic divergence as
mechanism upon changing the C-3 stereochemis- a probe of substrate activation of pyruvate decar-
try in the substrate from R to S, Bioorg. Med. boxylase, J. Am. Chem. Soc. 110,623M234.
Chem.7,977-990. GLOGE, A., LANGER, B., POPPE, L., RETEY, J. (1998),
GAO,S., OH, D. H., BROADBENT, J. R., JOHNSON,M. The behavior of substrate analogs and secondary
E., WEIMER, B. C, STEELE, J. L. (1997), Aromatic deuterium isotope effects in the phenylalanine
amino acid catabolism by Lactococci, Lait 77, ammonia-lyase reaction, Arch. Biochim. Biophys.
371-381. 359,l-7.
GAO,G., NARA,T., NAKAJIMA-SHIMADA, J., AOKI,T. GODA,S. K., MINTON, N. P., BOITING, N. P., GANI,D.
(1999a), Novel organization and sequences of five (1992), Cloning, sequencing, and expression in
genes encoding all six enzymes for de novo pyrim- Escherichia coli of the Clostridium tetanomor-
idine biosynthesis in Trypanosoma cruzi, J. Mol. phum gene encoding P-methylaspartase and
Biol. 285,149-161. characterization of the recombinant protein, Bio-
GAO,J. M., WABER, L., BENNETT, M. J., GIBSON, K. chemistry 31,10747-10756.
M., COHEN, J. C. (1999b), Cloning and mutational GOODWIN, G. W., TAEGTMEYER, H., (1999), Regula-
analysis of human malonyl-coenzyme A decar- tion of fatty acid oxidation of the heart by MCD
boxylase,J. Lipid Rex 40,178-182. and ACC during contractile stimulation, Am. J.
GAWRON, O.,FONDY,T. P. (1959), Stereochemistry of Physiol. Endocrinol. Metabol. 277, E772-E777.
the fumarase and aspartase catalyzed reactions GONZALEZ, D. H., ANDREO, C. S. (1988), Carboxyla-
and of the Krebs cycle from fumaric acid to d-iso- tion and dephosphorylation of phosphoenol-3-
citric acid,J. Am. Chem. SOC.81,63334334, fluoropyruvate by maize leaf phosphoenolpyru-
GAWRON, O.,GLAID, A. J., FONDY, T. P. (1961), Ster- vate carboxylase,Biochem. J. 253,217-222.
eochemistry of Krebs’ cycle hydrations and relat- GOPALAN, R. (1999), Kinetics of decarboxylation of
ed reactions,J.Am. Chem. SOC.83,3634-3640. ethylmalonic acid: A hundred fold reactivity of
5 References 153
the acid molecule over its mono-anion, Asian J. mentation technology - Zymomonas mobilis,
Chem. 11,1474-1482. Curr. Sci. 77,5648.
GOITSCHALK,G., BENDER,R. (1982), D-glUCOnate GUITA, M. N. (1992), Enzyme function in organic
dehydratase from Clostridium pasteurianum, solvents. Eur. J. Biochem. 203,25-32.
Methods Enzymol. 90,283-287. GuITA,A., PHUNG, L. T., CHAKRAVARTY, L., SILVER,
GRABER,R., KASPER,P., MALASHKEVICH, V. N., S. (1999), Mercury resistance in Bacillus cereus
STROP,P., GEHRING, H. et al. (1999), Conversion RC607: Transcriptional organization and two new
of aspartate aminotransferase into L-aspartate p- open reading frames,J. Bacteriol. 181.7080-7086.
decarboxylase by a triple active site mutation, J. GUTHRIE, R. D., JENCKS, W. P. (1989), IUPAC recom-
Biol. Chem. 274,31203-31208. mendations for the representation of reaction
GRABOWSKI, R., HOFMEISTER,A. E. M., BUCKEL, W. mechanisms,Acc. Chem. Res. 22,343-349.
(1993), Bacterial L-serine dehydratases - a new GYAMERAH, M. H. (1995), Oxygen requirement and
family of enzymes containing iron-sulfur clusters, energy relations of itaconic acid fermentation by
Biochem. Sci. 18,297-300. Aspergillus terreus NRRL 1960,Appl. Microbiol.
GRIGG,R., HENDERSON, D., HUDSON, A. J. (1989) Biotechnol. 44,20-26.
Decarboxylation of a-amino acids by pyruvic ac- HALLIS, T. M., LIU,H. W. (1998), Stereospecificity of
id and its derivatives: evidence for azomethine hydride transfer for the catalytically recycled
ylides in in vitro analogs of pyruvoyl enzymic pro- NAD in CDP-D-glucose4,6-dehydratase, Tetra-
+
cesses, Tetrahedron Lett. 30,2841-2844. hedron 54,15975-15982.

GRISHIN,N. V., OSTERMAN, A. L., BROOKS,H. B., HALLIS,T.M., LIU,H.-W. (1999a), Mechanistic stud-
PHILLIPS, M. A., GOLDSMITH, E. J. (1999), X-ray ies of the biosynthesis of tyvelose: Purification
structure of ornithine decarboxylase from Trypa- and characterization of CDP-D-tyvelose 2-epime-
nosoma brucei: The native structure and the rase, J.Am. Chem. SOC.121,676556766.
structure in complex with a-difluoromethylorni- HALLIS,T.M., LIU,H.-W. (1999b), Learning nature’s
thine, Biochemistry 38,15174-15184. strategy for making deoxy sugars: Pathways,
GRUER,M. J., ARTYMIUK, P. J., GUEST,J. R. (1997), mechanisms and combinatorial applications,Acc.
The aconitase family: Three structural variations Chem. Res. 32,579-598.
on a common theme,. Trends. Biochem. Sci. 22, HALLIS, T. M., LEI,Y., QUE,N. L. S., LIU,H., (1998),
3-6. Mechanistic studies of the biosynthesis of para-
GRUPE,H., GOITSCHALK,G. (1992), Physiological tose: purification and characterization of CDP-
events in Clostridium acetobutylicum during the paratose synthase,Biochemistry 37,49354945.
shift from acidogenesis to solventogenesis in con- HAMILTON, G.A., WESTHEIMER, F. H. (1959), On the
tinuous culture and presentation of a model for mechanism of the enzymatic decarboxylation of
shift induction, Appl. Environ. Microbiol. 58, acetoacetate,J. Am. Chem. SOC.81,6332-6333.
3896-3902. HANDA, S., Koo, J. H., KIM,Y.S., FLOSS,H. G. (1999),
GULICK,A. M., PALMER, D. R. J., B A B B I ~ P., C., Stereochemical course of biotin-indepenent mal-
GERLT, J. A., RAYMENT, I. (1998),Evolution of en- onate decarboxylase catalysis,Arch. Biochem. Bi-
zymatic activities in the enolase superfamily: ophys. 370,93-96.
Crystal structure of D-glucarate dehydratase from HANSON, K. R., HAVIR,E. A. (1972), The enzymic
Pseudomonas putida, Biochemistry 37, 14358- elimination of ammonia, in: The Enzymes 3rd
14368. Edn. Vol. 7 (BOYER,S. D., Ed.), pp. 75-166. New
GULZAR, M. S., AKHTAR,M., GANI,D. (1994), Enan- York Academic Press.
tiospecific conjugate addition of N-nucleophiles HANSON, K. R., WIGHTMAN, R. H., STAUNTON, J.,
to substituted fumaric acids using methylaspar- BATERSBY,A. R. (1971), Stereochemical course
tase, J. Chem. Soc., Chem. Commun. 1994,1601- of the elimination catalyzed by L-phenylalanine
1602. ammonia-lyase and the configuration of 2-ben-
GULZAR, M. S.,MORRIS, K. B., GANI,D.(1995), Con- zamidocinnamic azlactone, J. Chem. Soc., Chem.
trol of the regioselectivity of N-nucleophile addi- Commun.,185-186.
tion to N - carbonyl protected dehydroalanines - a HARDEN, A. (1901),The chemical action of Bacillus
model for the ammonialyase enzymes, J. Chem. coli communis and similar organisms on carbohy-
Soc., Chem. Commun. 1995,1061-1062. drates and allied compounds. J. C h t m SOC.79,
GULZAR, M. S., AKHTAR, M., GANI,D. (1997), Prep- 611-628.
aration of N-substituted aspartic acids via enan- HASSON,M. S., MUSCATE, A., HENEHAN, G. T. M.,
tiospecific conjugate addition of N-nucleophiles GUIDINGER, P. F., PETSKO,G. A. et al. (1995),Pur-
to fumaric acids using methylaspartase: Synthetic ification and crystallization of benzoylformate
utility and mechanistic implications, J. Chem. decarboxylase,Protein Sci. 4,955-959.
Soc., Perkin Trans.l.,649-655. HASSON, M. S., MUSCATE,A., MCLEISH, M. J., POLOV-
GUNASEKARAN, P., RAJ,K. C. (1999), Ethanol fer- NIKOVA, L. s.,GERLT,J. A. et al. (1998),The crystal
154 2 Lyases
structure of benzoylformate decarboxylase at 1.6 HIRAHARA, T., HORINOUCHI, S., BEPPU,T. (1993),
angstrom resolution: Diversity of catalytic resi- Cloning, nucleotide-sequence, and overexpres-
dues in thiamin diphosphate-dependent enzymes, sion in Escherichia coli of the P-tyrosinase gene
Biochemistry 37,9918-9930. from an obligately symbioticthermophile,Symbi-
HARRIS, T. K., WASHABAUGH, M. W. (1995a), Distri- obacterium thermophilum, Appl. Microbiol. Bio-
bution of the thiamin diphosphate C-2-proton technol. 39,341-346.
during catalysis of acetaldehyde formation by HIRSCH, W., SCHAGGER, H., FUCHS, G. (1998), Phenyl
brewers-yeast pyruvate decarboxylase, Biochem- glyoxylate :NAD+ oxidoreducatse (CoA benzoy-
istry 34,13994-14000. lating), a new enzyme of anaerobic phenylalanine
HARRIS,T. K., WASHABAUGH, M. W. (1995b), Sol- metabolism in the denitrifying bacterium, Azoar-
vent-derived protons in catalysis by brewers- cus evansii, Eur. J. Biochem. 251,907-915.
yeast pyruvate decarboxylase, Biochemistry 34, HIRSCHBEIN, B. L., MAZENOD, F. P., WHITESIDES, G.
14001-14011. M. (1982), Synthesis of phosphoenolpyruvate and
HASSETT,D. J., HOWELL,M. L., SOKOL, P. A., VASIL, its use in adenosine triphosphate cofactor regen-
M. L., DEAN,G. E. (1997), Fumarase C activity is eration, J. Org. Chem. 41,3765-3766.
elevated in response to iron deprivation and in HOENKE,S., DIMROTH, P.(1999), Formation of cata-
mucoid, alginate producing Pseudomonas aerugi- lytically active S-acetyl(ma1onatedecarboxylase)
nosa: Cloning and characterization of fumC and requires malonyl-coenzyme Aacyl carrier pro-
purification of native FumC, J. Bacteriol. 179, tein-SH transacylase as auxilary enzyme, Eur J.
1442-1451. Biochem. 259, 181-187 (correction 1999, 259,
HAYASHI, H. (1995), F'yndoxal enzymes - mechanistic 961).
diversity and uniformityJ Biochem. 118,463-473. HOENKE,S., SCHMID, M., DIMROTH, P. (1997), Se-
HAYASHI, S., KAMEJI,T. (1983), Ornithine decarboxy- quence of a gene cluster from Klebsiella pneu-
lase (rat-liver), Methods Enzymol. 94,154-158. moniae encoding malonate decarboxylase and
HE, X. M, THORSON, J. S., LIU,H. W. (1996), Probing expression of the enzyme in Escherichia coli, Eur.
the coenzyme and substrate binding events of J. Biochem. 246,530-538.
CDP-D-glucose 4,6-dehydratase: Mechanistic im- HOFMEISTER, A. E. F., ALBRACHT, S. P. J., BUCKEL, A,
plications, Biochemistry 35,47214731. W. (1994) Iron sulfur containing L-serine dehy-
HEATON,A. C. P., RUGH,C. L., WANG, N. J., MEAGHER, dratase from Peptostreptococcus asaccharolyti-
R. B. (1998), Phytoremediation of mercury and cus:correlation of the cluster type with enzymatic
methymercury polluted soils using genetically en- activity, FEBS Lett. 351,416-418.
gineeered plants, J. Soil Contamin. 7,497-509. HOHENESTER,E., KELLER,J. W., JANSONIUS, J. N.
HEBEL,D., FURLANO,D. C.,PHILLIFS,R. S., KOUSHIK, (1994),An alkali metal ion size dependent switch
S., CREVELING, C. R., KIRK,K. L. (1992),An enzy- in the active site structure of dialkylglycinedecar-
matic-synthesis of 2-azido-~-tyrosine, Bioorg. boxylase, Biochemistry 33,13561-13570.
Med. Chem. Lett. 2 , 4 1 4 . HOHMANN, S. (1991a), PDC6, a weakly expressed py-
HERBERT, R. B., KNAGGS, A. R. (1992), Biosynthesis ruvate decarboxylase from yeast, is activated
of the antibiotic obafluorin from para-amino- when fused spontaneously under the control of
phenylalanine and glycine (glyoxylate),J. Chem. the PDCl promoter, Curr. Genet. 1991,20,373-
SOC.,Perkin Trans. I , 109-113. 378.
HERNANDEZ, D., PHILLIPS, A. T. (1994), Ser-143 is an HOHMANN, S. (1991b), Characterization of PDC6, a
essential active-site residue in histidine ammonia- 3rd structural gene for pyruvate decarboxylase in
lyase of Pseudomonas putida. Biochem. Biophys. Saccharomyces cerevisiae, J. Bacteriol. 173,7963-
Res. Commun. 201,1433-1438. 7969.
HERNANDEZ, D., STROH, J. G., PHILLIPS, A. T. (1993), HOHMANN, S. (1993), Characterization of PDC2, a
Identification of Ser'43 as the site of modification gene necessary for high-level expression of pyru-
in the active-site of histidine ammonia-lyase. vate decarboxylase structural genes in saccharo-
Arch. Biochem.. Biophys. 307,126-132. myces-cerevisiae, Mol. Gen. Genet. 241, 657-
HIGHBARGER, L. A., GERLT,J. A., KENYON,G. L. 666.
(1996), Mechanism of the reaction catalyzed by HUANG,S., BEALE,J. M., KELLER, F! J., FLOSS,H. G.
acetoacetate decarboxylase.Importance of lysine (1986), Synthesis of (R)-[1-13C,,2-2Hl)]malonate
116 in determining the pK, of active site lysine and (S)-[1-'3C,,2-2H,)]malonate and its stereo-
115,Biochemistry 35,4146. chemical analysis by NMR spectroscopy,J. Am.
HILL,C. M., PANG,S. S., DUGGLEBY, R. G. (1997), Chem. SOC.108,1100-1101.
Purification of Escherichia coli acetohydroxyacid HUANG, C. L., WU,C. C., LIEN,M. H. (1997),Ab initio
synthase isoenzyme I1 and reconstitution of ac- studies of decarboxylations of P-keto carboxylic
tive enzyme from its individual pure subunits, Bi- acids, XCOCH2COOH (X = H, OH, and CH3),J.
ochem. J. 327,891-898. Phys. Chem. A 101,7867-7873.
5 References 155
HUANG, S., XUE, Y., SAUER-ERIKSSON, E., CHIRICA, SON,G. G., DEMENTIEVA, I. S. et al. (1998), Crystal
L., LINDSKOG, S., JONSSON, B.-H. (1998), Crystal structure of tryptophanase, J. Mol. Biol. 276,603-
structure of carbonic anhydrase from Neisseria 623.
gonorrhoeae and its complex with the inhibitor IWAMOTO, R., TANIKI,H., KOISHI,J., NAKURA, S.
acetazolamide,J. Mol. Biol. 283,301-310. (1995), D-Glucosamine aldolase activity of D-glu-
HUANG, P. Q., CHEN,Q. F.,CHEN,C. L., ZHANG, H. K. cosaminate dehydratase from Pseudomonas fluo-
(1999), Asymmetric synthesis of (-)-(R)-pyrro- rescens and its requirement for MnZ+,Biosci. Bi-
lam A starting from (S)-malic acid, Tetrahedron: otech. Biochem. 59,408-411.
Asymmetry 10,3827-3832. JAKLITSCH, W. M., KUBICEK, C. P., SCRUTTON, M. C.
HUBBARD, B. K., KOCH,M., PALMER, D. R. J., BAB- (1991), The subcellular organization of itaconate
BIIT, P. C., GERLT, J. A. (1998) Evolution of enzy- biosynthesis in Aspergillus terreus,J. Gen. Micro-
matic activities in the enolase superfamily: Char- biol.W7,533-539.
acterization of D-glucarate/galactarate catabolic JANSONIUS, J. N. (1998), Structure, evolution and ac-
pathway in Escherichia coti, Biochemistry 37, tion of vitamin B,-dependent enzymes, Curr.
14369-14375. Opin. Struct. Biol. 8,759-769.
HUBNER,G., TIITMANN, K., KILLENBERG-JABS, M., JANSSEN, P. H., HARFOOT,C. G. (1992), Anaerobic
SCHAFFNER, J., SPINKA, M. et al. (1998),Activation malonate decarboxylation by Citrobacter divs.,
of thiamin diphosphate in enzymes, Biochim. Bi- Arch. Microbiol. 157,471-474.
ophys. Acta. 1385,221-228. JAYASEKERA, M. M. K., SHI,W. X., FARBER, G. K., VI-
HUGENHOLTZ, J. (1993), Citrate metabolism in lactic OLA, R. E. (1997b), Evaluation of functionally im-
acid bacteria, FEMS Microbiol. Rev. 12,165-178. portant amino acids in L-aspartate ammonia-
HUHTA,D. W., HECKENTHALER, T., ALVAREZ, F. J., lyase from Escherichia coli, Biochemistry 36,
ERMER,J., HUBNER, G. et al. (1992),The catalytic 9145-9150.
power of pyruvate decarboxylase - a stochastic JEBAI,F., HANOUN,N., HAMON,M., THIBAULT, J.,
model for the molecular evolution of enzymes, PELTRE,G. et al. (1997), Expression, purification
Acta Chem. Scand. 46,778-788. and characterization of rat aromatic r.-amino acid
IDING,H., SIEGERT, P., MESCH,K., POHL,M. (1998), decarboxylase in Escherichia coli, Protein Expr.
Application of a-keto acid decarboxylases in bio- Purif. 11,185-194.
transformations, Biochim. Biophys. Acta W85, JENKINS,J., MAYANS, O., PICKERSGILL, R. (1998),
307-322. ' Structure and evolution of parallel P-helix pro-
IKEMOTO, M., SASAKI, M., HARADAHIRA, T., YADA, teins, J. Struct. Biol. 122,236-246.
T., OMURA,H. et al. (1999), Synthesis of L-[P- JETEN, M. S. M., SINSKEY, A. J. (1995), Purification
"Clamino acids using immobilized enzymes, and properties of oxaloacetate decarboxylasefrom
Appl. Rad. Isotopes 50,715-721. Corynebacterium glutamicum, A. Van Leeuwen-
IKUSHIRO, H., HAYASHI, H., KAWATA,~., KAGAMIYA- hoek Int. J. Gen. Mol. Microbiol. 67,221-227.
MA,H. (1998). Analysis of the pH and ligand in- JEZOWSKA-BOJCZUK, M., KOZLOWSKI, H. (1991), Co-
duced spectral transitions of tryptophanase: Acti- ordination of copper(I1) ions by a$-dehydrodi-
vation of the coenzyme at the early stages of the peptides. Potentiometric and spectroscopic study,
catalytic cycle, Biochemistry 37,3043-3052. Polyhedron 10,2331-2335.
IMPERIALI,B., MCDONNELL,K. A., SHOGREN- JEZOWSKA-BOJCZUK, M., KOZLOWSKI, H. (1994), Un-
KNAAK, M. (1999), Design and construction of usual binding ability of a$-dehydrodipeptides
novel peptides and proteins by tailored incorpo- towards metal ions, Polyhedron 13,2683-2687.
ration of coenzyme functionality, Topics Curr. JEZOWSKA-BOJCZUK, M., VARNAGY, K., SOVAGO,I.,
Chem. 202,l-38. PIETRZYNSKI, G., DYBA, M. et al. (1996), Co-ordi-
INGRAM, L. O., ALDRICH,H. C., BORGES, A. C. C., nation of copper(I1) ions by prolyl-a$-dehydroa-
CAUSEY,T. B., MARTINEZ,A. et al. (1999), Enteric mino acids: comparative studies and general con-
bacterial catalysts for fuel ethanol production, Bi- siderations, J. Chem. SOC., Dalton Trans. 3265-
otechnol. Prog. 15,855-866. 3268.
IRAQUI, I., VISSERS, S., ANDRE,B., URRESTARAZU,A.JOHN,R. A. (1995) Pyridoxal phosphate dependent
(1999); Transcriptional induction by aromatic enzymes, Biochim. Biophys. Acta. l248,81-96.
amino acids in Saccharomyces cerevisiae, Mol. JOHNSON, D. A. CHEN,J. S. (1995), Taxonomic rela-
Cell. Biol. 19,3360-3371. tionships among strains of Clostridium acetobu-
ISHII,S., MIZUGUCHI, H., NISHINO, J., HAYASHI, H., tylicum and other phenotypically related organ-
KAGAMIYAMA, H. (1996), Functionally important isms, FEMS Microbiol. Rev. 17,233-240.
residues of aromatic L-amino acid decarboxylase JOHNSON, D. A., LIU,H.-W. (1998) Mechanisms and
probed by sequence alignment and site directed pathways from recent deoxysugar biosynthesis
mutagenesis.J. Biochem. 120,369-376. research, Curr. Opin. Chem. Biol. 2,642.
ISUPOV, M. N., ANTSON,A. A,, DODSON, E. J., DOD- JOHNSON, D. A., GASSNER,G.T., BANDARIAN,~, Ru-
156 2 Lyases
ZICKA, F. J., BALLOU,D. F? et al. (1996), Kinetic monia-lyase from sunflower (Helianthus annuus
characterization of an organic radical in the as- L.) hypocotyls,Biochim. Biophys.Acta 964,73432.
carylose biosynthetic pathway, Biochemistry 35, KAMATH, A. V., VAALER, G. L., SNELL,E. E. (1991),
15846-15856. Pyridoxal phosphate dependent histidine decar-
JOHNSON, J. L., Tom, J., SANTIWATANAKUL, S., CHEN, boxylases - Cloning sequencing and expression
J. S. (1997), Cultures of “Clostridium acetobutyli- of genes from Klebsiella planticola and Entero-
cum” from various culture collections comprise bacter aerogenes and properties of the overex-
Clostridium acetobutylicum, Clostridium beije- pressed enzymes,J. Biol. Chem.266,9432-9437.
rinckii and two other distinct types based on KAMMEYER, A, EGGELTE,T. A., Bos, J. D., TEUNIS-
DNA-DNA reassociation, J. Systemat. Bacteriol. SEN, M. B. M. (1999), Urocanic acid isomers are
47,420-424. good hydroxyl radical scavengers: a comparative
JOHNSON,K., ALLEMANN, R. K., WIDMER, H., BEN- study with structural analogs and with uric acid,
NER,S. A. (1993), Synthesis, structure and activity Biochim. Biophys. Acta. 1428,117-120.
of artifical, rationally designed catalytic polypep- KANE,J. F., FISKE,M. J. (1985), Regulation of pheny-
tides, Nature 365, No. 6446,530-532. lalanine ammonia lyase in Rhodotorula glutinis, J.
JONES,D. H. (1984), Phenylalanine ammonia-lyase: Bacteriol. 161,963-966.
Regulation of its induction, and its role in plant KAPAT, A., ZIMAND, G., ELAD,Y. (1998), Effect of
development, Phytochemistry 23,1349-1359. two isolates of Trichodermaharzianum on the ac-
JONES,D. T., KEIS,S. (1995), Origins and relation- tivity of hydrolytic enzymes produced by Botrytis
ships of industrial solvent producing clostridial cinerea,Physiol. Mol. Plant Pathol. 52,127-137.
strains, FEMS Microbiol. Rev. 17,223-232. KAPAT,A.,ZIMAND, G., EL AD,^. (1998), Biosynthe-
JONES,D. H., NORTHCOTE, D. H. (1984), Stability of sis of pathogenicity hydrolytic enzymes by Botry-
the complex formed between French bean Phase- tis cinerea during infection of bean leaves and in
olus vulgaris) phenylalanine lyase and its transi- vitro, Mycol. Rex 102,1017-1024.
tion state analog, Arch. Biochem. Biophys. 235, KARSTEN, W. E., VIOLA,R. E. (1991), Kinetic studies
167-177. of L-aspartase from Escherichia-coli:pH depen-
JORDAN, F. (1999), Interplay of organic and biologi- dent activity changes. Arch. Biochem. Biophys.
cal chemistry in understanding coenzyme mecha- 287,6047.
nisms: example of thiamin diphosphate-depen- KATAOKA, M., IKEMI, M., MORIKAWA,~., MIYOSHI,T.,
dent decarboxylations of 2-0x0 acids, FEBS Lett. NISHI,K. et al. (1997), Isolation and characteriza-
457,29&301. tion of D-threonine aldolase, a pyridoxal-5’-phos-
JORDAN, P. M., SPENCER, J. B. (1990), Stereospecific phate dependent enzyme from Arthrobacter sp.
manipulation of hydrogen atoms with opposite DK-38, Eur. J. Biochem. 248,385-393.
absolute orientations during the biosynthesis of KATO,Y., ASANO, Y. (1995a), Purification and prop-
the polyketide 6-methylsalicyclicacid from chiral erties of crystalline 3-methylaspartase from two
malonates in Penicillin patulum, J. Chem. SOC., facultative anaerobes, Citrobacter sp. strain YG-
Chem. Commun.,238-242. 0505 and Morganella morganii strain YG-0601,
JORDAN, P. M., SPENCER, J. B. (1991),Mechanistic and Biosci. Biotech. Biochem. 59,93-99.
stereochemical investigation of fatty acid and KATO,~., A S A N O ,(1995b),
~. 3-Methylaspartase am-
polyketide biosynthesis using chiral malonates, monia-lyase from a facultative anaerobe strain
Tetrahedron47,60154028. YG-1002, Appl. Microbiol. Biotechnol. 43, 901-
JORDAN, l? M., SPENCER, J. B., CORINA, D. L. (1986), 907.
The synthesis of chiral malonates and determina- KATO,Y., ASANO,Y. (1997), 3-Methylaspartase am-
tion of their chirality using fatty acid synthase and monia-lyase as a marker enzyme of the mesaco-
mass spectrometry, J. Chem. Soc., Chem. Com- nate pathway for (S)-glutamate fermentation in
mun., 911-913. Enterobacteriaceae, Arch. Microbiol. 168, 457-
JORDAN, K.N., O’DONOGHUE, M., CONDON, S., Co- 463.
GAN,T. M. (1996). Formation of diacetyl by cell- KATO,Y., ASANO, Y. (1998), Cloning, nucleotide se-
free extracts of Leuconostoc lactis, FEMS Micro- quencing and expression of the 3-methylaspar-
biol. Lett. 143,291-297. tase ammonia lyase gene from Citrobacter amalo-
JORDAN, F., NEMERIA, N., Guo, F. S., BABURINA, I., naticus strain YG-1002,Appl. Microbiol. Biotech-
GAO,Y. H. et al. (1998), Regulation of thiamin nol. 50,468-474.
diphosphate-dependent 2-0x0 acid decarboxylas- KAWAGUCHI, M., SYONO,K. (1996), The excessive
es by substrate and thiamin diphosphate. Mg(I1) - production of indole-3-acetic acid and its signifi-
evidence for tertiary and quaternary interactions, cance in studies of the biosynthesis of this regula-
Biochim. Biophys. Acta. 1385,287-306. tor of plant growth and development, Plant Cell
JORRIN,J., LOPEZ-VALBUENA, R., TENA,M. (1988), Physiol. 37,1043-1048.
Purification and properties of phenylalanine am- KAWASAKI, T., WATANABE, M., OHTA, H. (1995), A
5 References 157
novel enzymatic decarboxylation proceeds via a tion of the pyruvate decarboxylase from a hap-
thiol ester intermediate, Bull Chem. SOC.Jpn. 68, loid strain of Saccharomyces cerevisiae, Biol.
2017-2020. Chem. Hoppe-Seyler 377,313-317.
KAWASAKI, T., HORIMAI, E., OHTA,H. (1996a), On KILLENBERG-JABS,M., KONIG,S., EBERHARDT, I.,
the conformation of the substrate binding to the HOHMANN, S., HUBNER, G. (1997), Role of Glu51
active site during the course of enzymatic decar- for cofactor binding and catalytic activity in pyru-
boxylation, Bull. Chem. SOC.Jpn. 69,3591-3594. vate decarboxylase from yeast studied by site-di-
KAWASAKI, K., YOKOTA, A., TOMITA, F. (1996b), L- rected mutagenesis,Biochemistry 36,1900-1905.
Tryptophan production by a pyruvic acid produc- KIM,Y. S., BYUN,H. S. (1994), Purification and prop-
ing, Escherichia coli strain carrying the Entero- erties of a novel type of malonate decarboxylase
bacter aerogenes tryptophanase gene, J. Ferment. from Acinetobacter calcoaceticus, J. Biol. Chem.
Bioeng. 82,604-606. 269,29636-29641.
KAWASAKI, T., SAITO,K., OHTA,H. (1997), The mode KIM,K., COLE,P. A. (1999), Synthesis of (2S,3R)-P-
of substrate recognition of arylmalonate decar- methyltyrosine catalyzed by tyrosine phenol-
boxylases, Chem. Lett. 351-352. lyase, Bioorg. Med. Chem. Lett, 9,1205-1208.
KAWATA, Y, TAMURA, K., YANO,S., MIZOBATA, T., KIM, Y. S., K O L A ~ K U DP.YE.,, Boos, A. (1979),
NAGAI,J. et al. (1999), Purification and character- Malonyl-CoA decarboxylase from Mycobacteri-
ization of thermostable aspartase from Bacillus um tuberculosis and Pseudomonas fluorescens,
sp. YM55-1, Arch. Biochem. Biophys. 366,4046. Arch. Biochem. Biophys. 1%, 543-551.
KEHAYOVA,P. D., BOKINSKY, G. E., HUBER,J. D., KIM,S. H., KRONSTAD, J. W., ELLIS,B. E. (:1996),Pur-
JAIN,A.(1999), A caged hydrophobic inhibitor of ification and characterization of phenylalanine
carbonic anyhydrase, Org. Lett., 1,187-188. ammonia-lyase from Ustilago maydis, Phyto-
KELLARD,J. G., PALCIC, M. M., PICKARD, M.A.,VED- chemistry 43,351-357.
ERAS, J. C. (1985), Stereochemistry of lysine for- KIM,M. S.,LEE,W. K., KIM,H. Y., KIM,C., RYU,Y. W.
mation by meso-diaminopimelate decarboxylase (1998), Effect of environmental factors on flavo-
from wheat-gem, Biochemistry 24,3263-3267. no1 glycoside production and phenylalanine am-
KENNEDY, J. F., WHITE,C. A. (1990) The plant, algal, monia-lyase activity in cell suspension cultures of
and microbial polysaccharides, in: Carbohydrate Ginkgo biloba. J. Microb. Biotechnol. 8, 237-
Chemistry (KENNEDY, J. F., Ed.), pp. 22Ck261. Ox- 244.
ford: Oxford University Press KINOSHITA, S., NAKAYAMA, K. (1978). Amino acids,
KERN,D., KERN,G., NEEF,H., TITMANN, K, KILLEN- in: Economic Microbiology: Primary Products of
BERG-JABS, M. et al. (1997), How thiamine diph- Metabolism Vol. 2 (ROSE,A. H., Ed.),pp. 210-256.
osphate is activated in enzymes, Science 275, London: Academic Press.
67-70. KIRIMURA,K., SATO,T.,NAKANISHI, N., TERADA, M.,
KERN,A. D., OLIVEIRA, M. A., COFFINO, P., HACK- USAMI,S. (1997), Breeding of starch utilizing and
ERT, M. L. (1999), Structure of mammalian orni- itaconic acid producing koji molds by interspecif-
thine decarboxylase at 1.6 8, resolution: stereo- ic protoplast fusion between Aspergillus terreus
chemical implications of PLP-dependent amino and Aspergillus usamii, Appl. Microbiol. Biotech-
acid decarboxylases,Structure with Folding & De- nol. 47,127-131.
sign 7,567-581. KIRSCHNING, A., BECHTHOLD, A. F. W., ROHR,J.
KERUCHENKO, J. S., KERUCHENKO, I. D., GLADILIN, (1997), Chemical and biochemical aspects of de-
K. L., ZAITSEV, V. N., CHIRGADZE, N. Y. (1992), oxysugars and deoxysugar oligosaccharides,Top-
Purification, characterization and preliminary X- ics Curr. Chem. 188,144.
ray study of fumarase from Saccharomyces cerev- KLUGER, R., LAM,J. F., PEZACKI, J. P., YANG,C.-H.
isiae, Biochem. Biophys. Acta 1122,85-92. (1995), Diverting thiamin from catalysis to de-
KHOMUTOV,R. M., FALEEV, N. G., BELYANKIN, A. V., struction. Mechanism of fragmentation of N(1')-
KHURS,E. N., KHOMUTOV, A. R. et al. (1997), methyl-2-(l-hydroxybenzyl)thiamin, J. Am.
l-Amino-2-(4-hydroxyphenyl)ethyl phosphinic Chem. SOC.117,11383-11389.
acid - a novel substrate of tyrosine phenol lyase, KNIGHT, R. L.,LEEPER, F. J. (1998), Comparison of
Bioorganicheskaya Khimiya 23,919-921. chiral thiazolium and triazolium salts as asym-
KHRISTOFOROV, R. R., SUKHAREVA, B. S., DIXON, H. metric catalysts for the benzoin condensation, J.
B. F., SPARKES, M. J., KRASNOV, V. F?, BUKRINA, I. Chem. SOC.,Perkin Trans. 1 ., 1891-1893.
M. (1995),The interaction of glutamate decarbox- KNOX,c.,SASS, E., NEUPERT, W., PINES,0. (1998),
ylase from Escherichia coli with substrate analogs Import into mitochondria, folding and retrograde
modified at C-3 and C-4, Biochem. Mol. Biol. Znt. movement of fumarase in yeast, J. Biol. Chem.
36,77-85. 273,25587-25593.
KILLENBERG-JABS, M., KONIG,S., HOHMANN, S., KOBAYASHI, K., YAMANISHI, T., TUBOI,S. (1981),
HUBNER, G. (1996), Purification and characteriza- Physiochemical, catalytic and immunochemical
158 2 Lyases
properties of fumarases crystallized separately SON, D. W., KONIG,W. et al. (1993), Pyruvate de-
from mitochondria1 and cystolic fractions of rat carboxylase - a new enzyme for the production of
liver,J. Biochem. 89,1923-1931. acyloins by biotransformation, J. Chem. SOC.,
KOGA,J. (1995), Structure and function of indolepy- Chem. Commun.,1993,341-343.
ruvate decarboxylase, a key enzyme in indole-3- KYRIAKIDIS, D. A., PANAGIOTIDIS, C. A., GEORGAT-
acetic-acid biosynthesis, Biochim. Biophys. Acta. SOS, J. G. (1983), Ornithine decarboxylase (germi-
l249,l-13. nated barley-seeds), Methods Enzymol. 94, 162-
KOGA,J., ADACHI, T., HIDAKA, H. (1991), Molecular 166.
cloning of the gene for indolepyruvate decarbox- LABROU, N. E., CLONIS, Y. D. (1995), Biomimetic
ylase from Enterobacter cloacae, Mol. Gen. Genet. dye-ligands for oxalate recognizing enzymes -
22410-16. studies with oxlate oxidase and oxalate decarbox-
KOGA,J., ADACHI, T., HIDAKA, H. (1992), Purifica- ylase, J. Biotechnol. 40,59-70.
tion and characterization of indolepyruvate de- LABROU, N. E., CLONIS, Y. D. (1999), Oxaloacetate
carboxylase - a novel enzyme for indole-3-acetic- decarboxylase from Pseudomonas stutter? Purifi-
acid biosynthesis in Enterobacter cloacae, J. Biol. cation and characterization, Arch. Biochem. Bi-
Chem. 267,15823-15828. ophys. 365,17-24.
KOGA, J., SYONO,K., ICHIKAWA, T., ADACHI, T. LAI,M. C., TRAXLER, R. W. (1994), A coupled two
(1994), Involvement of L-tryptophan aminotrans- stage continuous fermentation for solvent pro-
ferase in indole-3-acetic-acid biosynthesis in En- duction by Clostridium acetobutylicurn, Enzyme
terobacter cloacae, Biochim. Biophys. Acta. 1209, Microb. Technol. 16,1021-1025.
241-247. LANDRO, J. A., GERLT,J.A., KOZARICH, J. W., Koo, C.
KOK,J. (1996) Inducible gene expression and envi- W., SHAH, V. (1994),The role of lysine 166 in the
ronmentally regulated genes in lactic acid bacte- mechanism of mandelate racemase from Pseudo-
ria, A . Van Leeuwenhoek Znt. J. Gen. Mol. Micro- monas putida - mechanistic and crystallographic
biol. 70,129-145. evidence for stereospecific alkylation by (R)-a-
K O L A ~ K U D YP., E., POULOSE, A. J., KIM, Y. S. phenylglycidate Biochemistry 33,635-643.
(1981), Malonyl-CoA from avian, mammalian LANGER, M., LIEBER,A., RETEY,J. (1994a), Histidine
and microbial sources, Methods Enzymol. 71, ammonia-lyasemutant-S143Cis post-translation-
150-163. ally converted into fully active wild-type enzyme
KOLB,S., SEELINGER, S., SPRINGER, N., LUDWIG, W., - evidence for ~ e r i n eto
l ~be~ the precursor of ac-
SCHINK, B. (1998), The fermenting bacterium tive-site dehydroalanine, Biochemistry 33,
Malonomonas rubra is phylogenetically related 14034-1 4038.
to the sulfur reducing bacteria and contains a c- LANGER, M., RECK,G., REED,J., RETEY, J. (1994b),
type cytochrome similar to those of sulfur and Identification of serinel43 as the most likely pre-
sulfate reducers, System. Appl. Microbiol. 21, cursor of dehydroalanine in the active-site of his-
340-345.. tidine ammonia-lyase - a study of the overex-
KONIG,S. (1998), Subunit structure, function and or- pressed enzyme by site-directed mutagenesis, Bi-
ganization of pyruvate decarboxylases from vari- ochemistry 33,6462-6467.
ous organisms, Biochim. Biophys. Acta. l385, LANGER, M., PAULING, A., RETEY, J. (1995),The role
271-286. of dehydroalanine in catalysis by histidine ammo-
KONIG,S., SVERGUN, D. I., VOLKOV, V. V., FEIGIN, L. nia lyase, Angew. Chem. Znt. Edn. Engl. 34,1464-
A,, KOCH,M. H. J. (1998),Small-angleX-ray solu- 1465.
tion-scattering studies on ligand-induced subunit LANGER, B., STARCK, J., LANGER, M., RETEY,J.
interactions of the thiamine diphosphate depen- (1997a), Formation of the Michaelis complex
dent enzyme pyruvate decarboxylase from differ- without involvement of the prosthetic group de-
ent organisms,Biochemistry 37,5329-5334. hydroalanine of histidine ammonialyase, Bioorg.
KOSUGE,T., UMEHARA, K., HOSHINO,T. (1998), Clon- Med. Chem. Lett. 7,1077-1082.
ing and sequence analysis of fumarase and super- LANGER,B.,ROTHER,D.,RETEY, J. (1997b), Identifi-
oxide dismutase genes from an extreme thermo- cation of essential amino acids in phenylalanine
phile Thermus thermophilus HB27,J. Ferment.Bi- ammonia-lyaseby site-directed mutagenesis,Bio-
oeng. 86,125-129. chemistry 36,10867-10871.
KRAUTWURST, H., BAZAES, S., GONZALAE, F. D., JA- LAUBLE, H., KENNEDY, M. C., BEINERT, H.,STOUT, C.
BALQUINTO, A. M., FREY,P. A., CARDEMIL, E. D. (1994), Crystal structures of aconitase with
(1998), The strongly conserved lysine of Saccha- trans-aconitate and nitrocitrate bound, J. Mol.
romyces cerevisiae phosphoenolpyruvate carbox- Biol. 237,437451.
ykinase is essential for phosphoryl transfer, Bio- LAUBLE, H., KENNEDY,M. C., EMFTAGE, M. H., BEI-
chemistry 37,6295-6302. NERT, H., STOUT, c . D. (1996),The reaction of flu-
KREN,V., CROUT,D. H. G., DALTON, H., HUTCHIN- orocitrate with aconitase and the crystal structure
5 References 159
of the enzyme-inhibitor complex, Proc. Natl. Ac- tryptophan 412 in the substrate activation path-
ad. Sci. USA.93,13699-13703. way of yeast pyruvate decarboxylase, Biochemis-
LEE,K.-L., RAMALINGAM, K., SON,J.-K., WOODARD, try 38,10004-10012.
R. W. (1989), A highly efficient and large scale LIM,H. W., PARK,S. S., LIM,C. J. (1997), Purification
synthesis of (2S,3S)-[2,3-ZH2]-and(2S,3R)-[3-*H]- and properties of phenylalanine lyase from leaf
aspartic acids via an immobilized aspartase con- mustard, Molecules Cells 7,715-720.
taining microbial cell system, J. Org. Chem. 54, LIM,H. W., SA,J. H., PARK,S. S., LIM,C. J. (1998), A
3195-3198. second form of phenylalanine ammonia lyase
LEE,S. G.,Ro,H. S.,HONG,S. P.,KIM,E.H.,SUNG,M. from leaf mustard, Molecules Cells 8,343-349.
H. (1996a), Production of L-DOPA by thermo- LIMBERG, G., THIEM, J. (1996), Synthesis of modified
stable tyrosine phenol-lyase of a thermophilic aldonic acids and studies of their substrate effi-
Symbiobacterium species overexpressed in re- ciency for dihydroxy acid dehydratase, Aust. J.
combinant Escherichia coli,J. Microbiol. Biotech- Chem. 49,349-356.
nol. 6,98-102. LINDQUIST, Y., SCHNEIDER, G. (1993), Thiamin diph-
LEE,S.-G., HONG,S. P., SUNG,M. H. (1996b), Remov- osphate dependent enzymes - transketolase, py-
al and bioconversion of phenol in wastewater by ruvate oxidase and pyruvate decarboxylase, Curr.
a thermostable p-tyrosinase, Enzyme Microb. Opin. Struct. Biol. 3,896-901.
Technol. 19,374-377. LINDQUIST, L., SCHWEDA, K. H., REEVES, l? R., LIND-
LEE, S.-G., HONG,S.-P., (301, Y.-H., CHUNG, Y.-J., BERG, A. A. (1994), In vitro synthesis of CDP-D-
SUNG,M.-H. (1997), Thermostable tyrosine phe- abequose using Salmonella enzymes of cloned rfb
nol-lyase of Symbiobacterium sp. SC-1:gene clon- genes: Production of CDP-6-deoxy-~-xylo-4-hex-
ing, structure determination and overproduction ulose, CDP-3,6-dideoxy-~-xylo-4-hexulose and
in Escherichia coli, Protein Expr. Purif: 11, CDP-3,6-dideoxy-~-galactose and isolation by
263-270. HPLC, Eur. J. Biochem. 225,863-872.
LEE,S.-G., HONG,S.-F’., SUNG,M.-H. (1999a), Devel- LINDSKOG, S. (1997), Structure and mechanism of
opment of an enzymatic system for the produc- carbonic anhydrase, Pharmacol. Ther. 74,l-20.
tion of dopamine from catechol, pyruvate and LIU, H. W., THORSON, J. S. (1994), Pathways and
ammonia, Enzyme Microb. Technol. 25,298-302. mechanisms in the biogenesis of novel deoxysug-
LEE,S.-G.,HONG,S.-P.,KWAK, M. S., ESAKI,N., SUNG, ars by bacteria, Ann. Rev. Microbiol. 48,223-256.
M.-H. (1999b), Characterization of thermostable LLOYD-GEORGE, I., CHANG,T. M. S. (1993), Free and
tyrosine phenol-lyasefrom an symbiotic obligato- microencapsulated Envinia herbicola for the pro-
ry thermophile,Syrnbiobacterium sp. SC-1,J. Bio- duction of tyrosine, Biomat. Artif: Cells Immobil.
chem. Mol. Biol. 32,480485. Biotechnol. 21,323-333.
LEE,T.T.,WORBY, C., BAO,Z. Q., DIXON, J. E., COLE- LLOYD-GEORGE, I., CHANG, T. M. S. (1995), Charac-
MAN, R. F. (1999c), Hisrn and His141are critical terization of free and alginate-polylysine-alginate
contributors to the intersubunit catalytic site of microencapsulated Envinia herbicola for the con-
adenylosuccinate lyase of Bacillus subtilis, Bio- version of ammonia, pyruvate, and phenol into L-
chemistry 38,22-32. tyrosine, Biotechnol. Bioeng. 48,706-714.
LEHOU,I. E., MITRA,B. (1999), (S)-Mandelate dehy- Lo, S. F., MILLER,V.l?, LEI,Y.Y., THORSON, J. S., LIU,
drogenase from Pseudomonas putida: Mechanis- H.-W., SCHOTTEL, J. L. (1994), CDP-6-deo~y-A~.~-
tic studies with alternative substrates and pH and glucoseen reductase from Yersinia pseudotuber-
kinetic isotope effects, Biochemistry 38, culosis,J. Bacteriol. 176,460-468.
5836-5848. LOBELL, M., CROUT,D. H. G. (19%a), New insight
LEMONNIER, M., LANE,D. (1998), Expression of the into the pyruvate decarboxylase-catalyzedforma-
second lysine decarboxylase gene of Escherichia tion of lactaldehyde from H-D exchange experi-
coli, Microbiology (UK) 144,751-760. ments: A “water proof” active site, J. Chem. SOC.,
LENZ,H., WUNDERWALD, P., EGGERER, H. (1976), Perkin Trans. 1,1577-1581.
Partial purification and some properties of oxa- LOBELL, M., CROUT,D. H. G. (1996b), Pyruvate de-
lacetase, Eur. J. Biochem. 65,225-236. carboxy1ase:A molecular modeling study of pyru-
LEPINIEC, L., VIDAL, J., CHOLLET, R., GADAL, P., CRE- vate decarboxylation and acyloin formation, J.
TIN,C. (1994), Phosphoenolpyruvate carboxylase Am. Chem. SOC.118,1867-1873.
- Structure, regulation and evolution, Plant Sci. LOEWUS, M. W., LOEWUS, F. A., BRILLINGER, G. U.,
99,111-124. OTSUKA,H., FLOSS,H.G. (1980), Stereochemistry
LEVIN, L., FORCHIASSIN, F. (1998), Culture conditions of the L-myo-inositol-1-phosphate synthase reac-
for the production of pectinolytic enzymes by the tion,J. Biol. Chem. 255,1710-1712.
white-rot fungus Trametes trogii on a laboratory LOUWRIER, S., OSTENDORF, M., BOOM.A., HIEM-
scale, Acta Biotechnol. 18,157-166. STRA, H., SPECKAMP, W. N. (19%), Studies towards
LI, H., JORDAN, F. (1999), Effects of substitution of the synthesis of (+)-ptilomycalin A, stereoselec-
160 2 Lyases
tive N-acyliminium ion coupling reactions to protozoan diseases by inhibitors of ornithine de-
enantiopure C-2 substituted lactams, Tetrahedron carboxylase,Methods Enzymol. 94,209-213.
52,2603-2628. MERMEISTEIN, L. D., PAPOUTSAKIS, E. T., PETERSEN,
Lu, G. G., DOBRITZSCH, D., KONIG,S., SCHNEIDER, G. D. J., BENNEIT,G. N. (1993), Metabolic engineer-
(1997), Novel tetramer assembly of pyruvate de- ing of Clostridium acetobutylicum ATCC-824 for
carboxylase from brewers' yeast observed in a increased solvent production by enhancement of
new crystal form, FEBS Lett. 403,249-253. acetone formation enzyme activities using a syn-
LUNG,H. Y., BAETZ, A. L., PECK,A. B. (1994),Molec- thetic acetone operon, Biotechnol. Bioeng. 42,
ular cloning, DNA sequence and gene expression 1053-1060.
of the oxalyl-coenzyme A decarboxylase gene, MIALL,L. M., (1978), Organic acids, in: Economic
oxc from the bacterium Oxalobacter formigenes, Microbiology. Primary Products of Metabolism (-
J. Bacteriol. 176,2468-2472. ROSE,A. H., Ed.), pp. 1-55. London: Academic
LUTHY, J., RETEY,J., ARIGONI, D. (1969). Preparation Press.
and detection of chiral methyl groups,Nature 221, MICHIELSEN, M. J. F., MEIJER,E.A., WIJFFELS,R. H.,
1213-1215. TRAMPER, J., BEEFTINK, H. H. (1998), Kinetics of
LYNSTRAD, M., GRASDALEN, H. (1993),A new air lift D-malate production by permeabilized Pseudo-
bioreactor used in P-31-NMR studies of itaconic monas pseudoaligenes, Enzyme Microb. Technol.
acid producing Aspergillus terreus,J.Biochem. Bi- 22,621-628.
ophys. Methods 27,105-116. MICKLEFIELD, J., HARRIS,K. J., GROGER, S., MOCEK,
MALASHKEVICH, V. N., BURKHARD, P., DOMINICI,I?, U., HILBI,H. et al. (1995), Stereochemical course
MOORE,P. S., VOLTATTORNI, C. B., JANSONIUS, J. N. of malonate decarboxylation in Malonomonas
(1999), Preliminary X-ray analysis of a new crystal rubra,J.Am. Chem. SOC.117,1153-1154.
form of recombinant pig kidney DOPA decarbox- MILLER, B. G., TRAUT,T.W., WOLFENDEN, R. (1998),
ylase, Acta CrystallographicaD 55,568-570. Effects of substrate binding determinants in the
MALASHKEVICH, V. N., STROP,I?, KELLER, J. W., JAN- transition state for orotidine 5 '-monophosphate
SONIUS, J. N., TONEY, M. D. (1999), Crystal struc- decarboxylase,Bioorg. Chem.26,283-288.
tures of dialkylglycine decarboxylase inhibitor MINAMISAWA, K., OGAWA, K.,FUKUHARA, H., KOGA,
complexes,J. Mol. Biol. 294,193-200. J. (1996), Indolepyruvate pathway for indole-3-
MA", J. (1987),Secondary Metabolism, pp. 173-190. acetic acid biosynthesis in Bradyrhizobium elka-
Oxford: Oxford Science Publications. nii, Plant Cell Physiol. 37,449-453.
MA", J., DAVIDSON, R. S., HOBBS, J. B., BANTHORPE, MITCHELL, J. L. A. (1983), Ornithine decarboxylase
D. V., HARBOURNE, J. B. (1994), Natural Products: and the ornithine decarboxylase-modifying pro-
Their Chemistry and Biological Significance, pp. tein of Physarum polycephalum, Methods Enzy-
372-375. Longman Scientific and Technical. mol. 94,140-146.
MANULIS,S., HAVIVCHESNER, A., BRANDL,M. T., MIYAMOTO, K., OHTA,H. (1990), Enzyme mediated
LINDOW, S. E., BARASH, I. (1998), Differential in- asymmetric decarboxylation of disubstituted mal-
volvement of indole-3-acetic acid biosynthetic onic acids, J.Am. Chem. SOC.112,40774078.
pathways in pathogenicity and epiphytic fitness MIYAMOTO, K., OHTA,H. (1991),Asymmetric decar-
of Erwinia herbicola pv, gypsophilae, Mol. Plant boxylation of disubstituted malonic acid by Alcal-
Microbe Interact. 11,634-642. igenes bronchisepticus KU 1201, Biocatalysis 5,
MARLETTA, M. A., CHEUNG, Y. F., WALSH,C. (1982), 49-60.
Stereochemical studies on the hydration of MIYAMOTO, K., OHTA, H. (1992), Purification and
monofluorofumarate and 2, 3-difluorofumarate properties of a novel arylmalonate decarboxylase
by fumarase, Biochemistry 21,2637-2644. from Alcaligenes bronchisepticus KU 1201,Eur.J.
MAYANS, O., SCOTT,M., CONNERTON, I., GRAVESEN, Biochem. 210,475481.
T., BENEN, J. et al. (1997),%0 crystal structures of MIYAMOTO, K., TSUCHIYA, S., OHTA,H. (1992), Mi-
pectin lyase A from Aspergillus reveal a pH driv- crobial asymmetric decarboxylation of fluorine
en conformational change and striking diver- containing arylmalonic acid derivatives, J. Fluo-
gence in the substrate-binding clefts of pectin and rine Chem. 59,225-232.
pectate lyases,Structure 5,677-689. MIZOBATA,T., FLJJIOKA,T., YAMASAKI, F., HIDAKA,M.
MBWAGA, A. M., MENKE,G., GROSSMANN, F. (1997), (1998), Purification and characterization of a ther-
Investigations on the activity of cell wall-degrad- mostable class I1 fumarase from Thermus thermo-
ing enzymes in young wheat plants after infection philus, Arch. Biochem. Biophys. 35549-55.
with Pseudocercosporella herpotrichoides (Fron) MOCHIZUKI, N., HIRAMATSU, S., SUGAI,T.,OHTA,H.,
Deighton, J. Phytopathol. 145,123-130. MORITA,H., ITOKAWA, H. (1995), Reductive con-
MCCANN,I? P., BACCHI,C. J., HANSON, W. L., NA- version of carbonyl compounds by yeast. 2. Im-
THAN, H. C., HUTNER, S. H., SJOERDSMA, A. proved conditions for the production and charac-
(1983), Methods for the study of the treatment of terization of l-arylpropane-l,2-diols and related
5 References 161
compounds, Biosci. Biotechnol. Biochem. 59, MURASE,S., TAKAGI,J. S., HIGASHI, Y., IMAISHI,H.,
2282-2291. YUMOTO,N., TOKUSHIGE (1991), Activation of
MOHRIG,J. R., MOERKE,K. A., CLOUTIER,D. L., aspartase by side-directed mutagenesis,Biochem.
LANE,B. D., PERSON, E. C., ONASCH,T. B. (1995), Biophys. Res. Commun. 177,414-419.
Importance of historical contingency in the ster- MURASE, s.,YUMOTO,N. (1993), Characterization of
eochemistry of hydratase-dehydratase enzymes, 3 types of aspartase activated by site- directed
Science 269, No. 5223,527-529. mutagenesis, limited proteolysis, and acetylation.
MOMANY, C., ERNST,S., GHOSH,R., CHANG, N. L., J. Biochem. 114,735-739.
HACKERT, M. L. (1995), Crystallographic struc- MUSSONS, M. L., RAPOSO,c., DE LA TORRE,M. F.,
ture of a PLP dependent ornithine decarboxylase MORAN,J. R., CABALLERO, M. C. (1999), Di-
from Lactobacillus 30a to 3.0 A resolutionJ Mol. benz[c,h]acridine receptors for dibutylmalonic
Biol. 252,643-655. acid, Tetrahedron,55,40774094.
MONNET,C., CORRIEU,G. (1998), Selection and NAGAI,T., HAMADA, M., KAI, N., TANOUE, Y., NA-
properties of Lactobacillus mutants producing a- GAYAMA, F. (1996), Distribution of aromatic L-
acetolactate, J. Dairy Sci. 81,2096-2102. amino acid decarboxylase in tissues of skipjack
MONNET, C, SCHMITT, P, DIVIES,C. (1994), Diacetyl tuna using L-DOPA as the substrate, J. Fish. Biol.
production in milk by an a-acetolactic acid accu- 48,1014-1017.
mulating strain of Lactococcus lactk ssp. lactis bi- NAGASAWA,T., UTAGAWA,T., GOTO,J., KIM,C. J., TA-
ovar diacetylactis,J. Dairy Sci. 77,2916-2924. NI,Y.et al. (1981),Syntheses of L-tyrosine-related
MONTGOMERY, J. A., ROSIERS,C. D., BRUNENGRA- amino-acids by tyrosine phenol- lyase of Citro-
BER,H. (1992), Biosynthesis and characterization bacter intermedius, Eur. J. Biochem. 117,3340.
of 3-hydroxyaikan-2-ones and 2,3-alkanediols - NAIDU,G. S. N., PANDA, T. (1998), Production of pec-
potential products of aldehyde metabolism, Biol. tolytic enzymes - a review, Bioproc. Eng. 19,355-
Mass. Spectr. 21,242-248. 361.
MOORE,P. S., DOMINICI,P., VOLTATTORNI, C. B. NAIR,R.V., GREEN,E. M., WATSON, D. E., BENNETT,
(1996) Cloning and expression of pig kidney DO- G. N., PAPOUTSAKIS, E. T. (1999), Regulation of
PA decarboxylase: Comparison of the naturally the sol locus genes for butanol and acetone for-
occumng and recombinant enzymes, Biochem. J. mation in Clostridium acetobutylicum ATCC 824
315,249-256. by a putative transcriptional represssor,J. Bacteri-
MORGAN, D. M. L. (1999), Polyamines, an overview, 01. 181,319-330.
Mol. Biotechnol. 11,229-250. NAUNDORF, A., KLAFFKE,W. (1996), Substrate speci-
MORENO-ARRIBAS, V., LONVAUD-FUNEL, A. (1999), ficity of native dTDP-~-glucose-4,6-dehydratase:
Tyrosine decarboxylase activity of Lactobacillus Chemo-enzymatic syntheses of artificial and nat-
brevis IOEB-9809 isolated from wine and L. bre- urally occurring deoxy sugars, Curb. Res. 285,
vis ATCC-367,FEMS Microbiol. Lett. 180,5540. 141-150.
MORRIS,D. R., BOEKER,E. A. (1983), Biosynthetic NELSESTUEN, G. L., KIRKWOOD, S. (1971),The mech-
and biodegradative ornithine and arginine decar- anism of action of the enzyme uridine diphos-
boxylases from Escherichia coli, Methods Enzy- phogiucose 4-epimerase,J. Biol. Chem. 246,7533.
mol. 94,125-134. NICHOLSON, R. L., HAMMERSCHMIDT, R. (1992), Phe-
MOVAHEDI, S., HEALE,J. B. (1990), The roles of nolic compounds and their role in disease resis-
aspartic proteinase and endo-pectin lyase en- tance, Ann. Rev. Phytopathol. 30,369-389.
zymes in the primary stages of infection and path- NIEDEND,B. R., PARKER,S. R., STIERLE,D. B.,
ogenesis of various host tissues by different iso- STIERLE,A. A. (1999), First fungal aromatic L-
lates of Botrytis cinerea pers ex pers, Physiol. Mol amino acid decarboxylase from a paclitaxel pro-
Plant. Pathol. 36,303-324. ducing Penicillium raistrickii, Mycologia 91,
MUGURUMA, C. (1999),Ab initio MO study on the cat- 619-626.
alytic mechanism in the active site of carbonic an- NIKAIDOU, N., NAGANUMA, T., KAMIO,Y., IZAKI, K.
hydrase, THEOCHEM,J. Mol. Struct.462,439-452. (1995),Production, purification, and properties of
MULLER,E. H., RICHARDS,E. J., NORBECK,J., a pectin lyase from Pseudomonas marginalis
BYRNE, K. L., KARLSSON, K. A. et al. (1999),Thia- N6301, Biosci. Biotechnol. Biochem. 59,323-324.
mine repression and pyruvate decarboxylase au- NIKOLOVA, P., WARD,0. P. (1991), Production of L-
toregulation independently control the expres- phenylacetyl carbinol by biotransformation -
sion of the Saccharomyces cerevbiae PDC5 gene, product and by-product formation and activities
FEBS Lett. 449,245-250. of the key enzymes in wild-type and ADH isoen-
MUNIER, R. L., BOMPEIX, G. (1985), Inhibition of the zyme mutants of Saccharomyces cerevisiae, Bio-
L-phenylalanine ammonia-lyase from Rhodoto- technol. Bioeng. 38,493-498.
rula glutinis with N-substituted-phenylalanines, NUIRY,I. I., HERMES, J. D., WEISS,P. M., CHEN,C-Y.,
C. R. I11 300,203-206. COOK,P. F. (1984), Kinetic mechanism and loca-
162 2 Lyases
tion of rate-determinig steps for aspartase from OYAMA, K. (1992), The industrial production of
Hafnia alvei, Biochemistry 23,5168-5175. aspartame, in: Chirality in Industry (COLLINS, A.
OBA,K., URITANI, I. (1982), Pyruvate decarboxylase N., SHELDRAKE, G. N., CROSBY J., Eds), pp. 237-
from sweet-potato roots, Methods Enzymol. 90, 247. Chichester: John Wiley & Sons.
528-532. PALMER, D. R. J., GERLT,J. A. (1996), Evolution of
OGAWA, H., FUJIOKA,M. (1999), Is threonine aldo- enzymatic activities: multiple pathways for gener-
lase identical to serine hydroxymethyltransfe- ating and partitioning a common enolic interme-
rase?, Seikagaki 71,1145-1152. daite by glucarate dehydratase from Pseudomo-
OGINO,K., TAMIYA, H., KIMURA,~., AZUMA, H., TA- nus putida, J. Am. Chem. SOC. 118,10323-10324.
GAKI,W. (1996), cis-Diamines as active catalysts PALMER, D. R. J., WIECZOREK, S. J., HUBBARD, B. K.,
fro the decarboxylation of oxalacetate, J. Chem. MRACHKO, G. T., GERLT,J. A. (1997), Importance
Soc., Perkin Trans II, 979-984. of mechanistic imperatives in enzyme-catalyzed
O’HARE,M. C., DOONAN, S. (1985), Purification and j3-elimination reactions: Stereochemical conse-
structural comparisons of the cytosolic and mito- quences of the dehydration reactions catalyzed
chondrial isoenzymes of fumarase from pig liver, by D-galactonate dehydratase from Escherichia
Biochim. Biophys. Acta 827,127-134. coli and D-glUCarate dehydratase from Pseudo-
OHBA,H., YASUDA, S., HIROSUE,H., YAMASAKI, N. monas putida,J. Am. Chem. SOC.119,9580-9581.
(1995), Improvement of the thermostability of PALMER,D. R. J., HUBBARD, B. K., GERLT,J. A.
pyruvate decarboxylase by modification with an (1998), Evolution of enzymatic activities in the
amylose derivative, Biosci. Biotech. Biochem. 59, enolase superfamily: Partitioning of reactive
1581-1583. intermediates by (D)-glucarate dehydratase from
OHTA,H. (1997), Enzyme mediated enantioselective Pseudomonas putida, Biochemistry 37, 1435&
protonation of enolates in aqueous medium, Bull. 14357.
Chem. SOC.Jpn. 10,2895-2911. PARK, Y. S., ITIDA, M., OHTA,N., OKABE, M. (1994),
OKABE, M., OHTA,N., PARK,^. S. (1993), Itaconic ac- Itaconic acid production using an airlift reactor in
id production in an airlift bioreactor using a mod- repeated batch culture of Aspergillus terreus, J.
ified draft tube, J. Ferment. Bioeng. 76,117-122. Ferment. Bioeng. 71,329-333.
OLIVER,A. L., RODDICK, F. A., ANDERSON, B. N. PARK,S. H., XING,R. Y., WHITMAN, W. (1995), Non-
(1997), Cleaner production of phenylacetylcarbi- enzymatic acetolactate oxidation to diacetyl by
no1 by yeast through productivity improvements flavin, nicotinamide and quinone coenzymes, Bi-
and waste minimization, Pure Appl. Chem. 69, ochim. Biophys. Acta. 1245,366370.
2371-2385. PARK,H.S., LEE,J. Y., KIM,H. S. (1998) Production of
ORCZYK,A., HIPSKIND,J., DE NEERGAARD, E., L-DOPA (3-(3,4-dihydroxyphenyl)-~-alanine)
GOLDBROUGH, P., NICHOLSON (1996), Stimulation from benzene using a hybrid pathway, Biotechnol.
of phenylalanine ammonia lyase in Sorghum in Bioeng. 58,339-343.
response to innoculation with Bipolaris maydis, PARKER, A. R., MOORE,J. A., SCHWAB, J. M., DAVIS-
Physiol. Mol. Plant. Pathol. 4 8 , 5 5 4 . SON,V. J. (1999, Escherichia coli imidazoleglyce-
ORR,G. R., GOULD,S. J. (1982), Stereochemistry of rol phosphate dehydratase: Spectroscopic charac-
the bacterial ornithine, lysine and arginine decar- terization of the enzyme product and the steric
boxylase reactions, Tetrahedron Lett. 23, 3139- course of the reaction, J. Am. Chem. SOC. 117,
3142. 10605-10613.
ORTEGA, J. (1996), Pectolytic enzymes produced by PARKS,E. H.,ERNsT,S. R.,HAMLIN, R., XUONG,N. H.
the phytopathogenic fungus Colletotrichum gloe- (1985), Structure determination of histidine de-
osporioides, Texas J. Sci. 48,123-128. carboxylase from Lactobacillus 30a at 3.0 A reso-
OSTERMAN, A. L., BROOKS, H. B., RIZO,J., PHILLIPS, lution, J. Mol. Biol. 182,455465.
M. A. (1997), Role of Arg-277 in the binding of PESCHKE,~. M., SACHS, M. M. (1993), Multiple pyru-
pyridoxal 5 ‘-phosphate to Trypanosoma brucei vate decarboxylase genes in maize are induced by
ornithine decarboxylase, Biochemistry 36, 4558- hypoxia, Mol. Gen. Genet. 240,26212.
4567. PETERSEN, D. J., BENNEIT,G. N. (1990), Purification
OSTERMAN, A. L., BROOKS, H. B., JACKSON, L., AB- of acetoacetate decarboxylase from Clostridium
BOIT,J. J., PHILLIPS, M. A. (1999), Lysine-69 plays acetobutylicium ATCC-824 and cloning of the ac-
a key role in catalysis by ornithine decarboxylase etoacetate decarboxylase gene in Escherichia co-
through acceleration of the Schiff base formation, li, Appl. Environ. Microbiol. 56,3491-3498.
decarboxylation and product release steps, Bio- PETERSEN, D. J., VAN DER LEYDEN, J., BENNEIT,G. N.
chemistry 38,11814-11826. (1993), Sequence and arrangement of genes en-
OTHS,P. J.,MAYER, R. M.,FLoss,H. G. (1990) Stereo- coding the enzymes of the acetone production
chemistry and mechanism of the GDP-mannose pathway of Clostridium acetobutylicum ATCC-
dehydratase reaction, Curb. Res. 198,91-100. 824, Gene l23,93-97.
5 References 163
F'ETRUCCIOLI,M., PmqV., FEDERICI, F. (1999), Itacon- PLETNEV, S. V., ISUPOV, M. N., DAUTER, Z., WILSON,
ic acid production by Aspergillus terreus on raw K. S., FALEEV, N. G. et al. (1996), Purification and
starchy materials, Lett.Appl. Microbiol.28,309-312. crystals of tyrosine phenol-lyase from Erwinia
PHALIP,V., MONNET, C., SCHMI'IT, P., RENAULT, P., herbicola, Biochem. Mol. Biol. Int. 38,3742,
GODON, J. J., DIVES, C. (1994), Purification and POCHLAUER, P. (1998), Syntheses of homochiral cya-
properties of the cr-acetolactate decarboxylase nohydrins in an industrial environment: hydroxy
from Lactococcus lactis ssp. lactis NCDO-2118, nitrile lyases offer new options, Chimica Oggi
FEBS Lett. 351,95-99. (Chemistry Today) 16,15-19.
PHILLIPS, R. S. (1989), Mechanism of tryptophan in- POHL,M., MESCH, K., RODENBROCK,A., KULA,M. R.
dole-lyase: Insights from pre-stady state kinetics (1995), Stability investigations on the pyruvate
and substrate and solvent isotope effects, J. Am. decarboxylase from Zymomonas mobilis, Bio-
Chem. SOC. 111,727-730. technol.Appl. Biochem. 22,95-105.
PHILLIPS, R. S., VON TERSCH,R. L., SECUNDO, F. POLAK, J., BRZESKI, H. (1990), Isolation of the tyro-
(1997), Effects of tyrosine ring fluorination on sine phenol-lyase gene from Citrobacter freundii,
rates and equilibria of formation of intermediates Biotechnol. Lett. 12,805-810.
in the reactions of carbon-carbon lyases, Eur. J. POLLARD,J. R., RICHARDSON, S., AKHTAR, M., LAS-
Biochem. 244,658-663. RY, P., NEAL,T. et al. (1999), Mechanism of 3-
PIATIGORSKY, J., WISTOW, G. (1991) The recruitment methylaspartase probed using deuterium and sol-
of crystallins: new functions precede gene dupli- vent isotope effects and active-site directed re-
cation, Science 252,107S1079. agents: Identification of an essential cysteine res-
PICCIRILLI, J. A., ROZZELL, Jr., J. D., BENNER, S. A. idue, Bioorg. Med. Chem. 7,949-975.
(1987), The stereospecificity of oxaloacetate de- PORTER, D. T. J., BRIGHT, H. J. (1980), 3-Carbanionic
carboxylase: A stereochemical imperative?, J. substrate analogs bind very tightly to fumarase
Am. Chem. SOC.109,8084-8085. and aspartase, J. Biol. Chem. 255,47724780.
PICKERSGILL, R., JENKINS, J., HARRIS, G., NASSER, W., POUPON, A., JEBAI,F., LABESSE, G., GROS,F., THI-
ROBERT-BAUDOUY, J. (1994),The structure of Ba- BAULT, J. et al. (1999), Structure modeling and site
cillus subtilis pectate lyase in complex with cal- directed mutagenesis of the rat aromatic L-amino
cium Struct. Biol. l,717-723. acid pyridoxal 5 '-phosphate dependent decar-
PICKERSGILL, R.,SMITH,D.,WORBOYS,K., JENKINS, J. boxylase: A functional study, Proteins Struct.
(1998), Crystal structure of polygalacturonase Funct. Genet. 37,191-203.
from Erwinia carotovora ssp. carotovora, J. Biol. PRONK,J. T., STEENSMA, H. Y., VAN DIJKEN,J. P.
Chem 273,24660-24664. (1996), Pyruvate metabolism in Saccharomyces
PIEPER, P. A., GUO,Z., LIU,W.-W. (1995), Mechanis- cerevisiae, Yeast 12,1607-1633.
tic studies of the biosynthesis of 3,6-dideoxy sug- PROSEN, E., WARD, 0.P. (1994), Optimization of the
ars: stereochemical analysis of C-3 deoxygena- reaction conditions for production OF (S)-(-)-2-
tion, J. Am. Chem. SOC.117,5158-5159. hydroxypropiophenone by Acinetobacter calcoa-
PIEPER,P. A., YANG,D. Y., ZHOU,H. Q., LIU,H.-W. ceticus,J. Ind. Microbiol. 13,287-291.
(1997), 3-deoxy-3-fluoropyridoxamine5 '-phos- QIAN,M. Z., EARNHARDT, J. N., WADHWA, N. R., Tu,
phate: Synthesis and chemical and biological C. K., LAIPIS,P. J., SILVERMAN, D. N. (1999), Pro-
properties of a coenzyme B6 analog,J. Am. Chem. ton transfer to residues of basic pK, during catal-
SOC. 119,1809-1817. ysis by carbonic anhydrase, Biochim. Biophys. Ac-
PILNIK, W., VORAGEN, A. G. J. (1992), Gelling agents ta 1434,l-5.
(pectins) from plants for the food industry, in: Ad- Qu, K. B., MARTIN, D. L., LAWRENCE, C. E. (1998),
vances in Plant Cell Biochemistry and Biotechnol- Motifs and structural fold of the cofactor binding
ogy Vol. 1, (MORRISON, I., Ed.), pp. 219-270. Lon- site of human glutamate decarboxylase, Protein
don: JAI Press. Sci. 7,1092-1105.
PIRRUNG, M. C., HOLMES, C. P., HOROWITZ, D. M., RAMJEE,M. K., GENSCHEL, U., ABELL,C., SMITH, A.
NU", D. S. (1991), Mechanism and stereochemis- G. (1997), Escherichia coli L-aspartate-a-decar-
try of a,P-dihydroxyacid dehydratase, J. Am. boxylase: preprotein processing and observation
Chem. SOC.113,1020-1025. of reaction intermedaites by electrospray mass
PISHKO, E. J., ROBERTUS, J. D. (1993), Site directed al- spectrometry, Biochem. J. 323,661-669.
teration of 3 active site residues of a pyruvoyl-de- RANZI,B. M., RONCHETTI, F., Russo, G., TOMA,L.
pendent histidine decarboxylase, Biochemistry (1981), Stereochemistry of the introduction of the
32,4943-4948. hydrogen atom at C-2 of cis-aconitic acid during
PLETNEV, S. V., ANTSON, A. A., SINITSYNA, N. I., its transformation into itaconic acid in Aspergil-
DAUTER, Z., ISUPOV, M. N. et al. (1997), Crystallo- lus terreus:a 2H N. M. R. approach, J. Chem. SOC.,
graphic study of tyrosine phenol-lyase from Erwi- Chem. Commun.,1981,1050-1051.
nia herbicola, Crystallogr.Rep. 42,809-819. RAZAL,R. A., ELLIS,S., SINGH,S., LEWIST,N. G.,
164 2 Lyases
TOWERS,G. H. N. (1996), Nitrogen recycling in RONDAGS, E., GERMAIN, P., MARC,I., (1998), Kinetic
phenylpropanoid metabolism, Phytochemistry 41, studies on a-acetolactic acid extra and intracellu-
31-35. lar oxidative decarboxylation to diacetyl by Lac-
REID,M. F., FEWSON, C. A. (1994), Molecular charac- tococcus lactis ssp. lactis var. diacetylactis SD 933,
terization of microbial alcohol dehydrogenases, Lait 78,135-143.
Crit. Rev. Microbiol. 20,13-56. ROSE,A. H. (1997), Restructuring the active site of
REES,D. G., JONES, D. H. (1996), Stability of L-phen- fumarase for the fumarate to malate reaction, Bi-
ylalanine ammonia-lyase in aqueous solution and ochemistry 36,12346-12354.
as the solid state in air and organic solvents, En- ROSE,A. H. (1998), How fumarase recycles after the
zyme Microb. Technol. 19,282-288. malate fumarate reaction. Insights into the the re-
REES,D. G., JONES, D. H. (1997),Activity of L-phen- action mechanism,Biochemistry 37,17651-17658.
ylalanine ammonia-lyase in organic solvents,Bio- ROZZELLJr., J. D., BENNER,S. A. (1984), Stereo-
chem. Biophys. Acta 1338,121-126. chemical imperative in enzymatic decarboxyla-
REGLINSKI, T., STAVELY, F. J. L., TAYLOR, J. L. (1998), tions. Stereochemical course of the decarboxyla-
Induction of phenylalanine ammonia lyase activ- tion catalyzed by acetoacetate decarboxylase, J.
ity and control of Sphaeropsis sapinea infection in Am. Chem. SOC.106,4937-4941.
Pinus radiata by 5-chlorosalicylic acid. Eur. J. Fo- RUAN,Z . S., ANANTHARAM, V., CRAWFORD, I.T., AM-
restry Pathol. 28,153-158. BUDKAR, s.v, RHEE,s.Y. et al. (1992), Identifica-
REHMAN, A., MCFADDEN, B. A. (1996), The conse- tion, purification and reconstitution of OxlT, the
quences of replacing histidine 356 in isocitrate oxalate-formate antiport protein of Oxalobacter
lyase from Escherichia coli, Arch. Biochem. Bi- formigenes, J. Biol. Chem. 267,10537-10543.
OphyS. 336,309-315. RUSSELL, R. N., Yu, Y. (1991), Stereochemical and
RENAULT, P., CALERO, S., DELORME, C., DROUAULT, mechanistic studies of the CDP-D-glucoseoxidor-
S., GOUPIL-FEUILLERAT, N. et al. (1998) From ge- eductase isolated from Yersiniapseudotuberculo-
nome to industrial application, Lnit 78,39-52. sis, J. Am. Chem. SOC.ll3,7777-7778.
REYNOLDS, L. J., GARCIA,G. A., KOZARICH, J. W., SACCHETTINI, J. C., MEININGER, T., RODERICK, S.,
KENYON, G. L. (1988), Differential reactivity in BANAZAK, L. J. (1986), Purification, crystalliza-
the processing of p-[(halomethyl)benzoyl]for- tion, and preliminary X-ray data for porcine fu-
mates by benzoylformate decarboxylase, a thia- marase, J. Biol. Chem. 261,15183-15185.
min pyrophosphate dependent enzyme,Biochem- SACHS,M. M., SUBBAIAH, C. C., SAAB,I. N. (1996),
istry 27,5530-5538. Anaerobic gene expression and flooding toler-
RHEE,S. K., FUCHS, G. (1999), Phenyl-CoA:acceptor ance in maize, J. Exp. Bot. 47,l-15.
oxidoreductase, a membrane bound molybde- SACKSTEDER, K. A., MORELL, J. C., WANDERS, R. J.
num-iron-sulfur enzyme involved in the anaero- A., MATALON, R., GOULD,S. J. (1999), MCD en-
bic metabolism of phenylalanine in the denitriy- codes peroxisomal and cytoplasmic forms of mal-
ing bacterium, Thauera aromatica, Eur. J. Bio- onyl-CoA decarboxylase and is mutated in malo-
chem. 262,507-515. nyl-CoA decarboxylase deficiency,J. Biol. Chem.
RICHARDS, J. C., SPENSER, I. D. (1983), 2H NMR 274,24461-24468.
spectroscopy as a probe of the stereochemistry of SALVARREY, M. S., CAZZULO, 5. J., CANNATA, J. J. B.
enzymic reactions at prochiral centres, Tetrahe- (1995),Effects of divalent cations and nucleotides
dron 39,3549-3568. on the (C0,)-'4C-oxaloacetate exchange cata-
RIKIN,A., SCHWARTZBACH, S. D. (1989),Translation- lyzed by the phosphoenol pyruvate carboxyki-
al regulation of the synthesis of Euglena fumarase nase from the moderate halophile, Vibrio costico-
by light and ethanol, Plant Physiol. 90,63-69. la, Biochem. Mol. Biol. Int. 36,1225-1234.
ROBERT-BAUDOW, J., JIMENO-ABENDANO, J., STOE- SANO,H, TADA,T,MORIYAMA, A., OGAWA, H., ASAI,
BER, F. (1982), D-Mannonate and D-akronate de- K. et al. (1997), Isolation of a rat histidase cDNA
hydratases of Escherichia coli-K-12, Methods En- sequence and expression in Escherichia coli - Ev-
zymol. 90,288-294. idence of extrahepatic/epidermal distribution,
ROBINSON, J. B., SINGH,M., SRERE,P. A. (1976), Eur. J. Biochem. 250,212-221.
Structure of the prosthetic group of Klebsiella SANTANGELO, J. D., DUERRE,P. (1996), Microbial
aerogenes citrate (pro-3S)-lyase,Proc. Natl. Acad. production of acetone and butanol: Can history
Sci. USA 73,1872-1876. be repeated? Chimica Oggi (Chemistry Today)
RONDAGS, E., GERMAIN, P., MARC,I. (1997), Quan- 14,29-35.
tification of extracellular a-acetolactate oxidative SANTA-MARIA, J. R., COLL,R., FUENTESPINA, E,
decarboxylation in diacetyl production by an a- (1993), Comparative study of two commerical
acetolactate overproducing strain of Lactococcus kits for determining oxalate in urine, Clin. Bio-
lactis ssp. lactis bv. diacetylactis, Biotechnol. Lett. chem. 26,93-96.
21,303-307. SANTANIELLO, E., MANZOCCHI, A., BIONDI,P. A.
5 References 165
(1981), On the stereochemistry of the decarboxy- SEELY, J. E., PEGG,A.E. (1983), Ornithine decarbox-
lation of (2s)-histidine catalyzed by histidine de- ylase (mouse kidney), Methods Enzymol. 94,
carboxylase from Clostridium welchii (EC 158-161.
4.1.1.22),J. Chem. SOC.,Perkin Trans. I , 307-309. SEELY, J. E., POSO,H., PEGG,A. E. (1983), Labeling
SARIBAS, A. S., SCHINDLER, J. F., VIOLA,R. E. (1994), and quantitation of ornithine decarboxylase pro-
Mutagenic investigation of conserved functional tein by reaction with a-[5-'4C]difluoromethylor-
amino acids in Escherichia coli L-aspartase. J. nithine, Methods Enzymol. 94,206-209.
Biol. Chem.269,6313-6319. SENUMA, M., OTSUKI, O., SAKATA, N., FURUI,M., To-
SAUER, U.,DUERRE, P.(1995), Differential induction SA, T. (1989) Industrial production of D-aspartic
of genes related to solvent formation during the acid and L-alanine from DL-aspartic acid using a
shift from acidogenesis to solventogenesis in con- pressurized column reactor containing immobi-
tinuous culture of Clostridium acetobutylicum, lized Pseudomonas dacunhae cells, J. Ferment. Bi-
FEMS Microbiol. Lett. 125,115-120. oeng. 67,233-237.
SCAPIN, G., BLANCHARD, J. S. (1998), Enzymology of SENWO, Z. N., TABATABAI, M. A. (1996), Aspartase
bacterial lysine biosynthesis, Adv. Enzymol. 72, activity of soils. Soil Sci. Soc.Am. J. 60,1416-1422.
279-327. SENWO, Z. N., TABATABAI, M. A. (1999), Aspartase
SCHELLENBERGER, A. (1998), Sixty years of thiamin activity in soils: effects of trace elements and rela-
diphosphate biochemistry, Biochim. Biophys. Ac- tionships to other amidohydrolases, Soil Biol. Bi-
ta. 1358,177-186. ochem. 31,213-219.
SCHINDLER, J. F., VIOLA,R. E. (1994), Mechanism- SEREBRENNIKOV, V. M., KISRIEVA, Y. S., ZAGUSTINA,
based inactivation of L-aspartase from E. coli, Bi- N. A., SEMINIKHINA, V. F., BEZBORODOV, A. M.
ochemistry 33,9365-9370. (1999),The ability of diacetyl-producing lactic ac-
SCHMID,M., BERG,M., HILBI,H., DIMROTH, P. id bacteria of the genus Lactococcus to release a-
(1996), Malonate decarboxylase of Klebsiella acetolactic acid into the medium, Appl. Biochem.
pneumoniae catalyzes the turnover of acetyl and Microbiol. 35,612-620.
malonyl thioester residues on a coenzyme-A like SHARMA, S., NATH,R., THIND, S. K. (1993), Recent
prosthetic group, Eur. J. Biochem. 237,221-228. advances in the measurement of oxalate in bio-
SCHNEIDER, S., MOHAMED, M. E., FUCHS,G. (1997), logical materials, Scanning Microscopy 7,
Anaerobic metabolism of L-phenylalanine via 431-441.
benzoyl-CoA in the denitrifying bacterium SHELP,B. J., BOW, A. W., MCLEAN,M. D. (1999),
Thauera aromatica, Arch. Microbiol. 168, Metabolism and functions of y-aminobutyric ac-
310-320. id, Trends Plant Sci. 4,446-452.
SCHORKEN, U., SPRENGER, G. A. (1998),Thiamin-de- SHEN,B. W., HENNIG, M., HOHENESTER, E., JANSON-
pendent enzymes as catalysts in chemoenzymatic IUS, J. N., SCHIRMER,T. (1998), Crystal structure of
syntheses, Biochim. Biophys. Acta. 1385,229-243. human recombinant ornithine aminotransferase,
SCHUSTER, B., RETEY,J. (1994), Serine-202 is the pu- J. Mol. Biol. 277,81-102.
tative precursor of the active-site dehydroalanine SHERIDAN, R. P., ALLEN, L. C. (1981),The active site
of phenylalanine ammonia-lyase - Site directed electrostatic potential of human carbonic anhy-
mutagenesis studies on the enzyme from parsley drase, J. Am. Chem. SOC.103,1544-1550.
(Petroselinum crispum L.), FEBS Lett. 349,252- SHI,W., KIDD,R., GIORGIANNI, F., SCHINDLER, J. F.,
254. VIOLA,R. E., FARBER, G. K. (1993), Crystalliza-
SCHUSTER, B., RETEY,J. (1995), The mechanism of tion and preliminary X-ray studies of i--aspartase
action of phenylalanine ammonia-lyase - the role from Escherichia coli, J. Mol. Biol. 234, 1248-
of prosthetic dehydroalanine, Proc. Natl. Acad. 1249.
Sci. USA 92,8433-8437. SHI,W. X., DUNBAR, J., JAYASEKERA, M. M. K., VIO-
SCHWARTZ, H. L., CHANDONIA, J. M., KASH,S. F., KA- LA, R. E.,FARBER, G. K. (1997),The structure of L-
NAANI, J., TUNNELL, E. et al. (1999), High resolu- aspartate ammonia-lyase from Escherichia coli,
tion autoreactive epitope mapping and structural Biochemistry 36,9136-9144.
modeling of the 65 kDa form of human glutamic SHIBATA, H., GARDINER, W. E., SCHWARTZBACH, S. D.
acid decarboxylase, J. Mol. Biol. 287,983-999. (1985), Purification and characterization and im-
SCHWEDE, T. F., RETEY,J., SCHULZ,G. E. (1999), munological properties of fumarase form Eugle-
Crystal structure of histidine ammonia lyase re- na gracilis var. bacillaris, J. Bacteriol. 164, 762-
vealing a novel polypeptide modification as the 768.
catalytic electrophile, Biochemistry 38, 5355- SHIN,H. S., ROGERS, P. L. (1996a), Production of L-
5361. phenylacetylcarbinol (L-PAC) from benzalde-
SCOPES, R. K. (1997), Ethanol from biomass:The po- hyde using partially purified pyruvate decarboxy-
tential use of thermophilic organisms in fermen- lase (PDC),Biotechnol. Bioeng. 49,5242.
tation, Australasian Biotechnol. 7,296-299. SHIN,H. S., ROGERS, P. L. (1996b),Kinetic evaluation
166 2 Lyases
of biotransformation of benzaldehyde to L-phen- tion and properties, Methods Enzymol. 122,128-

ylacetylcarbinol by immobilized pyruvate decar- 135.
boxylase from Candida utilis, Biotechnol. Bioeng. SNELL,E. E. (1993), From bacterial nutrition to en-
49,429-436. zyme structure - A personal odyssey, Ann. Rev.
SHUKLA, V. B., KULKARNI, P. R. (1999), Downstream Biochem. 62,l-27.
processing of biotransformation broth for recov- SNELL, E. E., GUIRARD, B. M. (1986),Pyridoxal phos-
ery and purification of L-phenyl acetyl carbinol phate-dependent histidine decarboxylase from
(L-PAC),~ Sci. Ind. Res. 58,591-593. Morganella am-15, Methods Enzymol. 122, 139-
SIDDIQUI, M. A., FUJIWARA, S., IMANAKA, T. (1997), 143.
Indolepyruvate ferredoxin oxidoreductase from SNELL,E. E., HUYNH,Q. K. (1986), Prohistidine de-
Pyrococcus sp. KODl possesses a mosaic: Struc- carboxylase from Lactobacillus-30a, Methods En-
ture showing features of various oxidoreductases, zymol. 122,135-138.
Mol. Gen. Genet. 254,433439. SNIPES, C. E., BRILLINGER, G.-U., SELLERS, L., MAS-
SIDDIQUI, M. A., FUJIWARA, S., TAKAGI, M., IMANA- CARO,L., FLOSS,H. G. (1977), Stereochemistry of
KA,T. (1998), In vitro heat effect on heterooligo- the dTDP-glucose oxidoreductase reaction, J.
meric subunit assembly of thermostable indole- Biol. Chem. 252,8113-8117.
pyruvate ferredoxin oxidoreductase, FEBS Lett. SOURKES, T. L. (1987),Aromatic-~-aminoacid decar-
434,372-376. boxylase, Methods Enzymol. 142,170-178.
SIDHU,H., ALLISON, M., PECK,A. B. (1997), Identifi- SPAMPINATO, C. P., ANDREO,C. S. (1995), Kinetic
cation and classification of Oxalobacter formi- mechanism of NADP-malic enzyme from maize
genes strains using oligonucleotide probes and leaves, Photosynth. Res. 43,l-9.
primers, J. Clin. Microbiol. 35,35&353. SPENCER, J. B., JORDAN, P. M. (1990), Use of chiral
SIDHU,H., HOPPE,B., HESSE,A., TENBROCK, K., malonates to determine the absolute configura-
BROMME, S. et al. (1998), Absence of Oxalobacter tion of the hydrogen atoms eliminated during the
formigenes in cystic fibrosis patients: a risk factor formation of 6-methylsalicyclicacid by 6-methyl-
for hyperoxaluria,Lancet 352, No. 9133,1026-1029. salicyclicacid synthase from Penicillin patulum, J.
SIDHU,H., SCHMIDT, M. E., CORNELIUS, J. G., THA- Chem. SOC.,Chem. Commun., 1704-1706.
MILSELVAN, S., KHAN,S. R. et al. (1999), Direct SPENCER, J. B., JORDAN, P.M. (1992a), Stereospecific
correlation between hyperoxaluria/oxalate stone elimination of hydrogen atoms with opposite ab-
disease and the absence oif the gastrointestinal solute orientations during the biosynthesis of or-
tract dwelling bacterium Oxalobacter formigenes, sellinic acid from chiral malonates in Penicillin
J. Am.. SOC.Nephrol. 10, S334-S340. cyclopium, J. Chem. Soc., Chem. Commun., 6 46
SIMPSON, A., BATEMAN, O., DRIESSEN, H., LINDLEY, 648.
P., Moss, D. et al. (1994), The structure of avian SPENCER, J. B., JORDAN, P. M. (1992b), Investigation
eye lens Scrystallin reveals a new fold for a of the mechanism and steric course of the reac-
superfamily of oligomeric enzymes,Nature Struct. tion catalyzed by 6-methylsalicylic acid synthase
Biol. 1,724-733. from Penicillium patulum using (R)-[l-C-13,2-H-
SLOAN, M. J., PHILLIPS, R. S. (1996), Effects of a-deu- 2lmalonate and (S)-[l-C-13,2-H-2]malonate, Bio-
teration and of aza and thia analogs of L-trypto- chemistry 31,9107-91 16.
phan on formation of intermedaites in the reac- SPRENGER, G. A., POHL,M. (1999), Synthetic poten-
tion of Escherichia coli tryptophan indole lyase, tial of thiamin diphosphate-dependent enzymes,
Biochemistry 35,16165-16173. J. Mol. Catal. B Enzymatic 6,145-159.
SMITH,D. M., THOMAS,N. R., GANI,D. (1991), A STIM-HERNDON, K. P., PETERSEN, D. J., BENNETT,G.
comparison of the pyridoxal 5'-phosphate de- N. (1995), Characterization of an acetyl-CoA C-
pendent decarboxylase and transaminase en- acetyltransferase (thiolase) gene from Clostridi-
zymes at a molecular level, Experientia 47,ll-12. um acetobutylicum ATCC-824, Gene 154,8145.
SONG,Y.H., NIEDERER, D., LANEBELL, P. M., LAM,L. STIM-HERNDON, K. P., NAIR,R., PAPOUTSAKIS, E. T.,
K. P., CRAWLEY, S. et al. (1994), Stereospecificsyn- BENNETT,G. N. (1996), Analysis of degenerate
thesis of phosphonate analogs of diaminopimelic variants of Clostridium acetobutylicum ATCC-
acid (DAP) their interaction with DAP enzymes 824,Anaerobe 2,ll-18.
and antibacterial activity of peptide derivatives,J. STIRLING, D. I. (1992),The use of aminotransferases
Org. Chem.59,57865793. for the production of chiral amino acids and
SOOKKHEO, B., PHUTAKUL, S., CHEN,S. T., WANG,K. amines, in: Chirality in Industry (COLLINS, A. N.,
T. (1998), Aspartase catalyzed preparative scale SHELDRAKE, G. N., CROSBY J., Eds.), pp. 208-222.
synthesis of "N-aspartic acid, J. Chin. Chem. SOC. Chichester: John Wiley & Sons.
45,525-528. Su, P. H., LIN,C. H. (1996), Metabolic responses of
SNELL,E. E. (1986), Pyruvoyl-dependent histidine- luffa roots to long-term flooding,J. Plant Physiol.
decarboxylase from Lactobacillus-30a - purifica- 148,735-740.
5 References 167
SUCHI, M., HARADA, N., WADA,~., TAKAGI,~. (1993), lalanine by L-phenylalanine ammonia-lyase of
Molecular cloning of a cDNA-encoding human Rhodotorula glutinis: parameters and kinetics,
histidase, Biochem. Biophys. Acta 1216,293-295. Enzyme Microb. Technol.17,445452.
SUN,S. X.,DUGGLEBY, R. G., SCHOWEN,R.L. (1995), TAKAHASHI, R., KAWASAKI, M., SONE,H., YAMANO,
Linkage of catalysis and regulation in enzyme ac- S. (1995), Genetic modification of brewers’ yeast
tion - carbon-isotope effects, solvent isotope ef- to produce acetolactate decarboxylase and the
fects, and proton inventories for the unregulated safety aspects of the beer brewed by the trans-
pyruvate decarboxylase of Zymomonas mobilis, formed yeast, ACS Symp. Sex 605,171-180.
J. Am. Chem. SOC. 117,7317-7322. TAKAMURA, Y., KITAYAMA, Y. (1981), Purification
SUN,S. X., SMITH, G. S., O’LEARY, M. H., SCHOWEN, and some properties of the malonate decarboxy-
R. L. (1997), The linkage of catalysis and regula- lase from Pseudomonas ovalis: an oligomeric en-
tion in enzyme action. Fluoropyruvate as a probe zyme with bifunctional properties, Biochem. Int.
of regulation in pyruvate decarboxylases,J. Am. 3,483491.
Chem. SOC.119,1507-1515. TAKATSUKA, Y., ONODA, M., SUGNAMA,T., TOMITA,T.,
SUN,S. X., ZABINSKI, R. F., TONEY,M. D. (1998a), Re- KAMmo,Y. (1999a),Novel characteristicsof Selen-
actions of alternate substrates demonstrate ster- omonas ruminantiurn lysine decarboxylase ca-
eoelectronic control of reactivity in dialkylglycine pable of decarboxylatingboth L-lysine and L-orni-
decarboxylase,Biochemistry 37,3865-3875. thine, Biosci. Biotech. Biochem. 63,1063-1069.
SUN,S. X., BAGDASSARIAN, C. K., TONEY,M. D. TAKATSUKA, Y., TOMITA,T., KAMINO, Y. (1999b),
(1998b), Pre-steady-state kinetic analysis of the Identification of the amino acids residues confer-
reactions of alternative substrates with dialkyl- ring specificity upon Selenomonas ruminantiurn
glycine decarboxylase, Biochemistry 37, 3876- lysine decarboxylase, Biosci. Biotech. Biochem.
3885. 63,1843-1846.
SUNDARARAJU, B., ANTSON,A. A., PHILLIPS, R. S., TANAKA, I., TOSA,T., CHIBATA, I. (1983a), Stabiliza-
DEMIDKINA, T. V., BARBOLINA, M. V. et al. (1997), tion of fumarase activity of Brevibacterium fla-
The crystal structure of Citrobacter freundii tyro- vum cells by immobilization with K-carrageenan,
sine phenol-lyase complexed with 3-(4 ’-hydroxy- Appl. Biochem. Biotechnol. 8,31-38.
pheny1)propionicacid, together with site directed TANAKA, I., TOSA,T., CHIBATA, I. (1983b), Reasons
mutagenesis and kinetic analysis, demonstrates for the high-stability of fumarase activity of Brev-
that arginine 381 is required for substrate speci- ibacteriumflavum cells immobilized with K-carra-
ficity, Biochemistry 36,6502-6510. geenan gel, Appl. Biochem. Biotechnol. 8,39-54.
SUTTON,C. R., KING,H. G (1962), Inhibition of leu- TANAKA, I., TOSA,T., CHIBATA, I. (1983c), Effect of
cine decarboxylase by thiol-binding reagents, growth-phase on stability of fumarase activity of
Arch. Biochem. Biophys. 96,360-370. Brevibacterium jZavum cells immobilized with K-
SUZUKI, T., SATO, M., YOSHIDA, T., TUBOI, S. (1989), carrageenan,Agric. Biol. Chem. 47,1289-1296.
Rat liver mitochondria1 and cystolic fumarases TANAKA, I., TosA,T., CHIBATA, I. (1984),Stability of
with identical amino acids sequences are encoded fumarase activity of Brevibacterium flavum im-
from a single gene, J. Biol. Chem. 264, 2581- mobilized with K-carrageenan and Chinese gallo-
2586. tannin, Appl. Microbiol. Biotechnol. 19,85-90.
SUZUKI, S., HIRAHARA, T., SHIM,J. K., HORINOUCHI,TANAKA, F., LERNER, R. A., BARBAS, C. F. (1999),Thi-
S., BEPPU,T.(1992), Purification and properties of azolium-dependentcatalytic antibodies produced
thermostable P-tyrosinase from an obligately using a covalent modification strategy, Chem.
symbiotic thermophile,Symbiobacterium thermo- Commun. 15,1383-1384.
philum, Biosci. Biotech. Biochem. 56,84-89. TARI,L. W., MATTE, A., PUGAZHENTHI, U., GOLDIE,
SWANSON, T., BROOKS,H. B., OSTERMAN, A. L., H., DELBAERE, L. T. J. (1996), Snapshot of an en-
O’LEARY, M. H., PHILLIPS, M. A. (1998), Carbon- zyme reaction intermediate in the structure ofthe
13 isotope effect studies of Trypanosoma brucei ATP-Mg2 -oxalate ternary complex of Escheri-
+
ornithine decarboxylase, Biochemistry 37,14943- chia coli PEP carboxykinase, Nature Struct. Biol.
14947. 3,355-363.
TABIB,A.,BACHRACH, U. (1999), Role of polyamines TAYLOR, R. G., LAMBERT, M. A., SEXSMXH, E., SAD-
in mediating malignant transformation and onco- LER,S. J., RAY,P. N. et al. (1990), Cloning and ex-
gene expression, Int. J. Biochem. Cell Biol. 31, pression of rat histidase, J. Biol. Chem. 265,
1289-1295. 18192-181 99.
TADEGE,M., DUPUIS,I., KUHLEMEIER, C. (1999), TAYLOR, R. G., LEVY,H. L., MCINNES, R. R. (1991),
Ethanolic fermentation: new functions for an old Histidase and histidinemia - clinical and molecu-
pathway, Trends Plant Sci. 4,32Q-325. lar considerations,Mol. Biol. Med. 8,101-116.
TAKAC, S., AKAY,BULENT,OZDAMAR, T. H. (1995), TAYLOR,R. G., MCINNES, R. R. (1994), Site-directed
Bioconversion of trans-cinnamic acid to L-pheny- mutagenesis of conserved serines in rat histidase-
168 2 Lyases
identification of serine-254 as an essential active- TRIPATHI, C. M., AGARWAL, S. C., BASU,S. K. (1997),
site residue, J. Biol. Chem. 269,27473-27477. Production of L-phenylacetylcarbinolby fermen-
THATCHER, B. J., DOHERTY,A. E., ORVISKY, E., MAR- tation,J. Ferment. Bioeng. 84,487492.
TIN, B. M., HENKIN, R. I. (1998), Gustin from hu- TSENG,C. P. (1997), Regulation of fumarase (furnB)
man parotid saliva is carbonic anhydrase VI, Bio- gene expression in Escherichia coli in response to
chem. Biophys. Res. Cornmun. 250,635-641. oxygen, iron and heme availability: role of the ar-
THOMPSON, M. W., STROHL, W. R.,FLOSS, H. G. (1992) cA,fur, and hemA gene products, FEMS Microbi-
Purification and characterization of TDP-D-glU- 01. Lett. 157,67-72.
cose 4,6-dehydratase from anthracycline-produc- Tsou, A. Y., RANSOM, S. C., GERLT,J. A., BEUCHTER,
ing streptomycetes, J. Gen. Microbiol. 138,779- D. D., BABBITT,P. C., KENYON, G. L. (1990), Man-
786. delate pathway of Pseudomonas putida - se-
THORSON, J. S., KELLY,T. M., LIU, H.-W. (1994a), quence relationships involving mandelate race-
Cloning, sequencing and overexpression in Es- mase, (S)-mandelate dehydrogenase and benzyl-
cherichia coli of the a-D-glucose-1-phosphatecy- formate decarboxylase and expression of benzyl-
tidylyltransferase gene isolated from Yersinia formate decarboxylase in Escherichia coli, Bio-
pseudotuberculosis, J. Bacteriol. 176,1840-1849. chemistry 29,9856-9862.
THORSON, J. S., Lo,S. F., PLOUX, O., HE,X. M., Lnr, H. TUBOI,S., SUZUKI, T., SATO,M., YOSHIDA, T. (1990),
W. (1994b), Studies of the biosynthesis of 3,bdide- Rat liver mitochondria1 and cytosolic fumarases
oxyhexoses - molecular cloning and characteriza- with identical amino acid sequences are encoded
tion of the ASC (ascrylose) region from Yersinia from a single mRNA with two alternative in-
pseudotuberculosis,J. Bacteriol. 176,5483-5493. phase AUG initiation sites, Adv. Enzyme Regul.
TILLEY, K., AKHTAR,M., GANI,D. (1992) The stereo- 30,289-304.
chemical course of reactions catalyzed by Esche- TURNER, M. A., SIMPSON, A., MCINNES, R. R., How-
richia coli glutamic acid decarboxylase, J. Chem. ELL, €! L. (1997) Human arginosuccinate lyase: a
Soc., Chem. Commun., 68-71. structural basis for intragenic combination, Proc.
TILLEY, K., AKHTAR, M., GANI,D. (1994),The stereo- Natl. Acad. Sci. USA. 94,9063-9068.
chemical course of decarboxylation, transamina- TYAGI, A. K., TABOR,C. W., TABOR,H. (1983), Orni-
tion and elimination reactions catalyzed by Es- thine decarboxylase (Saccharomyces cerevisiae),
cherichia coli glutamic acid decarboxylase, J. Methods Enzymol. 94,135-139.
Chem. Soc., Perkin. Trans.1 1994,3079-3087. UEDA,Y., YUMOTO, N., TOKUSHIGE, M., FUKUI,K.,
TOH,H., KONDO,H., TANABE, T. (1993), Molecular OHYA-NISHIGUCHI, H. (1991), Purification and
evolution of biotin-dependent carboxylases,Eur. characterization of two types of fumarases from
J. Biochem. 215,687496, Escherichia coli, J. Biochem. 109,728-733.
TONEY, M. D., HOHENESTER, E., KELLER, J. W., JAN- UGWUANYI, J. O., OBETA,J. A. N. (1997), Some pec-
SONIUS, J. N. (1995), Structural and mechanistic tinolytic and cellulolyticenzyme activities of fun-
analysis of 2 refined crystal structures of the pyri- gi causing rots of cocoyams, J. Sci. Food Agr. 73,
doxal phosphate dependent enzyme, dialkylgly- 432436.
cine decarboxylase,J. Mol. Biol. 245,151-179. URBAN,J. J., VON TERSCH, R. L. (1999), A computa-
TORSELL, K. B. G. (1983), Natural Product Chemis- tional study of charge delocalization and ring flu-
try: A Mechanistic and Biosynthetic Approach to or0 substituent effects in 4-fluoromethylphenox-
Secondary Metabolism, pp. 80-88. Chichester: ides,J. Org. Chem. 64,3409-3416.
John Wiley & Sons. VACCARO, J. A., CRANE, E. J., HARRIS,T.K., WASHA-
TOSA,T., TANAKA, I., CHIBATA, I. (1982), Stabiliza- BAUGH, M. W. (1995), Mechanism of reconstitu-
tion of fumarase activity of Brevibacterium flu- tion of brewers’ yeast pyruvate decarboxylase
vum cells by immobilization with K-carrageenan with thiamin diphosphate and magnesium, Bio-
and polyethyleneimine, Enzyme Eng. 6,237-238. chemistry 34,12636-12644.
TOTH,C., COFFINO, I? (1999), Regulated degradation VALLEE, F., TURNER, M. A., LINDLEY, I? L., HOWELL,
of yeast ornithine decarboxylase, J. Biol. Chem. P.L. (1999), Crystal structure of an inactive duck
274,25921-25926. 8-11-crystallin mutant with bound arginosucci-
TOTH,J., ISMAIEL, A. A., CHEN,J. S. (1999), The ald nate, Biochemistry 38,2425-2434.
gene, encoding a coenzyme A-acylating aldehyde VAN DEN HOMBERGH, J. P. T. w., FRAISSINET-TACHET,
dehydrogenase, distinguishes Clostridium beije- L., VAN DE VONDERVOORT, €! J. I., VISSER,J.
rinckii and two other solvent producing clostridia (1997), Production of the homologous pectin
from Clostridium acetobutylicum, Appl. Environ. lyase B protein in six genetically defined protease
Microbiol. 65,4973-4980. deficient Aspergillus niger mutant strains, Curr.
TRAMPER, J. VERMUE, M. H., BEEFTINK,H. H., VON Genet. 32,7341.
STOCKAR, U. (Eds.) (1992), Biocatalysis in Non- VAN DER WERF,M., VAN DEN TWEEL,W. J. J., HART-
conventional Media. Amsterdam: Elsevier. MANS, S. (1992), Screening for microorganisms
5 References 169
producing D-malate from maleate, Appl. Environ. WATANABE,S. K., HERNANDEZ-VELAZCO, G.,
Microbiol. 58,2854-2860. ITURBE-CHINAS, F., LOPEZ-MUNGIA, A. (1992),
VAN DER WERF, M. J., VAN DEN TWEEL, w. J. J., HART- Phenylalanine ammonia lyase from Sporidiobo-
MANS, S. (1993), Purification and characterization lus pararoseus and Rhodosporidium toruloides:
of maleate hydratase from Pseudomonas pseudo- Application for phenylalanine and tyrosine de-
alcaligenes, Appl. Environ. Microbiol. 59, 2823- amination, World J. Microbiol. Biotechnol. 8,
2829. 406-410.
VAN RENSBURG, P., VANZYL, w. H., PRETORIUS, 1. s. WEAVER, T., BANASZAK, L. (1996), Crystallographic
(1994), Expression of the Butyrivibrio fibrisol- studies of the catalytic and a second site in fuma-
vens endo-P-1,4-glucanasegene together with the rase C from Escherichia coli, Biochemistry, 35,
Erwinia pectate lyase and polygalacturonase 13955-13965.
genes in Saccharomyces cerevisiae, Curr. Genet. WEAVER, T., LEES,M., BANASZAK, L. (1997) Muta-
27,17-22. tions of fumarase that distinguish between the ac-
VAN WAARDE, A. (1991) Alcoholic fermentation in tive site and a nearby dicarboxylic acid binding
multicellularorganisms,Physiol. Zool. 64,895-920. site, Protein Sci. 6,834-842.
Various (1998), Biochim. Biophys. Acta 1385, 175- WEAVER,T. M., LEV^, D. G., DONNELLY, M. I., STE-
419. VENS, P. P. W., BANASZAK, L., (1995) The multisub-
VEIGA,L. A., GUIMARAES, M. F. (1991), L-Fuconate unit active-site of fumarase-C from Escherichia
dehydratase - purification and properties of the coli, Nature Struct. Biol. 2,654-662.
enzyme from Pullularia pullulans, Arquivos de WEAVER, T., LEES,M., ZAITSEV,V., ZAITSEVA, I.,
Biologia e Tecnologia 34,536-553. DUKE,E. et al. (1998) Crystal structures of native
VOLTATTORNI, C. B., GIARTOSIO, A., TWRANO, C. and recombinant yeast fumarase, J. Mol. Biol.
(1987), Aromatic-L-amino acid decarboxylase 280,431442.
from pig-kidney,Methods Enzyrnol. 142,179-187. WEIGEL,T.M, MILLER,^. P.,LIU,H.-W. (1992), Me-
VON TERSCH,R. L., SECUNDO, F., PHILLIPS, R. S., chanistic and stereochemical studies of a unique
NEWTON,M. G. (1996),Preparation of fluorinated dehydration catalyzed by CDP-4-keto-6-deoxy-
amino acids with tyrosine phenol lyase - Effects ~-glucose-3-dehydrase - a pyridoxamine 5 I -
of fluorination on reaction kinetics and mecha- phosphate dependent enzyme isolated from Yer-
nism of tyrosine phenol lyase and tyrosine pro- sinia pseudotuberculosis, Biochemistry 31, 2140-
tein kinase Csk,ACS Symp. Ser. 639,95-104. 2147.
WAAGEPETERSEN, H. S., SONNEWALD, U., SCHOUS- WEISS,F! M., GARCIA,G. A., KENYON, G. L., CLE-
BOE, A. (1999), The GABA paradox: Multiple LAND, W. W., COOK, P. F. (1988), Kinetics and
roles as metabolite, neurotransmitter and neuro- mechanism of benzoylformate decarboxylase us-
differentitation agent, J. Neurochem. 73, 1335- ing C-13 and solvent deuterium effects on benzyl-
1342. formate and benzylformate analogs, Biochemistry
WADA,M., SAKAMOTO, M., KATAOKA, M., LIU,J. Q., 27,2197-2205.
YAMADA, H., SHIMIZU, S. (1998), Distribution of WESTHEIMER, F. H. (1995), Coincidences,decarboxy-
threonine aldolase activity with different stereo- lation and electrostatic effects, Tetrahedron 51,
specificities in aerobic bacteria, Biosci. Biotech. 3-20.
Biochem. 62,1586-1588. WHITE,P. J., KENDRICK, K. E. (1993), Inactivation of
WAGNER,U. G., HASSLACHER, M., GRIENGL,K., histidine ammonia-lyase from Streptomyces gri-
SCHWAB, H., KRATKY, C. (1996), Mechanism of seus by dicarbonyl reagents, Biochinz. Biophys.
cyanogenesis: The crystal structure of hydroxyni- Acta 1163,273-279.
trile lyase from Hevea brasiliensis, Structure 4, WIECZOREK, S. J., KALIDOVA, K. A., CLIFTON,J. G.,
811-822. RINGE,D., PETSKO, G. A., GERLT,J. A. (1999), Ev-
WAJANT,H., EFFENBERGER, F. (1996), Hydroxyni- olution of enzyme activities in the enolase super-
trile lyases of higher plants, Biol. Chem. Hoppe- family: Identification of a “new” general acid cat-
Seyler 377,611617. alyst in the active site of D-galactonate dehydra-
WANG,S.-F.,GABRIEL, 0. (1970), Biological mecha- tase from Escherichia coli,J. Am. Chem. SOC.121,
nisms involved in the formation of deoxysugars,J. 4540-4541.
Biol. Chem. 245,8-14. WIGHTMAN, R. H., STAUNTON, J., BAITERSBY, A. R.
WANG,X. H., GONG,C. S.,TSAO,G.T. (1998),Produc- (1972), Studies of enzyme-mediated reactions.
tion of L-malic acid during biocatalysis employing Part 1.Syntheses of deuterium or tritium-labeled
wild-type and respiratory deficient yeast, Appl. (3s)- and (3R)-phenylalanines: Stereochemical
Biochem. Biotechnol. 70-2,845-852. course of the elimination catalyzed by L-pheny-
WARD,0.P., (1995), Application of bakers’ yeast in lalanine ammonia-lyase, J. Chem. SOC.,Perkin
bioorganic synthesis, Can. J. Bot. 73, S1043- Trans.I , 2355-2364.
S1048. WILCOCKS, R., WARD,0.P. (1992),Fasctors affecting
170 2 Lyases
2-hydroxypropiophenone fromation by benzoyl (1988b), Two biochemically distinct classes of fu-

formate decarboxylase from Pseudomonas puti- marase in Escherichia coli, Biochem. Biophys. Ac-
da, Biotechnol. Bioeng. 39,1058-1063. ta. 954,14-26.
WILCOCKS, R.,WARD, 0.P., COLLINS, S., DEWDNEY, WU, M., TZAGOLOFF, A. (1987), Mitochondria1 and
N. J., H o N G , ~P.,. PROSEN,
E. (1992),Acyloin for- cytoplasmic fumarases in Saccharomyces cerevi-
mation by benzylformate decarboxylase from siae are encoded by a single nuclear gene FUM1,
Pseudomonas putida, Appl. Environ. Microbiol. J. Biol. Chem. 262,12275-12282.
58,1699-1704. Wu, P. C., KROENING, T. A., WHITE,P. J., KENDRICK,
WILLIAMS, R. M., YUAN,C. G. (1992), Asymmetric K. E. (1992), Histidine ammonia-lyase from
synthesis of 2,6-diaminopimelic acids, J. Org. Streptomyces griseus, Gene 115,19-25.
Chem. 57,6519-6527. Wu, C.-Y., LEE,H.-W., Wu, S.-H., CHEN,S.-T., CHI-
WILLIAMS, S. E., WOOLRIDGE, E. M., RANSOM, S. C., OU,S.-H., CHANG, G.-G. (1998), Chemical mecha-
LANDRO, J. A., BABBITT,P. C., KOZARICH, J. W. nism of the endogenous argininosuccinate lyase
(1992), 3-Carboxy-cis,cis-muconate lactonizing activity of duck lens B-crystallin, Biochem. J. 333,
enzyme from Pseudomonas putida is homologous 327-334.
to the class-I1 fumarase family:A new reaction in YAGASHI, M., OZAKI,A. (1998), Industrial biotrans-
the evolution of a mechanistic motif, Biochemis- formations for the production of D-amino acids,J.
try 31,9768-9776. Mol. Catal. B 4,l-11.
WILLIAMSON, J. M. (1985),L-Aspartate-a-decarboxy- YAHIRO,K., TAKAHAMA, T., PARK,Y. S., OKABE,M.
lase, Methods Enzymol. 113,589-595. (1995), Breeding of Aspergillus terreus TN-484
WITSCHEL, M., EGLI,T.(1997), Purification and char- for itaconic acid production with high yield,J. Fer-
acterization of a lyase from the EDTA-degrading ment. Bioeng. 79,506-508.
bacterial strain DSM 9103 that catalyzes the split- YAHIRO,K., SHIBATA, S., JIA,S. R., PARK,Y., OKABE,
ting of [S,S]-ethylenediaminedisuccinate,a struc- M. (1997), Efficient itaconic acid production from
tural isomer of EDTA, Biodegradation 8, raw corn starch,J. Fermet. Bioeng. 84,375-377.
419428. YAMADA, S., NABE,K., Izuo, N., NAKAMICHI, K.,
WITSCHEL, M., NAGEL,S., EGLI,T. (1997), Identifica- CHIBATA,I. (1981), Production of L-phenylala-
tion and characterization of the two enzyme nine from trans-cinnamic acid with Rhodotorula
system catalysing oxidation of EDTA in the ED- glutinis: containing L-phenylalanine ammonia-
TA-degrading bacterial strain DSM 9103, J. Bac- lyase activity, Appl. Environ. Microbiol. 42,
teriol. 179,6937-6943. 773-778.
WOEHL,A., Du”, M. F. (1999), Mechanisms of YAMAMOTO, Y., MIWA,Y., MIYOSHI, K., FURUYAMA,
monovalent cation action in enzyme catalysis: J., OHILIORI, H. (1997), The Escherichia coli ZdcC
The tryptophan synthase a+, and @reactions, gene encodes another lysine decarboxylase,prob-
Biochemistry 38,7131-7141. ably a constitutive enzyme, Genes Genet. Systems
WOODRELL, C. D., ICEHAYOVA, P. D., JAIN,A.(1999), 72,167-172.
Photochemically-triggered decarboxylatiodde- YAMANO, S., TOMIZUKA, K., TANAKA, J., INOUE, T.
amination of o-nitrodimethoxyphenylglycine, (1994), High-level expression of a-acetolactate
Org. Lett. 1,619-621. decarboxylase gene from Acetobacter aceti ssp.
WOODS,D. R. (1995),The genetic engineering of mi- xylinum in brewing, J. Biotechnol. 37,4548.
crobial solvent production, Trends Biotechnol. W, YAMANO, S, TOMIZUKA, K, SONE,H, IMURA, M, TA-
29-264. KEUCHI,T. et al. (1995),Brewing performance of a
WOODS,S. A., GUEST,J. R. (1987), Differential roles brewers’ yeast having a- acetolactate decarboxy-
of the Escherichia coli fumarases and FNR-de- lase from Acetobacter aceti ssp. xylinum, J. Bio-
pendent expression of fumarase B and aspartase. technol. 39,21-26.
FEMS Microbiol. Lett. 48,219-224. YANG,X. P., TSAO,G. T. (1994), Mathmatical model-
WOODS,S. A., MILES,J. S., ROBERTS, R. E., GUEST,J. ling of inhibition kinetics in acetone-butanol fer-
R. (1986), Structural and functional relationships mentation by Clostridium acetobutylicum, Bio-
between fumarase and aspartase nucleotide se- technol. Prog. 10,532-538.
quences of the fumarase (FumC) and aspartase (- YANO,M., % M A , K., UMIJI,K., IZUI,K. (1995),
AspA) genes of Escherichia coli-K12,Biochem. J. Catalytic role of an arginine residue in the highly
237,547-557. conserved and unique sequence of phosphoenol-
WOODS,S. A., MILES,J. S., GUEST,J. R. (1988a), Se- pyruvate carboxylase,J. Biochem. 117,1196-1200.
quence homologies between argininosuccinase, YOON,M. Y., THAYER-COOK, K. A,, BERDIS,A. J.,
aspartase and fumarase - a family of structurally- KARSTEN, W. E., SCHNACKERZ, K. D., COOK,P. F.
related enzymes, FEMS Microbiol. Lett. 51, (1995), Acid-base chemical mechanism of aspar-
181-186. tase from Hafnia alvei, Arch. Biochem. Biophys.
WOODS,S., SCHWARTZBACH, S. D., GUEST,J. R. 320,115-122.
5 References 171
YOUNG, D. W. (1991), Use of enzymes in the synthe- the activation and inactivation of brewers' yeast
sis of stereospecifically labeled compounds, in: pyruvate decarboxylase investigated with a
Isotopes in the Physical and Biomedical Sciences, PDCI-PDC6 fusion protein, Biochemistry 32,
Volume I , Labeled Compounds (Part B) (BUN- 2704-2709.
CEL,E., JONES,J. R., Eds.), pp. 341427. Amster- Z H O U , Z.,TONEY,M.
~. D. (1999),pH studies on the
dam: Elsevier. mechanism of the pyridoxal phosphate depen-
Yu,Y., RUSSELL, R. N., THORSON, J. S., LIU,L. D., LIU, dent dialkylglycine decarboxylase, Biochemistry
H.W. (1992), Mechanistic studies of the biosyn- 38,311-320.
thesis of 3,6-dideoxyhexoses in Yersinia pseudo- ZHU,M. Y., Juo~10,A.V.(1995),Aromatic amino ac-
tuberculosis - purification and stereochemical id decarboxylase - Biological characterization
analysis of CDP-D-glucose oxidoreductase, J. and functional role, Gen. Pharmacol. 26,681496.
Biol. Chem. 267,5868-5875. ZIMMER,W., HUNDESHAGEN, B., NIEDERAU,E.
YUMOTO, N., TOKUSHIGE, M. (1988), Characteriza- (1994), Demonstration of the indolepyruvate de-
tion of multiple fumarase proteins in Escherichia carboxylase gene homolog in different auxin-pro-
coli, Biochem. Biophys. Res. Commun. 153,1236 ducing species of the Enterobacteriaceae, Can J.
1243. Microbiol. 40,1072-1076.
ZAITSEV, G. M., GOVORUKHINA, N. I., LASKOVNEVA,ZIMMER, W., WESCHE, M., TIMMERMANS, L. (1998),
0.V., TROTSENKO, Y. A. (1993), Properties of the Identification and isolation of the indole-3-pyru-
new obligatory oxalotrophic bacterium Bacillus vate decarboxylase gene from Azospirillum bras-
oxalophilus, Microbiology 62,378-382. ilense Sp7: Sequencing and functional analysis of
Z E N G ,P.,FARRENKOPF,
~. B., HoHMANN,S.,DYDA,F., the gene locus, Curr. Microbiol. 36,327-331.
FUREY, W., JORDAN, F. (1993), Role of cysteines in
3 Halocompounds
GARYK. ROBINSON
SIMON A. JACKMAN
JANE STRATFORD
Canterbury, UK
1 Introduction 175
1.1 Introductory Remarks 175
1.2 Distribution and Function 175
1.3 Reasons for Synthesis by the Host 178
2 Synthetic Importance of Halocompound Transforming Enzymes 179
2.1 Halogenation 179
2.2 Dehalogenation 181
3 Current Developments in Dehalogenase and Haloperoxidase Biochemistry and Genetics 181
4 Mechanistic Aspects of Biohalogenation 184
4.1 Natural Organohalogens 184
4.1.1 Chlorine and Bromine 184
4.1.2 Fluorine 184
4.1.3 Fluoroacetate 190
4.1.4 wFluorofatty Acids 190
4.1.5 Fluoroacetone 190
4.1.6 Nucleocidin 190
4.1.7 Fluorothreonine 190
4.1.8 Iodine 190
5 Enzymology of Biohalogenation 192
5.1 Haloperoxidases 192
5.1.1 Basic Mechanism 192
5.1.2 Natural Sources of Haloperoxidases 192
5.1.3 Haloperoxidase Classes 193
5.1.4 Enzyme Mechanisms 193
5.1.4.1 Heme Haloperoxidase 193
5.1.4.2 Vanadium Haloperoxidase 193
5.1.4.3 Non-Heme Non-Metal Haloperoxidase 195
5.1.4.4 FlavidHeme Haloperoxidase 196
174 3 Halocompounds - Biosynthesis and Biotransformation
5.1.5 Reactions of the Haloperoxidases 196

5.1.5.1 Phenols, Anilines, and other Aromatics 196
5.1.5.2 Alkenes 196
5.1.5.3 Alkynes 197
5.1.5.4 Cyclopropanes 197
5.1.5.5 P-Diketones 197
5.1.5.6 Nitrogen Atoms 197
5.1.5.7 Sulfur Atoms 197
5.1.5.8 Inorganic Halogens 198
5.1.5.9 Stereo- and Regioselectivity 198
5.2 Halide Methyltransferase 198
5.3 The Enzymes of Fluorine Metabolism 199
5.4 Advances Towards the Commercial Application of Biohalogenation 201
6 Dehalogenations 202
6.1 Introduction 202
6.2 Aliphatic Dehalogenation 203
6.2.1 Reductive Dehalogenation 203
6.2.2 Oxidative Dehalogenation 203
6.2.3 Hydrolytic Dehalogenation 204
6.2.4 Dehydrohalogenation 205
6.2.5 Epoxide Formation 206
6.3 Aromatic Dehalogenation 207
6.3.1 Reductive Dehalogenation 207
6.3.2 Oxidative Dehalogenation 208
6.3.2.1 Dioxygenase Catalyzed Dehalogenation 208
6.3.2.2 Monooxygenase Catalyzed Dehalogenation 210
6.3.3 Hydrolytic Dehalogenation 210
6.3.4 Dehydrohalogenation 211
6.4 Advances Towards the Commercial Application of Dehalogenases 211
7 Finalcomments 212
8 References 212
1 Introduction 175
1 Introduction ment of genetic information may be caused by

recombination or other mechanisms of gene
exchange, e.g., conjugation, transduction, or
1.1 Introductory Remarks transformation. It is clear that both vertical
and horizontal evolution have a role to play in
Haloorganic compounds are ubiquitous the development of catalysts which may be of
throughout all environmental matrices. Their use in organic syntheses but techniques which
levels range from ppb to saturation levels in facilitate this will not be discussed here.
water, soil, and air. The anthropogenic origin The present review will deal exclusively
of many of these compounds is not in question with the biosynthesis and biotransformation of
and has been the subject of many reports haloorganic compounds of potential interest
which have influenced environmental legisla- to those practitioners developing new routes
tion throughout the world. Aside from these of organic synthesis. Additionally, it will illus-
anthropogenic inputs, it is becoming clear that trate the diversity of substrates able to be
the natural formation of haloorganics plays a transformed by biological material, whether
major role in the global haloorganic balance. microbial, plant, or animal. It should be stated
The burden of halocompound transformation from the outset that microorganisms play a
and turnover falls on the major trophic level, central role in the transformation of halogen-
the microorganisms. It has been suggested by ated compounds. As a consequence the major-
PRIESet al. (1994) that the lack of halocom- ity of currently available information and the
pound biodegradation is due to biochemical obvious industry preference for microbial
rather than thermodynamic constraints, i.e., systems dictate that halotransformation by mi-
the fidelity of compound recognition by up- croorganisms forms the foundation of any re-
take proteins, regulatory proteins, or catabolic view on the subject. However, where appropri-
enzymes is insufficient for their transforma- ate, halotransformation or synthesis by non-
tion and degradation. Indeed, it is known that microbial sources will be discussed.
both oxidative conversion of chlorinated com-
pounds with oxygen as the electron acceptor
and reductive degradation to methanes or al- 1.2 Distribution and Function
kanes should yield sufficient energy to support
growth (DOLFING et al., 1993). The ubiquity of biological materials contain-
Despite the apparent recalcitrance of many ing a covalently bound halogen was thought
halogenated compounds it is clear that, pro- unlikely only a quarter of a century ago. In-
viding environmental conditions are favor- deed, FOWDEN (1968) undertook the first pub-
able, microbial populations may adapt to use lished review of naturally occurring organo-
these compounds as novel carbon and energy halogens and stated that:
sources. The genetic mechanisms of adapta- “present information suggests that organic
tion, especially relating to haloaromatic trans- compounds containing covalently bound halo-
formation have recently been reviewed (VAN gens are found only infrequently in living or-
DER MEER,1994).The author makes the clear ganisms.”
distinction between vertical evolution and hor- Today, approximately 2000 halogenated
izontal evolution. The former is brought about chemicals, predominantly chlorinated, are
by alterations in the DNA sequence which known to be discharged into the biosphere by
arise due to the accumulation of mutations. biological systems and natural processes
These may arise due to the presence of the ha- (GRIBBLE, 1992, 1994; VAN PEE, 1996). It is
logenated substrate itself or be accelerated in interesting to note that public perception and
the laboratory by the battery of mutagenic awareness of the incidence of halogenated
protocols available. Horizontal evolution oc- compounds in the natural environment is of-
curs when DNA sequences are exchanged ten concentrated, and rightly so, on anthropo-
between cells (intercellular movement) or genic inputs and their associated recalcitrance.
between plasmid and chromosomal DNA Such concerns are heightened by uninformed
(intermolecular movement). Horizontal move- statements such as that released by the Scien-
176 3 Halocornpounds - Biosynthesis and Biotransforrnation
tific Advisory Board to the International Joint shown to be at least 300 times greater than that
Commission on the Great Lakes which stated which can be accounted for purely by anthro-
that: pogenic sources (ASPLUNDand GRIMVALL,
“There is something nonbiological about 1991). AOX production has been shown to
halogenated organics (excluding iodinated take place during leaf litter degradation and
compounds). ...Chemicals [that] do not occur therefore the organisms responsible for degra-
naturally.. . are often persistent, since there dation of leaf litter, primarily basidiomycetes,
are often no natural biological processes to have been targeted (ASPLUND, 1995). Basidi-
metabolize or deactivate them.” omycetes produce a cross section of halometa-
The ignorance of this statement, made in bolites including chloromethane (HARPER,
1989,is clear when one considers the biological 1985) plus chlorinated anisoles (DE JONGet
contribution to atmospheric pollution by vola- al., 1994), orcinol derivatives (1) (OKAMOTO
tile hydrocarbons. Estimates of the industrial et al., 1993), hydroquinones (2) (HAUTZELet
production of chloride and fluoride as halohy- al., 1990) and diphenyl ethers (3-8) (Fig. 1)
drocarbons (1982-1984) put the release as (TAKAHASHI, 1993;OHTAet al., 1995). Recent-
2.28.10’* g and 0.273 lo1’ g, respectively, into ly, it as been shown that the ability to produce
the environment. However, the biological con- AOX is fairly ubiquitous, with 25% of 191
tribution, as chloromethane from oceans and fungal strains examined showing moderate
burning vegetation is put at l.4-3.5.1012 g (0.5-5.0 mg L-’) to high (5-67 mg L-’) AOX
(HARDMAN, 1991). The occurrence of organo- production (VERHAGEN et al., 1996).
halogens in nature is usually quantified in Today, it is recognized that a diverse array of
terms of the bulk parameter AOX (adsorbable organohalogens is produced by biological
organic halogen). This parameter has been systems. These range from the large volume
OR c1
OR’
1 2 Mycenon c1 Russuphelins D-F

aR=Me 3 R = R’ = Me, R2 = H; D
bR=CHO 4 R = Me, R1 = H,R2 = Me; E
5 R = H, R’ = R2 = Me; F
b+&
HO
OMe c1
cpcl
bcq:kLoH
Ho 6 R = Me; Russuphelin
OR
7 R = H; Russuphelin B
A
Me0
OH
8 Russuphelol
OH
Fig. l. Chlorinated aromatics from basidiomycetes.

1 Introduction 177
9 Nucleocidin 10 Blattellastanoside A
Fig. 2. Naturally occurring fluorinated nucleoside and cockroach aggregation pheromone.
but simple halogenated alkanes through to the The distribution of halogenation is outlined in
complex secondary metabolites such as nucle- Fig. 3.
ocidin (9) and the cockroach aggregation Although some of these pesticides have
pheromone (10) (Fig. 2). The simplest halogen- been superseded, the data illustrate two con-
ated alkane, chloromethane, is produced by a trasting requirements of interest in the present
wide cross section of biological systems includ- review:
ing marine algae (WUOSMAAand HAGER,
1990), wood rotting fungi (HARPER,1985), (1) Haloorganics are favored targets for
phytoplankton (GSCHWEND et al., 1985), and chemosynthesis because they possess a
the pencil cedar (ISIDOROV, 1990). As well as wide spectrum of biological activities.
species diversity it has been shown that prod- (2) Haloorganics often possess increased
uct diversity can occur within one species. recalcitrance contributing to their in-
Asparagopsis taxiformis, an edible seaweed fa- creased persistence in the environ-
vored by Hawaiians, produces nearly 100 ment.
chlorinated, brominated, and iodinated com-
pounds (MOORE,1977). Microbial biodegradation is considered to
It is clear that naturally occurring organo- be the most important route of breakdown for
halogens, while diverse and somewhat ubiqui-
tous, do not exert the same environmental
pressure as the man-made organohalogens. Multi-
These products, which are often used in rela- Halogenated
tively large amounts, necessitate the evolution 12%
of new detoxification mechanisms. In the ma-
jority of cases, the nature, position, and num-
ber of halosubstituents mirrors that found in
the natural organohalogens. However, it is clear Fluorinated
that manufactured organohalogens present a 17%
different set of problems to biosynthesized
organohalogens. lodinated
The diversity of organohalogens which are 1%
routinely used may best be illustrated by those Brominated ChlOrhlated
classes of compounds which are directly ap- 5% 65%
plied to the environment, namely the pesti-
cides. The current Pesticide Manual (TOMLIN,
1995) contains approximately 1500 pesticides Fig. 3. Distribution of halogenated pesticides (data
of which approximately 50% are halogenated. adapted from TOMLIN, 1995).
the majority of organic chemicals deposited in Whatever the number and diversity of halo-
soil and water and the addition of xenophores compounds the question which needs to be ad-
such as halosubstituents retards this process dressed is why invest metabolic energy in the
(HOWARD et al., 1992). In the pesticides out- synthesis of halocompounds? NEIDLEMAN and
lined above over 100 compounds possess two GEIGERT (1986) speculate that two major rea-
or more different halosubstituents. These com- sons exist:
pounds are obviously more recalcitrant than
the non-halogenated homologs and require (1) Halointermediates are key elements in
the development of specific detoxification biosynthesis.
mechanisms.The pressure to biodegrade pesti- NEIDLEMAN (1975) stated that:
cides is largely borne by microorganisms and “Microorganisms, ... have discovered the
the likelihood of transformation may be in- fact, as have organic chemists, that halog-
creased if the level of application is high. Obvi- enated intermediates, on pathways to non-
ously, abiotic mechanisms contribute to pesti- halogenated end products are useful de-
cide degradation but 52 of the halogenated vices.”
pesticides outlined above are applied at levels
>50 t a-l in at least 1 EU member country
(FIELDING, 1992) Consequently, the burden of
transformation of these compounds falls upon
biological systems and the mechanisms of
transformation will be outlined herein.
OH
1.3 Reasons for Synthesis
11
by the Host a X = H; Corynecin I
b X = C1; Chloroamphenicol
Both chlorine and bromine are ubiquitous
elements in terrestrial and marine environ-
ments. The earth contains 0.031% C1 and 0 s
0.00016% Br (w/w) (cf. 0.00005% I) in min-
erals and 19gL-’ C1, 65mgL-’ Br, and
0.05 mg L-’ I in seawater. The world’s oceans
compose over 70% of the earth’s surface and Me0
over 90% of the volume of its crust. Conse-
quently, the richest source of halometabolites
are the marine algae which, in a survey by 12 Griseofulvin
HAGER(1982), were shown to contain up to
20% of extractable halogenated compounds.
The marine habitat is complex, as evidenced
by the wide variations in pressure, salinity, and
temperature. Therefore, marine microorgan-
isms have developed unique metabolic and
physiological capabilities, offering the poten-
tial for the production of metabolites un-
known in terrestrial environments. Although HO 0 Ho 0 NH2
the present article stresses the synthesis of 13
halometabolites, such synthetic versatility is a X = H; Tetracycline
shown in the production of other, non-halog- b X = C1; Chlorotetracycline
enated compounds and the reader is directed
to other reviews for further information (FENI- Fig. 4. Common antibiotics possessing a halosub-
CAL, 1993;JENSEN and FENICAL, 1994 ). stituent.
2 Synthetic Importance of Halocompound TransformingEnzymes 179
Subsequent to this comment it has been counterparts. 7-Bromotetracycline has the

shown that halogenated intermediates are syn- same level of activity as 7-chlorotetracycline
thesized by a variety of synthetic pathways in- (13b) (PE’ITY, 1961) whereas pyrrolnitrin (15,
volving unsaturated carboxylic acids, cycliza- Fig. 5 ) is more efficacious as a chlorinated,
tion of isoprenoids, ring contractions, and rather than a brominated derivative (VANPEE
methyl migration to yield rearranged terpen- et al., 1983).The absence of the halogen atom
oid derivatives (FENICAL, 1979,1982).Many of may also cause different effects with respect to
these can be rationalized by the intervention antibiotic activity. Corynecin I (lla,Fig. 4),the
of halonium ion intermediates. dechlorinated analog of chloramphenicol
(llb), possesses only a fraction of the antibio-
(2) Halogenation enhances the bioactive effi- tic activity of its chlorinated congener (SUZUKI
cacy of most compounds. et al., 1972) whereas actinobolin (14a) and
As stated at the beginning of this introduc- bactinobolin (14b) have similar antibiotic ac-
tion the presence of halogen substituents in tivity (Fig. 5).
pesticides is commonplace. Why this should be Halocompounds (e.g., fluoroacetate (19,Fig.
so is evidenced by the wide variety of natural 13)) and halogenating enzymes are used for
organohalogens which possess antibacterial, defensive purposes by a variety of organisms.
antifungal, and antitumor activities. Chloram- This subject is beyond the scope of the present
phenicol (llb), griseofulvin (U), and chloro- article but has been reviewed (NEIDLEMAN
tetracycline (13b) are all common antibiotics and GEIGERT, 1986).
that contain chlorine (Fig. 4). However, it does
not necessarily follow that the efficacy of these
compounds is related to the type, number, and
position of the halogen atoms. The bioactivity
of bromo-analogs is usually very similar or less 2 Synthetic Importance
than their normally produced chlorinated
of Halocompound
Transforming Enzymes
0
2.1 Halogenation
A small number of functional groups occupy
a dominant position with regard to organic
synthesis.All of these groups, C=C (olefinic),
C=O (carbonyl), C=N (cyano), C-OH (al-
cohol), COOH (carboxyl), NH2 (amino), NO,
(nitro), and C=C (acetylenic) will have been
14 discussed within this volume as they are cen-
a X = H; Actinobolin tral to organic syntheses due to their ease of
b X = C1; Bactinobolin interconversion. Halides are examples of
much less central or peripheral groups which
”. are required in the target or simply provide ac-
tivation or control in the synthetic route. The
advantages of biohalogenation are no differ-
ent to those proposed for other enzyme cata-
lyzed reactions:
EfSicient catalysts - usually expressed as
turnover number, it has been shown to be ap-
15 Pyrrolnitrin proximately lo5 for chloro- and bromoperoxi-
Fig. 5. Microbial antibiotics possessing a halosub- dases (HAGERet al., 1966; MANTHEY and HA-
stituent. GER, 1981).
180 3 Halocornpounds - Biosynthesis and Biotransformation
Environmental acceptability - traditional the halide dependent reactions, halogenation

halogenation and dehalogenation methodolo- of P-diketones and halohydration, were cata-
gies use harsh reagents (Friedel-Crafts catalyzed by an acidic form of the enzyme.
lysts, Lewis acids, and heavy metal catalysts) The stereoselective haloperoxidase cata-
with high environmental impact. Furthermore, lyzed epoxidation of alkenes can be highly
unlike heavy metal catalysts, enzymes are enantioselective (COLONNA et al., 1993; AL-
completely biodegradable. LAIN et al., 1993) and does not require an allyl-
Mild reaction conditions - enzymes catalyze ic alcohol (cf. Sharpless epoxidation). Al-
reactions in the range, of pH 5-8, typically 5 though the abiotic enantioselective epoxida-
using haloperoxidases, and at temperatures of tion of alkenes which do not bear an allylic
2 0 4 0 "C. This minimizes problems of unde- alcohol group continues to be improved, the
sired side reactions, a major drawback to many reaction is currently only highly stereoselec-
chemosynthetic methodologies. tive with cyclic alkenes (VELDEand JACOBSEN,
Wide substrate specificity - enzymes may act 1995).
on a broad range of substrates giving a range The oxidation of sulfides to sulfoxides or
of variously substituted products. The central sulfones has been performed with many types
group of enzymes assumed to catalyze halo- of enzyme. With haloperoxidases in the ab-
compound synthesis, the haloperoxidases, are sence of halide ion the reaction is enantiose-
unusual in that their primary synthetic utility is lective and an oxygen from hydrogen peroxide
the halide independent reactions (ZAKSand is incorporated into the sulfoxide. Whereas in
DODDS, 1995). the presence of halide the rate is increased, the
Several general assay methods which permit reaction is not enantioselective, and there is no
the rapid screening for haloperoxidases (the oxygen incorporation from peroxide. This
main halogenating enzyme) have been em- clearly indicates that in the presence of halide
ployed including the use of monochlorodime- a freely diffusing species such as hypohalous
done (MCD) (16a) and phenol red (17a) as
substrates (Fig. 6). However, it is unlikely that
novel synthetic activity will always be evident
when employing limited substrates for discov-
ery. What are required (although it is difficult
to see how they may be devised), are specific
screens aimed at elucidating enantiospecific
halogenations. When considering potential
16
substrates for halogenation there are few
a R = H; monochlorodimedone
structural limits providing that they are rela-
tively electron rich, e.g., pyridine and pyrimi- bR=Br
dine are fairly unreactive towards haloperoxi-
dase unless an electron donating substituent is
present (ITOHet al., 1987b).Additionally, ole-
finic groups are fairly unreactive unless cou-
pled to an electron rich system, e.g., styrene.
The scope of reactions catalyzed by the ha-
loperoxidases, exemplified largely by the chlo-
0s03H
roperoxidases, is broad and can be subdivided
into halide dependent and halide independent
reactions. Halide independent asymmetric ox-
idations were recently studied by ZAKSand
17
DODDS(1995) who suggested the halide inde-
pendent reactions, epoxidation of alkenes, for- a R = H; Phenol red
mation of sulfoxides, aldehydes and nitroso b R = Br; Bromophenol blue
compounds and N-dealkylations, were cata- Fig. 6. Common substrates for screening haloper-
lyzed by a neutral form of the enzyme whereas oxidases.
acid reacts nonenzymatically with the sulfide and dehalogenation field the impetus has been
(or other substrate molecule) (PASTAet al., twofold:
1994).
There has been a drive towards under-
standing the degradative pathways in-
2.2 Dehalogenation volved in the transformation and mine-
ralization of organohalogens in the en-
Dehalogenation is a process normally asso- vironment. This has led to the develop-
ciated with the detoxification or amelioration ment of biochemical and molecular
of a recalcitrant halocompound. There are sev- techniques which have facilitated our
eral methods of dehalogenating but this re- understanding of dehalogenation.
view will concentrate on those catalyzed by There has been an attempt to better
specific enzymes. Dehalogenation which arises understand how single enantiomer
due to facilitated abiotic mechanisms, e.g., halocompounds are formed in nature.
spontaneous elimination of a halide ion after It has been said that “bacterial non-
ring cleavage of a haloaromatic compound, heme haloperoxidases are difficult to
will not be considered. All of the enzymatic isolate and are available in small quan-
mechanisms require at least one halogen tities” (WENGet al., 1991). Only now is
atom, which is removed and replaced by an- progress being made in this field but it
other atom, functional group, or is eliminated. still remains in its infancy, especially
In the case of reductive dehalogenation this when ascribing function to haloper-
will result in a molecule which is deactivated oxidases in vivo.
and, unless selective removal was being
sought, would be of limited synthetic use. All Both synthesis and degradation have relied
other dehalogenation mechanisms, oxygeno- on the development of molecular techniques
lytic, hydrolytic, thiolytic, epoxide formation, and a slow increase in the amount of sequence
dehydrohalogenation, and hydration result in data, both DNA and protein, available for
substitution of the halogen atom with a reac- manipulation and exploitation. Additionally,
tive carbonyl or alcohol group, with the excep- these approaches have caused us to re-evalu-
tion of dehydrohalogenation, an elimination ate the roles that enzymes such as haloperoxi-
reaction resulting in double bond formation. dase may play in halocompound synthesis.
In only a few cases has the genetics and bio-
chemical mechanism for introducing chlorine
been examined in detail. Indeed, following the
studies of chlorination in the fungus Caldario-
3 Current Developments myces jkmago, which confirmed that caldari-
in Dehalogenase omycin (18, Fig. 7) was chlorinated via a chlo-
roperoxidase catalyzed reaction, it was antici-
and Haloperoxidase pated this would be a generic mechanism.
While haloperoxidase catalyzed incorporation
Biochemistry and Genetics of halide is still generally accepted as the pri-
mary mode of halogenation, it has still proved
Biotransformations have come to the fore-
front of biotechnology over the last 10 years
due to the legislative drive towards single
enantiomer preparations in the agrochemical,
flavor and fragrance, and pharmaceutical mar-
kets (CANNARSA, 1996). The primary reasons
for this have been the selectivity of enzymes
and the potential to produce and manipulate 18 C aldariomy ci n
the whole cells and enzymes which catalyze
the reactions of interest. In the halogenation Fig. 7. Caldariomycin.
difficult studying the biochemistry and genet- ter argued that they have no role to play in the
ics of halogenated secondary metabolite synthesis of halometabolites. FACEYet al.
formation. The bacterial non heme-type ha- (1996) have recently shown that a bromoper-
loperoxidases differ greatly from the heme- oxidasexatalase gene from Streptomyces ve-
type and vanadium containing haloperoxi- nezuelue is not required for chlorination in
dases. Moreover, it has been shown that the chloramphenicol (llb,Fig. 4) synthesis. How-
bacterial haloperoxidases form a totally dis- ever, the non-heme chloroperoxidase from
tinct enzyme family for which the catalytic Pseudomonus pyrrocinu has been shown to be
mechanism is still poorly understood (see Sect. involved in the synthesis of pyrrolnitrin (15,
5.1.4). Fig. 5) (PELLETIER et al., 1995).
Chloramphenicol (llb,Fig. 4),probably the As mentioned previously, there are seven
best known chlorinated antibiotic is believed mechanisms for dehalogenating compounds.
to be chlorinated due to the action of a chloro- The biochemistry and genetics of these
peroxidase (NEIDLEMAN and GEIGERT, 1986). systems have been thoroughly reviewed by
It is produced by Streptomyces venezuelue, FETZNER and LINGENS (1994) and JANSSEN et
from which bromoperoxidases but not chloro- al. (1994) and only a cursory glance and update
peroxidases have been isolated. It is well will be provided here. The naming of dehalo-
known that chloroperoxidases will catalyze genases, particularly those involved in haloali-
the incorporation of both chloride and bro- phatic metabolism,has been confused and this
mide whereas bromoperoxidases will only, due has only started to be addressed. SLATER,
to thermodynamic constraints, catalyze bro- BULL,and HARDMAN (1995) have attempted
mide incorporation.Presently, using molecular to categorize the various dehalogenating en-
techniques,there is no report of a chloroperox- zymes on the basis of their mechanism and
idase being probed and found in an organism substrate range with further subdivisions to
known to produce a chlorometabolite. To the take into account molecular descriptors such
authors knowledge, sequence information is as protein and DNA sequence homology. Ulti-
only available on a very limited number of ha- mately this approach will lead to complete de-
loperoxidases as follows (information taken scriptions of the genetic and evolutionary rela-
from the European Bioinformatics Institute tionships between classes and a classification
WWW site,http://www. ebi.uc.uW): of the different enzyme mechanisms which are
Chloroperoxidases - sequenced from Cul- undoubtedly involved in dehalogenation by
duriomyces fumugo (NUELLet al., 1988), Cur- reference to significant tertiary structures.
vuluriu inequalis (SIMONS et al., 1995), Pseu- Currently, the classification of dehalogenas-
domonas pyrrocina (WOLFFRAMM et al., 1993), es is largely dependent on mechanism and can
and Streptomyces lividuns (BANTLEON et al., best be summarized as follows:
1994). Another sequence from Pseudomonas
jluorexcens is available but unpublished (PEL- (1) Reductive dehalogenation- largely as-
LETIER et al., 1995). sociated with anaerobic environments,
Bromoperoxidases - sequenced from Strep- but not well characterized (Fig. 8)
tomyces venezuelue (FACEYet al., 1996) and (DOLFING and BUERSKENS, 1995).
Streptomyces uureofuciens (PFEIFERet al., (2) Oxygenolytic dehalogenation- arylhal-
1992;PELLETIER et al., 1994). ide dehalogenation,usually, involves
Additionally,the role of the haloperoxidases temporary loss of aromaticity and labil-
in the synthesis of halometabolites is not un- ization of the halogenated molecule by
equivocally established, indeed it maybe bet- the introduction of oxygen.This is not
cl+(c*
c1 c1
+ XH ”#”’
c1 c1
+ 00 + x0
Fig. 8. Reductive dehalogenation.

Fig. 9. Oxygenolytic dehalogenation.
considered a true dehalogenase in the nine and serine-0-sulfate undergo

context of the present review but the elimination via imines formed with
genetics have been extensively investi- pyridoxal phosphate, followed by con-
gated and reviewed due to their impor- jugate nucleophilic addition and hy-
tance in biodegradation (Fig. 9) (FETz- drolysis of the imine to give overall a
NER and LINGENS, 1994). substitution product (CONTESTABILE
( 3 ) Dehalogenation via epoxide formation and JOHN,1996;NAGASAWA and YAMA-
- dehalogenation of haloalcohols to DA, 1986).
give epoxides (Fig. 10) is frequently fol- ( 5 ) Hydrolytic dehalogenation- the most
lowed by hydrolysis of the epoxide to a common dehalogenation mechanisms
diol, catalyzed by an epoxide hydro- are hydrolytic, and these are fairly
lase. The dehalogenation is catalyzed ubiquitous throughout the substrate
by lyases which have been variously range (Fig. 12).Whether thiolysis, hy-
termed halohydrin epoxidases (CAS- dration, or other hydrolytic reactions,
TRO and BARTNICKI, 1968),haloalcohol they all fall within the classification
dehalogenases and haloalcohol halo- system put forward by SLATER,BULL,
gen-halide lyases (VAN DEN WIJN- and HARDMAN (1995).All enzymes
GAARD et al., 1989,1991),and halohy- catalyzing this type of reaction may be
drin hydrogen-halide lyases (NAGA- classified into 3 groups: hydrolytic de-
SAWA et al., 1992). Recently, two halo- halogenases, haloalcohol dehalogenas-
hydrin hydrogen-halide lyases from
Corynebacterium sp. have been cloned,
sequenced, and expressed in E. coli
(Yu et al., 1994).
(4) Dehydrohalogenation- dehalogena-
tion via dehydrohalogenation is not a
common mechanism (Fig. 11). The
x
most often cited, and possibly unique Fig. 10. Dehalogenation via epoxide formation.
example, involves the elimination of
hydrogen chloride from y-hexachloro-
cyclohexane (lindane) (82), to give se-
quentially: y-pentachlorocyclohexene
(83) and 1,3,4,6-tetrachloro-l,4-cyclo-
hexadiene (84).The enzyme, termed
dechlorinase, is encoded on the chro- x
mosome in Pseudomonas (or Sphingo-
monus)paucimobilis.The gene (linA) Fig. 11. Dehydrohalogenation.
-
has been cloned, sequenced, and ex-
pressed in E. coli (see Fig. 32) (IMAIet
al., 1991). R-X R-OH
Amino acids with good leaving groups
at the P-position such as pchloroala- Fig. 12. Hydrolytic dehalogenation.
es, and cofactor dependent dehaloge- 4.1 Natural Organohalogens

nases, which are further subdivided
into 3 subgroups and 8 classes. The
basis for these divisions is primarily 4.1.1 Chlorine and Bromine
mechanistic but is supported and
endorsed by extensive DNA and amino Tab. 1 is a survey of natural organohalides,
acid sequence information. collated according to biogenic origins and
structural type. No attempt has been made to
give an exhaustive list of organohalogens as
new metabolites are being discovered all the
4 Mechanistic Aspects of time. Compounds of pharmaceutical or agro-
chemical value are indicated, but the reader is
Biohalogenation referred to cited original references for more
details on the structures of interest.
The development of our understanding of The most abundant halogenated organics
the nature of biological halogenation has pro- are alkane derivatives produced either through
gressed along traditional investigative lines. natural combustive processes or as metabolic
Beginning with the identification of halogenat- products in marine algae. Combustion of
ed compounds from different species and the plants, wood, soil, and minerals containing
possible elucidation of their function, it has chloride ions leads to the formation of orga-
progressed to consider the biosynthetic path- nochlorine compounds, but a larger contribu-
ways involved. From this point, the individual tor to these sinks is the action of volcanoes,
enzymes involved in each transformation are with halocarbons such as chloromethane being
identified, and it is then the role of the biotech- produced at the rate of 5-106t a-' (RASMUS-
nologist to seek to apply these enzyme proc- SEN et al., 1980), cf. 26000 t from anthropogen-
esses to the production of compounds of inter- ic inputs (HARPER, 1985). Natural volcanic ac-
est and value. A plethora of literature is now tivity has also been shown to produce more
available concerning halogenated metabolites complex highly toxic organohalogens such as
identified in bacterial and algal species. While chlorofluorocarbons (CFCs), dioxins, and cer-
it would appear that most halogenations pro- tain polychlorinated biphenyl (PCB) congen-
ceed through a single ubiquitous route, namely ers. A considerable proportion of simple ha-
that catalyzed by the haloperoxidases, the de- logenated alkanes are produced in the oceans
velopment of standard assays for these en- by marine algae, together with smaller quan-
zymes has failed to detect novel catalysts. Only tities of more complex halogenated metab-
the identification of novel natural products olites (MOORE,1977; WOOLARD et al., 1976;
can give some early indication as to their route FENICAL, 1974).
of biosynthesis.
In this discussion of biohalogenation, we
will therefore summarize the broad range of
organohalogens found in nature, drawing par- 4.1.2 Fluorine
ticular attention to those which have enhanced
our understanding of the process and those Very few organofluorines have been isolat-
that have led to technological advances in this ed from biological material to date, with none
area.This forms a very suitable backdrop from of these coming from the animal kingdom or
which to enter into the more detailed analysis marine organisms. It is thought that the main
of biosynthetic routes and enzymology. Once reason for the scarcity of fluorine containing
again, following the same thread of investiga- compounds is the high heat of hydration of the
tion, this section will be rounded off with a fluoride ion which severely restricts its partici-
summary of the developments of biohalogena- pation in biochemical processes (Tab. 2). In ad-
tion as a technology in its application to the dition, fluorine has a major electronic effect
manufacture of compounds that are of com- upon compounds in which it is incorporated,
mercial significance. restricting their further metabolism.
Tab. 1. Natural Organohalogens
Compounds Source Propertiedother Details Reference
Terpenes
- mixed chlorinated aquatic red algae - Laurentia and Plocamium wide range of mono- and polychlorinated monoterpenes, 1
and brominated sesquiterpenes - cytotoxic and antitumor agents 1
- chlorinated soft corals diterpenes and a tetraterpene 1
marine sponges - Acanthella terpenes with rare isonitrile functionality 1
ferns and related species 10 sesquiterpene indanones 1
Streptomyces (Australian) naphthalenequinone
basidiomycete Armillaria ostoyae 5 chlorinated aryl-sesquiterpene metabolites
- brominated green algae - Neomaris annulata herbicides 1
Cymopolia barbata cymbarbatol - antimutagenic 1
Nonterpenes
- chlorinated and marine red algae - Laurencia large variety including 6 cyclic ethers, some of which are
brominated allenes 1
- chlorinated Pseudomonas sp. bactobolin B 1
Gluconobacter enacycloxin I1 (dichloropolyenic antibiotic) 1
fungus - Chaetomium globosum 4 metabolites incl. chaetovirdin and a unique shikimate
derivative 1
terrestrial plants - e.g., Rehmannia glutinosa 15 iridoid derivatives 2
blue-green alga - Nostoc linckia 4 paracyclophanes 1
- brominated marine sponge - Haliclona sp. 2 bromotetrahydropyrans 1
Amino acids and peptides

-chlorinated marine sponge - Dysidea herbacea 4 trichloromethyl metabolites including dysidin and 1
dysidenin (could produce CHCl=CH,Cl by elimination)
Streptomyces and Pseudomonas spp. amino acids and peptides many of which are potent anti-
bacterials 1
S. griseosporus y-chloronorvaline 1
F! syringae 4-chlorothreonine
blue-green alga - Anabaena sp. cardioactive cyclic peptide puwainaphycin containing
3-amino-l4-chloro-2-hydroxy-4-methylpalmitic acid 1
Alkaloids rarely contain halogens

- chlorinated terrestrial plants - Sinomenium acutum acutumine and acutumidine 1
Melodinus celastroides 2-bis-indole alkaloids 1
microorganisms - Streptomyces sp. clazamycins A and B
Tab. 1. Natural Organohalogens (Continued)
Compounds Source Propertieslother Details Reference
Steroids rarely contain halogens

- chlorinated plants - Withania somnifera and others withanolides (e.g., physanolactone) and associated compounds
(e.g., jaborochlorodiol) 1
Fatty acids, prostaglandins, and lipids
- chlorinated edible jellyfish and white sea jellyfish 6 fatty acid chlorohydrins 1
octocoral Telesto riisei and stolonifer 8 novel chlorinated prostaglandins, several with antitumour
Clavularia viridis activities
fresh water algae, e.g., Ochromonas danica chlorosulfolipids 1
- brominated seeds of Eremostachys molucelloides 9,lO-dibromo- and 9,10,12,13-tetrabromostericacids 1
marine sponges - Xestospongia and Petrosia series of novel bromo acids 1
Pyrroles reactivity leads to a large number in nature
- chlorinated bacterial - Pseudomonas aeruginosa pyroluteorin - antibiotic 1
Pseudomonas pyrrocinia pyrrolnitrin 3
Streptomyces sp. pyrrolomycin B and an optically active pyrrolomycin 1
Actinomyces sp. pyrrolomycin A 1
Actinosporangium vitaminophilum 10 related pyrrolomycins 1
- brominated marine bacterium - Chromobacterium sp. polybrominated pyrroles ?
marine sponges, e.g., Hymeniacidon mono- and dibromophakellin 4
Agelas sceptrum sceptrin (contains cyclobutane) 1
Hymeniacidon sp. 3 bromopyrrolopyrimidine 1
Astrosclera willeyara dibromoageliferin 5
Indoles
- chlorinated terrestrial plants, e.g., Pisum sativum 4-chloroindole ester and carboxcylic acid
blue-green alga - Hapalosiphon fontinalis 12 chlorinated isonitriles 1
sponges, e.g., Batzella sp. 6 chlorinated metabolites with tryptamine nitrogen attached
to C-4 indole position 1
microbe Penicillium crustosum 3,6-chloroindole metabolites - very high structural complexity 1
- brominated mollusks - Dicathais and Murex sp. Vrian Purple (indigo derivative) 1
acorn worm - Glossobalanus sp. 2 dibromoindoles 1
red alga - Laurencia brongniartii 4 polybromoindoles 1
marine Pseudomonas sp. 6-bromoindole-3-carboxaldehyde 1
sponge - Pleroma manoui bromoester and hydroxyketone 1
Iotrochota sp. indole acrylate 1
sponges 5- and 6-bromo and 5,6-dibromotryptamines, 6
6-bromohypaphorine 7
Tab. 1. Natural Organohalogens (Continued)
tunicates and sponges dimeric tryptamines and brominated bis-indoles 1

sponges and related marine organisms brominated indole hydantoins, cyclic peptides incorporating
2-bromotryptophan 1
blue-green algae - Rivularia firma 6 novel polybrominated diindoles 1
Carbazoles comparatively rare in comparison to unhalo-

genated carbazoles
- chlorinated blue-green alga - Hyella caespitosa chlorohyellazole
bovine urine 3-chlorocarbazole 1
Carbolmes
- brominated tunicates, e.g., Eudistoma glaucus 25 different brominated P-carbolines 1
IndoIocarbazoIes
- chlorinated microbes and fermentation broths 5 halogenated indolo[2,3-a]carbazoles 1
e.g., Nocardia aerocolonigenes e.g., rebeccamycin - anticancer activity 1
Quinolines
- chlorinated Streptomyces nitrosporeus virantmycin 1
young corn roots - Zea mays glycosyl metabolite 1
- brominated marine bryozoan - Flustra foliacea bromoquinoline 1
Furans and benzofurans

- chlorinated plant - Gilmaniella humicola benzofuran mycorrhizinol 1
- brominated sponge - Dendrilla sp. 2-bromofuran 1
Thiophenes
- chlorinated plants, e.g., Pterocaulon 5 chlorinated thiophenes 1
Nucleic acids
- chlorinated Actinomyces sp. 2 '-chloropentostatin 1
- brominated sponge - Echinodictyum sp. novel brominated purine 1
Miscellaneous heterocycles
- chlorinated plants and fungi chlorinated xanthones
plants isocoumarins
- brominated red alga - Ptilonia australasica unusual polybrominated pyrines
P
Tab. 1. Natural Organohalogens (Continued) 00
W
Aromatic compounds
- chlorinated and deep sea gorgonian halogenated azulenes
brominated
- chlorinated basidiomycetes (8 genera) chlorinated anisyl metabolites
basidiomycetes (6 genera) e.g., drosopholin A
Mississippi salt marsh “needlerush” 1,2,3,4-tetrachlorobenzene
&
Phenols and phenolic ethers I
- chlorinated and sea organisms, e.g., mollusk Buccinum undatum halogenated tyrosines, e.g., 3-chloro-5-bromotyrosine- 1 5
brominated stabilization of structural proteins 0
marine sponges mixed bromochlorodiphenyl ethers 1 93
- chlorinated soil Penicillium sp. range of dichlorobiphenyls 3
2
- brominated acorn worm 2,6-dibromophenol- defense mechanism 1 E;.
sponges metabolites derived from brominated tyrosine 1 n
a
FL
Anthraquinones
- chlorinated fungus - Dermocybe 5-chlorodermolutein and 5-chlorodermorubin 1
Dioxins and related compounds

- chlorinated soil and water microbes using horseradish PCDDs and PCDFs from chlorophenols
peroxidase
3
1:GRIBBLE(1992); 2: KITAGAWA et al. (1995); 3: ELANDER et al. (1968); 4:KOBAYASHI et al. (1991);5: WILLIAMS (1996);6: SEARLEand
and FAULKNER
MOLINSKI(1994); 7: KONDOet al. (1994);8: FIELDet al. (1995);9 SPINNLER et al. (1994).
4 Mechanistic Aspects of Biohalogenation 189
Comparison of the Physicochemical Properties of the Halides (data taken from HARPER
Tab. 2. and
O'HAGAN,1994)
Bond Dissociation Bond Length Hydration Electronegativity

Energy CH,-X (C-X) Energy, X- (Pauling Scale)
[kcal.mol-'] [A1 [kcal .mol- '1
Halide
F 110 1.39 117 4.0
c1 85 1.78 84 3.0
Br 71 1.93 78 2.8
I 57 2.14 68 2.5
H 99 1.09 - 2.2
Of the ten known organofluorine metab- Although this review deals exclusively with
olites (Fig. 13), six are modified carboxylic organohalogens, it is of passing interest to note
acids (19-24) from the plant Dichapetalurn the peculiarly high accumulation of the inor-
toxicarurn. While most of the compounds are ganic fluoride K,SiF, in the marine organism
elaborated by plants, the production of fluo- Halichondria moorei to 10% of dry weight
rothreonine (27) and nucleocidin (9) from from seawater containing 1.3 ppm fluoride
streptomycetes suggests that bacteria may also (GREGSON et al., 1979). This salt is a potent
be good sources for fluorinated structures anti-inflammatory and may act as part of the
(MEYERand O'HAGAN, 1992a). defense mechanism of the organism.
F(CH2)n- CO2H 9 CO2H

19 n = 1; Fluoroacetate
20 n = 9; 10-Fluororcapric acid
10
18
F
21 n = 13; 14-Fluoromyristic acid
22 n = 15; 16-Fluoropalmitic acid 23 18-Fluorooleic acid
24 ~hreo-18-Fluoro-9,lO- 25 Fluoroacetone 26 2R,3R-Fluorocitrate

dihydroxystearic acid
OH 0 0
F @NH,
OH OH
27 Fluorothreonine 9 Nucleocidin
Fig. 13. Naturally occurring organofluorine compounds.

4.1.3 Fluoroacet at e 4.1.6 Nucleocidin

Fluoroacetate (19) is the most ubiquitous Nucleocidin (9) was isolated from Strepto-
fluorine metabolite (HARPERand O’HAGAN, myces calvus, found in an Indian soil sample.
1994). It was first identified in the southern Plausibly, it could be formed by oxidation of
African plant Dichapetalum cymosum, and the ribose ring of adenosine to the correspond-
subsequently in over 40 other plant species ing lactol, followed by substitution of the lactol
from Africa, Australia, and South America. hydroxyl group by fluoride and sulfamoylation
The richest single source is D. bruunii seeds (MAGUIRE et al., 1993).
which contain up to 8000 ppm of dry weight,
but no wfluorofatty acids (O’HAGANet al.,
1993). 4.1.7 Fluorothreonine
Fluoroacetate (19) is also produced by the
bacterium Streptomyces cattleya together with The second bacterial organofluoride,
fluorothreonine (27). The mechanism of fluo- (2S,3S)-fluorothreonine (27) was discovered
roacetate biosynthesis has not been elucidat- during attempts to optimize the production of
ed, but some possible routes are described in thienomycin by Streptomyces cattleya. Fluoro-
Sect. 5.3. Fluoroacetate is toxic to all cells, due acetate was also identified. The source of fluo-
to the lethal synthesis of 2R,3R-fluorocitrate ride was traced to casein (containing 0.7% in-
(26). This is a competitive inhibitor of aco- organic fluoride) used in the media. No fluo-
nitrase (citric acid cycle) and probably binds rothreonine was produced when it was absent
irreversibly to mitochondria1 citrate transport- from the media and production could be re-
ers (MEYERand O’HAGAN,1992a). stored by 2 mM potassium fluoride supple-
ments (SANADA et al., 1986).The stereochem-
istry of fluorothreonine (27) is the same as
natural (2S,3R)-threonine (i.e., L-threonine)
4.1.4 w-Fluorofatty Acids (AMINet al., 1997), although the Cahn-Ingold-
Prelog assignment of C-3 is different because
Seeds from Dichapetalum toxicarum metab- of the fluorine substitution.
olize fluoroacetate to wfluorofatty acids, pre-
sumably as the starter unit for fatty acid syn-
thetase(s). The major product is 18-fluorooleic 4.1.8 Iodine
acid (23), with minor quantities of the capric
(20), myristic (21),and palmitic (22) analogs While iodine is less abundant than chlorine
plus the dihydroxylated stearate (24) (HARPER or bromine, a significant number of iodinated
et al., 1990). All of the wfluorofatty acids are metabolites have been isolated to date, al-
very toxic to cells. though they are rare compared to bromo and
chloro natural products. However iodome-
thane has been detected in the oceans and
measurements suggest up to 4 -106t a-’ is pro-
4.1.5 Fluoroacetone duced by marine algae and kelp. The tunicate
Didemnum sp. produces an aromatic diiodide
Homogenates of plants such as Acacia (28) to a concentration of 0.4% dry weight (Fig.
georginae convert inorganic fluoride into vola- 14) (SESINand IRELAND,1984),and the marine
tile organofluorine compounds, the major sponge Geodia sp. produces a cyclic peptide
component of which is fluoroacetone (25) (PE- containing either a 2-iodo- or 2-bromophenol
TERS and SHORTHOUSE, 1971). It is believed moiety (29,30) (CHANet al., 1987). The iodo
that this pathway is an aberration of fatty acid analog (29) is also produced by the sponge
synthesis. Fluoroacetone (25) has also been Pseudaxinyssa sp. together with the chloroana-
detected in livers of rats perfused with fluo- log (31) plus the corresponding nor-methyl
roacetate (MIURAet al., 1956). compounds (32-34) (DESILVAet al., 1990).
4 MechanisticAspects of Biohalogenatiorr 191
Geodiamolides A-F
R = Me
29 X = I; A
30 X = Br; B
31 X = C1; C
R=H
32 X = I; D
OMe OMe 33 X = Br; E
28 34 X = C1; F
Fig. 14. Organoiodine compounds isolated from marine organisms.
The calicheamicinse.g. (35-41) are extreme- In higher organisms, thyroxine (42) within
ly potent DNA cleaving agents (enediyne anti- the thyroid of mammals is the most well-
biotics, SMITHand NICOLAOU, 1996) which are known and studied iodocompound. Details of
produced by Micromonospora echinospora the action of the peroxidase will be dealt with
ssp. calichensis. During attempts to optimize below.
the fermentation conditions for the bromo-
compounds (37,39), sodium iodide was added
to the media and the iodo compounds (35,36,
38,40,41) were discovered (Fig. 15) (LEEet al.,
1991,1992).
SSSMe
Am =
Calicheamicins a 4 OR1
Rh =
"5 OH
X R' R2 R3 I
35 I H Am Et :
a
36 I Rh H :
a
37 Br Rh Am 'Pr BIB*
38 I Rh Am 'Pr p: @ozc
39 Br Rh Am Et ylBr 1
1
40 I Rh Am Et yt
42 Thyroxine
41 I Rh Am Me 6,'
Fig. 15. Organoiodine compounds.

192 3 Halocompounds - Biosynthesis and Biotransforrnation
5 Enzymology of little advantage over conventional chemical

methods.
Biohalogenation The reactivity of a halonium ion (X’) in-
creases as the stability of the counterion in-
creases. As noted above, in water, this will usu-
5.1 Haloperoxidases ally be hydroxyl to give a hypohalous acid
(XOH). As the halide concentration increases,
5.1.1 Basic Mechanism elemental halogen (X,) or trihalide (X;) will
be formed which are more reactive. Under the
Haloperoxidases catalyze halogenation by normal conditions of haloperoxidase reactions
species which are “synthetically equivalent” to such species will halogenate electron rich aro-
halonium ions (X’). These are produced by matics or undergo addition to double bonds.
oxidation of halide (X-) by a peroxide (Fig. Iodine has the lowest oxidation potential and
16). Under normal aqueous conditions for an hence iodination is the most favored reaction,
enzymatic reaction, the halonium ion will have with bromination and chlorination requiring
hydroxyl as the counter ion and hence will be a increasing levels of activation of the site for
hypohalous acid (HOX). The halide can be halogenation. Consequently, each iodoperoxi-
iodide, bromide, or chloride. The oxidant po- dase is only able to use iodide as substrate,
tential of the halides increase in the sequence whereas a bromoperoxidase can brominate or
I - < B r - < C l - < F - . Peroxide is not able to iodinate and a chloroperoxidase can use all
provide the oxidation potential for fluorina- three halides. If halide concentrations are too
tion and, therefore, there are no fluoroper- low to give an appreciable reaction with the
oxidases. peroxide, this may also react, e.g., with alkenes
The reaction in Fig. 16 is shown with hydro- to give epoxides.
gen peroxide as the oxidant, however any per- Haloperoxidases are widespread among
oxide (including one bound at an enzyme ac- plant, bacterial, and animal species with the
tive site) can participate in the reaction. If the largest range having been found in algal and
hypohalous acid is bound to an active site (i.e., bacterial isolates (VANPEE, 1996). Attempts
Enz-OBr) it may react with organic substrates to find useful haloperoxidase activity have
with useful regiq- or stereoselectivity, howev- spawned ventures into exotic locations. A
er, if it diffuses into solution it will have identi- team from the Scripps Oceanographic In-
cal reactivity to that of “chemically generated” stitute studied marine red and green algae
hypohalous acid. The majority of current evi- and found 50 bromoperoxidases (HEWSON
dence suggests that free hypohalous acid is and HAGER,1980). The Cetus Corporation
produced in most if not all cases, although searched fungal populations in Death Valley
results from a vanadium bromoperoxidase and found 80 chloroperoxidases (HUNTERet
(TSCHIRRET-GUTH and BUTLER,1994) and al., 1984). The latter search yielded some po-
some non-heme haloperoxidases (BONGSand tentially useful enzymes which will be dis-
VAN PEE, 1994; FRANSSEN, 1994) indicate sub- cussed in more detail below.
strate binding. Haloperoxidase reactions in
-
which free hypohalous acid is produced have
5.1.2 Natural Sources of
H202 + X- + H+ HOX + HzO Haloperoxidases
Little is known of the role of haloperoxidas-
es in nature, though it is thought that their pri-
mary function may be as part of the defense
mechanism of the cell (FRANSSEN and VAN DER
RX + H2O PLAS,1992).Several algal metabolites are tox-
ic to predatory organisms, in addition mam-
Fig. 16. Haloperoxidase mechanism. malian myeloperoxidase (LI et al., 1994) and
eosinophil peroxidase both produce hypo- 5.1.4 Enzyme Mechanisms

chlorous acid which kills target cells for leuko-
cytes, including microorganisms such as Staph-
ylococcus aureus (MCCORMICK et al., 1994). 5.1.4.1 Heme Haloperoxidase
Lactoperoxidase is able to produce hypobro-
mous acid which oxidizes thiocyanate to the The basic mechanism can be summarized as
antimicrobial hypothiocyanate. Having high- follows. Hydrogen peroxide reacts with the na-
lighted this defensive role, there is such a di- tive enzyme producing “Compound I” in
versity of halogenated metabolites, especially which the ferriprotoporphyrin IX prosthetic
in algal and bacterial species that other roles group is two oxidizing equivalents above the
for these compounds in cellular processes can- native state (Fig. 17, Step 1). Compound I is
not be ruled out. unstable and is able to react with alkenes
(epoxidation), sulfides, or halide ions to give
Compound EOX (Step 2).This is also very un-
5.1.3 Haloperoxidase Classes stable and decomposes to yield the oxidized
halide (Step 3) which is the halogenating agent
The haloperoxidases may be divided into for the organic substrate (Step 4). The halo-
four distinct categories according to the pros- peroxidase is inactivated by reaction with hy-
thetic group. In order of their relative abun- pohalous acid and consequently the reaction
dance in the organisms studied to date, they rate slows down as the reaction progresses
are as follows: (WAGENKNECHT and WOGAN, 1997).
The first heme haloperoxidase to be purified
(1) Heme (heme-thiolate) containing and characterized was the bromoperoxidase of
haloperoxidases; Penicillus capitatus, a homodimer of 97 kDa
(2) Vanadium haloperoxidases (VILTER, subunits each containing one heme (MANTHEY
1995;BUTLERand WALKER, 1993); and HAGER,1981). Recently, a chloroperoxi-
(3) Non-heme non-metal haloperoxidases; dase and a bromoperoxidase were purified
(4) Flavin/heme haloperoxidases. from Streptomyces toyocaensis (MARSHALL
and WRIGHT,1996).
Early studies indicated that all haloperoxi-
dases contained a heme prosthetic group, with
the iron atom ligated to a cysteine thiolate in 5.1.4.2 Vanadium Haloperoxidase
an arrangement similar to that of the cyto-
chrome P450s. In 1984 the first vanadium con- Non-heme vanadium haloperoxidases (VIL-
taining non-heme haloperoxidase was ob- TER, 1995; BUTLERand WALKER,1993) are
tained from the brown alga, Ascophyllum no- generally more stable than heme enzymes to
dosum (pigweed) (VILTER,1984) and subse- higher temperatures and organic solvent
quently non-heme non-metal haloperoxidases systems (DE BOER et al., 1987) but the en-
and flavidheme haloperoxidases were discov- zymes isolated to date generally have a lower
ered. A summary of haloperoxidase producing specific activity than the heme enzymes.
organisms and isolated haloperoxidases is All vanadium bromoperoxidases are similar
shown in Tab. 3. The heme chloroperoxidase of in structure and amino acid composition, being
Caldariomyces fumago (which produces cal- acidic in nature with 65000 kDa subunits and
dariomycin (18,Fig. 7)) is the most extensively 0.4 vanadium atomshubunit. In the catalytic
studied as well as the most stable haloperoxi- mechanism, hydrogen peroxide binds to the
dase in use at the present time. It can be pro- vanadium to form a vanadium-peroxo com-
duced at concentrations up to 280 mg L-’ in plex to which the halide ion binds. The result-
batch culture (CARMICHAEL and PICKARD, ing complex breaks down with the release of
1989;PICURD et al., 1991) but the enzyme dis- the oxidized halide species (HOX or XJ. This
plays no significant stereoselectivity. Prelimi- enzyme is also able to catalyze chlorination
nary X-ray crystal structure data has been re- although at a slower rate than for bromination.
ported (SUNDARAMOORTHY et al., 1995). The detailed role of the vanadium as an elec-
+
Tab. 3. Haloperoxidase Producing Cells and Isolated Enzymes \o
P
Source Substrate(s) Notes Reference
Chloroperoxidase [u
Caldariornycesfurnago ATCC 16373,58814 phenol ether; C1, Br isolated enzyme from Sigma 1
and 11925 (Woronichin) - heme containing phenols; C1, Br, I cloned and expressed in E. coli and Streptomyces lividans 2
anilines; C1, Br
pyrazoles, pyridines; C1
nucleic bases; C1, Br, I
Streptornyces aureofaciens - vanadium phenylpyrroles; C1, Br 1 E
nikkomycin; Br 3
obscurolide; Br &
I
phenol; Br
Pseudornonas pyrrocinia - vanadium indole; C1, Br tn
8’
phenylpyrroles; C1, Br
Notornastus lobatus - flavidheme phenols; C1, Br 3
s
8
Curvularia inequalis high stability to peroxide, purified and characterized G.
Eosinophil peroxidase human gene cloned
Q.
2
Bromoperoxidase 5
Pseudornonas aurofuciens ATCC 43 051 pyrrol to pyrrolnitrin
Ascophyllurn nodosum - vanadium phenols; Br, I 5 3
phenol r e d Br Q
Corallina pilulifera - vanadium nucleic bases; Br, I 1
phenols; Br
2
Streptornyces phaeochrornogenes z
=.
Penicillus cuptitatus (green alga) -heme 0
3
Phanaerochaete chrysosporiurn ligninase - heme 4
Rhodophyta
Chlorophyta
Phaeophyta
Milk, saliva, and tears
Iodoperoxidase
Lactoperoxidase from bovine milk - heme phenols; I purified enzyme - Sigma, Calbiochem. 1
estrone; I immobilized on Sephadex beads - Sigma
immobilized with glucose oxidase on enzymobeads - Bio-Rad
bovine and human cDNAs cloned
Horseradish root purified enzyme - Sigma, Calbiochem.
Thyroid peroxidase phenols; I 1
Turnip root
Phaeophyta
~~~~ ~
1: GRIBBLE et al. (1992);4: SCHNEIDER et al. (1996); 5: VAN PEE (1990).

(1992)~2:VANSCH1JNDELet al. (1993); 3: ROMANO
RH
Enz-Fe3+-PP
Rx
Step 3
HZO
PP = Protoporphyrin IX
Enz-Fe3+-PP-0-X Enz-Fe4+-PPO+
'Compound EOX 'Compound I'
X-
Fig. 17. Mechanism of heme haloperoxidases.
tron transfer catalyst or Lewis base is not 5.1.4.3 Non-Heme Non-Metal

known.
Of the non-heme vanadium-dependent ha- Haloperoxidase
loperoxidases, the chloroperoxidase from Cur-
vularia inequalis has been purified (SIMONS et The X-ray crystal structure of bromoperoxi-
al., 1995), and an X-ray structure for this en- dase A2 from Streptomyces aureofaciens
zyme is now available (MESSERSCHMIDT et al., (ATCC 10762) shows a typical alp hydrolase
1996).The bromoperoxidases from the brown fold with an active site containing a catalytic
alga Ascophyllum nodosum (WEYANDet al., triad consisting of Ser 98, Asp 228, and His 257
1996; WEVERet al., 1985) and the alga Coraffi- (HECHTet al., 1994).The non-heme non-metal
napilulifera (ITOHet al., 1988) have also been haloperoxidase have substantial sequence ho-
well studied. mology with serine hydrolases, including the
Less well studied but still well characterized consensus motif Gly-X-Ser-X-Gly (PELLETIER
are the bromoperoxidases from Pseudornonus and ALTENBUCHNER, 1995). Given this similar-
pyrrocinia (WIESNER et al., 1985).Pseudomon- ity, it is perhaps not surprising to find that the
as aureofaciens (VANPEEand LINGENS, 1985a), esterase from Pseudomonus Juorescens also
Streptomyces phaeochromogenes (VAN PEE acts as a bromoperoxidase as demonstrated
and LINGENS,1985b), Streptomyces aureo- by the bromination of monochlorodimedone
faciens (VANPEEet al., 1987), Murex trunculis (MCD) (16a) and phenol red (17a) (see Fig. 6).
(JANNUNand COE, 1987), Xanthoria parietina Site directed mutagenesis and inhibitor studies
(PLATet al., 1987), Coraflina oficinafis (SHEF- indicate the catalytic triad is essential for ha-
FIELD et al., 1993), Pseudomonus putida (ITOH logenation activity (PELLETIER et al., 1995). In
et al., 1994), and the chloroperoxidase from an alternative proposal for the mechanism, it
Serratia marcescens (BURDet al., 1995). has been suggested that a polypeptide back-
bone S-halogenated methionine, may be the
active halogenating agent (HAAGet al., 1991).
5.1.4.4 FlavinlHeme
Haloperoxidase
This eight subunit enzyme was first isolated
from the marine worm Notomastus lobatus P 7 H
(CHENet al., 1991). The flavin moieties are
contained within four identical polypeptide 43 A n i s o l e 4 4 Indole
chains and two pairs of nonidentical subunits
contain the heme groups.The ratio for optimal
activity is 1 heme: 1 flavin. A! lobatus contains
a plethora of bromophenols, and it is therefore
likely that the enzyme prefers bromide over
chloride.
H
45 O x i n d o l e
5.1.5 Reactions of the
Haloperoxidases Fig. 18. See text.
There are comprehensive reviews of halo-

peroxidase reactions (FRANSSEN,1994; FRANS- results) has shown that the product is 3-chloro-
SEN and VAN DER PLAS, 1992; DRAUZ and indole as would be expected on the basis of
WALDMANN, 1995) and detailed protocols electron density.
for the halogenation of different substrates
(NEIDLEMAN and GEIGERT,1986).
5.1.5.2 Alkenes
5.1.5.1 Phenols, Anilines, Alkenes (46)are halogenated to cr,P-halo-
and other Aromatics hydrins (48) by haloperoxidases (Fig. 19). If
the halide concentration is sufficiently high,
The major substrate requirement for suc- the intermediate cyclic halonium ion (47) will
cessful haloperoxidase catalyzed halogenation react with halide ion to give a dihalide (49).
of aromatic compounds is activation of the Substrates ranging from simple alkenes to bi-
ring structure. As a result, phenols, phenol
ethers, anilines, and electron rich heterocyclic
aromatics make good substrates. The transfor-
mation of phenol red (17a) to bromophenol
blue (1%) (see Fig. 6) is often used as an indi-
cator of haloperoxidase activity.
While the majority of aromatic halogena-
*-R
tions shows no regioselectivity,it is worth not-
48
ing that Caldariomyces fumago chloroperoxi-
dase displays a preference for para-bromina-
tion of anisole (43, Fig. 18) (PICKARDet al., 46 47
1991). This enzyme has been used for large
scale oxidation of indole (44)to oxindole (45) Y=OH,X,Xf
(SEELBACH et al., 1997). It has been claimed X
that Pseudomonas pyroccinia chloroperoxi-
dase catalyzed chlorination of indole (44) 49
gives 7-chloroindole (WIESNERet al., 1986),
however reinvestigation (BONG,unpublished Fig. 19. Mechanism of the halogenation of alkenes.
cyclic alkenes and steroids all undergo halog- 5.1.5.4 Cyclopropanes

enation (COUGHLIN et al., 1993).The presence
of certain functional groups leads to different The cyclopropanes are converted to a,y-
products to the halohydrins, e.g., haloacetones halohydrins by haloperoxidases according to
are produced from unsaturated carboxylic the same principles as for alkenes. One exam-
acids (GEIGERT et al., 1983a). ple of this reaction is the conversion of methyl-
The enzymatic halogenation of propylene cyclopropane (55, Fig. 21) to 4-chloro-2-hy-
was one of the few attempts made to utilize droxybutane (56) by C. furnugo haloperoxi-
haloperoxidases in a commercial synthesis. dase (GEIGERT et al., 1983b).
Propylene is converted to propylene halohy-
drin by a haloperoxidase. Halohydrin epoxi-
dase converts the propylene halohydrin to 5.1S.5 P-Diketones
propylene oxide, regenerating the halide. Un-
fortunately this process was not economical A wide range of diketones have been halog-
and the pressure to move to halogen indepen- enated using haloperoxidases, with the major
dent manufacturing processes ensured the determinant of reactivity being the enol con-
method did not reach commercial reality tent of the substrate. The simple ketone 2-hep-
(NEIDLEMAN, 1980). tanone, with a low enol content, has low reac-
tivity, whereas the diketone monochlorodime-
done (MCD) (16a, Fig. 6), which is predomi-
5.1.5.3 Alkynes nantly enol, has a very high reactivity. This re-
activity, together with a marked decrease in
Haloperoxidases catalyze the halogenation UV absorbance upon halogenation has led to
of alkynes (50, Fig. 20) to a-haloketones (53). its use as a substrate for quantifying halo-
As with alkenes, at higher halide ion concen- peroxidase activity.
trations dihalides (54) can be formed and the
use of a mixture of different halide ions can
yield heterogeneous dihalides (GEIGERT et al., 5.1.5.6 Nitrogen Atoms
1983b).
The reaction of haloperoxidases with amine
compounds yields haloamines, most of which
are unstable and rapidly decompose by deam-
ination or decarboxylation, freeing the halide
(GRISHAM et al., 1984).
5.1.5.7 Sulfur Atoms

The reaction of haloperoxidases with thiols
produces the sulfenyl halide (-SX) which
reacts with excess thiol to yield the disulfide
(-S-S-) or with a nucleophile such as
OH
55 56
2 54 53
Fig. 21. Cyclopropane cleavage by Caldariomyces
Fig. 20. See text. fumago haloperoxidase.
hydroxyl anion to yield the sulfenic acid

(-SOH), which can be oxidized to the sulfinic
(-S0,H) and sulphonic acid derivatives
(-S0,H). In common with other haloperox- HO
idase mediated reactions, the reduction or re-
ms
moval of halide ions favors competitive perox-
idase activity with, for example, C. fumago
chloroperoxidase oxidizing dimethylsulfoxide
to its sulfone (GEIGERT et al., 1983~).
HO
5.1.5.8 Inorganic Halogens
Br OH
The chloroperoxidase from C. fumago is 58
able to oxidize iodine to iodate and to dismu-
tate chlorine dioxide to chlorate (THOMAS and Fig. 22. See text.
HAGER,1968).
5.1.5.9 Stereo- and Regioselectivity

Several groups have attempted to find re-
gio- or stereoselective biotransformations cat-
alyzed by haloperoxidases. Bromohydrin for-
mation from five cinnamyl substrates by the 5 9 Aplysiaterpenoid A
chloroperoxidase from C. fumago, showed no Fig. 23. Aplysiaterpenoid A.
enantioselectivity, but some subtle differences
in diastereoselectivity (COUGHLIN et al., 1993).
Similarly,the Corallinapilulifera bromoperox-
idase (non-heme) gave the same regiospecific ora of complex natural products containing
transformations of anisoles as obtained with halogens, thus far no enzyme has been isolated
sodium hypobromite (NaOBr) and there was which is involved in their halogenation. It is in-
no enantioselectivity for bromohydrin forma- conceivable that complex polyhalocompounds
tion from a variety of unsaturated substrates such as aplysiaterpenoid A (59, Fig. 23) (cited
(ITOHet al., 1988). by FRANSSEN, 1994) could be produced by ha-
C.fumago chloroperoxidase was used in the logenation using currently known haloperoxi-
regioselective bromohydration of saccharide dases.
glycals (57, Fig. 22), to produce 2-deoxy-2-
bromosaccharides (58) (Fu et al., 1992; LIU
and WONG,1992). These have both biological 5.2 Halide Methyltransferase
activity and potential uses as synthons. The
mild, specific halogenation of both sugars and The study of the biosynthesis of chlorome-
peptides is a potentially rich source of applica- thane by the species Hymenochaetae, a family
tions for these enzymes. of white-rot fungi, has demonstrated a novel
There remain some puzzles, however, in biohalogenation independent of that carried
both the enzymology and natural products out by haloperoxidases (HARPERand HAMIL-
chemistry. Most notably, the presence of multi- TON, 1988).The mechanism appears to operate
ple haloperoxidases in Streptomyces aureofaci- via a novel methyltransferase system whereby
ens, none of which appear to be present in the halide ions are directly methylated by a meth-
biosynthetic pathway for 7-chlorotetracycline yl donor such as S-adenosylmethionine. Nor-
(13b, Fig. 4) which is abundant in these cells. It mally, in the metabolism of these fungi, the
is an extraordinary fact, that despite the pleth- chloromethane goes on to methylate aromatic
acids such as benzoate and furoate, producing attack of the si-face of oxaloacetate gives
the corresponding esters. This reaction is also stereospecifically (2R,3R)-fluorocitrate (26).
possible when chlorine is replaced by bromine Fluoroacetate (19)and fluorothreonine (27)
or iodine, but fluoromethane is neither a sub- are both produced by Streptomyces cattleya
strate nor an inhibitor of the enzyme. and labeling studies seem to indicate that they
Methyl halide formation can be uncoupled have a common origin. Feeding with [2-13C]-
from methylation under certain conditions, glycine (61)(Fig. 25) gave fluoroacetate (62)
and it is then that the halomethane is emitted containing 13C in both carbons and fluoro-
into the atmosphere. Although these emissions threonine (63)with the label at C-3 and C-4.
were originally thought to come mainly from Feeding with [3-13C]-pyruvate(64) resulted in
fungal sources, an in vivo halide methyltrans- incorporation into the fluoromethyl groups of
ferase activity has been detected in a number both metabolites (65,66).The results are ac-
of species of higher plants (SAINIet al., 1995) commodated by a pathway (Fig. 25) in which
and the enzyme responsible for this reaction C-2 of glycine (67)contributes both C-2 and
has been purified and characterized (ATTIEH C-3 of pyruvate (69)which in turn is incorpo-
et al., 1995). It is conceivable that these en- rated intact into the fluorinated metabolites
zymes might be engineered to transfer alkyl (19,27)(HAMILTON et al., 1997).
groups more complex than methyl. The importance of a three carbon interme-
diate such as pyruvate (69)was demonstrated
by incorporation experiments with glycerol
5.3 The Enzymes of Fluorine (Fig. 26) (TAMURA et al., 1995).When (2R)-[l-
Metabolism ’H2]- and (2S)-[1-’H2] glycerol were fed inde-
pendently to S. cattleya only the 2R-stereoiso-
The biosynthesis of the majority of natural mer (70)yielded fluoroacetate (71)and fluo-
organofluorine compounds can be rationa- rothreonine (72) containing two deuterium
lized as anabolites of fluoroacetate (19).The atoms. Glycerol kinase only phosphorylates
terminally fluorinated capric (20), myristic glycerol (73) at the pro-R-hydroxylmethyl
(21),and palmitic acids (22)apparently result group, direct displacement of the phosphate
from fatty acid biosynthesis initiated by fluo- group (74) (or of a derivative) by fluoride is
roacetate. There is also presumably a 18-fluo- consistent with the results (NIESCHALK et al.,
rostearic homolog which undergoes A9-desat- 1997). One derivative which might undergo
uration to give 18-fluorooleic acid (23),which this process is phosphoglycolate (76)to give 3-
in turn undergoes cis-dihydroxylation to give fluoropyruvate (77).This reaction has been
the dihydroxylated stearate (24)(see Fig. 13) demonstrated in reverse in several pseudomo-
(HARPER et al., 1990). nads where a haloacetate halidohydrolase en-
Fluorocitrate (26) is formed by the action of zyme has been identified (WALKERand LIEN,
citrate synthase on fluoroacetate (19) and 1981).The conversion of 3-fluoropyruvate (77)
oxaloacetate (60) in the “first step” of the to fluoroacetate (19) also occurs in Dicha-
Krebs cycle (Fig. 24). Removal of the pro-R petalum cymosum (MEYER and O’HAGAN,
proton from fluoroacetate (19),followed by 1992b,c).
s i face attack
Citrate synthase
CO2H
60 Oxaloacetate 19 26 2R,3R-Fluorocitrate
Fig. 24. See text.

S. cattleya
2)
0 F ONH3
6 4 65 66
yo@
0 HO 0 0
3) +oo""r, 2 q A 0 L 0
1 9 Fluoroacetate
27 F1 u or o t h re o n i n e
ONH3 ONH,
67 G l y c i n e 6 8 Serine 6 9 Pyruvate
Fig. 25. Biosynthesis of fluoroacetate (19) and fluorothreonine (27).
2H O H 0
S. cattleya
0
D
OH OH 0 F ONH3
7 0 ( 2 R ) - [l-2H2]glycerol 7 1 7 2
OH n-
-
OH
OH
Glycerol
kinase
-P-0
GH
-
OH
- F
F
-OH
OH
I
00
73 Glycerol 74 sn-G ly cer 01- 3 -phosphate 75
0
0 &C02H
II
0-7-0
-F F
F
CO2H
@b
76 77
Fig. 26. The role of glycerol in fluoroacetate biosynthesis (19).

The labeling data above do not exclude confirm this hypothesis in homogenates of
elimination-addition mechanisms which have plant cells and this lack of detailed metabolic
been discussed in detail by HARPERand proof leaves the whole question of the mecha-
O’HAGAN (1994). In one proposal, phos- nism of fluorination open to the suggestions
phoglycolic acid (76) forms an imine (79a) summarized above.
with pyridoxamine phosphate (78) (Fig. 27).
Loss of a proton (SOa) and elimination of the
terminal phosphate gives a substituted acry- 5.4 Advances Towards the
late (81) which undergoes nucleophilic addi-
tion of fluoride. Reversal of the steps (Sob, Commercial Application of
79b,78)gives fluoropyruvate (77).This mecha- Biohalogenation
nism, first proposed by MEAD and SEGAL
(1973), has been supported by several meta- Despite the lack of overall success in the
bolic studies in D. cymosum, but it has yet to application of enzymes to halogenation reac-
be verified by in vivo studies of fluoride me- tions, several biotechnological approaches are
tabolism in these plants. making some headway into developing en-
The caterpillar Sindris albimaculatus accu- zyme systems and applications that enable
mulates fluoroacetate and can degrade it to small steps in the development of processes.
carbon dioxide and fluoride. Attempts to force Certainly the advent of molecular biology has
this system to operate in reverse with the led to the cloning of chloroperoxidases from
enzme generating fluoroacetate have proved human eosinophils, Caldariomyces furnugo,
unsuccessful. Curvularia inequalis, Pseudomonus pyrrociniu,
The possibilities of ethylene and chlorinated and Streptomyces aureofaciens (Sect. 3). With
organics as precursors for fluoroacetate con- the rapid advancement in expression technol-
version have also been discussed by HARPER ogies these should enable the relatively cheap
and O’HAGAN(1994), but the evidence for production of haloperoxidases from many dif-
these is sparse. In one final suggestion, based ferent species such that the cost of enzyme will
on studies by FLAVIN et al. ( 1957),PETERShas not limit its application. There has also been
proposed the presence of a fluorokinase, pos- much investigation of the stability of haloper-
sibly an existing pyruvate kinase, which cataly- oxidases under conditions of high temperature
zes the ATP- and C0,-dependent incorpora- and in the presence of organic solvents (DE
tion of fluoride into phosphate (PETERSand BOERet al., 1987).Both of these conditions are
SHORTHOUSE, 1964). Once again, he could not potentially useful for optimizing manufactur-
76 X = OP032-; Phosphoglycolic acid 78-81 R = C H Z O P O ~ ~ -

QCOZH 77 X = F; Fluoropyruvate ax=0 ~ 0 ~ ~ -
0 bX=F
78 79ab 80ab 81
Fig. 27. See text.

ing processes as they may be more cost-effec- strates makes the latter approach very difficult
tive at higher temperatures, and the use of or- to conceive without either the presence of ad-
ganic solvents may also increase the substrate ditional molecules to protect certain groups or
repertoire that is available to the enzymes. As the incorporation of binding domains through
mentioned earlier (Sect. 5.1.1), the Cetus Cor- protein engineering.
poration isolated several fungal chloroperoxi-
dases from Death Valley, with particular em-
phasis on those with good resistance to high
concentrations of hydrogen peroxide and hy-
pochlorous acid. The chloroperoxidase from 6 Dehalogenations
Curvularia inequalis lost no activity after incu-
bation for 25 h in the presence of 200mM 6.1 Introduction
hydrogen peroxide whereas that from Calda-
riomycesfumago was inactivated within 2 min. Although organohalogens may arise natu-
A similarly increased stability was observed in rally, many are anthropogenic inputs. These
the presence of hypochlorous acid. tend to be relatively resistant to degradation
One further technique applied to haloper- and, therefore, have become known as major
oxidases has been immobilization and chemi- recalcitrant pollutants. However, many of
cal modification. These techniques have been these compounds can be degraded or trans-
used with many enzyme and whole cell formed in the environment by a range of biotic
systems because of the advantages of separat- and abiotic processes. The ability of microor-
ing the catalyst from substrates and products, ganisms to utilize halogenated compounds
potential increases in stability of immobilized may have arisen by selective pressure and ad-
enzymes, and also potential to use enzymes at aptation created by the presence of such com-
wider pH and temperature ranges. ITOHet al. pounds in their environment. Therefore an im-
(1987a) studied the immobilization of bro- portant relationship has been formed between
moperoxidase from Corallina pilulifera onto a the environmental exposure of microorgan-
variety of matrices utilizing the techniques of isms and halogenated organics, especially in
covalent binding, adsorption, and entrapment. terms of biodegradation, biotransformation,
They determined that ionic adsorption to and biosynthesis.Many naturally occurring mi-
DEAE-cellulofine and encapsulation in ENT- croorganisms have been isolated that degrade
2000 matrix were the immobilization systems halogenated compounds to some degree.
of choice for continuing process development. Some of them have been shown to work in
SHEITIELDet al. (1994) extended this work axenic cultures but often, where more complex
with the enzyme from Corallina officinalis molecules or mixtures are involved, mixed
demonstrating high thermal stability and toler- cultures are required.
ance to organic solvents when the enzyme was The removal of the halogen substituent is
immobilized on cellulose acetate. There are the key step in the degradation of halogenated
currently two commercially available immobi- compounds. This requires cleavage of the
lized enzyme products (see Tab. 3). carbon-halogen bond, a very difficult reaction
Unfortunately, while the promised market to achieve as exemplified by the bond dissoci-
for enzymatic halogenation remains extremely ation energies given in Tab. 2.
good with so many halogenated organics being During haloorganic degradation the deha-
used as pharmaceuticals, agrochemicals, and logenation step is key and maybe rate limiting.
fine chemicals, the nature of the reaction proc- It may occur early or late in metabolism.There
ess in all enzymes studied to date does not are five well characterized mechanisms identi-
allow for selectivity and therefore we await fied for dehalogenation: reductive, oxidative,
either the discovery of suitable enzymes from dehydrogenative, epoxide formation, and hy-
as yet unexplored sources or further develop- drolytic (encompassing thiolytic and hydration
ments in protein engineering such that speci- reactions).
ficity can be conferred upon existing enzymes.
The lack of a binding pocket for organic sub-
6 Dehabgenatioris 203
6.2 Aliphatic Dehalogenations halogen as a halogenide ion and its replace-

ment by hydrogen. Haloalkane reduction
Haloaliphatics encompass the haloalcohols, occurs on a range of short chain ( C, and C,)
haloacids, haloalkanes, and their unsaturated chlorinated alkanes by methanogenic, denitri-
derivatives. Chlorinated aliphatics are widely fying, and sulfate reducing organisms in reduc-
used as solvents, herbicides, and a variety of ing environments in nature (CURRAGH et al.,
specialist applications, e.g., tetra- and trichlo- 1994). The precise enzymatic nature of the
roethane are used in dry cleaning. Many chlor- transformation is not well defined but there is
inated aliphatics are poorly degraded, mainly evidence that reduced porphyrin and corrin
due to biochemical, rather than thermodynam- complexes are able to dehalogenate efficiently.
ic factors (PRIESet al., 1994). Their biochemi- The rate of reductive dechlorination, especial-
cal inertness is caused by an absence of meta- ly in anaerobic environments with highly
bolic routes from which energy and anabolic halogenated substrates, is slow and may take
intermediates may be derived. In general, the several months.
degree of recalcitrance increases as the degree Tri- or tetrachlorinated species may be re-
of chlorination increases and, therefore, deha- ductively dehalogenated by strictly anaerobic
logenation is a critical step. bacteria causing sequential chloride release to
Twenty seven percent of the priority pollu- produce dichloro- and monochloroderivatives,
tants listed by the US EPA are haloaliphatics. ultimately yielding methane. Alternatively an-
Of these, nearly two thirds are haloalkanes aerobic substitutive dehalogenation may total-
and the rest comprises unsaturated derivatives ly degrade tri- or tetrachloromethane to form
and activated derivatives. It should be stated carbon dioxide, although this is possibly due to
that metabolism of haloalkanes and haloali- a nonenzymatic process. Both of these reac-
phatic acids may overlap. If the halogen positions have previously been shown in the same
tion on the alkane chain is not terminal, deha- organism and the true catalyst has yet to be
logenation is likely to be preceded by oxida- unequivocally verified (EGLI et al., 1988,
tion of the terminal methyl group to yield the 1990). The list of haloaliphatic compounds
2- or 3-haloaliphatic acids (YOKOTA et al., which have been shown to be reductively de-
1986).Therefore, the examples chosen to illus- chlorinated is not extensive but has been re-
trate specific dehalogenations are to guide the viewed by Mom and TIEDJE (1992) and FETZ-
reader through the myriad of possible reac- NER and LINGENS (1994). It is clear that apart
tions without giving an exhaustive list of exam- from the haloaromatic transforming strain De-
ples. sulfomonile tiedje DCB-1, the tetrachloro-
Haloalkanes are formed by both natural and ethylene transforming strain PER-K23 (see
anthropogenic routes and are found in all en- Fig. 8) is the only pure culture available for
vironmental matrices. Haloalkanes can be further studies into the energy production dur-
metabolized in a variety of ways: as a carbon ing reductive dehalogenation (HOLLIGER et
and energy source; cometabolised or partially al., 1993).
degraded by microrganisms who are unable to
utilize them as a growth source. A range of
mono- and dichlorinated species ranging from 6.2.2 Oxidative Dehalogenation
chloro- or dichloromethane up to halogenated
octadecane, can be degraded by a limited Cleavage of a covalent carbon-halogen
range of microorganisms. An extensive review bond may proceed through polymerization of
of haloalkane metabolism by microorganisms free radical intermediates (Fig. 28) or via oxi-
is available (BELKIN, 1992).
6.2.1 Reductive Dehalogenation Monoxygenase

H3C-X * -(CHZO)-
0 2 , NADH
Reductive dehalogenation is a two-electron
transfer reaction whTch involves the release of Fig. 28. See text.
dative hydroxylation at the carbon atom adja- genolytic dehalogenases specific for halogen-
cent to the halogen (Fig. 29). The former ated alkanes (FETZNER and LINGENS, 1994).
occurs due to the action of peroxidase, while
the latter is oxygenase mediated. Such oxygen-
ases are broadly distributed in nature and may 6.2.3 Hydrolytic Dehalogenation
be either mono- or dioxygenases.The action of
oxygenase on haloalkanes leads to the forma- Hydrolytic dehalogenation is perhaps the
tion of the corresponding aldehyde, while commonest route for the dehalogenation and
further dehydrogenation may yield the acid transformation of haloaliphatic compounds.
(Fig. 29). Such a reaction pathway has been As outlined above, the hydrolytic transforma-
shown for 1-chlorobutane grown Corynebacte- tion of a haloalkane may subsequently give
rium sp. strain m15-3 (YOKOTAet al., 1986, rise to a haloalcohol and a haloacid before de-
1987) and for the ammonia monooygenase halogenation occurs.Therefore, it is possible to
(RASCHEet al., 1990). have multiple dehalogenating activities in one
Oxidative dehalogenation of haloalkanes is organism. Several organisms able to aerobical-
usually mediated by a relatively nonspecific ly degrade dichloroethane have been isolated
monooxygenase, which catalyzes the forma- (KEUNINGet al., 1985). The initial step is the
tion of halohydrins or halogenated epoxides: hydrolytic removal of one chlorine to form the
these spontaneously decompose to aldehydes, haloalcohol, chloroethanol. The ' enzyme re-
releasing the halide ion (CURRAGH et al., 1994). sponsible has since been cloned and se-
Generally oxidative dehalogenation only oc- quenced (JANSSEN et al., 1989) and the struc-
curs with short chain halocarbons comprised ture elucidated (FRANKEN et al., 1991; VER-
of 1-4 carbons: e.g., monohaloethanes and n- SCHUEREN et al., 1993a, b). Following the for-
alkanes are dehalogenated by the ammonia mation of the chloroethanol, further oxidation
monooxygenase of the nitrifying bacterium via the aldehyde and acid occurs. It is then at
Nitrosomonas europaea, and the methane oxy- this stage that the second chlorine is removed
genase found in methanogenic microorgan- to yield glycolate. Several enzymes able to
isms can dehalogenate C, and C, compounds. catalyze the dehalogenation of the haloacid
In general, oxygenase catalyzed dehalogen- have been purified (KLAGES et al., 1983;MOTO-
ation reactions of short chain haloalkanes are SUGI et al., 1982) and some have been cloned
due to multifunctional enzymes with broad and sequenced (SCHNEIDER et al., 1991).
substrate specificity (methane monooxygen- During hydrolytic dehalogenation of halo-
ase) or involve enzymes from aromatic degra- alkanes nucleophilic substitution occurs, in
dative pathways (toluene dioxygenase). Oxi- which the halogen atom is replaced by a hy-
dation can lead to dehalogenation as a result droxyl ion to give the corresponding alcohol
of the formation of labile products, not true (Fig. 30). These reactions are catalyzed by a
dehalogenation. There are no reports of oxy- halidohydrolase-type dehalogenase. The halo-
alkane dehalogenases can be divided into two
-
classes depending on their substrate specific-
ity. Those which have a fairly restricted range
of substrate specificities are gram-negative
strains, best exemplified by Xanthobacter auto-
RAX "202 Rx x trophicus GJlO (JANSSEN et al., 1989) for which
a detailed mechanism has been determined
from X-ray crystal structures. An aspartate
residue is alkylated by the haloalkane to give
Fig. 29. See text. Fig. 30. See text.

an ester and the displaced halide ion is bound compared with the original product configura-
to the ring NHs of two tryptophan residues. A tion.
histidine/aspartate pair assist the hydrolysis of Within these classifications, 1L would ap-
the aspartate ester to give the alcohol (VER- pear the most common, having been shown to
SCHUEREN et al., 1993a, b). The second class of be present in strains of Pseudomonas (SCHNEI-
haloalkane dehalogenases is represented by DER et al., 1991; KAWASAKI et al., 1994;NARDI-
those enzymes isolated from a group of closely DEIet al., 1994;JONES et al., 1992; MURDIYAT-
related gram-positive organisms. Rhodococcus MO et al., 1992), Moraxellu (KAWASAKIet al.,
erythropolis strain Y2 (SALLISet al., 1990), 1992) and Xunthobacter (VAN DER PLOEGet
Arthrobucter sp. strain HA1 (SCHOLTZ et al., al., 1991).
1987), and Corynebacteriurn sp. strain m15-3 A final group of haloaliphatic transforming
(YOKATA et al., 1987) all demonstrate much enzymes are best classified as those glutath-
broader substrate specificities and are suggest- ione (GSH) dependent dehalogenases. STUCKI
ed to be grouped together using the system of et al. (1981) isolated a Hyphomicrobium spe-
SLATERet al. (1995). cies able to dechlorinate dichloromethane
The haloalcohol dehalogenases are a dis- which was GSH dependent. The mechanism of
tinct group of enzymes which result in the for- these enzymes involves a nucleophilic substi-
mation of epoxides. These are dealt with in a tution by GSH, yielding an S-chloromethyl
separate section but are still hydrolytic en- glutathione conjugate which is dehalogenated
zymes acting on haloaliphatic compounds (see when it rapidly undergoes hydrolysis in an
Sect. 6.2.5). aqueous environment. The thiohemiacetal
Of greatest interest and by far the most thus formed is then in equilibrium with GSH
studied systems are those catalyzing the trans- and formaldehyde (KOHLER-STAUB and LEI-
formation of the haloaliphatic acids - the SINGER, 1985). The enzyme has only been
haloalkanoic acids, the haloacids, and the shown to work with dichloromethane and a
haloacetates. The enzymes catalyzing the restricted substrate range.
transformation are broadly divided into two
groups of halidohydrolases, namely the halo-
acetate dehalogenases (EC 3.8.1.3) and the 2-
haloacid dehalogenases (EC 3.8.1.2). The divi- 6.2.4 Dehydrohalogenation
sion of these enzymes was based on their sub-
strate range, haloacetate dehalogenases acting Dehydrohalogenation occurs with simulta-
exclusively on haloacetates and 2-haloacid de- neous removal of the halogen atom and the
halogenases acting on haloacetates and other hydrogen atom on the neighboring carbon
short chain fatty acids (&-C,).The two groups (Fig. 31). This results in the formation of al-
of enzymes appear to have non-overlapping kenes from simple halogenated hydrocarbons.
activity spectra (JANSSEN et al., 1985). Both The major substrates which appear to be trans-
types of halidohydrolases preferentially deha- formed by this route are the lindane (82, Fig.
logenate in the order F > C l > I > B r . The 32) pesticides, a halogenated cyclohexane, and
mechanism of displacement proceeds through some steps in the transformation of dichloro-
a SN2-type reaction and has been found to diphenyltrichloroethane (DDT), a haloaro-
differ, depending on the enzyme. SLATERet al. matic pesticide.
(1995) categorized the enzymes into four The transformation of lindane (y-hexachlo-
classes, based on their enantiospecificity and rocyclohexane, y-HCH) (82) by a dehydro-
ability to invert the substrate-product config-
uration. Class 1L and 1D catalyze the inver-
sion of the product configuration compared
with the original substrate and are D (Class 1D
) or L (Class 1L) specific. Class 21 and 2R are
able to dehalogenate both the D and L-enan-
tiomers with either retention (Class 2R) or
inversion (21) of product configuration Fig. 31. Dehydrohalogenation.
82 Lindane 83
q- Q
85
OH
86
a
J Spontaneous
I
a
87 88
Fig. 32. The metabolism of lindane (82) by Pseudornonas paucimobilis UT26.
chlorinase is probably the best studied of this systems responsible for the transformation of
limited group of enzymes. Lindane (82) was lindane (82) are suggested to be extrachromo-
first shown to be aerobically transformed by somally located and present in Pseudomonas
Tu (1976) and HAIDER (1979). In Pseudomo- ovalis CFT1 and Pseudomonas tralucida CFT4
nas paucimobilis UT26, the proposed pathway (JOHRIet al., 1991).
of lindane (82) degradation involves dehy- A dehydrohalogenase or dechlorinase, iso-
drochlorination to yield y-pentachlorocyclo- lated from the house fly (Musca domestica),
hexene (83) and 1,3,4,6-tetrachloro-1,4-cyclo-(LIPKEand KEARNS, 1959) is a glutathione S-
hexadiene (84) which may decompose to the transferase (ISHIDA,1968) which catalyzes the
dead-end product 1,2,4-trichlorobenzene (87) monodehydrochlorination of DDT.
or be acted upon by the hydrolytic dehaloge- P-Chloroalanine and serine-0-sulfate form
nase LinB (Fig. 32) to give the dichlorodihy- imines (80)with pyridoxal phosphate (see Fig.
droxycyclohexadiene (86). IMAIet al. (1991) 27). These readily eliminate to give 2-amino
have cloned and sequenced the gene encoding acrylates (81), which in turn undergo conju-
the initial dehydrohalogenase LinA. It has no gate addition of nucleophiles. Hydrolysis of
sequence homology with any bacterial or the imine yields amino acids with a new P-sub-
eukaryotic glutathione S-transferase and did stituent (CONTESTABILE and JOHN,1996). Us-
not show DDT dechlorinase activity in the ing tryptophan synthase or tyrosine phenol
presence of glutathione. lyase this has been developed into a powerful
Apart from the restricted range of dehy- method for the synthesis of p-substituted ala-
drochlorinases which have been shown, it is nines (NAGASAWA and YAMADA, 1986).
also clear that LinA from Pseudomonaspauci-
mobilis UT26 has a very limited substrate
range, only converting a-HCH, 7-HCH (82), 6.2.5 Epoxide Formation
GHCH, a-pentachlorocyclohexene, and 7-
pentachlorocyclohexene (83) (NAGATAet al., Epoxidation results from the simultaneous
1993). Other, less well characterized enzyme removal of the halogen atom and the hydro-
benzenes) to the polycyclic (polychlorinated

biphenyls PCBs). Each may be modified to
give a range of haloaromatic pesticides (e.g.,
2,4-D, dichlobenil) and other anthropogenic
Fig. 33. See text. inputs such as dioxins. Natural haloaromatics
range from the esoteric 1,2,3,4-tetrachloroben-
zene (MILESet al., 1973) to the EPA priority
gen atom from the adjacent hydroxyl group on pollutant 2,4-dichlorophenol produced by a
the neighboring carbon (Fig. 33). Penicillium sp. (ANDOet al., 1970).
Although the reaction was first shown near- As outlined previously for chlorinated
ly 30 years ago (CASTRO and BARTNICKI, 1968) aliphatics (Sect. 6.2), the removal of the halo-
very few studies have extended this finding. gen substituent is a key step in the degradation
VANDEN WIJNGAARD et al. (1989) have isolat- of halogenated aromatic compounds. This may
ed the strains AD1 (Pseudomonus sp.), AD2 occur either as an early reaction, catalyzed by
(Arthrobucter sp.) and AD3 (coryneform) and a true dehalogenase, or at a later stage in me-
shown that a variety of vicinal haloalcohols tabolism, often resulting from the chemical de-
may be degraded. The formation of epoxides composition of unstable primary products of
from a range of haloalcohols (&-C3) has been an unassociated enzyme reaction.
shown for the enzyme purified from AD2 (VAN Generally, initial halogen removal occurs via
DEN WIJNGAARD et al., 1991). The enzyme re- reductive, oxygenolytic, or hydrolytic mecha-
quires no cofactors or oxygen and probably nisms while later removal may be a fortuitous
acts as a simple acid-base catalysis. The halo- event caused by a separate abiotic reaction
alcohol dehalogenases from Corynebacterium after the loss of aromaticity.There is an exten-
sp. strain N-1074 are the best studied. In the sive discussion of the microbial metabolism
wild-type strain, two haloalcohol transforming of haloaromatics (REINEKEand KNACKMUSS,
enzymes and two epichlorohydrin transform- 1988).
ing enzymes have been isolated. The haloalco-
hol transforming enzymes catalyzed the trans-
formation of halohydrins into epoxides and 6.3.1 Reductive Dehalogenation
the reverse reaction. However, they were
shown to differ in their enantioselectivity for Under a variety of redox conditions the re-
1,3-dichloro-2-propanol conversion as well as ductive dehalogenation of a wide cross section
their substrate range, subunit composition, and of haloaromatics has been demonstrated and
immunological reactivity (NAKAMURA et al., discussed extensively (MOHN and TIEDJE,
1992). As outlined above for the other hydro- 1992;WACKETT and SCHANKE, 1992).Haloben-
lytic enzymes, SLATERet al. (1995) have zenes (RAMANAND et al., 1993),halobenzoates
attempted to classify the haloalcohol dehalo- (HAGGBLOM et al., 1993), haloanilines (KUHN
genases on the basis of their substrate specific- et al., 1990),and halocatechols (NEILSON et al.,
ities. It is clear that the number of examples 1987) are only a few of the compounds which
limits this exercise but it may be significant have been shown to be reductively dechlori-
that the N-terminal amino acid sequence of nated. Pentachlorophenol (89), which was
the enzyme from Corynebacterium sp. strain widely used as a herbicide and wood preserva-
N-1074 is similar to that of Arthrobacter strain tive, undergoes reductive dehalogenation with
AD2 (NAGASAWA et al., 1992). sequential removal of the chloride substitu-
tions to give 3-chlorophenol (94) as the final
product (Fig. 34).
6.3 Aromatic Dehalogenation It is also evident from the majority of studies
performed to date that very few axenic cul-
Chlorinated aromatic compounds have tures able to perform reductive dehalogena-
been widely used as solvents, herbicides, fungi- tion have been studied. Desulfonomile tiedje
cides, and insecticides. The aromatic moiety DCB-1 is one of the few organisms which have
may range from the the monocyclic (chloro- been shown to perform reductive dechlorina-
c1 c1 c1
89 Pentachlorophenol
c1 c1
94 93 92
Fig. 34. Degradation of pentachlorophenol.
tion and has become a benchmark organism 6.3.2 Oxidative Dehalogenation

for these studies. SHELTON and TIEDJE (1984)
showed that this organism can grow and derive The commonest mechanisms in (ha1o)aro-
energy from the dechlorination of 3-chloro- matic degradation is the introduction of hy-
benzoate. The rate of dehalogenation depends droxyl groups to facilitate ring cleavage. Both
upon the number and position of the halogen monooxygenases and dioxygenases may play a
substitutions, since the presence of the carbo- role in haloaromatic dehalogenation. In mono-
nyl group favors removal at metu > ortho > cyclic aromatic metabolism, the key ring fis-
para positions. sion substrates (which may be halogenated)
Due to the global environmental concerns are, in order of importance: catechol, proto-
many studies have been made on the reductive catechuate, and gentisate. Subsequently, the
dechlorination of polychlorinated biphenyls. aromatic ring is cleaved and the halogenated
Using Hudson River sediments BROWNet al. molecule is labilized by the further incorpora-
(1987) showed that there was an alteration in tion of oxygen. Halide removal is thereafter
the PCB congener distribution over a long peri- spontaneous and is associated with normal
od of time; highly chlorinated congeners were aromatic catabolism.
removed and there was an increase in the lower
chlorinated species. It has been shown that the
pattern of dechlorination is specific for the par-
ticular sediment from which it is derived with
6.3.2.1 Dioxygenase Catalyzed
dechlorination occurring specifically at metu Dehalogenation
and para chloro substituents.A consortium de-
void of sediment has never been shown to an- Oxygenolytic attack on halogenated aro-
aerobically dechlorinate PCBs. It has been matic hydrocarbons may cause cleavage of the
demonstrated that as the degree of chlorination chlorine atom fortuitously when both atoms of
increases, so does the probability of dechlorina- molecular oxygen are incorporated into the
tion, and as the number of mono- and dichlori- aromatic nucleus.These reactions may be cata-
nated congeners increases, so the role of the an- lyzed by an aromatic dioxygenase and require
aerobes decreases (ABRAMOWICZ, 1990). two adjacent carbons, only one of which is
halosubstituted. Of the limited substrates and e.g., biphenyl (95) is dihydroxylated (%), re-
dioxygenases which fulfill these criteria the aromatized (97), cleaved to a ketoacid (98),
metabolism of 2-chlorobenzoate is the best and then further cleaved to benzoic acid (99)
studied (FETZNER et al., 1989,1992).The 2-ha- (Fig. 35).
lobenzoate-1,2-dioxygenasefrom Pseudomo- This upper pathway has a broad substrate
nus cepacia 2CBS, which catalyzes the forma- specificity and has been demonstrated in a va-
tion of catechol from 2-halobenzoates, is a riety of microbial taxa including Achromo-
multicomponent enzyme which is structurally bacter (AHMEDand FOCHT,1973),Alcaligenes,
related to benzoate 1,2-dioxygenase and the and Acinetobacter (FURUKAWA et al., 1978).
TOL plasmid encoded toluate 1,Zdioxyge- The action of the four enzyme system results
nase. Despite this structural similarity, neither in oxygenolytic cleavage of one of the biphen-
the benzoate nor the toluate 1,2-dioxygenases yl rings to produce (chlorinated) benzoates.
are able to convert the ortho substituted ben- Since the early work on microbial degradation
zoates. Furthermore, although the enzyme many studies have been undertaken. These
from f! cepacia 2CBS showed broad substrate have been summarized and some general ob-
specificity, it demonstrated a preference for 2- servations have been made (ROBINSONand
halosubstituted benzoates, justifying its in- LENN,1994):
clusion and terminology as a dehalogenase.
Other oxygenolytic haloaromatic dehaloge- Degradation decreases as the extent of
nases have also been shown to be multicompo- chlorination increases.
nent enzymes. Further 2-chlorobenzoate-1,2- Ortho substituted biphenyls have a lower
dioxygenases have been identified in I! putida degradation rate.
CLB250 (ENGESSER and SCHULTE, 1989) and Ring cleavage always occurs in the least
I! aeruginosa JB2 (HICKEYand FOCHT,1990) or non-chlorinated ring.
and shown to be plasmid encoded in strain Degradation decreases if both rings are
Pputida P l l l (BRENNER et al., 1993). Dihy- chlorinated (4 '-substituted biphenyls
droxylation of aromatics is covered in detail in result in the formation of a yellow meta
Chapter 10. cleavage product).
Of significant environmental concern, and
reliant upon oxygenolytic dehalogenation, is In summary, many dioxygenases are able to
the degradation of PCBs.The aerobic degrada- catalyze the incorporation of dioxygen into a
ggOH
tion of lightly chlorinated PCBs has been (ha1o)aromatic compound and may cause de-
shown to involve an upper pathway in which, halogenation. We have attempted to highlight
-
HO
4
/
L g O H LOH
,OH
\ ' O H
95 96 97 98 9 9
1 Biphenyl-2,3-dioxygenase
2 Dihydrodiol dehydrogenase
3 2,3-Dihydrobiphenyl- 1.2-dioxygenase
4 2-Hydroxy-6-oxo-6-phenylhexa-2,4-dienoicacid hydrolase
Fig. 35. PCB upper pathway.

some of those enzymes which cause dehalog- (H and NH,) and electron withdrawing groups
enation due to relaxed substrate specificity (F, C1, Br, NO,, and CN) requiring 1mole or
and not those enzymes simply associated with 2 mole NADPH, respectively (XUN et al.,
spontaneous elimination of halide after cleav- 1992a). Although other isolates able to de-
age of the aromatic ring. grade halophenols have been isolated (Go-
LOVLEVA et al., 1992; KIYOHARA et al., 1992),
the monooxygenase catalyzed dehalogenation
6.3.2.2 Monooxygenase Catalyzed would appear to be restricted to the metab-
Dehalogenation olism of more highly halogenated compounds,
with the less halogenated aromatics being de-
Despite having a high degree of chlorination halogenated via the dioxygenase or post cleav-
some microorganisms have been shown to be age routes outlined above.
able to degrade pentachlorophenol(89) under
aerobic conditions (Fig. 36) (RADEHAUS and
SCHMIDT, 1992; SCHENKet al., 1990; TOPPand 6.3.3 Hydrolytic Dehalogenation
HANSON, 1990). The initial reaction has been
shown to be an NADPH dependent oxygena- The replacement of a halogen with a hy-
tion to form tetrachlorohydroquinone (100). droxyl from water is rare in comparison with
The purified enzyme from Flavobacterium sp. the oxidative dehalogenations previously out-
strain ATCC 39723 was shown to catalyze the lined. The delocalization of the .rr-electrons
incorporation of 1 8 0 2 (XUNet al., 1992b). Pen- contributes to the stability of the aromatic ring
tachlorophenol-4-hydroxylase from Flavobac- system but it does not preclude the direct hy-
terium sp. strain ATCC 39723, has been shown drolysis of the carbon-halogen bond. Various
to be a flavoprotein monooxygenase catalyz- s-triazines have been shown to be hydrolytical-
ing the para hydroxylation of a broad range of ly transformed (COOKand HUTTER,1986) but
substituted phenols. The requirement for the central focus of hydrolytic haloaromatic
NADPH was dependent upon the leaving dehalogenation has been the initial step in the
group with 1mole electron donating groups transformation of 4-chlorobenzoate. It has
been suggested that 3-chlorobenzoate may
also be metabolized by a similar route (JOHN-
STON et al., 1972) but this is the only reported
OH example of 3-chlorobenzoate transformation
not involving a dioxygenase.
The halidohydrolase responsible for catalyz-
ing the dechlorination of 4-chlorobenzoate
cl*cl
c1 c1 (101) has been extensively characterized in
c1 Pseudomonas sp. strain CBS3 (Fig. 37). The
multicomponent enzyme system comprises an
89 initial 4-chlorobenzoate-CoA ligase which
adenylates the carboxyl group in an ATP
cocl
dependent reaction. The AMP moiety is then
replaced by coenzyme A resulting in the for-
mation of a thioester (102).The second en-
zyme, 4-chlorobenzoyl-CoA dehalogenase, is
then able to catalyze the nucleophilic attack at
C-4, to yield 4-hydroxybenzoyl-CoA (103).
c1 0 c1 Finally, hydrolysis of the thioester yields 4-hy-
droxybenzoate (104) (ELSNERet al., 1991;
SCHOLTEN et al., 1991; CHANGet al., 1992;
100 LOFFLERet al., 1992).
Other analogous pathways have been
Fig. 36. See text. shown in Arthrobacter sp. strain SU (SCHMITZ
CO2H COSCoA COSCoA CO2H
Mg2+
Cl ATP AMP+ c1 H20 HC1 OH H20 CoASH OH
PPi
10 1 102 103 104
Fig. 37. Dechlorination of 4-chlorobenzoate to 4-hydroxybenzoate by Pseudomo-

nas sp. strain CBS3.
et al., 1992) and Acinetobacter strain 4-CB1 commercial sector. (S)-2-Chloropropionic acid
(COPLEY and CROOKS, 1992). is a key chiral synthon required for the synthe-
sis of a range of pharmaceuticals and agro-
chemicals. Initial attempts to resolve racemic
6.3.4 Dehydrohalogenation 2-chloropropionic acid with hydrolytic en-
zymes (CAMBOUand KLIBANOV,1984) were
Dehydrohalogenation of an aromatic yields superseded by the use of an (R)-specific deha-
a benzyne which rapidly undergoes addition logenase enzyme from Pseudomonas putida
reactions. Although this reaction can be (Fig. 38). Thus from racemic chloropropionic
achieved under extreme abiotic conditions acid (105, 106) the (R)-enantiomer (105) is
(sodium hydroxide, 300 "C), there is no known converted to (S)-lactate (107) with inversion
enzyme catalyzed example. The corresponding of configuration leaving the (S)-chloropro-
reaction of the alicycle lindane (82, Fig. 32) and pionate (106)behind (ee 96--98%).This system
in the aliphatic moiety of DDT are well known has been commercialized by Zeneca BioMole-
(see Sect. 6.2.4). cules with the enzyme being produced at
> 1000 t a-' at Chilton,Teeside.
The bioremediation of halogenated organics
6.4 Advances Towards the in effluent treatment has attracted much re-
search interest. However, the application of a
Commercial Application of biocatalyst for the removal of halogenated
Dehalogenases organics in a product stream is novel and may
not require any significant alteration to the
Dehalogenases have a key role to play in the manufacturing process. Carbury Herne Ltd., a
degradation of persistent haloorganic com- company based in Canterbury and Cardiff, has
pounds. Compounds such as lindane (82, Fig. collaborated with Hercules Inc.. a multination-
32) DDT, and PCBs have been considered
above but it is well known that a large number
of commonly isolated microorganisms, such as
Pseudomonas and Alcaligenes, are able to de-
halogenate a wide variety of halogenated com-
pounds. Inevitably, the restricted range of se-
lective conditions employed in the laboratory 105 107
has, up to the present time, resulted in very few (R)-2-~hloropropionate (S)-Lactate
well characterized anaerobes being isolated.
There can be little doubt that these complex
consortia are key catalysts in the turnover of
-c-1 106
haloaromatic compounds in the environment. /~CO,H (S)-2-~hloropropionate
Microorganisms able to dehalogenate spe-
cific compounds are finding some uses in the Fig. 38. See text.
212 3 Halocompounds - Biosynthesis and Biotrarnsformation
a1 speciality chemical company based in Wilm- compounds are commercially available at

ington, Delaware, USA, and they have success- the current time.
fully developed such a process. Products like
paper towels, tissues, and packaging materials It is clear that far more effort has been in-
need a measure of wet strength if they are to vested in understanding the effects and persis-
perform properly. This property is provided by tence of halocompounds in the workplace and
a polymer which is produced when epichloro- the environment than elaborating novel routes
hydrin is reacted with an aqueous solution of a for their synthesis. Each of these activities are
poly(aminoamide). Unfortunately, traces of the clearly overlapping and will require continued
haloalcohols 1,3-dichloropropan-2-ol (DCP) research and discovery if fundamental under-
and 3-chloropropanediol (CPD) are produced standing and commercial exploitation are to
as by-products of this reaction. These com- occur concurrently.
pounds are contaminants and have no benefi-
cial effects on the finished product. Using a
well characterized microbial consortia, Agro-
bacterium tumefaciens NCIMB 40313 and A r - 8 References
throbacter histidinolovorans NCIMB 40214,
these molecules are mineralized via glycidol ABRAMOWICZ, D. A. (1990),Aerobic and anaerobic
and glucose. This process, incorporating a de- biodegradation of PCBs: A review, Crit. Rev. Bio-
halogenase step, has now been adopted at the tech. 10,241-251.
production scale at two manufacturing sites AHMED,M., FOCHTD. D. (1973), Degradation of
polychlorinated biphenyls by two species of
producing several thousand tonnes polymer Achromobacter, Can. J. Microbiol. 19,47-52.
per annum. ALLAIN, E. J.,HAGER,L. P., DENG,L.,JACOBSEN, E. N.
(1993), Highly enantioselective epoxidation of
disubstituted alkenes with hydrogen peroxide
catalyzed by chloroperoxidase,J. Am. Chem. Soc.
115,4415416.
7 Final Comments AMIN,R. A., HARPER,
PHY, C. D., HOWARD,
D. B., MOLONEY,
J. K. A., O'HAGAN,
J. M., MUR-
D. (1997),
A short and stereoselectivesynthesis of the fluor-
In this review we have attempted to present inated natural product (2S,3S)-4-fluorothreonine,
an up-to-date appraisal of halogenated mole- J. C. S. Chem. Commun.1997,1471-1472.
cules: their synthesis and transformation by ANDO,K., KATO,A., SUZUKI, S. (1970), Isolation of
biological systems. Obviously, there will be 2,4-dichlorophenol from a soil fungus and its bio-
omissions that may have enhanced the article logical significance, Biochem. Biophys. Res. Com-
but several facts are clear: mun. 39,1104-1107.
ASPLUND, G. (1995), Origin and occurrence of halo-
- The principal route to halocompound genated matter in soil, in: Naturally-Produced
Organohalogens (GRIMVALL, A,, LEERE. W. B.,
synthesis is that catalyzed by haloperoxi- Eds.), pp. 35-48. Dordrecht: Kluwer.
dases. However, this class of enzymes ASPLUND, G., GRIMVALL, A. (1991), Organohalogens
does not appear to catalyze the selective in nature, more widespread than previously as-
(regio-, stereo-, and enantio-) incorpora- sumed, Environ. Sci. Technol. 25,1346-1350.
tion of halides which obviously occur in ATTIEH,J. M., HANSON, A. D., SAINI,H. S. (1995),
nature. It is therefore likely that other, Purification and characterization of a novel
novel biohalogenation mechanisms re- methyltransferase responsible for biosynthesis of
main to be discovered. halomethanes and methane thiol in Brassica ole-
- Of the reactions that the haloperoxidases racea,J. Biol. Chem. 270,9250-9257.
BANTLEON, R., ALTENBUCHNER, J., VAN PEE, K.-H.
are able to catalyze, it is the halide inde- (1994), Chloroperoxidasefrom Streptomyces livi-
pendent reactions that have demonstrat- duns - isolation and characterization of the en-
ed excellent synthetic utility. zyme and the corresponding gene, J. Bacteriol.
- Apart from a limited range of haloperox- 176,2339-2347.
idases, no enzymes able to catalyze either BELKIN,S. (1992), Biodegradation of haloalkanes,
the formation or dehalogenation of halo- Biodegradation 3,299-313.
8 References 213
BONGS, G., VAN PEE,K. H. (1994), Enzymatic chlori- Rhodococcus corallinus, FEMS Microbiol. Lett.
nation using nonheme haloperoxidases, Enzyme 34,335-338.
Microb. Technol. 16,5340. COPLEY, S. D., CROOKS, G. P. (1992),Enzymatic deha-
BRENNER,~., HERNANDEZ, B. S., FOCHT,D. D. (1993), logenation of 4-chlorobenzoyl coenzyme A in
Variation in chlorobenzoate catabolism by Pseu- Acinetobacter sp. strain 4-CBI, Appl. Environ.
dornonasputida P l l l as a consequence of genetic Microbiol. 58,138.5-1387.
alteration,Appl. Environ.Microbiol. 59,2790-2794. COUGHLIN, F?, ROBERTS, S., RUSH,C., WILLETTS, A.
BROWN, J. F., WAGNER, R. E., FENG,H., BEDARD, D. (1993), Biotransformation of alkenes by haloper-
L., BRENNAN, M. J., CARNAHAN, J. C., RAY,R. J. oxidases - regiospecific bromohydrin formation
(1987), Environmental dechlorination of PCBs, from cinnamyl substrate, Biotechnol. Lett. 15,
Environ. Toxicol. Chem. 6,579-593. 907-912.
BURD,W., YOURKEVICH, o.,VOSKOBOEV, A. J., VAN CURRAGH, H., FLY”, O., LARKIN, M. J., STAFFORD,T.
PEE,K. H. (1995), Purification and properties of a M., HAMILTON, J. T. G., HARPER,D. B. (1994),
nonheme chloroperoxidase from Serratia mar- Haloalkane degradation and assimilation by
cescens, FEMS Microbiol. Lett. 129,255-260. Rhodococcus rhodochrous NCIMB 13064, Mi-
BUTLER,A., WALKER, J.V. (1993),Marine haloperox- crobiology 140,1433-1442.
idases, Chem. Rev. 93,1937-1944. DE BOER,E., PLAT,H.,TRoMP,M. G. M., WEVER,R.,
CAMBOU, B., KLIBANOV, A. M. (1984), Lipase-cata- FRANSSEN, M. c . R.,VANDER PLAS,H. c.,MEIJER,
lyzed production of optically-activeacids via asym- E. M., SCHOEMAKER, H. E. (1987), Vanadium
metric hydrolysis of esters - effect of the alcohol containing bromoperoxidase - an example of an
moiety,Appl. Biochem. Biotechnol. 9,255-260. oxidoreductase with high operational stability in
CANNARSA, M. J. (1996), Single enantiomer drugs: aqueous and organic media, Biotechnol. Bioeng.
new strategies and directions, Chem. Ind., 374-378. 30,607610.
CARMICHAEL, R. D., PICKARD, M. A. (1989), Contin- DE JONG,E., FIELD,J. A., SPINNLER, H. E., WIJNN-
uous and batch-production of chloroperoxidase BERG, J. B. P. A., DE BONT,J. A. M. (1994), Signifi-
by mycelial pellets of Caldariomyces furnago in cant biogenesis of chlorinated aromatics by fungi
an airlift fermenter, Appl. Environ. Microbiol. 55, in natural environments, Appl. Environ. Mi-
17-20. crobiol. 60,264-270.
CASTRO, C. E., BARTNICKI, E. W. (1968),Biodehalog- DE SILVA,E. D., ANDERSEN, R. J., ALLEN,T. M.
enation. Epoxidation of halohydrins, epoxide (1990), Geodiamolide-C to geodiamolide-F, new
opening, and transdehalogenation by a Flavobac- cytotoxic cyclodepsipeptides from the marine
terium species, Biochemistry 7,3213-3218. sponge Pseudaxinyssa sp., Tetrahedron Lett. 31,
CHAN, W. R.,TINTo,W. F., MANCHAND, P. S.,TODARO, 489492.
L. J. (1987), Stereostructures of geodiamolide-A DOLFING, J., BUERSKENS, J. E. M. (1995), The micro-
and geodiamolide-B, novel cyclodepsipeptides bial logic and environmental significance of re-
from the marine sponge Geodia sp.,J. Org. Chem. ductive dehalogenation, Adv. Microb. Ecol. 14,
52,3091-3093. 143-206.
CHANG,K. H., LIANG,F? H., BECK,W., SCHOLTEN, DOLFING, J., VAN DER WIJNGAARD, A. J., JANSSEN, D.
J. D., DUNAWAY-MARINO, D. (1992), Isolation B. (1993), Microbiological aspects of the removal
and characterization of the three polypeptide of chlorinated hydrocarbons from air, Biodegra-
components of 4-chlorobenzoate dehalogenase dation 4,261-282.
from Pseudomonas sp. CBS3, Biochemistry 31, DRAUZ,K., WALDMANN, H. (Eds.) (1995), Enzyme
5605-5610. Catalysis in Organic Synthesis, pp. 783-791. Wein-
CHEN,Y. P., LINCOLN, D. E., WOODIN, S. A., LOVELL, heim: VCH.
C. R. (1991), Purification and properties of a EGLI,C.,TSCHAN,T., SCHOLTZ, R., COOK,A. M., LEI-
unique flavin-containing chloroperoxidase from SINGER, T. (1988), Transformation of tetrachlo-
the capitellid polychaete Notomastus lobatus, J. romethane to dichloromethane and carbon diox-
Biol. Chem. 266,23 909-23 915. ide by Acetobacterium woodii,Appl. Environ. Mi-
COLONNA, S., GAGGERO, N., CASELLA, L., CARREA, crobiol. 54,2819-2834.
G., PASTA, P. (1993),Enantioselective epoxidation EGLI,C., STROMEYER, S., COOK,A.M., LEISINGER, T.
of styrene derivatives by chloroperoxidase cata- (1990),Transformation of tetra- and trichlorome-
lysts, Tetrahedr0n:Asymmetry 4,1325-1330. thane to CO, by anaerobic bacteria is a non-enzy-
CONTESTABILE, R., JOHN,R. A. (1996), The mecha- matic process, FEMS Microbiol. Lett. 68,207-212.
nism of high-yielding chiral syntheses catalyzed ELANDER, R. P., MABE,J. A., HAMILL, R. H., GOR-
by wild-type and mutant forms of aspartate-ami- MAN,M. (1968), Metabolism of tryptophans by
notransferase, Eur. J. Biochem. 240,15Ck155. Pseudomonas aureofaciens. I1 Production of pyr-
COOK,A. M., HUTTER,R. (1986), Ring dechlorina- rolnitrin by selected Pseudomonas species,Appl.
tion of deethylsimazine by hydrolases from Microbiol. 16,753-7.58.
ELSNER, A., MULLER,R., LINGENS, F. (1991), Sepa- FRANSSEN,

M. C. R. (1994), Haloperoxidases: useful
rate cloning and expression analysis of two pro- catalysts for halogenation and oxidation reac-
tein components of 4-chlorobenzoate dehalogen- tions, Catalysis Today 22,441-457.
ase from Pseudomonas sp. CBS3, J. Gen. Micro- FRANSSEN, M. c. R., VAN DER R A S , H. c. B. (1992),
biol. 137,477481. Haloperoxidases- their properties and their use in
ENGESSER, K.-H., SCHULTE, P. (1989), Degradation organic synthesis,Adv. Appl. Microbiol. 37,41-99.
of 2-bromo, 2-chloro and 2-fluorobenzoate by Fu, H., KONDO, H., ICHIKAWA,~., LOOK,G. C., WONG,
Pseudomonas putida CLB250, FEMS Microbiol. C.-H. (1992), Chloroperoxidase-catalyzed asym-
Lett. 60,143-148. metric synthesis - enantioselective reactions of
FACEY,S. J., GROSS,F., VINING,L. C., YANG,K., VAN chiral hydroperoxidase with sulfides and bromo-
PEE, K.-H. (1996), Cloning, sequencing and dis- hydration of glycals, J. Org. Chem. 57,7265-7270.
ruption of a bromoperoxidase-catalase gene in FURUKAWA, K., MATSUMURA, F., TONOMURA, K.
Streptomyces venezuelae: evidence that it is not (1978), Alcaligenes and Acinetobacter strains
required for chlorination in chloramphenicol bio- capable of degrading polychlorinated biphenyls,
synthesis,Microbiology 142,657-665. Agric. Biol. Chem. 42,543-548.
FENICAL, W. (1974), Polyhaloketones from the red GEIGERT, J., NEIDLEMAN, S. L., DALIETOS, D. J., DE-
seaweed Asparagopsis taxiformis, Tetrahedron WITT,S. K. (1983a), Haloperoxidases - enzymatic
Lett. 51/52,4463466. synthesis of a,P-halohydrins from gaseous al-
FENICAL, W. (1979), Molecular aspects of halogen- kenes, Appl. Environ. Microbiol. 45,366-314.
based biosynthesis of marine natural products, GEIGERT, J., NEIDLEMAN, S. L., DALIETOS, D. J. (1983b),
Recent Adv. Phytochem. 13,219-239. Novel haloperoxidase substrates - alkynes and
FENICAL, W. (1982), Natural products chemistry in cyclopropanes,J. Biol. Chem. 258,2273-2277.
the marine environment, Science 215,923-928. GEIGERT, J., DEWITT,S. K., NEIDLEMAN, S. L., DALIE-
FENICAL, W. (1993), Chemical studies of marine bac- TOS, D. J., MORELAND, M. (1983c),DMSO is a sub-
teria - developing a new resource, Chem. Rev. 93, strate for chloroperoxidase, Biochem. Biophys.
1673-1682. Res. Commun. 116,8245.
FETZNER, S., LINGENS,F. (1994), Bacterial dehalo- GOLOVLEVA, L. A., ZABOFUNA, O., F’ERTSOVA, R.,
genases: Biochemistry, genetics and biotechno- BASKUNOV, B., SCHURUKHIN,Y., KUZMIN, S. (1992),
logical applications,Microbiol. Rev. 58,641-685. Degradation of polychlorinated phenols by Strep-
FETZNER, S., MULLER, R., LINGENS, F. (1989), Degra- tomyces rochei 303, Biodegradation 2,201-208.
dation of 2-chlorobenzoate by Pseudomonas GREGSON, R. P.,BALDO,B. A.,THOMAS, P. G., QUINN,
cepacia 2CBS, Biol. Chem. Hoppe-Seyler 370, R. J., BERGQUIST, P. R., STEPHENS, J. R., HORNE,A.
1173-1 182. R. (1979), Fluorine is a major constituent of the
FETZNER, S., MULLER, R., LINGENS, F. (1992), Purifi- marine sponge Halichondria moorei, Science 206,
cation and some properties of 2-halobenzoate 1,2- 110&1109.
dioxygenase, a two-component enzyme system GRIBBLE, G. W. (1992), Naturally occurring organo-
from Pseudomonas cepacia 2CBS, J. Bacteriol. halogen compounds - A survey, J. Nat. Prod. 55,
174,279-290. 1353-1395.
FIELD, J. A., VERHAGEN, F. J. M., DE JONG,E. (1995), GRIBBLE,G. W. (1%4), Natural organohalogens,
Natural organohalogen production by basidiomy- J. Chem. Educ. 71,907-911.
cetes, Trends Biotechnol. 13,451456. GRISHAM, M. B., JEFFERSON, M. M., MELTON, D. F.,
FIELDING, M. (1992), in: Water Pollution Research THOMAS, E. L. (1984), Chlorination of endoge-
Reports: Pesticides in Ground and Drinking Water nous amines by isolated neutrophils - ammonia-
Report No. 27 (FIELDING, M., Ed.), pp. 5-11 (pub- dependent bactericidal, cyto-toxic, and cytolytic
lication of the Commission of the European activities of the chloramines, J. Biol. Chem. 259,
Communities, Directorate General for Science, 10404-10413.
Research and Development). GSCHWEND, P. M., MACFARLAND, J. K., NEWMAN, K.
FLAVIN, M., CASTRO-~~ENDOZA, H., OCHOA, S. (1957), A. (1985), Volatile halogenated organic com-
Metabolism of propionic acid in animal tissues. pounds released to seawater from temperate ma-
I1 Propionyl coenzyme A carboxylation system, rine macroalgae, Science 227,1033-1035.
J. Biol. Chem. 229,981. HAAG,T., LINGENS, F., VAN PEE, K.-H. (1991), A
FOWDEN, L. (1968),The occurrence and metabolism metal-ion-independent and cofactor-independent
of carbon-halogen compounds, Proc. R. SOC. enzymatic redox reaction - halogenation by bac-
London B 171,5-18. terial nonheme haloperoxidases, Angew. Chem.
FRANKEN, S. M., ROZEBOOM,H. J., KALK,K. H., DIJK- (Int. Edn. Engl.) 30,1487-1488.
STRA, B. W. (1991), Crystal structure of halo- HAGER,L. P. (1982), Mother nature likes some
alkane dehalogenase: an enzyme to detoxify ha- halogenated compounds, Basic Life Sci. 19,
logenated alkanes, EMBO J. 10,1297-12302. 415429.
8 References 215
HAGER, L. P., MORRIS, D. R., BROWN, F. S., EBERWEIN, HUNTER, J. C., FONDA, M., SOTOS,L., Toso, B., BELT,
H. (1966), Chloroperoxidase. I1 Utilization of A. (1984), Ecological approaches to isolation,
halogen anions, J. Biol. Chem. 241,1769-1776. Dev. Ind. Microbiol. 25,247-266.
HAGGBLOM, M. M., RIVERA,M. D., YOUNG,L. Y. IMAI,R., NAGATA,Y., FUKADA,M., TAGAKI, M.,
(1993), Influence of alternative electron accep- YANO,M. (1991), Molecular cloning of a Pseudo-
tors on the anaerobic biodegradability of chlori- monas paucimobilis gene encoding a 17-kilodal-
nated phenols and benzoic acids, Appl. Environ. ton polypeptide that eliminates HCl from y-hexa-
Microbiol. 59,1162-1167. chlorocyclohexane,J. Bacteriol. 173,6811-6819.
HAIDER, K. (1979), Degradation and metabolization ISHIDA, M. (1968), Comparative studies on BHC me-
of lindane and other hexachlorocyclohexane iso- tabolizing enzymes, DDT dehydrochlorinase and
mers by anaerobic and aerobic soil microorga- glutathione S-transferase, Agric. Biol. Chem. 32,
nisms, 2.Naturforsch. (Sect. C) 34,1066-1069. 947-955.
HAMILTON, J. T. G., AMIN,M. R., HARPER,D. B., ISIDOROV, V. A. (1990), Organic Chemistry of the
O’HAGAN, D. (1997), Biosynthesis of fluoroace- Earths Atmosphere. Berlin: Springer-Verlag.
tate and 4-fluorothreonine by Streptomyces catt- ITOH,N., CHENG,L. Y., IZUMI,Y., YAMADA,H.
leya. Glycine and pyruvate as precursors, J. C. S. (1987a), Immobilized bromoperoxidase of Coral-
Chem. Commun. 797-798. linu pilulifera as a multifunctional halogenating
HARDMAN, D. J. (1991), Biotransformation of halo- biocatalyst,J. Biotechnol. 5,29-38.
genated compounds, Crit. Rev. Biotech. 11,140. ITOH, N., IZUMI,Y., YAMADA, H. (1987b), Halo-
HARPER, D. B. (1985), Halomethane from halide ion peroxidase-catalyzed halogenation of nitrogen-
- a highly efficient fungal conversion of environ- containing aromatic heterocycles represented by
mental significance,Nature 315,55-57. nucleic bases, Biochemistry 26,282-289.
HARPER, D. B., HAMILTON, J.T. G. (1988), Biosynthe- ITOH,N., HASAN,A. K. M. Q., IZUMI,Y.,YAMADA, H.
sis of chloromethane in Phellinus pomaceus, (1988), Substrate-specificity,regiospecificity and
J. Gen. Microbiol. 134,2831-2839. stereospecificity of halogenation reactions cata-
HARPER, D. B., O’HAGAN, D. (1994),The fluorinated lyzed by non-heme-type bromoperoxidase of Co-
natural products, Nut. Prod. Rep. 11,123-133. rallina piluliferu, Eur. J. Biochem. 172,477-484.
\RPER, D. B., HAMILTON, J. T. G., O’HAGAN,D. ITOH, N., MORINAGA, N., KONZAI, T. (1994), Purifica-
(1990), Identification of threo-18-fluoro-9,lO- tion and characterization of a novel metal-
dihydroxystearic acid - A novel *fluorinated containing nonheme bromoperoxidase from
fatty-acid from Dichapetalum toxicarium seeds, Pseudomonas putidu, Biochim. Biophys. Acta
Tetrahedron Lett. 31,7661-7662. 1207,208-216.
WTZEL, R.,ANKE,H., SHELDRICK, w. s. (1990), JANNUN, R., COE, E. L. (1987), Bromoperoxidase
Mycenon, a new metabolite from a Mycena spe- from the marine snail Murex trunculis, Comp.
cies TA-87202 (Basidomycetes) as an inhibitor of Biochem. Physiol. 88,917-922.
isocitrate lvase. J.Antibiot. 43.1240-1244. JANSSEN, D. B., SCNEPER, A., DIJKHUIZEN, L., WIT-
HECHT,T. J., h E K , H., HAAG,T., PFEIFER, o.,VAN HOLT, B. (1985), Degradation of halogenated
PEE,K. H. (1994),The metal ion free oxidoreduct- aliphatic compounds by Xanthobacter autotrophi-
ase from Streptomyces aureofuciens has an alp cus GJ10, Appl. Environ. Microbiol. 49,673-677.
hydrolase fold, Nut. Struct. Biol. 1,523-537. JANSSEN, D. B., FRIES,F., VAN DER PLOEG,J., KAZE-
HEWSON, W. D., HAGER,L. I? (1980), Bromoperoxi- MIER, B., TEPSTRA, I?,WITHOLT, B. (1989), Cloning
dases and halogenated metabolites in marine of 1,2-dichloroethane degradation genes of Xan-
algae,J. Phycol. 16,340-345. thobucter autotrophicus GJlO and expression and
HICKEY, W. J., FOCHT,D. D. (1990), Degradation of sequencing of the dhla gene, J. Bacteriol. 171,
mono-, di- and trihalogenated benzoic acids by 6791-6799.
Pseudomonas aeruginosa JB2, Appl. Environ. JANSSEN, D. B., PRIES, F., VAN DER PLOEG, J. R. (1994),
Microbiol. 56,3842-3850. Genetics and biochemistry of dehalogenating
HOLLIGER, C., SCHRAA, G., STAMS,A. J. M., ZEHN- enzymes, Ann. Rev. Microbiol. 48,163-191.
DER, A. J. B. (1993),A highly purified enrichment JENSEN, I? R., FENICAL, W. (1994), Strategies for di-
culture couples the reductive dechlorination of covery of secondary metabolites from marine
tetrachloroethene to growth, Appl. Environ. bacteria - Ecological perpectives, Ann. Rev. Mi-
Microbiol. 59,2991-2997. crobiol. 48,559-584.
HOWARD, I? H., BOETHLING, R. S., STITELER, W. M., JOHNSTON, H. W., BRIGGS,G. G., ALEXANDER, M.
MEYLAN, W. M., HUEBER, A. E., BEAUMAN, J. A., (1972), Metabolism of 3-chlorobenzoic acid by a
LAROSCHE, M. E. (1992), Predictive model for pseudomonad, Soil Biol. Biochem. 4,187-190.
aerobic biodegradability developed from a file of JOHRI,S., QUAZI,G. N., CHOPRA, C. L. (1991), Evi-
evaluated biodegradation data, Environ. Toxicol. dence of plasmid mediated dechlorinase activity
Chem. 11,593403. in Pseudomonas sp.,J. Biotechnol. 20,73-82.
JONES, D. H. A., BARTH,F! T., BYROM,D., THOMAS,

C. LEE, M. D., DUNNE,T. S., CHANG,C. C., SIEGEL,M.
M. (1992), Nucleotide sequence of the structural M., MORTON, G. O., ELLESTAD, G. A., MCGAHREN,
gene encoding a 2-haloalkanoic acid dehalogen- W. J., BORDERS,D. B. (1992), Calicheamicins, a
ase of Pseudomonas putida strain AJ1 and novel family of antitumor antibiotics. 4. Structure
purification of the encoded protein, J. Gen. elucidation of calicheamicins PIBr,Y , ~ ‘ ,a2’, a31,
Microbiol. 138,675-683. PI1,yll,&I, J.Am. Chem. SOC.114,985-997.
KAWASAKI, H., TSUDA,K., MATSUHITA, I., TONOMU- LI, J. Z., SHARMA, R., DILEEPAN, K. N., SAWN,V. J.
RA, K. (1992), Lack of homology between two (1994), Polymorphonuclear leukocytes increase
haloacetate dehalogenase genes encoded on a glomerular albumin permeability via hypohalous
plasmid from Moraxella species strain B, J. Gen. acid, Kidney Znt. 46,1025-1030.
Microbiol. l38,1317-1323. LIPKE, H., KEARNS,C. W. (1959), DDT dehy-
KAWASAKI, H., TOYAMA, T., MAEDA,T., NISHINO, H., drochlorinase. I Isolation. chemical DroDerties.
TONOMURA, K. (1994), Cloning and sequence and spectrophotometric assay, J. Biol. khdm. 234:
analysis of a plasmid-encoded 2-haloacid deha- 2123-2128.
logenase gene from Pseudomons putida no. 109, LIPKE,H., KEARNS, C. W. (1959),DDT dehydrochlor-
Biosci. Biotech. Biochern. 58,160-163. inase. I1 Substrate and cofactor specificity,J. Biol.
KEUNING, s.,JANSSEN, D. B., WITHOLT, B. (1985), Pur- Chem. 234,2129-2132.
ification and characterization of hydrolytic halo- LIU, K. K.-C., WONG, C.-H. (1992), Enzymatic
alkane dehalogenase from Xanthobacter auto- halohydration of glycals, J. Org. Chem. 57,
trophicus GJ10, J. Bacteriol. 163,635-639. 3748-3750.
KITAGAWA, I., FUKUDA,Y., TANIYAMA, T., YOSHI- LOFFLER,F., MULLER,R., LINGENS, F. (1992), Purifi-
KAWA, M. (1999, Chemical studies on crude drug cation and properties of 4-chlorobenzoate-coen-
processing. 8. On the constituents of Rehmanniae zyme A ligase from Pseudomonas sp. CBS3,
radix. 2. Absolute stereostructures of rehmaglu- Hoppe-Seyler’s Z. Physiol. Chem. 373,1001-1007.
tin-C and glutinoside isolated from Chinese Reh- MAGUIRE, A. R., MENG,W.-D., ROBERTS, S. M., WIL-
manniae radix, the dried root of Rehmannia gluti- LEmS, A. J. (1993), Synthetic approaches towards
nosa libosch, Chem. Pharm. Bull. 43,1096-1100. nucleocidin and selected analogs - anti-HIV
KIYOHARA, H., HAITA, T., OGAWA,Y., KAKUDA, T., activity in 4 ‘-fluorinated nucleoside derivatives,
YOKOYAMA, H., TAKIZAWA, N. (1992), Isolation J. Chem. SOC.Perkin Trans. 1,1795.
of Pseudomonas pickettii strains that degrade MANTHEY, J. A., HAGER,L. P. (1981), Purification
2,4,6-trichlorophenol and their dechlorination of and properties of bromoperoxidase from Penicil-
chlorophenols, Appl. Environ. Microbiol. 58, lus capitatus,J. Biol. Chem. 256,1232-1238.
1276-1283. MARSHALL, G. C., WRIGHT,G. D. (1996), Purification
KLAGES,U., KRAUSS, S., LINGENS, F. (1983), 2-Halo- and characterization of 2 haloperoxidases from
acid dehalogenase from a 4-chlorobenzoate-de- the glycopeptide antibiotic producer Streptomy-
grading Pseudomonas spec. CBS 3, Hoppe-Sey- ces toyocaensis NRRL-15 009, Biochem. Biophys.
ler’s Z. Physiol. Chem. 364,529-535. Res. Commun. 219,58&583.
KOBAYASHI, J., KANDA,F., ISHIBASHI, M., SHIGEMORI, MCCORMICK, M. L., ROEDER,T. L., RAILSBACK, M.
H. (1991), Manzacidins AC, novel tetrahydro- A., BRITIGAN,B. E. (1994), Eosinophil per-
pyrimidine alkaloids from the Okinawan marine oxidase-dependent hydroxyl radical generation
sponge Hyrneniacidon sp., J. Org. Chem. 56, by human eosinophils, J. Biol. Chem. 269,
45744576. 27914-27919.
KOHLER-STAUB, D., LEISINGER, T. (1985), Dichlo- MEAD, R. J., SEGAL,W. (1973), Formation of P-
romethane dehalogenase of Hyphomicrobium cyanoalanine and pyruvate by Accacia georginae,
species strain DM2, J. Bacteriol. 162,676-681. Phytochernistry 12,1977-1981.
KONDO,K., NISHI,J., ISHIBASHI, M., KOBAYASHI, J. MESSERSCHMIDT, A., WEVER,R. (1996), X-ray struc-
(1994), 2 New tryptophan-derived alkaloids from ture of a vanadium-containing enzyme - chloro-
the Okinawan marine sponge Aplysina sp.,J. Nat. peroxidase from the fungus Curvularia in-
Prod. (Lloydia) 57,1008-1011. aequalis, Proc. Natl. Acad. Sci. USA 93,392-396.
KUHN,E. P., TOWNSEND, G. T., SUFLITA, J. M. (1990), MEYER,M., O’HAGAN,D. (1992a), Rare fluorinated
Effect of sulfate and organic carbon supplements natural products, Chem. Brit. 28,785-788.
on reductive dehalogenation of chloroanilines in MEYER,J. J. M., O’HAGAN, D. (1992b), Conversion of
anaerobic aquifer slurries, Appl. Environ. Micro- fluoropyruvate to fluoroacetate by Dichapetalum
biol. 56,2630-2637. cymosum, Phytochemistry 31,499-501.
LEE,M. D., ELLESTAD, G.A., BORDERS, D. B. (1991), MEYER,J. J. M., O’HAGAN, D. (1992c),Conversion of
Calicheamicins - discovery, structure, chemistry 3-fluoropyruvate to fluoroacetate by cell-free ex-
and interaction with DNA, Acc. Chem. Res. 24, tracts of Dichapetalum cymosum, Phytochemistry
235-243. 31,2699-2701.
8 References 217
MILES,D. H., MODY,N.V., MINYARD, J. P., HEDIN,P.A. NEIDLEMAN, S. L. (1980), Use of enzymes as catalysts
(1973), Constituents of marsh grass. Survey of the for alkene oxide production, Hydrocarbon Pro-
essential oils in Juncus raemerianus, Phytochem- cess. (Intl. Edn.) 59,135-138.
istry 12,1399. NEIDLEMAN, S. L., GEIGERT,J. (1986), Biohalogena-
MIURA,K., OTSUKA, S., HONDA, K. (1956),Abnormal tion: Principles, Basic Roles and Applications.
metabolism in animals poisoned with sodium New York: Halsted Press.
fluoroacetate, Bull. Agric. Chem. Soc. Jpn. 20, NEILSON,A. H., ALLARD,A. S., LINDGREN,C.,
219-222. REMBERGER, M. (1987), Transformation of chlo-
MOHN,W. W., TIEDJE,J. M. (1992), Microbial reduc- roguaiacols, chloroveratroles and chlorocatechols
tive dehalogenation, Microbiol. Rev. 56,482-507. by stable consortia of anaerobic bacteria, Appl.
MOORE,R. E. (1977), Volatile compounds from ma- Environ. Microbiol. 53,949-954.
rine algae, Acc. Chem. Res. 10,40-47. NIESCHALK, J., HAMILTON, J. T. G., MURPHY,C. D.,
MOTOSUGI, K., ESAKI,N., SODA,K. (1982), Purifica- HARPER, D. B., O’HAGAN, D. (1997), Biosynthesis
tion and properties of 2-haloacid dehalogenase of fluoroacetate and 4-fluorothreonine by Strep-
from Pseudomonas putida, Agric. Biol. Chem. 46, tomyces cattleya. The stereochemical processing
837-838. of glycerol, J. C. S. Chem Commun. 799-800.
MULLER, R. (1992), Bacterial degradation of xeno- NUELL,M. J., FANG,G.-H., AXLEY,M. J., KENISBERG,
biotics, in: Microbial Control of Pollution, SGM P., HAGER,L. P. (1988), Isolation and nucleotide-
Symposium 48 (FRY,J. C., GADD,G. M., HERBERT, sequence of the chloroperoxidase gene from Cal-
R. A., JONES,C. W., WATSON-CRAIK, I. A., Eds.), dariomyces fumago,J. Bacteriol. 170,1007-1011.
pp. 35-57. Cambridge: Cambridge University O’HAGAN,D., PERRY,R., LOCK,J. M., MEYER,J. J.
Press. M., DASARADHI, L., HAMILTON, J. T. G., HARPE,
MURDIYATMO, U., ASMARA,W., TSANG,J. S. H., D. B. (1993), High levels of monofluoroacetate
BAINES, A. J., BULL,A. T., HARDMAN, D. J. (1992), in Dichapetalum braunii, Phytochemistry 33,
Molecular biology of the 2-haloacid halidohy- 1043-1 045.
drolase from Pseudomonas cepacia MBA4, Bio-
OHTA,T., TAKAHASHI, A., MATSUDA, M., KAMO,S.,
chem. J. 284,87-93.
AGATSUMA,T., ENDO,T.,NAZOE,S. (1995), Russu-
NAGASAWA,T., YAMADA, H. (1986), Enzymatic trans-
phelol, a novel optically active chlorohydroqui-
formations of 3-chloroalanine into useful amino-
none tetramer from the mushroom Russula sub-
acids,Appl. Biochem. Biotechnol. 13,147-165.
nigricans, Tetrahedron Lett. 36,5223-5226,
NAGASAWA, T., NAKAMURA, T., Yu, F., WATANABE, I.,
YAMADA, H. (1992), Purification and character- OKAMOTO, K., SHIMADA, A., SHIRAI,R., SAKAMOTO,
ization of halohydrin hydrogen-halide lyase from H.,YOSHIDA, S., OJIMA,F., ISHIGURO, Y., SAKAI,T.,
a recombinant Escherichia coli containing the KAWAGISHI, H. (1993), Antimicrobial chlorinated
gene from a Corynebacteriurn species, Appl. Mi- orcinol derivatives from mycelia of Hericium
crobiol. Biotech. 36,478482. erinaceum, Phytochemistry 34,1445-1446.
NAGATA,~., HATTA,T.,IMAI,R., KIMBARA, K., FUKU- PASTA,P., CARREA,G., COLONNA, S., GAGGERO, N.
DA,M., YANO,K., TAKAGI, M. (1993), Purification (1994), Effects of chloride on the kinetics and
and characterization of y-hexachlorocyclohexane stereochemistry of chloroperoxidase catalyzed
( y-HCH) dehydrochlorinase (LinA) from Pseu- oxidation of sulfides, Biochim. Biophys. Acta
domonas paucimobilis, Biosci. Biotechnol. Bio- 1209,203-208.
chem. 57,1582-1583. PELLETIER, I., ALTENBUCHNER, J. (1993, A bacterial
NAKAMURA, T., NAGASAWA, T., Yu, F., WATANABE, J., esterase is homologous with nonheme haloper-
YAMADA, H. (1992), Resolution and some pro- oxidases and displays brominating activity, Mi-
perties of enzymes involved in enantioselective crobiology 141,459468.
transformation of 1,3-dichloro-2-propanol to (R)- PELLETIER, I., PFEIFER,O., ALTENBUCHNER, J., VAN
3-chloro-1,2-propanediol by Corynebacterium sp. PEE,K.-H. (1994), Cloning of a second nonheme
strain N-1074, J. Bacteriol. 174,7613-7619. bromoperoxidase gene from Streptomyces aureo-
NARDI-DEI,V., KURIHARA, T., OKAMURA, O., LIU,J. faciens ATCC 10762. Sequence analysis, expres-
Q., KOSHIKAWA, H., OZAKI,H., TERASHIMA, Y., sion in Streptomyces lividans and enzyme purific-
ESAKI,N., SODA,K. (1994), Comparative studies ation, Microbiology 140,509-516.
of genes encoding thermostable 1-2-halo acid de- PELLETIER, ~.,ALTENBUCHNER, J., MATTES, R. (1999,
halogenase from Pseudomonas species YL, other A catalylic triad is required by the non-heme ha-
dehalogenases, and two related hypothetical pro- loperoxidases to perform halogenation, Biochim.
teins from Escherichia coli,Appl. Environ. Micro- Biophys. Acta. 1250,149-157.
biol. 60,3375-3380. PETERS,R. A., SHORTHOUSE, M. (1964), Fluoride me-
NEIDLEMAN, S. L. (1975), Microbial halogenation, tabolism in plants of Accacia georginae, Biochem.
CRC Crit. Rev. Microbiol. 5,333-358. J. 93,P20.
218 3 Halocompounds - Biosynfhesis and Biofransformafion
PETERS,R. A., SHORTHOUSE, M. (1971), Identifica- haloalkane halidohydrolase from Rhodococcus
tion of a volatile constituent formed by homogen- erythropolis strain Y2, J. Gen. Microbiol. 136,
ates of Accacia georginae exposed to fluoride, 115-1 20.
Nature 231,123-124. SANADA, M., MIYANO, T., IWADARE, S., WILLIAMSON,
PET~Y, M. A. (1961), An introduction to the origin J. M.,ARISON, B. H., SMITH,J. L., DOUGLAS,A. W.,
and biochemistry of microbial halometabolites, LIESCH, J. M., INAMINE, E. (1986), Biosynthesis of
Bacteriol. Rev. 25,111-130. fluorothreonine and fluoroacetic acid by the
PFEIFER,O., PELLETIER, I., ALTENBUCHNER, J., VAN thienamycin producer, Streptomyces cattleya, J.
PEE, K.-H. (1992), Molecular cloning and se- Antibiot. 39,259-265.
quencing of a non-heme bromoperoxidase gene SCHENK,T., MULLER, R., LINGENS, A. (1990), Mecha-
from Streptomyces aureofaciens ATCC 10762, J. nism of enzymatic dehalogenation of pentachlo-
Gen. Microbiol. l38,1123-1131. rophenol by Arthrobacter sp. strain ATCC 33 790,
PICKARD, M. A., KADIMA,T. A., CARMICHEAL, R. D., J. Bacteriol. 172,7272-7274.
(1991), Chloroperoxidase, a peroxidase with po- SCHMITZ,A., GARTEMANN, K. H., FIELDER,J.,
tential, J. Znd. Microbiol. 7,235-241. GRUND, E., EICHENLAUB, R. (1992), Cloning and
PLAT,H., KREN,B. E., WEVER,R. (1987),The bromo- sequence analysis of genes for dehalogenation of
peroxidase from the lichen Xanthoria parietina is 4-chlorobenzoate from Arthrobacter sp. strain
a novel vanadium enzyme, Biochem. J. 248, SU, Appl. Environ. Microbiol. 58,40684071.
277-279. SCHNEIDER, B., MULLER, R., FRANK, R., LINGENS, F.
PRIES, F., VAN DER PLOEG, J. R., DOLFING, J., JANSSEN, (1991), Complete nucleotide sequences and com-
D. B. (1994), Degradation of halogenated aliphat- parison of the structural genes of two 2-haloalka-
ic compounds: The role of adaptation, FEMS Mi- noic acid dehalogenases from Pseudomonas sp.
crobiol. Rev. 15,279-295. strain CBS 3,J. Bacteriol. 173,1530-1535.
RADEHAUS, P. M., SCHMIDT, S. K. (1992), Character- SCHNEIDER, H., BARTH,W., BOHME,H. J. (1996),
ization of a novel Pseudomonas sp. that miner- Cloning and characterization of another lignin
alizes high concentrations of pentachlorophenol, peroxidase gene from the white-rot fungus Pha-
Appl. Environ. Microbiol. 58,2879-2885. naerochaete chrysosporium, Biol. Chem. Hoppe-
RAMANAND, K., BALBA,M. T., DUFFY,J. (1993), Re- Seyler 371,399-402.
ductive dehalogenation of chlorinated benzenes SCHOLTEN, J. D., CHANG, K. H., BABBIT, I? C., CHAR-
and toluenes under methanogenic conditions, EST, H., SYLVESTRE, M., DUNAWAY-MARINO, D.
Appl. Environ. Microbiol. 59,3266-3272. (1991), Novel enzymatic hydrolytic dehalogena-
RASCHE, M. E., HICKS,R. E., HYMAN, M. R.,ARP,D. tion of a chlorinated aromatic, Science 253,
J. (1990), Oxidation of monohalogenated ethanes 182-185.
and N-chlorinated alkanes by whole cells of Nitro- SCHOLTZ, R., LEISINGER, T., SUTER,F., COOK,A. M.
somonas europaea, J. Bacteriol. 172,5368-5373. (1987), Characterizationof 1-chlorohexanehalido-
RASMUSSEN, R. A., RASMUSSEN, L. E., KHALI,M. A. hydrolase,a dehalogenase of wide substrate range
K., DALUGE, R. W. (1980), Concentration distribu- from an Arthrobacter species, J. Bacteriol. 169,
tion of methyl chloride in the atmosphere,J. Geo- 5016-5021.
phys. Res. 85,7350-7356. Science Advisory Board of the International Joint
REINEKE, W., KNACKMUSS, H.-J. (1988),Microbial de- Commission of the Great Lakes (1989), 1989 Re-
gradation of haloaromatics, Ann. Rev. Microbiol. port. Int. J. Commission, Hamilton, Ontario, Oc-
42,263-287. tober 1989.
ROBINSON, G., LENN,M. J. (1994), The bioremedia- SEARLE, P. A,, MOLINSKI,T. F. (1994),5 New alkaloids
tion of polychlorinated biphenyls (PCBs): Prob- from the tropical ascidian, Lissoclinum sp. -
lems and perspectives,Biotechnol. Gen. Eng. Rev. lissoclinotoxin-A is chiral, J. Org. Chem. 59,
12,139-188. 6600-6605.
ROMANO, M., MELO,C., BARALLE, F.,DRI,P. (1992), SEELBACH, K., VAN DEURZEN, M. P. L., VAN RANT-
cDNA of myeloperoxidase (MPO) and eosino- WIJK, F., SHELDON, B. A., KRAGL,u. (1997), Im-
phi1 peroxidase (EPO) from human blood mono- provement of the total turnover number and
nuclear-cells differentiated into granulocyte pre- space-time yield for chloroperoxidase catalyzed
cursors in liquid cultures, J. Immunol. Methods oxidation, Biotechnol. Bioeng. 55,283-288.
154,265-267. SESIN,D. F., IRELAND, C. M. (1984),Iodinated prod-
SAINI,H. S.,ATTICH, J. M.,HANsoN,A.D. (1995),Bio- ucts from a didemnid tunicate, Tetrahedron Lett.
synthesis of halomethanes and methanethiol by 25,403-404.
higher plants via a novel methyltransferase reac- SHEFFIELD, D. J., HARRY, T., SMITH, A. J., ROGERS, L.
tion, Plant Cell Environ. 18,1027-1033. J. (1993), Purification and characterization of the
SALLIS, P. J., ARMFIELD, S. J., BULL,A. T., HARDMAN, vanadium bromoperoxidase from the macroalga
D. J. (1990), Isolation and characterisation of a Corallina officinalis, Phytochemistry 32,21-26.
8 References 219
SHEFFIELD, D. J., HARRY, T., SMITH, A. J., ROGERS, L. TSCHIRRET-GUTH, R. A., BUTLER,A. (1994), Evi-
J. (1994), Immobilization of bromoperoxidase dence for organic substrate binding to vanadium
from Corallina officinalis, Biotechnol. Techniques bromoperoxidase,J. Am. Chem. SOC.116,411-412.
8,579-582. Tu, C. M. (1976), Utilization and degradation of lin-
SHELTON, D. R., TIEDJE,J. M. (1984), Isolation and dane by soil microorganisms, Arch. Microbiol.
partial characterization of bacteria in an anaero- 108,259-263.
bic consortium that mineralizes 3-chlorobenzoic VAN DEN WIJNGAARD,A. J., JANSSEN, D. B., WITHOLT,
acid, Appl. Environ. Microbiol. 48,84&848. B. (1989), Degradation of epichlorohydrin and
SIMONS, B. H., BARNETT, P.,VOLLENBROEK, E. G. M., halohydrins by bacterial cultures isolated from
DEKKER, H. L., MUIJSERS,A. O., MESSERSCHMIDT, freshwater sediments, J. Gen. Microbiol. 135,
A.,WEVER, R. (1995),Primary structure and char- 2199-2208.
acterization of the vanadium chloroperoxidase VAN DEN WIJNGAARD, A. J., REUVEKAMP, P. T. W.,
from the fungus Curvularia inaequalis, Eur.J. Bio- JANSSEN, D. B. (1991), Purification and character-
chem. 229,566-574. ization of haloalcohol dehalogenase from Arthro-
SLATER, J. H., BULL,A. T., HARDMAN, D. J. (1995), bacter sp. strain AD2, J. Bacteriol. 173,124-129.
Microbial dehalogenation, Biodegradation 6, VAN DER MEER,J. R. (1994), Genetic adaptation of
181-189. bacteria to chlorinated aromatic compounds,
SMITH, A. L., NICOLAOU, K. C. (1996), The enediyne FEMS Microbiol. Rev. 15,239-249.
antibiotics,J. Med. Chem. 39,2103-2117. VAN DER PLOEG,J. R., HALL,G., JANSSEN, D. B.
SPINNLER, H.-E., DE JONG,E., MAUVAIS, G., SEMON, (1991), Characterization of the haloacid deha-
E., LE QUERE, J.-L. (1994),Production of halogen- logenase from Xanthobacter autotrophicus GJlO
ated compounds by Bjerkandera adusta, Appl. and sequencing of the dhl B gene, J. Bacteriol.
Microbiol. Biotechnol. 42,212-221. 173,7925-7933.
STUCKI, G. R., GALLI,R., EBERSOLD, H. R., LEISING- VAN PEE, K.-H. (1990), Bacterial haloperoxidases
ER, T. (1981), Dehalogenation of dichlorome- and their role in secondary metabolism, Biotech-
thane by cell extracts of Hyphomicrobium DM2, nol.Adv. 8,185-205.
Arch. Microbiol. 130,881-886. VAN PEE,K.-H. (1996), Biosynthesis of halogenated
SUNDARAMOORTHY, M., MAURO, J. M., SULLIVAN, A. metabolites by bacteria, Ann. Rev. Microbiol. 50,
M., TERNER, J., POULOS, T. L. (1995), Preliminary 375-399.
crystallographic analysis of chloroperoxidase VAN PEE,K.-H., LINGENS, F. (1985a), Purification of
from Caldariomyces fumago, Acta Crystallogr. 51, bromoperoxidase from Pseudomonas aureofa-
842-844. ciens, J. Bacteriol. 161,1171-1175.
SUZUKI, T., HONDA, H., KATSUMATA, R. (1972), Pro- VAN PEE,K.-H., LINGENS, F. (1985b),Purification and
duction of antibacterial compounds analogous to molecular and catalytic properties of bromoper-
chloramphenicol by an n-paraffin-grown bacte- oxidase from Streptomyces phaeochromogenes, J.
rium, Agr. Biol. Chem. 36,2223-2228. Gen. Microbiol. l31,1911-1916.
TAKAHASHI, A., AGATSUMA, T., OHTA,T., NUNO- VAN PEE, K.-H., SALCHER, o.,FISCHER,P., BOKEL,
ZOWA, T., ENDO,T., NOZOE,S. (1993), Russuphe- M., LINGENS, F. (1983),The biosynthesis of brom-
lins B, C, D, E and F, new cytotoxic substances inated pyrrolnitrin derivatives by Pseudomonas
from the mushroom Russula subnigricans HON- aureofaciens,J. Antibiot. 36,1735-1742.
GO, Chem. Pharm. Bull. 41,1726-1729. VAN PEE,K.-H., SURY, G., LINGENS, F. (1987), Purifi-
TAMURA, T., WADA,M., ESAKI,N., SODA,K. (1995), cation and properties of a non-heme bromoper-
Synthesis of fluoroacetate from fluoride, glycerol, oxidase from Streptomyces aureofaciens, Biol.
and P-hydroxypyruvate by Streptomyces cattleya, Chem. Hoppe-Seyler 368,1225-1232.
J. Bacteriol. 177,2265-2269. VANSCHIJNDEL, J. W. F! M.,VOLLENBROEK, E. G. M.,
THOMAS, J. A., HAGER,L. P. (1968),The peroxidation WEVER,R. (1993),The chloroperoxidase from the
of molecular iodine to iodate by chloroperoxi- fungus Curvularia inequalis - a novel vanadium
dase, Biochem. Biophys. Res. Commun. 32, enzyme, Biochim. Biophys. Acta 1161,249-256.
17&175. VELDE,S. L.V., JACOBSEN, E. N. (1995), Kinetic reso-
IMLIN, C. (1995), The Pesticide Manual UK (10th lution of racemic chromenes via asymmetric
Edn.). R. SOC.Chem., Crop. Protection Publica- +
epoxidation - synthesis of ( )-Teretifolione-B,J.
tion (TOMLIN, C., Ed.). Org. Chem. 60,5380-5381.
)PP,E., HANSON, R. S. (1990), Degradation of pen- VERHAGEN, E J. M., SWARTS, H. J., KUYPER, T. W.,
tachlorophenol by a Flavobacterium species WIJNBERG, J. B. P. A., FIELD,J. A. (1996), The
grown in continuous culture under various nutri- ubiquity of natural adsorbable organic halogen
ent limitations, Appl. Environ. Microbiol. 56, production among basidiomycetes,Appl. Micro-
541-544. biol. Biotechnol. 45,71&718.
VEKSCHUEREN, K. H. G., FRANKEN,S. M., ROZE- WIESNER,W.,VAN PEE,K.-H., LINGENS, F. (1986), De-
BOOM, H. J., KALK,K. H., DIJKSTRA, B. W. (1993a), tection of a new chloroperoxidase in Pseudomo-
Refined X-ray structures of haloalkane dehaloge- nus pyrrocinia, FEBS Lett. 209,321-324.
nase at pH 6.2 and pH 8.2 and implications for the WILLIAMS, D. H., FAULKNER, D. J. (1996), N-Methyl-
reaction mechanism, J. Mol. Biol. 232,85&872. ated ageliferins from the sponge Astrosclera wil-
VERSCHUEREN, K. H. G., FRANKEN,S. M., ROZE- leyana from Pohnpei, Tetrahedron 52,5381-5390.
BOOM, H. J., KALK,K. H.,DIJKSTRA, B. W. (1993b), WOLFFRAMM, C., LINGENS, F., MUTZEL,R., VAN PEE,
Crystallographic analysis of the catalytic mecha- K.-H. (1993), Chloroperoxidase-encoding gene
nism of haloalkane dehalogenase, Nature 363, from Pseudomonas pyrrocina - sequence, expres-
693698. sion in heterologous hosts and purification of the
VILTER,H. (1984), Peroxidases from phaeophycae. enzyme, Gene 130,131-135.
A vanadium(V) dependent peroxidase from WOOLARD, F. X., MOORE,R. E., ROLLER,P. P. (1976),
Ascophyllum nodosum (L) 5, Phytochemistry 23, Halogenated acetamides, but-3-en-2-01s and iso-
1387-1390. propanols from Asparagopsis taxiformis (Delile)
VILTER,H. (1995),Vanadium dependent haloperoxi- Trev., Tetrahedron32,2843-2846.
dases, Met. Ions Biol. Syst. 31,325-362. WUOSMAA,A. M., HAGER,L. P. (1990), Methyl-chlo-
WACKETT,L. F!, SCHANKE, C. A. (1992), Mechanisms ride transferase - a carbocation route for biosyn-
of reductive dehalogenation by transition metal thesis of halometabolites, Science 249,160.
cofactors found in anaerobic bacteria, in: Metal XUN, L., TOPP, E., ORSER,C. S. (1992), Diverse sub-
Ions in Biological Systems, Vol. 28: Degradation strate range of a Flavobacterium pentachlorophe-
of Environmental Pollutants by Microorganisms no1 hydroxylase and reaction stoichiometries,
and their Metalloenzymes (SIGEL,H., SIGEL,A., J. Bacteriol. 174,2898-2902.
Eds.), pp. 329-356. XUN,L., TOPP,E., ORSER,C. S. (1992), Confirmation
WAGENKNECHT, H. A., WOGAN,W. D. (1997), Iden- of oxidative dehalogenation of pentachlorophe-
tification of intermediates in the catalytic cycle of no1 by a Flavobacterium pentachlorophenol hy-
chloroperoxidase, Chem. Biol. 4,367-312. droxylase, J. Bacteriol. 174,5745-5747.
WALKER, J. R. L., LIEN,B. C. (1981), Metabolism of YOKOTA, T., FUSE, H., OMORI, T., MINODA, Y. (1986),
fluoroacetate by a soil Pseudomonas sp. and Microbial dehalogenation of haloalkanes mediat-
Fusarium solani, Soil Biol. Biochem. 13,231-235. ed by oxygenase or halohydrolase, Agric. Biol.
WENG,M., PFEIFER,C., KRAUSS, s.,LINGENS,F., VAN Chem. 5,453460.
PEE, K. H. (1991), Purification, characterization YOKOTA, T., OMORI,T., KODAM,T. (1987), Purifica-
and comparison of 2 nonheme bromoperoxidases tion and properties of haloalkane dehalogenase
from Streptomyces aureofaciens ATCC 10762, from Corynebacterium sp. strain m15-3, J. Bacte-
J. Gen. Microbiol. 137,2539-2546. rial. 169,40494054.
WEVER,R., PLAT,H., DEBOER,E. (1985), Isolation Yu, F., NAKAMURA, T., MIZUNASHI, W., WATANABE,
procedure and some properties of the bromoper- W. (1994), Cloning of 2 halohydrin hydrogen-
oxidase from the seaweed Ascophyllum nodo- halide lyase genes of Corynebacterium sp. strain
sum, Biochim. Biophys. Acta 830,181-186. N-1074 and structural comparison of the genes
WEYAND, M., HECHT,H. J.,VILTER,H., SCHOMBURG, and gene-products, Biosci. Biotechnol. Biochem.
D. (1996), Crystallization and preliminary X-ray 58,1451-1457.
analysis of a vanadium dependent peroxidase ZAKS,A., DODDS,D. R. (1995), Chloroperoxidase-
from Ascophyllum nodosum,Acta. Crystallogr.D catalyzed asymmetric oxidations: Substrate speci-
52,864-865. ficity and mechanistic study, J. Am. Chem. SOC.
WIESNER,W., VAN PEE, K.-H., LINGENS,F. (1985), 117,10419-10424.
Purification and properties of bromoperoxidase
from Pseudomonas pyrrocinia, Biol. Chem.
Hoppe-Seyler 366,1085-1091.
4 Phosphorylation
SIMONJONES
Tempe,AZ, USA
1 Phosphoryl Transfer in General 222

1.1 Introduction 222
1.2 Enzyme-Catalyzed Phosphate Transfer 223
1.2.1 The Choice and Action of the Enzyme 223
1.2.1.1 Acetate Kinase 225
1.2.1.2 Glycerol Kinase 225
1.2.1.3 Pyruvate Kinase 225
1.2.1.4 Creatine Kinase and Arginine Kinase 225
1.2.1.5 Adenylate Kinase 226
1.2.1.6 Nucleoside Kinase 226
1.2.1.7 Hexokinase 226
1.2.1.8 Alkaline Phosphatase 226
1.2.1.9 Phosphodiesterase 226
1.2.2 The Source of Phosphate Group 228
1.2.3 Cofactor Regeneration 228
2 Formation of P-0 Bonds 228
2.1 Inorganic Phosphate (Pi) as the Phosphate Source 228
2.2 Nucleoside Triphosphates (NTPs) as the Phosphate Source 228
2.2.1 Phosphoenolpyruvate/Pyruvate Kinase 229
2.2.2 Acetyl Phosphate/Acetate Kinase 231
2.2.3 Methoxycarbonyl Phosphate/Acetate Kinase or Carbamate Kinase 231
2.2.4 Other Systems 232
2.3 Coupling to Form Phosphodiesters 232
2.3.1 Coupling with ATP 232
2.3.2 Coupling with CTP 232
2.3.3 Coupling with UTP 233
2.3.4 Coupling with Other Phosphate Sources 235
3 Cleavage of P-0 Bonds 235
3.1 Hydrolysis of Nucleic Acid Derivatives 235
3.2 Hydrolysis of Substrates Other than Nucleic Acid Derivatives 236
4 References 237
222 4 Phosphorylation
1 Phosphoryl Transfer step in monoterpene biosynthesis. Using the

language of synthetic organic chemistry, for-
in General mation of the pyrophosphate converts the al-
cohol into a good leaving group (nucleofuge).
ATP is in effect Nature's tosyl chloride!
1.1 Introduction The importance of nucleotide phosphate
metabolism can be judged from the daily
The formation and cleavage of the phos- energy requirements of an adult woman,
phate bond is one of the most important reac- 1500-1800 kcal (6300-7500 kJ). Th' is corre-
tions in biological systems.The release of ener- sponds to the energy of hydrolysis of 200 mol
gy from the hydrolysis of a P-0 bond (602 kJ (ca. 150 kg) of ATP to ADP and phosphate,
mol-l; 144 kcal mol-l) (BERKOWITZ, 1959) is which must be generated by recycling less than
an indication of the free energy available to 70 g of ATP. The major pathway for the pro-
"power" biological processes, i.e., to couple en- duction of ATP is the exogonic oxidation of
dogonic processes to the exogonic cleavage of glucose to carbon dioxide and water (VOET
phosphate bonds. The most common way this and VOET,1995).
is achieved, is by transfer of a pyrophosphate The key feature that distinguishes phos-
group from adenosine triphosphate (ATP) (1) phate esters from other conceivable deriva-
(Fig. 1) to an aliphatic alcohol. The alkyl pyro- tives is that they are kinetically highly stable in
phosphate so formed can then undergo nucle- aqueous solution. For example, the free energy
ophilic displacement to form a new bond. A of hydrolysis of acetic anhydride, acetyl phos-
typical example is the coupling of dimethylal- phate, and inorganic pyrophosphate are all of
lyl pyrophosphate and isopentenyl pyrophos- the same magnitude, whereas the half lives in
phate to give geranyl pyrophosphate, the key water are a few seconds, several hours, and
years, respectively. Moreover the presence of
several oxygens is ideal for facilitating binding
w 2
to enzymes and for activation of cleavage by
protonation (Fig. 2) (KEIKINHEIMO et al.,
1996).The predominant counterion in vivo is
Mg2+.
Phosphate esters have biological roles other
than energy metabolism. For example, phos-
HO OH phodiesters provide the backbone of both
DNA and RNA, the carriers of the genetic
1 Adenosine triphosphate (.4TP) code, while phosphorylation of key enzymes
and proteins regulates their activity (KREBS
Fig. 1. Adenosine triphosphate (ATP) (1). and BEAU,1979;GIBSON et al., 1990).
0 0 0 0 0
Fig. 2. pK, values for phosphate and pyrophosphate.

I Phosphoryl Transfer in General 223
Since many important biological molecules Group 1 - Phosphate Monoesters

and drugs contain phosphate groups, there is a (For simplicity, the cleavage of
need for efficient and specific synthetic meth- y-phosphate groups of
ods. Chemical synthesis often proceeds in high triphosphates are covered here)
yield, but currently there is a dearth of stereo-
or enantioselective methods. Consequently
this must be achieved indirectly via protecting
groups. The use of biological systems, whether
whole cell or isolated enzymes, can allow the
stereoselective and often enantioselective in-
troduction of phosphate groups in comparable Phosphomu tases
Phosphorylases
yields to those obtained by chemical methods Nucleotidases
and without the need for protecting groups. Phosphatases
Phosphokitiases
This chapter aims to provide an insight into Phosphotranferases
the use of biological systems for both the for-
mation and cleavage of phosphate esters for
synthetic purposes. A range of examples of f 9 f
RO- f-0- f- 0-{- '
0
phosphate forming reactions have been in-
cluded in tabular form to illustrate the wide o* o* $0
applicability of the techniques (see Tab. 3).
Other complex enzyme systems involving Phosphatases
phosphates in multi-sequence reactions, such Phosphokiiiases
Phosphot ransferases
as aldolase reactions (ALLENet al., 1992), are ATPases
not considered here.
Group 2 - Phosphate Diesters &
Pyrophosphates
1.2 Enzyme-Catalyzed Phosphate
0 0 0
Transfer II II II
When we talk of an enzyme catalyzing the

phosphorylation of an alcohol or similar nucle-
ophilic substrate, we should bear in mind that
specificallyit is an enzyme catalyzed phospho- Nudeotidyl Transferass Fyrophosphokinases
Nudeotidyl Cyclases
ryl transfer from a phosphate source or cofac-
tor (such as ATP (1)) to the nucleophile.
Therefore, there are two considerations to be
made when examining phosphoryl transfer,
the enzyme and the source of phosphate
group.
Triphosphohydrolases
Polyiiucleotide Synthetases
1.2.1 The Choice and Action of the Phospholipases
Nucleases
Enzyme Phosphodiesterases
Fig. 3. The two groups of phosphoryl transfer reac-

The enzymes that catalyze phosphate trans- tions and enzyme classes.
fer are categorized according to the bonds
made or cleaved. There are two general groups
of enzymes: those that accept phosphate MANN (1995) correlated this classification with
monoesters as substrates and those which ac- the classes of enzymes specified by the No-
cept phosphate diesters or pyrophosphates menclature Committee of the International
(Fig. 3) (KNOWLES, 1980). DRAUZand WALD- Union of Biochemistry (1984) (Tab. 1). The
Tab. 1. Table of Enzymes that Fall into Groups 1 and 2

Cleavage Functional IUB Class & Name Role
Site Class
@ Phosphomutase 2.7.5. Phosphomutase intramolecular transfer of a

5.4.2. Intramolecular phosphotransferase phosphoryl group
0 Phosphorylase 2.4.1. Hexosyl transferases
2.4.2. Pentosyl transferases
P-0 bond formation from
phosphorolytic C-hetero-
atom cleavage
@ Nucleotidases 3.1.3. Phosphoric acid hydrolases transfer of phosphoryl from
3.1.4. Phosphoric diester hydrolases a nucleoside to water
@ Phosphatases 3.1.3. Phosphoric ester hydrolases transfer of phosphoryl from
3.6.1. Hydrolases acting on acid anhydrides a monoester to water
@ in phosphorus containing anhydrides
@ Phosphokinase 2.7.1. Phosphotransferases with an transfer of phosphoryl from
alcohol group as acceptor a nucleoside triphosphate
@ 2.1.2. Phosphotransferases with a to an acceptor other than
carboxyl group as acceptor water
@ Phospho- 2.7.4. Phosphotransferases with a transfer of phosphoryl from
transferase phosphate group as acceptor a molecule other than a nu-
@ cleoside triphosphate to an
acceptor other than water
@ ATPase 3.6.1.3. ATPases phosphatases which couple
ATP cleavage with other
processes
@ Pyrophospho- 2.7.6. Diphosphotransferases transfer of pyrophosphate
kinase from ATP to an acceptor
other than water
~
@ Nucleotidyl 2.7.7. Nucleotidyl Transferases transfer of nucleotidyl

Transferase groups
@ Nucleotidyl 4.6.1. Phosphorus oxygen lyases cyclization of a nucleoside
Cyclase triphosphate by formation
of a pyrophosphate
@ Triphospho- 3.1.5.Triphosphoric monoester transfer of triphosphate
hydrolase hydrolases from a nucleoside triphos-
phate to water
@ Polynucleotide 6.5.1. Ligases forming phosphoric links two polynucleotides
synthase ester bonds to produce a polynucleotide
chain
@ Phospholipase 3.1.4. Phosphoric diester hydrolases hydrolytic cleavage of
phosphoglycerides
@ Nuclease 3.1.4. Phosphoric diester hydrolases transfer of a phosphopoly-
3.1. Endo- and exonucleases nucleotide to water
@ Phospho- 2.7.8. Transferases for other substituted transfer of a phosphomono-
diesterase phosphate groups ester from a phosphodiester,
3.1.4. Phosphoric diester hydrolases other than a polynucleotide,
to water
range of commercially available enzymes is phosphate (UTP), guanosine triphosphate

somewhat less than this. On occasions it may (GTP), and cytidine triphosphate (CTP). ADP
be worthwhile to extract and purify a given en- (3) has been shown to inhibit glycerol kinase
zyme, however, this is not practical in general. noncompetitively at low concentrations, and
Consequently the following sections empha- competitively at higher concentrations. Ace-
size enzymes which are commercially available tate kinase and glycerol kinase are members of
or easily extractable. For each example a refer- a structural super family which includes sugar
ence to Methods in Enzymology is given which kinases, hexokinase, heat shock protein 70, and
provides recipes for purification and assay. actin.These are characterized by a two domain
structure (actin fold) with the topography
PPPaPaPa. The nucleotide binding site lies
1.2.1.1 Acetate Kinase between the two domains which are joined by
a putative hinge. Nucleotide hydrolysis elimi-
Acetate kinase (EC 2.7.2.1) has been used nates some of the interdomain bridging inter-
extensively for phosphorylation of adenosine actions which enables formation of an open
diphosphate (ADP) (3) (Fig. 4) and will also conformation. The large conformational
accept GDP, UDP, and CDP (HAYNIEand changes involved in these processes may be in-
WHITESIDES, 1990; CRANSet al., 1987). The volved in regulation (HURLEY,1996; KABSCH
mechanism of phosphoryl transfer has been and HOLMES, 1995).
extensively studied (SPECTOR,1980) and pro-
ceeds with net inversion at phosphorous. The
enzyme accepts acetyl phosphate (8) (Tab. 2), 1.2.1.3 Pyruvate Kinase
propionyl phosphate, and carbamoyl phos-
phate, although the latter two cause reduced The most common source of pyruvate kin-
enzyme activity (30% and 18%, respectively) ase is from rabbit muscle from which it can be
but phosphoenolpyruvate (4) is not accepted. isolated in crystalline form. It accepts guano-
Spontaneous hydrolysis of acetyl phosphate sine diphosphate (GDP) with approximately
(8) restricts the use of acetate kinase for ex- the same tolerance as ATP (1) (KAYNE, 1973).
tended periods. The X-ray crystal structure of However other nucleoside diphosphates
acetate kinase shows an “actin fold” which is (NDPs), such as cytidine diphosphate (CDP),
discussed in the section on glycerol kinase are not so readily accepted, with reaction rates
(Sect. 1.2.1.2) (Buss et al., 1997). Immobilized approximately 30% less than that of ADP (3).
acetate kinase from E. coli has high activity, The enzyme shows a very high degree of speci-
but is less stable than the much more expen- ficity towards the phosphate donor with only
sive enzyme from the thermophile, Bacillus phosphoenolpyruvate (4) being accepted. The
stearothermophilus (TANG and JOHANSSON,reaction rate is highly dependent on the con-
1997). centration of monovalent cations, in particular
potassium and ammonium. One drawback is
that it is inhibited by ATP (l),thus neces-
1.2.1.2 Glycerol Kinase sitating keeping ATP (1) levels low during re-
action.
Glycerol kinase (EC 2.7.1.30) is usually iso-
lated from rat liver (THOMERand PAULUS,
1973) and commercial enzymes with high ac- 1.2.1.4 Creatine Kinase
tivity extracted from E. coli (KEE et al., 1988)
and a Cellulomonus sp. Rat liver glycerol kin- and Arginine Kinase
ase is most stable at pH 5 and readily mono-
phosphorylates glycerol (15)(Fig. 6), L-glycer- These enzymes are both ATP :guanidino
aldehyde (21) (Fig. 9), or dihydroxyacetone phosphotransferases which have high amino
(LIN,1977; CRANSand WHITESIDES, 1985a, b). acid homology (GROSSet al., 1995; MUHLE-
ATP (1)is the best cofactor, although different BACH,1994) although they are found in two
forms of the enzyme can accept uridine tri- different biological classes (WATTS, 1973;
MORRISON, 1973). Creatine kinase (EC 2.7.3.2) 1.2.1.7 Hexokinase

is isolated from vertebrate muscle (usually
from rabbit muscle) and is stable below 50°C Hexokinases (EC 2.7.1.1) have been used
between pH 6.5 and 9.5. It has narrow sub- extensively for the conversion of glucose to
strate specificity accepting only a small range glucose-6-phosphate (13) (CHENAULT et al.,
of guanidine based amino acids. Arginine kin- 1997). There are two main sources of hexo-
ase (EC 2.7.3.3) is found in most invertebrates kinase: from yeast and from mammals (COLO-
and has similar stability and substrate proper- WICK,1973).Both sources have certain aspects
ties to creatine kinase (DUMASand CAMONIS, in common, including strong inhibition by
1993;STRONG and ELLINGTON, 1995). N-acetyl glucosamine derivatives (WILLSON
et al., 1997; MAITYand JARORI,1997), broad
substrate specificity towards the sugar accep-
1.2.1.5 Adenylate Kinase tor, and conversely narrow specificity towards
the NTP used as the donor (ATP (1) is the
Adenylate kinase (myokinase, E C 2.7.4.3) best).
catalyzes the disproportionation of ATP (1)
and adenosine monophosphate (2) (AMP) to
ADP (3) (Fig. 4). The enzyme is widespread 1.2.1.8 Alkaline Phosphatase
throughout organisms, with higher concentra-
tions located in regions of high energy turn- The two mains sources of alkaline phosphat-
over, such as muscle (NODA,1973; KREJCOVA ase (EC 3.1.3.1) are bovine intestines (FERN-
and HORSKA,1997). Most other nucleotides LEY, 1971) and E. coli (REID and WILSON,
and inorganic triphosphate can be utilized, but 1971). As its name suggests, the enzyme is
at reduced reaction rates. A divalent cation stable at basic pH (typically pH 9.8). Bovine
(usually magnesium or manganese) is needed alkaline phosphatase has very high activity, is
for the reaction to proceed (WILDet al., 1997). cheap, but has low stereospecificity (NATCHEV,
1987).Consequently it is used as a general pur-
pose workhorse for the cleavage of monophos-
1.2.1.6 Nucleoside Kinase phates to alcohols. It will also catalyze trans-
phosphorylation and some enzymes also
Nucleoside kinases catalyze the phosphoryl cleave pyrophosphates. The X-ray crystal
transfer from a nucleoside triphosphate (NTP) structure has been determined (MURPHY et al.,
to a nucleoside, giving a nucleoside mono- 1997;cf. KEIKINHEIMO et al., 1996).
phosphate (NMP). There are many different
classes of these enzymes depending upon the
nucleoside being phosphorylated (ANDERSON, 1.2.1.9 Phosphodiesterase
1973).These enzymes are often specific for the
nucleoside.Thus, AMP (2) will only be formed Phosphodiesterase enzymes are often called
from adenosine utilizing adenosine kinase venom exonucleases since they are present in
(EC 2.7.1.20).There is however, more flexibil- all snake venoms. One of the more common
ity with the NTP donor in most cases; adeno- enzymes used is snake venom phosphodies-
sine kinase accepts most other NTPs. terase (phosphodiesterase I, EC 3.1.4.1)
(LASKOWSKI, 1971), which is a 5 '-exonuclease,
i.e., it specifically cleaves oligonucleotides to
give 5 '-mononucleosides. This enzyme togeth-
Adenylate er with bovine intestinal phosphodiesterase
kinase has high activity with non-nucleotide sub-
ATP + AMP 2 ADP strates. Although snake venom phosphodies-
1 2 3 terases are known which act as 3'-exonucle-
ase, spleen phosphodiesterase is used more
Fig. 4. Formation of ADP (3) from ATP (1) and commonly (phosphodiesterase 11, EC 3.1.16.1)
AMP(2). (BERNARDI and BERNARDI, 1971).
1 Phosphoryl Transfer in General 227
Tab. 2. A Comparison of the Relative Phosphorylation Potentials of Phosphoryl Transfer Reagents
Cofactor Phosphorylation Potential

[kJ mol-’1
([kcal mol-’I)”
Phosphoenolpyruvate 4 COF -61.9 ( -14.8)b
Methoxycarbonyl Phosphate 5 Me0

K OP -51.9 ( - 12.4)’
Carbamyl Phosphate 6 HzN 1 OP -51.4 (-12.3)d

OH
1,3-Diphosphoglycerate 7 WJ C02P -49.4 (-11.8)=
Acetyl Phosphate 8 -43.1 (-10.3)b
Phosphocreatine 9 -43.1 (-10.3)”

P Me
ATP 1 -,ADP + Pi -30.5 ( - 7.3)’

ATP 1 -+ AMP + PP, -41.8 ( - 10.0)’
Arginine Phosphate 10 -32.2 ( - 7.7)’
PPi
Pyrophosphate 11 - 19.2 ( - 4.6)‘
Glucose-1-phosphate 12 -20.9 ( - 5.00)“

OP
Glucose-6-phosphate 13 - 13.8 ( - 3.3)‘
Glycerol-1-phosphate 14 - 9.2 ( - 2.2)’
aValues are for pH 7.0. ATP hydrolysis is highly dependent on magnesium ion concentration; BOLTEand
WHITESIDES (1984); KAZLAUSKASand WHITESIDES (1985); SHIHand WHITESIDES (1977); LEHNINGER
(1975).
1.2.2 The Source of generation can be achieved by chemical means

or by enzymatic methods. In general, the en-
Phosphate Group zymatic route is preferred. Most commonly a
phosphorylating agent with a high phosphory-
Phosphoryl transfer necessarily means that lation potential is used to enable efficient
a source of phosphate is needed. This is rarely cofactor regeneration. The differing combina-
inorganic phosphate and almost invariably a tions of enzyme and phosphate source are de-
complex cofactor. A comparison of the free scribed later.
energies of hydrolysis of a number of phos-
phorylating cofactors gives an indication of the
phosphorylation potential of that species (Tab.
2). The majority of these phosphorylating
agents have some biological role, although the
2 Formation of
most widely used in nature are the NTPs. ATP P-0 Bonds
(1) acts predominantly in central pathways of
energy metabolism, GTP is used to drive pro- Reactions which involve the synthesis of a
tein synthesis, CTP phospholipid biosynthesis, P-0 bond all require a source of phosphate.
and UTP glycosidation. Those agents with a This section is divided according to the co-
large phosphorylation potential are the factors used, concluding with a summary of
primary sources of energy in biological pro- various P-O bond forming reactions (Tab. 3).
cesses. Phosphoenolpyruvate (4) and 1,3-di-
phosphoglycerate (7) are both formed during
glycolysis and are used as a primary source of 2.1 Inorganic Phosphate (Pi)
phosphate. Phosphocreatine (9) and phospho- as the Phosphate Source
arginine (10) are found in muscle tissue in ver-
tebrates and invertebrates, respectively. These Glucose-1-phosphate (12) has been pre-
compounds act as an energy “store”, which is pared by the action of phosphorylase-a (EC
converted back to ATF’ (1) for use when 2.4.1.1) (Fig. 5) on soluble starch or dextrin in
primary energy sources (such as phosphoenol- the presence of inorganic phosphate and the
pyruvate (4)) are not available. ATP (1) itself glucose-1-phosphate (12)formed transformed
then serves as a means to transfer the to glucose-6-phosphate (13) using phospho-
phosphoryl groups to and from storage, and glucomutase (EC 2.7.5.1) (WONGand WHITE-
thus is recognized as a cofactor by many differ- SIDES,1981).
ent enzymes. Although better phosphoryl An excellent study of the use of calf intes-
transfer agents are available (cf. phosphoenol- tinal alkaline phosphatase with sodium pyro-
pyruvate (4)), ATP (1)is essential for these phosphate as the phosphate source has been
processes. made. A variety of diols were used but most of
the work was concentrated on the formation
of glycerol-1-phosphate (14) from glycerol
1.2.3 Cofactor Regeneration (15) (Fig. 6). The regioselectivity of this reac-
tion was found to be greater than 90% in favor
The most commonly used NTP as a cofactor of the primary hydroxyl group. However, the
for phosphoryl transfer is ATP (1). The active reaction was not enantioselective (PRADINES
form of ATP (1)has been found to be the et al., 1988).
MgATP2- species, which necessitates addition
of a source of magnesium ions to the reaction
mixture. However, the high cost of ATP (1) 2.2 Nucleoside Triphosphates
precludes the use of stoichiometric quantities (NTPs) as the Phosphate Source
in vitro. Since most enzymespeed ATP (1) as a
cofactor, regeneration of AMP (2), or more The use of NTPs is one of the most effective
commonly ADP (3) formed after the first and widespread enzymatic methods of phos-
phosphoryl transfer is necessary. ATP (1) re- phoryl transfer. As noted earlier, regeneration
OH
I
H O A O H 15
Starch
Alkaline
phosphatase
r
OH
Phosphorylase-a PO&OH 14 > 90%
OP
H o A O H 16
Fig. 6. Selective phosphorylation of glycerol using

OP alkaline phosphatase.
I
Phosphoglucomu tase
OH
G “A~$
17
Phosphoglycerate
mutase
OP
Fig. 5. Synthesis of glucose-6-phosphate (13).
of NTPs is necessary to reduce the cost of the

reaction. Several systems exist for this process
(HEIDLAS et al., 1992).
J
OP
Eholase
Ace 4
2.2.1 Phosphoenolpyruvate/
Fig. 7. Enzymatic synthesis of phosphoenolpyruv-
Pyruvate Kinase ate (4).
Phosphoenolpyruvate (PEP) (4) is an at-

tractive phosphorylating agent for ATP (1) re- those analogs containing sulfur or nitrogen
generation since it has a high phosphorylation within the pyranose ring (DRUECKHAMMER
potential ( - 61.9 kJ mol-’). A drawback is the and WONG,1985). The reaction is also highly
high commercial cost and problematic synthe- stereospecific. One of the more important uses
sis of the potassium salt (HIRSCHBEIN et al., of enzymatic phosphate synthesis is the pre-
1982),although WHITESIDES has developed an paration of chiral phosphorothioates which
efficient enzymatic method (Fig. 7) of generat- are used extensively for the elucidation of bio-
ing PEP (4) in situ from the relatively inexpen- logical mechanisms. The synthesis and uses of
sive D-(-)-3-phosphoglyceric acid (17) for the phosphorothioates have been extensively re-
synthesis of NTPs from NMPs (SIMONet al., viewed (LESNIKOWSKI, 1993; ECKSTEIN, 1983,
l989,1990).The use of this phosphoryl transfer 1985). As an illustrative example, the 5 ‘ -
system is widespread and has broad applicabil- monothiophosphate (19) was transformed ex-
ity. For example, a whole range of ring fluor- clusively into one diastereoisomer of the
inated hexose sugars have been transformed “pseudo” triphosphate (20) (Fig. 8) (MORAN
to their corresponding 6-phosphates, as well as and WHITESIDES, 1984).
230 4 Phosphorylution
OH
o&
k;ix
OH
2 1 rac-Glyceraldehyde
Pyruvate
kinase
Pyruvate
Adenylate kinase PEP 4

Pyruvate kinase
PEP
-
OH
-0 OH
R
2 1 DGlyceraldehyde
OH
22 L-Glyceraldehyde-3-phosphate
Fig. 8. Stereospecific phosphorylation of a mono-
thiophosphate (19).
Glycerol kinase and ATP (1) have been used

to perform kinetic resolutions of rac-glyceral-
dehyde (21) (Fig. 9) (WONGand WHITESIDES,
1983). ATP (1)was regenerated using PEP (4)
and pyruvate kinase. Enantioselective phos-
phorylation of glycerol (15) has also been
achieved with glycerol kinase (CRANSand
WHITESIDES, 1985a, b) and the acetyl phos-
phate @)/acetate kinase system (RIOS-MER- H A OP
CADILLO and WHITESIDES, 1979). The structu- R
ral requirements of glycerol kinase were eva- 14 sn-Glyceraldehyde-3-phosphate
luated in a survey of 66 glycerol analogs. This
indicated that one terminal hydroxyl group Fig. 9. Specific phosphorylation of glyceraldehyde
and either a hydroxyl or methyl group at the ruc-(21) and glycerol (15).
secondary position was necessary for transfor-
mation (CRANSand WHITESIDES, 1985a).
The pyruvate kinasePEP (4) regeneration
system has also been exploited in multienzyme not participate in substantial hydrogen bond-
sequences as illustrated by the regeneration of ing. Consequently, the carbosugar analog of
UTP from uridine diphosphate (UDP) for the ATP (23) (Fig. 10) should be substantially
in sifu synthesis of UDP-glucose (WONGet al., more stable and should bind to enzymes
1982), for use in Leloir glycosidation. equally well. Fortuitously the carbosugar ana-
Hydrolysis of the anomeric linkage to ade- log of adenosine is a microbial natural prod-
nine is a major pathway for the degradation of uct, aristeromycin (23a). This was converted
adenosine derivatives in solution. Moreover, to the 6’-monophosphate (23b)using a chem-
when bound to most enzymes the oxygen of ical method and then to the diphosphate (23c)
the ribose ring of adenosine nucleotides does and triphosphate (23d) catalyzed by adenylate
NH2 Acetyl phosphate (8) can be prepared in

large quantities as its diammonium salt from
either phosphoric acid, ketene, and ammonia
(WHITESIDES et al., 1975),or acetic anhydride,
phosphoric acid, and ammonia (LEWISet al.,
H 6 6H
1979).The latter is easier to use, since it does
aR1=H 24 R = F not involve the preparation and handling of
ketene. In both cases, the ammonium ion
present reacts with magnesium ions during the
phosphorylation reaction to give a precipitate
of Mg(NH,)PO,, which causes essential mag-
nesium ions to be removed from the reaction
bR1=P
Pyruvate mixture. Reaction of acetyl phosphate (8) with
minute quantities of ammonia present can
Pyruvate kinase also cause problems. These can be circumvent-
ed by using the potassium or sodium salts
PEP 4 which can be prepared either by ion exchange
c R1 = PP chromatography of the diammonium salt, or
lPruvate by direct preparation (CRANSand WHITE-
SIDES, 1983).
d R1 = PPP 2.2.3 Methoxycarbonyl Phosphate/

Fig. 10. Carbosugar nucleoside triphosphates used Acetate Kinase or Carbamate
in phosphoryl transfer reactions. Kinase
Both acetyl phosphate (8) and PEP (4) have

kinase and pyruvate kinase, respectively (cf. inherent advantages and disadvantages. Me-
SIMONet al., 1990).An identical sequence was thoxycarbonyl phosphate (5) has been devel-
used to prepare the fluoroanalog (24d). Both oped (KAZLAUSKAS and WHITESIDES, 1985) as
carbosugar nucleotides (23d)and (24d) func- an easily synthesized alternative to acetyl
tioned in place of ATP (1) in the synthesis of phosphate (8), with comparable phosphorylat-
glucose-6-phosphate (13) from glucose cata- ing potential to PEP (4). Methoxycarbonyl
lyzed by hexokinase and sn-glycerol-3-phos- phosphate (5) also has the advantage in not
phate (14) from glycerol (15) using glycerol containing ammonium groups, thus negating
kinase (LEGRAND and ROBERTS, 1993). the problems associated with diammonium
acetyl phosphate. Following phosphoryl trans-
fer, the by-product of the reaction, methyl car-
2.2.2 Acetyl Phosphate/ bonate, decomposes to give methanol and car-
Acetate Kinase bon dioxide, thus making the workup easier. It
is readily prepared in an analogous way to ace-
Acetyl phosphate (8) is a good phosphoryl- tyl phosphate with acetic anhydride and phos-
ating agent. It has a reasonable phosphoryla- phoric acid, but decomposes much more rapid-
tion potential and has been used extensively ly in aqueous solution. One of two enzymes
with acetate kinase in many enzyme reactions can be used to catalyze phosphoryl transfer to
due to its relative inexpense. One drawback is ATP (1):acetate kinase or carbamate kinase.
that acetate kinase is prone to slight inhibition The former has been used with methoxycarbo-
by acetate ions, which are formed during the nyl phosphate (9,creatine kinase, and ATP
reaction. Also, acetyl phosphate (8) is not as (1) to generate creatine phosphate (9) from
stable in solution as most other cofactors. creatine.
2.2.4 Other Systems that catalyze phosphodiester formation by

coupling of two components. Usually one of
Extensive work has been carried out on the these is a NTP and thus use of a phosphate
chemoselective formation of ATP (1) from source or cofactor is not necessary.
ADP (3) using the macrocycle (25a) (Fig. 11)
(HOSSEINIand LEHN,1985, 1987, 1988, 1991;
HOSSEINI et al., 1983).In the presence of acetyl 2.3.1 Coupling with ATP
phosphate (8), magnesium ions, and a hexo-
kinase, the complex (2%) is formed which is vrosine residues in peptides have been spe-
able to facilitate a turnover of ATP (1) suffi- cifically phosphorylated at the phenolic posi-
cient to catalyze the formation of glucosed- tion in a two step process. Initially a tyrosine
phosphate (13) from glucose by hexokinase 5 ’-adenosine phosphodiester was formed us-
(FENNIRI and LEHN,1993). ing glutamine synthetase adenylyltransferase
The versatility of the use of enzymes can be (EC 2.7.7.42), which was selectively dephos-
illustrated in the use of the glycolytic pathway phorylated using micrococcal nuclease to give
to act as a means of ATP (1) regeneration the desired phospho-tyrosine (GIBSONet al.,
(WEI and Goux, 1992). With inorganic phos- 1990). In a similar manner (MARTINand
phate and glucose as the “fuel” for the reac- DRUECKHAMMER, 1992), pantetheine 4 ’-phos-
tion, creatine was converted by creatine kinase phate (26) was coupled with ATP (1) using de-
to creatine phosphate (9) in the presence of phospho-CoA-pyrophosphorylase(EC 2.7.7.3)
ATP (1) and the required enzymes for glucose and inorganic pyrophosphate (Fig. 12) to give
metabolism. 3 ‘-dephospho-coenzyme A (27a). The 3 ‘-hy-
droxyl was specifically phosphorylated by ATP
using dephospho-CoA-kinase (EC 2.7.1.24).
2.3 Coupling to Form
Phosphodiesters
2.3.2 Coupling with CTP
Phosphodiesters play an important role in
biological functions. DNA polymers contain N-Acetyl-neuraminic acid (28) (Fig. 13), is
phosphodiester links as do coenzyme A and a sialic acid which is a component of glyco-
NAD(P)(H).There is a wide range of enzymes proteins and lipids. It was coupled with CTP
A DP
25a
25b (negative charges on oxygen not shown)
Fig. 11. Macrocyclic amino-crown ether used to catalyze formation of ATP (1)from ADP (3).
0 26 Pantetheine phosphate
Dephospho-CoA-
pyrophosphory lase
OH
RO 011
0 0
"x
27
aR=H
&phospho-Co A-kinase
b R = P Coenzyme A
ADP
Fig. 12. Formation of Coenzyme A (2%).
using cytidine-5 '-monophospho-N-acetylneu- This system has also been used with acetate
ramic acid synthase as a prelude to enzymatic kinase and acetyl phosphate (8) in place of
glycosidation. CTP was generated by phos- pyruvate kinase and PEP (4) (HAYNIEand
phorylation of CDP with PEP (4), catalyzed WHITESIDES, 1990).
by pyruvate kinase. CDP was prepared in situ
by disproportionation of stoichiometric CMP
with CTP catalyzed by adenylate kinase
(SIMONet al., 1988a).
2.3.3 Coupling with UTP

UDP-glucose has been prepared by
coupling of UTP with glucose-6-phosphate
(13) in the presence of UDP-glucose pyro-
Hvop
phosphorylase, inorganic phosphate, and phos-
phoglucomutase. The unusual feature of this
reaction is the source of UTP. Yeast RNA was
cleaved into oligonucleotides by nuclease PI
which were further degraded to the nucleoside
pyrophosphates using polynucleotide phos-
AcN OH COY
to"
phorylase. Pyruvate kinase mediated phos-
phorylation by PEP (4) gave a mixture of
NTPs corresponding to ATP (24%), CTP 29
OH
(18%),UTP (28%), and GTP (30%).The mix-
ture was used crude in the coupling with glu- Fig. 13. Coupling of cytidine-5'-triphosphate and
cose-6-phosphate (13) (WONGet al., 1983a). N-acetylneuramic acid (28).
Tab. 3. Survey of P-0 Bond Forming Reactions

~
Substrate Product Enzyme Cofactor Phosphate Cofactor Reference

Source Regeneration
D-Arabinose ~-arabinose-s- hexokinase ATP PEP pyruvate kinase BEDNARSKI

et al.
phosphate (1988)
D-Glucose ~-glucosed- hexokinase ATP PEP pyruvate kinase HIRSCHBEIN et al.

phosphate (1982)
hexokinase ATP AcP acetate kinase CRANSand WHITE-
SIDES (1983)
D-Fructose ~-fructose-6- hexokinase ATP AcP acetate kinase WONGand WHITE-

phosphate SIDES (1983)
D-Fructose ~-fructose-1,6- hexokinase ATP - - WONGet al.

diphosphate and phos- (1983b)
phofructo-
kinase
D-Ribose ~-ribose-5- ribokinase ATP PEP pyruvate kinase GROSSet al. (1983)
phosphate
5-phospho-~- PRPP syn- ATP PEP pyruvate kinase GROSSet al. (1983)
ribosyl-a-1- thase and Pi and adenylate
pyrophosphate ribokinase kinase
(PRPP)
D-Ribose-5- 5-phospho-~- PRPP syn- ATP PEP pyruvate kinase GROSSet al. (1983)
phosphate ribosyl-a-1- thase Pi and adenylate
pyrophosphate kinase
(PRPP)
D-Ribulose- ~-ribulose-1,5- phospho- ATP AcP acetate kinase WONGet al. (1980)
5-phosphate bisphosphate ribulose
kinase
phospho- ATP PEP pyruvate kinase GROSSet al. (1983)
ribulose
kinase
2'-Deoxy 2'-deoxy adenylate ATP PEP pyruvate kinase LADNERand
AMP ATP kinase WHITESIDES(1985)
Adenine ATP adenylate ATP AcP acetate kinase BAUGHN et al.
kinase and (1978)
adenosine
kinase
UMP UTP" adenylate ATP PEP pyruvate kinase SIMONet al.
kinase (1988b)
Deoxy- deoxycytidine deoxycyti- ATP - - KESSEL
(1968)
cytidine triphosphate dine kinase
CMP CTP" adenylate CTP PEP pyruvate kinase SIMON et al.
kinase (1988b)
adenylate ATP PEP pyruvate kinase SIMON et al.
kinase (1989)
nucleoside ATP PEP pyruvate kinase AUGEand
monophos- GAUTHERON
phokinase (1988)
3 Cleavage of P-0 Bonds 235
Tab. 3. Continued
Substrate Product Enzyme Cofactor Phosphate Cofactor Reference
Source Regeneration
GMP GTP guanylate ATP PEP pyruvate kinase SIMONet al.
kinase (1988b)
Dihydroxy- dihydroxy- glycerol ATP PEP pyruvate kinase WONGand
acetone acetone kinase WHITESIDES
(1983)
phosphate
glycerol ATP AcP acetate kinase WONGand
kinase WHITESIDES
(1983)
Creatine creatine-6- creatine ATP AcP acetate kinase SHIHand
phosphate kinase WHITESIDES
(1977)
Arginine arginine arginine ATP PEP pyruvate kinase BOLTEand
phosphate kinase WHITESIDES
(1984)
allo- 0-phospho- hydroxy- GTP - - HILESand
Hydroxy-L- allo-hydroxylysine kinase HENDERSON(1972)
lysine L-lysine
Hydroxy-L- 0-phospho- hydroxy- GTF’ - - HILESand
lysine hydroxy-L- lysine kinase HENDERSON(1972)
lysine
L-Serine L-serine- L-serine Pi - - CAGENand
phosphate transferase FRIEDMANN(1972)
L-Threonine L-threonine- L-serine Pi - - CAGENand
phosphate transferase FRIEDMANN(1972)
a Needed to initially generate the corresponding NDP.
2.3.4 Coupling with Other nique which has become a routine tool in the
analysis of nucleic acid oligomers, while re-
Phosphate Sources maining relatively unused in synthetic work.
This is largely due to the usual ease of cleavage
Phospholipase D has been used to couple of P-0 bonds by chemical methods, and is re-
various species with dimyristoyl-L-a-phos- flected in the literature pertaining to enzyme
phatidyl choline in order to synthesize possible catalyzed dephosphorylation (DAVIESet al.,
phospholipid inhibitors (WANG et al., 1993). 1989;FABER,1995).
These include (R)-and (S)-proline and serinol.
The reaction was found to be selective for pri-
mary alcohols but nitrogen and sulfur nucle- 3.1 Hydrolysis of Nucleic Acid
ophiles were not accepted. Derivatives
The extensive use of phosphodiesterase and
alkaline phosphatase enzymes for routine
3 Cleavage of P-0 Bonds analysis of nucleotides excludes a complete re-
view of this area. Brief descriptions of the
In marked contrast to the formation of P-0 mode of action of phosphodiesterase and alka-
bonds through the specific phosphorylation of line phosphatase have already been made.
functional groups, dephosphorylation is a tech- These enzymes are usually used together to
completely digest the oligomer of ribonucleic TpTpTpTpTpTpT 31
1
acid to either a 5 ’-or 3 ’-nucleoside depending
upon the phosphodiesterase chosen. The role
of alkaline phosphatase is usually to cleave Snake venom
any phosphate monoesters present, while the phosphodiesterase
phosphodiesterase (or for that matter, any nu-
clease) cleaves the phosphodiester link. For
example, the 2 ’-phospho-trimer (30) (Fig. 14) T + pT + pTpT
was first dephosphorylated at the 2 ‘-position
T = Thymidine
by calf intestinal alkaline phosphatase and
p = phosphate
further digested with nuclease PI to give aden-
p = methyl phosphonate
osine, 5 ’-monophospho-adenosine and 5 ’-
monophospho-uridine (SEKINEet al., 1993). Fig. 15. An example of the use of phosphonates to
Analysis of the digestion products is usually inhibit cleavage of phosphate diesters.
carried out by HPLC of the crude reaction
mixture. This method can prove to be a versa-
tile tool, especially when modified phospho-
diesters are employed as “markers” for specif- as (19)) have been used in determining the
ic groups. The thymidine oligomer (31) (Fig. mechanism of action of purple acid phosphat-
15), modified with one methyl phosphonate ase. It was found that the enzymecatalyzes di-
linkage, upon digestion with a 5 ’-snake venom rect transfer of the phospho group to water
phosphodiesterase gave thymidine, 5 ’-mono- (MUELLERet al., 1993). Isotopically labeled
phospho-thymidine, and the methylphospho- uridine (3 ‘-5’) adenosine phosphodiesters
nate dimer (AGRAWAL and GOODCHILD, 1987). have also been used in this way with various
Extensive mechanistic studies have been enzymes (SEELAet al., 1983).Spleen phospho-
carried out on both phosphodiesterase and al- diesterase gave the 3 ’-uridine-monophos-
kaline phosphatase enzymes using substrates phate and adenosine, while nuclease PI gave
synthesized by specific enzyme phosphoryla- uridine and 5 ’-adenosine-monophosphate.
tions. Chiral thio-adenosine derivatives (such Enzymes that catalyze more specific de-
phosphorylations are also known, although
not used as widely as those already mentioned.
For example, ATPase catalyzes the hydrolysis
A (2’-p) - PA (2l-p) IJ 30 of ATP (1) to ADP (3) (WATTet al., 1984).
1 Calf intestinal
phosphatase
3.2 Hydrolysis of Substrates Other
I
than Nucleic Acid Derivatives
A PA PU
The hydrolysis of phosphate esters is chem-
ically a trivial step. The use of enzymes for this
Nuclease P, process has therefore received little considera-
tion other than for elucidation of enzyme
mechanisms, such as in the hydrolysis of p-ni-
A + pA + pU trophenol phosphates (NEUMANN, 1968; WIL-
SON et al., 1964), or for more subtle processes
A = Adenosine where standard techniques are too harsh, as
U = Uridine with the hydrolysis of polyprenyl pyrophos-
p = phosphate phates (FUJIIet al., 1982). The epoxy-farnesyl
pyrophosphate (32)(Fig. 16), for example, was
Fig. 14. Typical hydrolysis of phosphate esters dephosphorylated with alkaline phosphatase
using nuclease and phosphatase enzymes. (KOYAMAet al., 1987,1990).
4 References 237
RO-,PLIZ; 36
HN
32
Fig. 16. Epoxy-farnesyl pyrophosphate (32). Alkaline
Phosphatase or
Phosphcdiesterase
Carbohydrates have also been used as sub-
strates, although the reaction is not of great
synthetic use since the phosphorylated species
are usually the more valuable (WONG and HO- P,
2
WHITESIDES, 1983).
NATCHEV has used the difference in reactiv- 1
ity of phosphodiesterase and alkaline phos-
phatase enzymes in the cleavage of various Fig. 18. Hydrolysis of phosphoramidate esters.
0
II 4 References
H 0-,P\% 34
RO AGRAWAL, S., GOODCHILD, J. (1987), Oligodeoxy-
1
nucleoside methylphosphonates: Synthesis and
Alkaline enzymic degradation, Tetrahedron Lett. 28,
Phosphatase 3539-3542.
ALLEN,S. T., HEINTZELMAN, G. R., TOONE,E. J.
(1992), Pyruvate aldolases as reagents for stereo-
fi' specific aldol condensation, J. Org. Chem. 57,
I
426427.
ANDERSON, E. I? (1973), Nucleoside and nucleotide
kinases, in: The Enzymes, 3rd Edn., IX (BOYER, F!
D., Ed.), pp. 49-96. New York: Academic Press.
Phosphodiesterase AuGE, C., GAUTHERON, C. (1988), An efficient syn-
thesis of cytidine monophospho-sialic acids with
four immobilized enzymes, Tetrahedron Left. 29,
789-790.
Lx 35
BAUGHN, R. L., ADALSTEINSSON, O., WHITESIDES, G.
HO = P M. (1978), Large-scale enzyme-catalyzed synthe-
HO sis of ATP from adenosine and acetyl phosphate.
Regeneration of ATP from AMP, J. Am. Chem.
Fig. 17. Selectivities in the hydrolysis of phospho- SOC.100,304-306.
nate esters. BEDNARSKI, M. D., CRANS,D. C., DICOSINIO, R.,
SIMON,E. S., STEIN,P. D., WHITESIDES, G. M.,
SCHNEIDER, M. J. (1988), Synthesis of 3-deoxy-~-
manno-2-octulosonate-8-phosphate(KDO-8-P)
from D-arabinose: Generation of ~-arabinose-5-
BOLTE,J., WHITESIDES, G. M. (1984), Enzymatic syn- FABER,K. (1995), Biotransformations in Organic

thesis of arginine phosphate with coupled ATP Chemistry, pp. 105-107. Heidelberg, New York:
cofactor regeneration, Bioorg. Chem. 12,170-175. Springer-Verlag.
BIJSS,K. A., INGRAM-SMITH, C., FERRY,J. G., SAN- FENNIRI,H., LEHN,J.-M. (1993), Coupling of su-
DERS, D. A., HASSON, M. S. (1997), Crystallization pramolecular synthesis of ATP with ATP-con-
of acetate kinase from Methanosarcina thermo- suming enzyme systems, J. Chem. SOC., Chem.
phila and prediction of its fold, Protein Sci. 6, Commun., 1819-1821.
2659-2662. FERNLEY, H. N. (1971), Mammalian alkaline phos-
CAGEN, L. M., FRIEDMANN, H. C. (1972), Enzymatic phatases, in: The Enzymes, 3rd Edn., IV (BOYER,
phosphorylation of serine, J. Biol. Chem. 247, P. D., Ed.), pp. 417447. New York: Academic
3382-3392. Press.
CHENAULT, H. K., MANDES, R. F., HORNBERGER, K. FUJII,H., KOYAMA, T., OGURA,K. (1982), Efficient
R. (1997), Synthetic utility of yeast hexokinase. enzymatic hydrolysis of polyprenyl pyrophos-
Substrate specificity, cofactor regeneration, and phates, Biochim. Biophys. Acta 712,716-718.
product isolation, J. Org. Chem. 62,331-336. GIBSON,B. W., HINES,W., Yu, Z., KENYON,G. L.,
COLOWICK, S. I? (1973),The hexokinases,in: The En- MCNEMAR, L., VILLAFRANCA, J. J. (1990), Enzy-
zymes, 3rd Edn., IX (BOYER,€? D., Ed.), pp. 1 4 8 . matic synthesis of phosphotyrosine-containing
New York: Academic Press. peptides via adenylated intermediates, J. Am.
CRANS, D. C., WHITESIDES, G. M. (1983), A conven- Chem. SOC.112,8523-8528.
ient synthesis of disodium acetyl phosphate for GROSS, A., ABRIL,O., LEWIS,J. M., GERESH,S.,
use in in situ ATP cofactor regeneration, J. Org. WHITESIDES, G. M. (1983), Practical synthesis of
Chem. 48,3130-3132. 5-phospho-~-ribosyl-a-l-pyrophosphate (PRPP):
CRANS,D. C., WHITESIDES, G. M. (1985a), Glycerol Enzymatic routes from ribose 5-phosphate or ri-
kinase: substrate specificity, J. Am. Chem. SOC. bose, J.Am. Chem. SOC. 105,7428-7435.
GROSS,M., LUSTIG, A,, WALLIMANN, T., FURTER, R.
107,7008-7018.
(1995), Multiple-state equilibrium unfolding of
CRANS,D. C., WHITESIDES, G. M. (1985b), Glycerol guanidino kinases, Biochemistry 34,lO 350-1 0 357.
kinase: synthesis of dihydroxyacetone phosphate,
HAYNIE, S. L., WHITESIDES, G. M. (1990), Preparation
sn-glycerol-3-phosphate, and chiral analogs, J. of a mixture of nucleoside triphosphates suitable
Am. Chem. SOC.107,7019-7027. for use in synthesis of nucleotide phosphate sugars
CRANS, D. C., KAZLAUSKAS, R. J., HIRSCHBEIN, B. L., from ribonucleic-acidusing nuclease-pl, a mixture
WONG,C.-H., ABRIL, O., WHITESIDES, G. M. of nucleoside monophosphokmases and acetate
(1987), Enzymatic regeneration of adenosine kinase,Appl. Biochem. Biotechnol. 23,205-220.
5 '-triphosphate - acetyl phosphate, phosphoenol HEIDLAS, J. E., WILLIAMS, K. W., WHITESIDES, G. M.
pyruvate, methoxycarbonyl phosphate, dihydrox- (1992), Nucleoside phosphate sugars - synthesis
yacetone phosphate, 5-phospho-a-~-ribosyl pyro- on practical scales for use as reagents in the enzy-
phosphate, uridine-5'-diphosphateglucose, Me- matic preparation of oligosaccharides and glyco-
thods Enzymol. 136,263-280. conjugates,Acc. Chem. Res. 25,307-314.
DAVIES,H. G., GREEN,H. G., KELLY, D. R., ROBERTS, HILES,R. A., HENDERSON, M. L. (1972), The partial
S. M. (1989), Biotransforrnations in Preparative purification and properties of hydroxylysine
Organic Chemistry: The Use of Isolated Enzymes kinase from rat liver, J. Biol. Chem. 247,64&651.
and Whole Cell Systems in Synthesis, pp. 75-86. HIRSCHBEIN, B. L., MAZENOD, F. ,.'F WHITESIDES, G.
San Diego, CA: Academic Press. M. (1982), Synthesis of phosphoenolpyruvate and
DRAUZ,K., WALDMANN, H. (1995), Enzyme Cataly- its use in adenosine triphosphate cofactor regen-
sis in Organic Synthesis, A Comprehensive Hand- eration, J. Org. Chem. 47,3765-3766.
book, pp, 505-545. Weinheim:VCH. HOSSEINNI, M. W., LEHN,J.-M. (1985), Cocatalysis:
DRUECKHAMMER, D. G.,WONG,C. H. (1985),Chemo- Pyrophosphate synthesis from acetylphosphate
enzymatic syntheses of fluoro sugar phosphates catalyzed by a macrocyclic polyamine, J. Chem.
and analogs,J. Org. Chem. 50,5912-5913. SOC.,Chem. Commun., 1155-1157.
DUMAS, C., CAMONIS, J. (1993), Cloning and sequen- HOSSEINNI, M. W., LEHN,J.-M. (1987), Binding of
ce analysis of the cDNA for arginine kinase of AMP, ADP, and ATP nucleotides by polyam-
lobster muscle, J. Biol. Chem. 268,21599-21 605. monium macrocycles, Helv. Chim. Acta 70,
ECKSTEIN, F. (1983), Phosphorothioate analogs of 1312-13 19.
nucleotides - Tools for the investigation of bio- HOSSEINNI, M. W., LEHN,J.-M. (1988), Supramolec-
chemical processes, Angew. Chem. (Int. Edn. ular catalysis: Substrate phosphorylations and
Engl.) 22,423439. adenosine triphosphate synthesis with acetyl
ECKSTEIN, F. (1985), Nucleoside phosphorothioates, phosphate catalyzed by a macrocyclic polyamine,
Annu. Rev. Biochem. 54,367402. J. Chem. SOC.,Chem. Commun.,397-399.
4 References 239
HOSSEINNI, M. W., LEHN,J.-M. (1991), Supramole- LASKOWSKI, M., Sr. (1971), Venom exonuclease, in:
cular catalysis of adenosine triphosphate synthe- The Enzymes, 3rd Edn., IV (BOYER,P. D., Ed.),
sis in aqueous solution mediated by a macrocyclic pp. 313-328. New York Academic Press.
polyamine and divalent metal cations, J. Chem. LEGRAND, D. M., ROBERTS, S. M. (1993), Carbocyclic
Soc., Chem. Commun.,451453. adenosine phosphates as nucleotide mimics in
HOSSEINNI, M. W., LEHN,J.-M., MERTES, M. €! (1983), some enzyme-catalyzed reactions, J. Chem. SOC.,
Efficient molecular catalysis of ATP-hydrolysis Chem. Commun., 12841285.
by protonated macrocyclic polyamines, Helv. LEHNINGER, A. L. (1975), Biochemistry, 2nd Edn.,
Chim.Acta 66,24542466. p. 398. New York: Worth Publishers.
HURLEY,J. H. (1996), The sugar kinase heat-shock- LESNIKOWSKI, Z. J. (1993), Stereocontrolled synthesis
protein-70, actin super family - implications of of P-chiral analogs of oligonucleotides, Bioorg.
conserved structure for mechanism, Ann. Rev. Chem. 21,127-155.
Biophys. Biomol. Struct. 25,137. LEWIS,J. M., HAYNIE, S. L., WHITESIDES, G. M. (1979),
KABSCH, W., HOLMES,K. C. (1995), Protein motifs. An improved synthesis of diammonium acetyl
2. The actin fold, FASEB J. 9,167-174. phosphate, J. Org. Chem. 44,864865.
KAYNE,F. J. (1973), Pyruvate kinase, in: The En- LIN,E. C. C. (1977), Glycerol utilization and its regu-
zymes, 3rd Edn., VIII (BOYER, P. D., Ed.), lation in mammals, Annu. Rev. Biochem. 46,
pp. 353-382. New York: Academic Press. 765-795.
KAZLAUSKAS, R. J., WHITESIDES, G. M. (1985), Syn- MAITY,H., JARORI,G. K. (1997), Yeast hexokinase
thesis of methoxycarbonyl phosphate, a new re- PII-bound nucleotide conformation at the active
agent having high phosphoryl donor potential for site, Eur. J. Biochem. 250,539-548.
use in ATP cofactor regeneration, J. Org. Chem. MARTIN,D. P., DRUECKHAMMER, D. G. (1992), Com-
50,1069-1076. bined chemical and enzymatic synthesis of co-
KEE, Y., LEE, Y. S., CHUNG,C. H., WAXMAN,L., enzyme A analogs, J. Am. Chem. SOC. 114,
GOLDBERG, A. L. (1988), Improved methods for 7287-7288.
purification and assay of glycerol kinase from MORAN,J. R., WHITESIDES, G. M. (1984),A practical
Escherichia coli, J. Chromatogr. Biomed. Appl. enzymatic synthesis of (S,)-adenosine 5 '-0-(1-
428,345-351. thiotriphosphate)((S,,)-ATP-a-S),J. Org. Chem.
KEIKINHEIMO, P., LEHTONEN, J., BAYKOV, A., LAHTI, 49,704706.
R., COOPERMAN, B. S., GOLDMAN, A. (1996), The MORRISON, J. F. (1973),Arginine kinase and other in-
structural basis for pyrophosphatase catalysis, vertebrate guanidino kinases, in: The Enzymes,
Structure 4,1491-1508. 3rd Edn., VIII (BOYER,P. D., Ed.), pp. 457486.
KESSEL,D. (1968), Properties of deoxycytidine kin- New York: Academic Press.
ase partially purified from L1210 cells, J. Biol. MUELLER,E. G., CROWDER, M. W., AVERILL,B. A.,
Chem. 243,47394744. KNOWLES, J. R. (1993), Purple acid phosphatase:
KNOWLES, J. R. (1980), Enzyme-catalyzed phospho- A diiron enzyme that catalyzes a direct phospho
ryl transfer reactions, Annu. Rev. Biochem. 49, group transfer to water, J. Am. Chem. SOC. 115,
877-919. 2974-2975.
KOYAMA,T., OGURA,K., BAKER,F. C., JAMIESON, G. MUHLEBACH, S. M., GROSS,M., WIRZ, T., WALLI-
C., SCHOOLERY, D. A. (1987), Synthesis and abso- MANN,T., PERRIARD, J. C., WYSS,M. (1994), Se-
lute configuration of 4-methyl juvenile hormone quence homology and structure predictions of
1 (4-MeJH 1) by a biogenetic approach: a combi- the creatine kinase isoenzymes, Mol. Cell. Bio-
nation of enzymatic synthesis and biotransforma- chem. 133,245-262.
tion, J.Am. Chem. SOC.109,2853-2854. MURPHY, J. E., STEC,B., MA, L., KANTROWITZ, E. R.
KOYAMA, T., INOUE,H., OHNUMA,S., OGURA,K. (1997), Trapping and visualization of a covalent
(1990), Prenyltransferase reaction involving enzyme-phosphate intermediate, Nature Struct.
enantiomeric discrimination.Enzymatic synthesis Biol. 4,618-622.
of (S)-l0,ll-epoxyfarnesol from racemic 6,7- NATCHEV, I. A. (1987), Phosphono and phosphino
epoxygeranyl diphosphate and isopentenyl analogs and derivatives of the natural ami-
diphosphate, Tetrahedron Lett. 31,41894190. nocarboxylic acids and peptides. 1. Synthesis and
KREBS,E. G., BEAU,J. A. (1979), Phosphorylation - enzyme-substrate interactions of N-phosphono-,
dephosphorylation of enzymes, Annu. Rev. Bio- and N-phosphinomethylated cyclic amides, Syn-
chem. 48,923-959. thesis, 1079-1084.
KREJCOVA, R., HORSKA,K. (1997), Adenylate kin- NATCHEV, I. A. (1988a), Organophosphorous analogs
ases, Chem. Listy 91,179-188. and derivatives of the natural L-amino carboxylic
LADNER, W. E., WHITESIDES, G. M. (1985), Enzymat- acids and peptides. 111. Synthesis and enzyme-
ic synthesis of deoxy ATP using DNA as starting substrate interactions of D-, DL-, and L-5-di-
materia1,J. Org. Chem. SO, 1076-1079. hydroxyphosphinyl-3,4-didehydrono~alineand
their cyclic analogs and derivatives, Bull. Chem. ation of UDP-glucose, UDP-glucuronic acid, and
SOC.Jpn. 61,3711-3715. GDP-mannose, J. Org. Chem. 55,1834-1841.
NATCHEV, I. A. (1988b),Total synthesis,enzyme-sub- SPECTOR, L. B. (1980), Acetate kinase: a triple-dis-
strate interactions and herbicidal activity of placement enzyme,Proc. Natl. Acad. Sci. USA 71,
plumbemicin A and B (N-1409), Tetrahedron 44, 2626-2630.
1511-1592. STRONG, S. J., ELLINGTON, W. R. (1995), Isolation and
NEUMANN, H. (1968), Substrate selectivity in the ac- sequence analysis of the gene for arginine kinase
tion of alkaline and acid phosphatases, J. Biol. from the Chelicerate arthropod, Limulus poly-
Chem. 243,46714676. phemus - insights into catalytically important
NODA,L. (1973),Adenylate kinase, in: The Enzymes, residues, Biochim. Biophys. Acta 1246,197-200.
3rd Edn., VIII (BOYER,P. D., Ed.), pp. 279-305. TANG,X. J., JOHANSSON, G. (1997), A bioelectro-
New York: Academic Press. chemical method for the determination of acetate
Nomenclature Commitee of the International with immobilized acetate kinase, Analyt. Lett. 30,
Union of Biochemistry (1984), Enzyme Nomen- 2469-2483.
clature. Orlando, F L Academic Press. THOMER, J. W., PAULUS, H. (1973), Glycerol and gly-
PRADINES,A., KLAEBE,A., P~RIE,J., PAUL,F., cerate kinases, in: The Enzymes, 3rd Edn., VIII
MONSAN, P. (1988), Enzymatic synthesis of phos- (BOER, P. D., Ed.), pp. 487-508. New York: Aca-
phoric monoesters with alkaline phosphatase in demic Press.
reverse hydrolysis conditions, Tetrahedron 44, VOET,D., VOET,J. (1995), Biochemistry, pp. 428-434;
63734386. 593-598. Chichester: John Wiley & Sons.
REID,T. W., WILSON,I. B. (1971), E. coli alkaline WANG,P., SCHUSTER, M., WANG,Y. F., WONG,C. H.
phosphatase, in: The Enzymes, 3rd Edn., IV (1993),Synthesis of phospholipid-inhibitor conju-
(BOYER,P. D., Ed.), pp. 373-415. New York: Aca- gates by enzymatic transphosphatidylation with
demic Press. phospholipase D, J. Am. Chem. SOC. 115,
RIOS-MERCADILLO,V. M., WHITESIDES, G. M. (1979), 10487-10 491.
Enzymatic synthesis of sn-glycerol 3-phosphate, WAIT, D. R., FINDEIS, M. A., RIOS-MERCADILLO, V.
J. Am. Chem. SOC.101,5828-5829. M., AuGB, J., WHITESIDES, G. M. (1984), An effi-
SEELA,F., O n , J., POTTER,B. V. L. (1983), Oxygen cient chemical and enzymatic synthesis of nico-
chiral phosphate in uridylyl(3’-5’) adenosine by tinamide adenine dinucleotide (NAD+), J. Am.
oxidatio of a phosphite intermediate: Synthesis Chem. SOC. 106,234-239.
and absolute configuration, J. Am. Chem. SOC. WAITS,D. C. (1973), Creatine kinase (Adenosine 5 ’-
105,5879-5886. triphosphate-creatine phosphotransferase), in:
SEKINE, M., IIMURA,S., FURUSAWA, K. (1993), Syn- The Enzymes, 3rd Edn., VIII (BOYER, P. D., Ed.),
thesis of a new class of 2‘-phosphorylated oligo- pp. 383-455. New York: Academic Press.
ribonucleotides capable of conversion to oligo- WEI,L. L., Goux, W. J. (1992),ATP cofactor regener-
ribonucleotides,J. Org. Chem. 58,3204-3208. ation via the glycolytic pathway, Bioorg. Chem.
SHIH,Y. S., WHITESIDES, G. M. (1977), Large-scale 20,6246.
ATP-requiring enzymatic phosphorylation of WHITESIDES, G. M., SIEGEL, M., GARRETT, P. (1975),
creatine can be driven by enzymatic ATP regen- Large-scale synthesis of diammonium acetyl
eration, J. Org. Chem. 42,41654166. phosphate, J. Org. Chem. 40,2516-2519.
SIMON, E. S., BEDNARSKI, M. D., WHITESIDES, G. M. WILD,K., GRAFMULLER, R., WAGNER, E., SCHULZ, G.
(1988a), Synthesis of CMP-NeuAc from N-ace- E. (1997), Structure, catalysis and supramolecular
tylglucosamine - generation of CTP from CMP assembly of adenylate kinase, Eur. J. Biochem.
using adenylate kinase, J. Am. Chem. SOC. 110, 250,326-331.
7159-7163. WILLSON, M., ALRIC,I., PERIE,J., SANEJOUAND, Y. H.
SIMON, E. S., BEDNARSKI, M. D., WHITESIDES, G. M. (1997), Yeast hexokinase inhibitors designed
(1988b), Generation of cytidine 5 ’-triphosphate from 3-D enzyme structure rebuilding,J. Enzyme
using adenylate kinase, Tetrahedron Lett. 29, Znhib. 12,101.
1123-1 126. WILSON, I. B., DAYAN, J., CYR,K. (1964), Some prop-
SIMON,E. S., GRABOWSKI, S., WHITESIDES, G. M. erties of alkaline phosphatase from Escherichia
(1989), Preparation of phosphoenolpyruvate coli. Transphosphorylation, J. Biol. Chem. 239,
from D-(-)-3-phosphoglyceric acid for use in 41824185.
regeneration of ATP, J. Am. Chem. SOC. 111, WONG,C. H.,WHITESIDES, G. M. (1981),Enzyme-cat-
8920-8921. alyzed organic synthesis: NAD(P)H cofactor re-
SIMON,E. S., GRABOWSKI, S., WHITESIDES, G. M. generation by using glucose 6-phosphate and the
(1990), Covenient synthesis of cytidine 5 ’-tri- glucose 6-phosphate dehydrogenase from Leuco-
phosphate, guanosine 5 ‘-triphosphate, and uri- nostoc mesenteroides, J. Am. Chem. SOC. 103,
dine 5’-triphosphate and their use in the prepar- 4890-4899.
4 References 241
WONG,C. H., WHITESIDES, G. M. (1983), Synthesis of WONG,C. H., HAYNIE,S. L., WHITESIDES, G. M.
sugars by aldolase-catalyzed condensation reac- (1983a), Preparation of a mixture of nucleoside
tions, J. Org. Chem. 48,3199-3205. triphosphates from yeast RNA: Use in enzymatic
WONG,C . H., MCCURRY,S. D., WHITESIDES, G. M. synthesis requiring nucleoside triphosphate re-
(1980), Practical enzymatic syntheses of ribulose generation and conversion to nucleoside diphos-
1,s-bisphosphate and ribose 5-phosphate, J. Am. phate sugars, J. Am. Chem. SOC. 105,115-117.
Chem. SOC. 102,7938-7939. WONG,C. H., MAZENOD,F. P., WHITESIDES, G. M.
WONG,C. H., HAYNIE,S. L., WHITESIDES, G. M. (1983b), Chemical and enzymatic syntheses of
(1982), Enzyme-catalyzed synthesis of N-acetyl- 6-deoxyhexoses. Conversion to 2,s dimethyl-4-
lactosamine with in situ regeneration of uridine hydroxy-2,3-dihydrofuran-3-one (furaneol) and
5 ‘-diphosphate glucose and uridine 5 ‘-diphos- analogs, J. Org. Chem. 48,3493-3497.
phate galactose, J. Org. Chem. 47,5416-5418.
5 Enzymes in Carbohydrate
Chemistry: Formation of Glycosidic
Linkages
L. FLITSCH
SABINE
GREGORYM. WATT
Edinburgh, UK
1 Introduction 245
2 Glycosidases 245
2.1 Availability of Enzymes 246
2.2 Kinetic vs. Thermodynamic Glycosylation 246
2.3 Glycosyl Donors 247
2.4 Acceptor Substrates for Transglycosylations 247
2.4.1 Simple Alcohols as Acceptor Substrates 247
2.4.2 Diastereoselective Glycosylation 248
2.4.3 Glycosides as Acceptors 249
2.4.4 Synthesis of Glycoconjugates 251
2.5 Glycosylation by Reverse Hydrolysis 253
2.5.1 Aqueous Systems 253
2.5.2 Use of Organic Solvents 254
2.6 Transfer of Disaccharides Using Endoglycosidases 255
2.7 Selective Hydrolysis for the Synthesis of Glycosides 255
3 Glycosyltransferases 256
3.1 Availability of Enzymes 256
3.2 Availability of Glycosyl Donors 256
3.3 Examples of Oligosaccharide Syntheses Using Glycosyltransferases 258
3.4 Synthesis of Glycoconjugates 261
3.4.1 Synthesis of Glycolipids 262
3.4.2 Glycopeptides and Glycoproteins 263
3.4.3 Cell Surface Glycosylation 264
3.5 Solid Phase Synthesis 264
3.6 Acceptor-Donor Analogs 264
244 5 Enzymes in Carbohydrate Chemistry: Formation of Glycosidic Linkages
3.7 Whole-Cell Glycosylation 266

3.8 Glycosyltransferases Using Non-Nucleotide Donor Substrates 267
4 Combination of Glycosidases and Glycosyltransferases 268
5 Practical Aspects of Synthesis and Analysis 268
5.1 Isolation and Purification of Enzymes for Biocatalysis 268
5.2 Biocatalytic Conversions 268
5.3 Analysis of Products 269
5.4 Chromatographic Methods for the Isolation of Products 269
6 Conclusions 270
7 References 270
2 Glycosidases 245
1 Introduction charide synthesis requires lengthy and labori-

ous synthetic routes and purification proto-
cols. Recent progress in this area has been re-
The glycosidic linkage is used in Nature as a viewed elsewhere (PAULSEN,1982; SCHMIDT,
way of reversibly attaching carbohydrates to 1991; SCHMIDT and KINZY,1994; BOONS,1996;
other biological materials and it forms the FLITSCH and WATT, 1997).
chains of oligo- and polysaccharides. Next to An alternative route to obtaining glycocon-
the peptide and phosphodiester linkages of jugates would be by using biological in vivo
nucleic acids, it plays a pivotal role in many methods, which again have found wide appli-
biological events ranging from provision of cations for proteins and larger oligonucleo-
mechanical stability in cellulose and energy tides. However, in vivo synthesis has met with
storage in amylose or glycogen to mediation of limited success because glycoconjugates gen-
highly specific inter- and intracellular recogni- erally occur in heterogeneous mixtures in
tion events. Although carbohydrates are high- small quantities in biological sources and thus
ly functionalized molecules, conjugation near- isolation from natural sources is not practical
ly always takes place through the anomeric in most cases. The manipulation of the biosyn-
center as outlined in Fig. 1.The two partners of thetic pathways within the cell by genetic engi-
the glycosidic linkage are generally called gly- neering techniques is very difficult, because
cosy1 donor (e.g., 1) and glycosyl acceptor (2), each glycosidic linkage is formed by an indi-
which is frequently, but not always an alcohol. vidual enzyme (glycosyltransferases) which in
The intrinsic chemistry of monosaccharides turn underlie complex control mechanisms.
provides for a startling level of structural com- One of the most successful methods for the
plexity of their polymers, which renders them practical synthesis of defined oligosaccharides
ideally suited as molecules for unique biologi- and glycoconjugates has, therefore, been the in
cal specificity.Whereas nucleic acids and poly- vitro enzymatic synthesis, using isolated en-
peptide chains are usually joined in a linear, di- zymes as biocatalysts.The enzymes used in bio-
valent fashion, the glycoside linkage alone can synthesis are the glycosyltransferases (and gly-
result in two stereoisomers, the a- and p-ano- cosidases), which have been shown to be
mers (e.g., 4 and 3). Further structural diversity amenable to use in v i m . Both types of en-
can be obtained if the glycosyl acceptor zymes will be discussed in detail.
(ROH) is multivalent, as in the case of saccha-
rides. Thus, between only 2 different hexoses,
20 different glycosidic linkages can be ob-
tained.
The potential for forming chemically simi- 2 Glycosidases
lar, isomeric glycosidic linkages has provided a
much greater challenge to synthetic chemistry It has been known for a long time that glyco-
than peptides and oligonucleotides. Whereas sidases,which normally catalyze the hydrolysis
automated synthesizers are now available for of glycosidic bonds (i.e., the backward reaction
the synthesis of the latter two, most oligosac- in Fig. l), can be used “in reverse” for the syn-
6
Ho Ho
1
O H O H
+
- H20 ., OH
OR
Glycosyl acceptor
Glycosyl donor
Fig. 1 9 OR
thesis of glycosidiclinkages. Systematic studies 2.2 Kinetic vs. Thermodynamic

using glycosidases for the synthesis of defined
saccharides started in the early 1980s, and Glycosylation
there are now a large number of examples of
glycosidases that are useful in synthesis. In the presence of glycosidases the thermo-
dynamic equilibium of the reaction shown in
Fig. 1lies generally strongly to the left in aque-
2.1 Availability of Enzymes ous medium, favoring hydrolyis of the glyco-
sides (3) and (4). If glycosidases are used for the
Glycosidases can be obtained from a large formation of glycosidic linkages, reaction con-
variety of biological sources, ranging from ditions need to be chosen which take this into
thermophiles, bacteria and fungi to mammal- account. In principle, there are two possible
ian tissue. They are generally stable and solu- approaches: the equilibrium can be shifted to-
ble enzymes. Since they are widely used as an- wards the glycosides in Fig. 1 by decreasing the
alytical tools for biochemical research, many water concentration and/or increasing glycosyl
glycosidases are commercially available, al- donor and/or alcohol concentration. This can
though not all glycosidases are suitable for syn- be either achieved by using a large excess of al-
thesis. Glucuronidases, e.g., have so far failed cohol (2) or sugar (1) or by working in organic
to yield any glucuronides. Glycosidases are gen- solvents.All these approaches have been used.
erally highly specific for a particular linkage (a Alternatively, one can take advantage of the
vs. p) and for a particular glycosyl donor. How- fact that many glycosidase acceptor substrates
ever, they tend to accept a structurally diverse have a much higher activity compared to water
range of glycosyl acceptors, which makes them than would be expected from the difference in
useful as general catalysts for glycosylation.At concentration. Thus, the enzymebound activat-
the same time, when the acceptor has several ed intermediate (represented as an oxonium
hydroxyl groups, glycosidases might have ion in Fig. 2) reacts much faster with an alcohol
poorer regioselectivity, and can result in mix- (R’OH) to give (7)and (8) than it does with
tures of isomers that need to be separated. water. In order to encourage this kinetic effect
over thermodynamic equilibration the glyco-
B Fig. 2
2 Glycosidases 247
syl donor needs to be a good substrate for the reaction. For these reasons, the most common
enzyme, which necessitates the use of activat- activated glycosyl donors are, therefore, glyco-
ed glycosyl donors, such as glycosyl fluorides syl fluorides, phenyl glycosides, nitro-, dinitro-,
or aryl glycosides. This allows the reaction to and chloro-phenyl glycosides. A 1,2-oxazoline
proceed rapidly before equilibration to (5) can derivative of N-acetylglucosamine has recent-
take place. Kinetic glycosylations (or “trans- ly been used as a donor for chitinase (Ko-
glycosylations”) can, therefore, be performed BAYASHI et al., 1997). In addition, cheaply
in aqueous medium with a moderate excess of available disaccharides such as lactose (for p-
donor or acceptor. A drawback, however, is galactosidase) and cellobiose (for pglucosid-
the requirement for multistep synthesis of the ase) have been used as glycosyl donors. Most
activated glycosyl donor. of these donors are commercially available.
The choice of glycosyl donor depends on the
enzyme system used and can markedly influ-
2.3 Glycosyl Donors ence yield and regioselectivity of the reaction,
an example of which is given in Sect. 2.4.3.
Glycosidases that have been used for syn-
thesis generally catalyze the transglycosylation
step with very high stereospecificity, in most 2.4 Acceptor Substrates
cases with retention of the anomeric configu- for Transglycosylations
ration.As a result, the activated glycosyl donor
(6) needs to have the right anomeric configu-
ration for the particular glycosidase used and 2.4.1 Simple Alcohols
will get selectively converted to only one of the as Acceptor Substrates
two possible anomers (7 or 8). For example, a
p-galactosidase would require a p-galactosyl Alkyl glycosides have found wide applica-
donor and would catalyze selectively the for- tions such as detergents in research and in in-
mation of the p-galactosidic linkage. dustry and are, therefore, good targets for en-
Glycosidases tend also to be highly specific zymatic synthesis using glycosidases, provided
for their donor sugar, although more catholic that inexpensive starting materials can be em-
glycosidases are now being reported, which ployed. Allyl-, benzyl-, and trimethylsilylethyl
have not been systematically studied in enzy- glycosides can be used as synthetic intermedi-
matic synthesis. ates carrying a temporary protecting group at
The activated glycosyl donor (6) needs to be the glycosidic center. One of the earlier appli-
a good substrate for the enzyme, but needs al- cations of transglycosylations for the synthesis
so to be stable in aqueous medium during the of simple glycosides was reported by NILSSON,
Ho
P
OH
a-galactosidase tqw
P o
Fig. 3
who found that a mixture of 0.1 M lactose (9) 2.4.2 Diastereoselective

and 0.2 M benzyl alcohol in phosphate buffer
with 5 mg P-galactosidase yielded 6% of ben- Glycosylation
zyl P-glucoside (10) (NILSSON, 1988) (Fig. 3).
Similarly, allyl alcohol was glycosylated with The diastereoselectivity of transglycosyla-
raffinose (11) and a-galactosidase to give se- tion with glycosidases has been investigated
lectively the allyl a-galactoside (12). with more complex prochiral or racemic ac-
The transglycosylation method is economic ceptor substrates such as (Ua, b), (15)and (17)
for these galactosylations,because lactose and (Fig. 4). In the case of the cyclic meso-diols
raffinose are inexpensive.Where synthetic ac- (13a, b) (n=l, 2); (GAISet al., 1988) good dia-
tivated glycosyl donors such as puru-nitro- stereoselectivities (75%de and 96% de) were
phenyl glycosides need to be used, this method obtained when the reactions were performed
becomes too expensive for the synthesis of in 50% (v/v) aqueous acetone. Interestingly,no
simple glycosides. Here reverse glycosylation diastereoselectivity was observed without ad-
employing organic solvents or the respective dition of the co-solvent.
alcohol as solvent is much more practical and In other cases reported so far, the selectiv-
recent examples will be discussed later on. ities have been much lower. For example, for
a OH
‘OH
+ lactose
p-galactosidase
E. coli
acetonehuffer *
141r
a--
n = i : 2oD/o(96%de)
n-2: 189&(7!5%de)
pgalactosidase Ho
E. coli
+ lactose
HO
OH
SOL
Ho
Ho OH
p-galactosidase
E. coli
t 1 RS = 10:8.6
W
J
, + lactose +
H0 OH
nob o 1pT OHO H
Fig. 4 WS = 10:7.7
2 Glycosidases 249
the galactosylation product of 2,3-epoxyprop- stereoselectivity of reaction but also the po-
anol (15) €US values for the aglycon of (16) tential glycosylation of one of several hydrox-
were only 7/3 (BJORKLING and GODTFREDSEN,yl groups. Thus, 8 different P-galactosides can
1988). Galactosylation of 1,2-propanediol(l7) be formed by galactosylation of methyl galac-
resulted in a mixture of regio- and stereoisom- toside (21) with para-nitrophenyl galactoside
ers with poor diastereoselectivity (CROUTand (20), as a result of galactosylation of the 4 dif-
MACMANUS,1990). ferent hydroxyl groups each of the acceptor
(21) and the donor (20) itself. However, with
the right choice of reaction conditions, sub-
2.4.3 Glycosides as Acceptors strates and enzymes, reasonable regioselectiv-
ities of reactions can be obtained, which has al-
A much more challenging application of gly- lowed the use of glycosidases for the synthesis
cosidases than alkyl glycosides is the use of of small oligosaccharides.
saccharides themselves as acceptor substrates, The competition of the donor substrate with
which results in the synthesis of oligosaccha- acceptor can be overcome by using a large ex-
rides. This provides not only a high degree of cess of acceptor substrate, although this can
k.0
HO .OH Ho We
POH
Ho OMe
HO No, p-galactosidase OH OH
ap major
Ho P
Ho
Ho OH
k&
OMe
'-0-
Ho Ho
OH
No, major OMe
ap 24
Ho bHog-+ 0 0
a-galactosidase + a
Fig. 5
present problems if the acceptor is valuable or the donor, whereas the 1-6 linked disaccharide
difficult to separate from product. (24) was the main product using methyl a-gly-
A bias of regioselectivity is generally ob- coside (23)as the acceptor substrate.
served in glycosidase-catalyzed reactions, of- Even more pronounced selectivity was ob-
ten with preferential formation of the 1-6 link- served with nitrophenyl glycosides (25)which
age. However, there have been many reports act both as acceptors and donors to give the
of good selectivities for other acceptor hydrox- (1-3) or (1-2) linked disaccharides (26) and
yl groups. How the regioselectivity of disac- (27) in different ratios, depending on whether
charide formation can be influenced by appar- ortho- or para-nitrophenyl glycosides are used.
ently subtle changes in glycosyl donor or ac- With the ortho-isomer of (25) the ratio of (26)
ceptor structure has been shown by NILSSON to (27) was less than 1:6 whereas with the
(NILSSON, 1987) (Fig. 5 ) . For example, the 1-3 para-isomer of (25) it was reversed (8: 1).
P-glucosidic linkage was mainly formed (22), Glycosidases can not only be used for disac-
when the P-methylglycoside (21) was the ac- charide synthesis, but also for the assembly of
ceptor and para-nitrophenyl p-glucoside (20) more complex oligosaccharides.Using a p-N-
Ho
OH
NHAC HO OH
29 NHAe
NHAe
N4 8-Nacetylhexosaminidase * +
I
-1
A. oryzae
Ho
Ho HO OH
NHAC NW
3Q
B-N-acety lhexosaminidase
A. oryzae
pmannosidase
A. otyzae
I
m,Ho NHtc Ho ;
II NHAe Ho NHAC OH
Ho
Ho Ho HO OH
NuAc NHAC
Fig. 6 ;P 26YO
2 Glycosidases 251
acetylhexosaminidase from Aspergillus ory- trisaccharide either for analog synthesis or

zae, CROUTand coworkers have synthesized conjugation to polymers. Both reactions were
chitooligosaccharides starting from N-acetyl performed with excess of glycosyl donor and
glucosamine (Fig. 6). The first transglycosyla- gave 20% and 12% yields based on the accep-
tion using para-nitrophenyl GlcNAc (28) pro- tor substrates (33) and (M),respectively
ceeded with good selectivity for the 1-4 isomer (NILSSON, 1997).
(30), although some 1-6 isomer (29) was
formed. The latter could be removed by selec-
tive hydrolysis using the 1-6 specific P-N-ac- 2.4.4 Synthesis of Glycoconjugates
etylhexosaminidase from Jack bean. Further
elongation to higher chito-oligosaccharides Other than saccharides, glycosidases are al-
such as (31) (with (30)acting as the donor and so able to glycosylate many other classes of
acceptor went with remarkable selectivity for natural products such as shown in Fig. 8. 001
the 1-4 linkage, with no detection of the 1-6 and colleagues have used galactosidase from
product (SINGHet al., 1995). Equally, glycosy- A. oryzae for the synthesis of cardiac glyco-
lation with a p-mannosidase from A. oryzae sides such as (37)from the precursor (36)in
and para-nitrophenyl Man gave the trisaccha- 26% yield. These glycosides are chemically un-
ride (32)in 26% yield based on the donor as stable and difficult to obtain by conventional
the only regioisomer (SINGHet al., 1996). chemical synthesis which involves harsh gly-
NILSSON has reported recently on the two- cosylation conditions and deprotection strate-
step synthesis of a trisaccharide derivative (35) gies (001et al., 1984).
which is related to antigens involved in hyper- An important class of glycoconjugates are
acute rejection of xenotransplants (Fig. 7). glycopeptides and glycoproteins. Many ad-
Both the thioethyl group and the 2-N-trichlo- vances have been made in the chemical syn-
roethoxycarbonyl group allow the further thesis of glycopeptides, which require large
straightforward chemical elaboration of the amounts of glycosylated amino acid building
NI p-galactosidase
lactose ~ Ho&o&
Ho OH no NI SEt
Bullera singularis 20%

I
a
oAOAm,
;ip
a-galactosidase
green coffee beans
Fig. 7
252 5 Enzymes in Carbohydrate Chemistry:Formation of Glycosidic Linkages
phenyl J3-Dgalactoside
J3-galactosidase OH
A. oryzae
26% OH
Ho BD0.K)
15% is
o-nitrophenyl
p-D-glucoside
o-nitrophenyl
Y2
bod
Ho OH
J3-D-galactoside
H o d w J3-galactosidase * HO OH C02H
1 A. oryzae 10%
R
!
Fig. 8
blocks, such as glycosyl serine derivatives. Such The need for adding excess of acceptor sub-
building blocks are accessible by enzymatic strate in order to reduce competition by the
synthesis of glycosyl serine derivatives using donor substrate can be a problem if the accep-
transglycosylation methodology. CANTACU- tor is expensive. For example, the yield of (39)
ZENE and colleagues have reported the synthe- based on (38) as a starting material is only 8%.
sis of various protected galactosyl serine deriv- This can be overcome (TURNERand WEBBER-
atives such as (39) from lactose and the semi- LEY,1991) by using excess donor instead, with
protected serine (38)in 15% yield based on slow addition of the glycosyl donor during the
lactose (CANTACUZENE et al., 1991). reaction (with a syringe pump). Using this
2 Glycosidases 253
method, the glycosyl serine derivative (41) vent mixtures, thus reducing the water activity.
could be prepared from (40) in 25% yield. Al- The use of organic solvents has the advantage
ternatively, for the synthesis of glycosyl serine that purification is easier, although not all gly-
derivatives, the less expensive serine (42) itself cosidases can tolerate organic solvents.
was used in large excess (30-fold) to generate
galactosyl serine (43) directly (SAUERBREI and
THIEM, 1992; HEIDELBERG and THIEM, 1997; 2.5.1 Aqueous Systems
NILSSON et al., 1997).
Di- and trisaccharides can be prepared by
using very high concentrations of acceptor and
2.5 Glycosylation by Reverse donor. This makes use of the high solubility of
sugars in water and of the good stability of en-
Hydrolysis zymes under high sugar concentrations. For
examples incubating a solution of 30% N-ace-
As discussed in Sect. 2.2, the alternative to tyl glucosamine and 10% galactose with P-ga-
transglycosylation is the use of glycosidases in lactosidase from Escherichia coli the 1-4 and
the reverse hydrolysis, which has the advant- 1-6 isomers (44) and (45) could be obtained in
age that no expensive activated glycosyl do- overall yield of 7.6% (AJISAKA et al., 1988;AJI-
nors are needed. Reverse hydrolysis is SAKAand FUJIMOTO, 1989) (Fig. 9). Purification
achieved by reducing the water/glycosyl donor of the disaccharides was possible by activated
ratio such that the reaction is driven towards carbon chromatography, since the affinity for
formation of the glycosidic linkage, rather than disaccharides is much higher than the affinity
hydrolysis. This can either be achieved by us- for monosaccharides. In addition, the overall
ing a very large excess of acceptor in aqueous yield could be improved to 16% by using a
systems, or by using the enzyme in organic sol- continuous process involving the circulation of
H
&
o
H
o
Ho& OH Ho OH
10% OH Ho OH
t NHAC
Ho
fbgalactosidase +
m o E. coli Ho
16% yield
Ho&OH&:
OH Ncue
4 : 44=4:1
Ho
Ho&
10 g
80% W h
OH
a-mannosidase
Aspergillus niger
50°C
- Manal-GMan (2.2 g)
Manal-2Man (290 mg)
Manal3Man (33 mg)
Manal-2ManalBMan (14 mg)
Manal-2Manal-6Man (3 mg)
Fig. 9
the reaction mixture through columns of im- This methodology could also be used for diols
mobilized galactosidase and activated carbon such as 1,6-hexane diol using reverse hydroly-
in series. sis, such that, e.g., the glucoside (46)was ob-
Mannobioses and mannotrioses were isolat- tained in good yield (61%) from glucose (Fig.
ed upon incubation of mannose (80% W/V) 10) (VICet al., 1996).
with an a-mannosidase from A. niger (AJISA- Reverse hydrolysis reactions normally pro-
KA et al., 1995) (Fig. 9). ceed very slowly, but can be accelerated using
higher temperatures if the enzyme can tolerate
such incubation conditions. The P-glucosidase
2.5.2 Use of Organic Solvents from almonds, e.g. (Fig. 10) gives higher yields
at 50°C (VICand CROUT,1994).Recently, ther-
The use of organic co-solvents has been in- mophile and thermostable glycosidases have
vestigated for both the kinetic and thermody- been isolated which can be used at even high-
namic glycosylation with almond P-glucosid- er temperatures or under focused microwave
ase using tert-butanol or acetonitrile as co-sol- irradiation (GELO-PUJICet al., 1997) to give
vents in order to improve yields. tert-Butanol products in good yields. Thus, glucosides (48)
was particularly useful because it does not act and (49) were produced in up to 77% and
as an acceptor substrate, presumably because 20%, respectively, from (47) using crude ho-
of steric hindrance, but the enzyme remained mogenate from Sulfolobus solfutaricus at
stable in up to 95%, with an optimum of activ- 110"C in 2 h. Commercial recombinant ther-
ity at about 90% butanol in water giving up to mophilic enzyme libraries are now becoming
20% yield. Total loss of activity was observed available, which give a number of biocatalysts
in 100% solvent (VICand THOMAS, 1992).The for screening. For example, the glycosidase
yield could be improved by using the acceptor CLONEZYMETM library developed by Re-
alcohol itself as a solvent, in which case ally1 combinant Biocatalysis Inc. has been used for
and benzyl glucosides could be synthesized in optimizing the synthesis of N-acetyl lactos-
40% and 62% yields (VIC and CROUT,1995). amine (LI and WANG,1997).
Ho&
Ho OH OH
H
o- 90% Vhl
pglucosidase
(almond)
OH
6
* H O Ho
4
OH O-OH
..G0J
Ho
OH
t
m 4
OPh +
Ho
OH
a
Fig. 10 4
2 Glycosidases 255
2.6 Transfer of Disaccharides reaction conditions (KOBAYASHI et al., 1991)

(Fig. 11). More recently, glucanohydrolases
Using Endoglycosidases have been used to make tetra- and higher
saccharides by using suitable acceptor sac-
Most glycosidases that have been used as charides. For example, a 1,3-1,4-P-~-glucan4-
biocatalysts are exoglycosidases,which hydro- glucanohydrolase from Bacillus licheniformis
lyze or synthesize terminal glycosidic linkages. can catalyze the formation of the tetrasac-
However, a number of endoglycosidases are charide Glc~l-3Glc~l-4Glc~l-3Glc~l-OMe
known and even available, which would allow from GlcP1-3GlcP1-F and GlcPl-3Glcpl-
assembly of larger oligosaccharides from natu- OMe in 40% yield. By using a 7-fold excess of
ral or synthetic building blocks. An interesting acceptor substrate, autocondensation could be
and useful example is the application of cellul- suppressed (VILADOT et al., 1997).
ase for such a “block synthesis” approach to
synthetic cellulose polysaccharides. KOBAYA-
SHI and colleagues have reported that incuba- 2.7 Selective Hydrolysis for the
tion of fi-~-cellobiosylfluoride (50) with cel-
lulase from Trichoderma viride in a mixed sol- Synthesis of Glycosides
vent of acetonitrile/acetate buffer (5 :1) yield-
ed predominantly water-soluble and insoluble Regioselective glycosylation can also be
cello-oligosaccharides of DP larger than 22 achieved by selective hydrolysis of multigly-
and smaller than 8, respectively, depending on cosylated substrates. For example, the potent
Ho
9p
Ho
Ho Ho HO
Fig. 11
2
h
OH
B-alucoronidase
.-Ho
OH OH
Fig. 12 a
analgesic morphine-6-glucoronide (52) was well established (PALCIC,1994) and cloning

obtained by selective hydrolysis of the readily and overexpression techniques have greatly
available diglucuronide (51)using glucuronid- increased the number of enzymes that are
ase as a catalyst (Fig. 12) (BROWNet al., 1995). available for biotransformations in recent
years (GIJSENet al., 1996). Although most of
the glycosyltransferases come from higher or-
3 G1y cosyltransf erases ganisms, there are some examples of successful
heterologous overexpression in prokaryotes
Glycosyltransferases are the enzymes that (WAIT et al., 1997; WANGet al., 1993). PALCIC
are naturally responsible for the biosynthesis has recently compiled a useful list of trans-
of glycosides. They catalyze the transfer of a ferases that have been used for preparative-
saccharide from a glycosyl donor to a glycosyl scale biotransformations (PALCIC,1994).
acceptor with either inversion or retention of
the anomeric center as outlined in Fig. 13.
Most of the transferases discussed here use 3.2 Availability of Glycosyl Donors
glycosyl phosphates as donors, in particular
the sugar nucleotides shown in Fig. 14.Howev- Despite the variety of different glycosyl-
er, the glycosyl donor might also be a glycoside transferases that are found in Nature, only a
very small number of common glycosyl donors
itself, such as a di- or polysaccharide. Since gly-
cosyltransferases have evolved to catalyze the are used by the majority of transferases. Their
formation of a very specific glycosidic linkage structures are shown in Fig. 14. These are all
in a biosynthetic pathway, they tend to be high- commercially available, but expensive, if reac-
ly selective both for acceptor and donor sub- tions need to be done beyond a 1G50 mg scale.
strates as well as highly regio- and stereoselec-In addition, glycosyltransferase reactions often
tive in the formation of the glycosidic bond. suffer from product inhibition when stoichio-
metric amounts of glycosyl donor are used.
Both problems can be overcome by in situ
3.1 Availability of Enzymes regeneration of the sugar nucleotide cofactor
such that concentrations of the nucleotide sub-
Although a large number of amino acid se- strates and products are kept low at all times
quences for glycosyltransferases are now during the biotransformation (ICHIKAWA et al.,
known (FIELDand WAINWRIGHT, 1995), the 1994).Such sugar nucleotide regeneration uses
number of enzymes commercially available is the biosynthetic enzymes in vitro and was first
still small compared to glycosidases, and they developed by WHITESIDESand colleagues
tend to be relatively expensive enzymes. 5 gly- (WONGet al., 1982) in the early 1980s. Since
cosyltransferases are currently sold through then many improvements have been reported,
catalogs, namely p-l,4-galactosyltransferase, such that glycosyltransferases can now be used
a-2,3-sialyltransferase,a-2,6-sialyltransferase, to produce complex oligosaccharides on a kilo-
a-1,2-mannosyltransferase, and a-1,3-fucosyl- gram scale (ICHIKAWA et al., 1994). The first
transferase V. However, protocols for the isola- reported regeneration protocol was for UDP-
tion of transferases from natural sources are Glc and UDP-Gal as outlined in Fig. 15. Both
0
R-OH: UDP-GIC R-OH: UDP-Gal

R - N H k : UDP-OICNAC H0 OH R - N H k : UDP-GelNAc H0
OH
GDP-Man
CMP-Neu-5- Ac
0
Ho
GDP-FUC
H O O H
Fig. 14
were generated from glucose-1-phosphate cofactor regeneration, allyl-N-acetyl lactos-

(53) and substoichiometric amounts of UTP. amine (55) was synthesized in 5 d on a 1.7 g
Synthesis of UDP-Glc is achieved by UDP- scale in 50% yield from (54) using equimolar
Glc pyrophosphorylase, with the by-product amounts of (54), glucose-1-phosphate, and
inorganic phosphate (PPi) being hydrolyzed to phosphoenolpyruvate and 0.025 equivalents of
phosphate using inorganic pyrophosphatase to UDI?
avoid enzyme inhibition. UDP-Glc can then When the monosaccharide starting material
be used directly in the reaction or be convert- is expensive, as in the case of sialic acid, the re-
ed to UDP-Gal using UDP-Gal 4-epimerase. generation system can include synthesis of the
The latter equilibrium favors formation of monosaccharide itself, as illustrated in Fig. 16
UDP-Glc, which can lead to complications if for the regeneration of CMP-NeuAc, the com-
the subsequent galactosyltransferase can ac- mon donor substrate for sialyltransferases
cept UDP-Glc as a substrate. UDP generated (ICHIKAWA et al., 1994).Synthesis of sialic acid
from the glycosyltransfer reaction can be re- (NeuAc) is achieved from N-acetyl mannos-
generated to UTP by using pyruvate kinase amine (56) and pyruvate by using a sialyl al-
and phosphoenolpyruvate as the phosphory- dolase. The monosaccharide is then activated
lating agent (ICHIKAWA et al., 1994).With such to CMP-NeuAc by the action of CMP-NeuAc
b0&
j3-1,4GalT
dGL-
Ho
&I Nwc Ho
5s NHAC
O\/\\
[=
OH
UDP-Gal
phosphoenolpyruvate
pyruvate kinase
uD) pyruvate
UDP-Glc
L7-/ap
PPase ww%opQ*
2Pi 53
Fig. 15
synthase using CTP. After transfer of the sialic very high stereo- and regioselectivity. This
acid to a suitable acceptor substrate by sialyl- makes them particularly useful as biocatalysts
transferase, the CMP is recycled to CTP in two for the synthesis of much larger and complex
steps first using ATP and nucleoside mono- oligosaccharides, where regioisomers that
phosphate kinase to generate CDP and then would be generated by glycosidases are diffi-
pyruvate kinase to generate CTPThe same py- cult to separate.
ruvate kinase can also be used to recycle ATP First examples of the use of glycosyltransfer-
needed for CDP formation. ases appeared in the early eighties (WONGet
al., 1982) (AUGEet al., 1984) using P-lP-galac-
tosyltransferase from bovine colostrum, which
3.3 Examples of has become the best studied glycosyltransfer-
ase and is now commercially available. Di- and
Oligosaccharide Syntheses trisaccharides (Galpl4GlcNAc and Galpl-4-
Using Glycosyltransferases GlcNAcpl-6/3Gal) were prepared on a milli-
mole scale using immobilized enzymes and re-
Glycosyltransferases are generally highly generation systems for the sugar nucleotide
selective for both their glycosyl donor and gly- cofactors. This work has been extended over
cosy1 acceptor substrates and catalyze the for- the past 15 years, perhaps driven by the discov-
mation of one specific glycosidic linkage with ery that oligosaccharide ligands such as the
a-sialyl transferase
acceptor-OH -m
CMP-NeuAc CMP
ADP
co;
Fig. 16
blood group antigens sialyl Lewis x and sialyl also been recently used for bivalent sialyl
Lewis a are involved in cell adhesion between Lewis x structure (DEFREESet al., 1995).
activated endothelial cells and neutrophils and Using similar enzymes, the sialylated un-
have potential therapeutic applications in in- decasaccharide - asparagine conjugate (62),an
flammation and cancer metastasis (FEIZI,1993; important side chain of glycoproteins,was pre-
LASKY, 1994; PAREKHand EDGE,1994). Thus, pared from chemically synthesized (61) in
the sialyl Lewis x structure (60) (Fig. 17) can be 86% yield by enzymatic transfer of saccharide
assembled in only three steps from (57) using a units in a one-pot reaction (UNVERZAGT, 1996).
galactosyltransferase to form (S),followed by Besides focus on galactosyl-, sialyl-, and fu-
sialylation to (59) and final fucosylation (ICHI- cosyltransferases,advances have been made in
KAWA et al., 1992). These reactions have been studying glycosyltransferases involved in the
performed on up to 0.5-1 kg scale and have synthesis of the core structures of oligosaccha-
GlcNAcpO-ally1
1 p1-4 galactosyltransferase
I
Galp(14)GlcNAcf3-0-allyl
a 2 3 sialyltransferase
I
Neu5Aca(2+3)Gal~(l4)GlcNAcp-O-allyl
al-3 fucosyltransferase
Neu5Aca(2+3)Galp(14)GlcNAcp-0-ally1 (u
I
a(l+S)Fuc
0 NHz
%
Ho
1) galactosyltransferaseE. Coli
alkaline phosphatase E. cob Ho
OUDP
OH
2) a-2,6-sialyltransferase€. cob
alkaline phosphatase E. m/i
Hox&ir-LACHV
Ho
f
h6Man8(1+)GlcNAcp(
NeuSAca(l+6)Gal~(1+4)GlcNAt$(l +P)Manal
n-
H
3 1+4)GlcNA@l- N
NeuSAca(1+6)Galp( 14)GlcNAcp( 1+P)Manal f 0 NH2
Ip
Fig. 17
ride side chains of glycoproteins.A P-1,4-man- tion of the enzyme on an immobilized metal
nosyltransferase from yeast involved in the (nickel) affinity column provided the manno-
biosynthesis of the conserved trisaccharide syltransferase directly from crude cell extracts
core of glycoproteins was overexpressed in E. as a functionally pure biocatalyst, which was
coli as a soluble HislO-fusion protein. Absorp- used in the synthesis of the glycolipid (64)
from synthetic (63a) (Fig. 18; W A et~ al., ronidation enhances water solubility and thus
1997). An a-l,2-mannosyltransferase from excretability from the cellular milieu. These
yeast has also been overexpressed in E. coli enzymes are, therefore, of great interest in
(WANGet al., 1993). drug metabolism, and a liver transferase
Most asparagine-linked oligosaccharides in system has been used for the synthesis of phe-
proteins contain a common pentasaccharide nol and lipophilic steroid glucuronates in good
core but are very heterogeneous in further yields (65% and 30%) on a milligram scale
elaboration of the oligosaccharide structure (GYGAXet al., 1991).When crude liver homo-
(KORNFELD and KORNFELD, 1985). Heteroge- genate was used all the necessary enzymes re-
neity is first introduced by the biosynthesis of quired to convert glucose-1-phosphate to
different N-acetyl glucosaminidic linkages to UDP-glucuronic acid were present in the
the pentasaccharide chore, each being catal- preparation, such that the much less expensive
yzed by a different GlcNAc-transferase. These glucose-1-phosphate could be employed as a
enzymes have been investigated by SCHACH- donor substrate. On the other hand, the liver
TER and colleagues (BROCKHAUSEN et al., enzymes and UDP-glucuronic acid are now
1988, 1992) and have been assigned as commercially available.
GlcNAc-transferases I-VI according to the
linkage they form, as shown in Fig. 19. All of
these can be isolated in at least milliunit 3.4 Synthesis of Glycoconjugates
amounts, which is sufficient for milligram
synthesis. The GlcNAc-transferases transfer One of the greatest advantages of using
GlcNAc not only to the natural glycoprotein glycosyltransferases is that complex glycocon-
or peptide side chain, but also to shorter oligo- jugates such as lipids, peptides, proteins and
saccharide acceptors, which are synthetically even cell surfaces can be glycosylated. Thus,
available.Thus trisaccharide (65) is a substrate oligosaccharides can be assembled directly on
for GlcNAc-transferases I and I1 and (66) for the glycoconjugate in a biomimetic fashion,
GlcNAc-transferase V (Fig. 19) (KAURet al., which is difficult with glycosidases because of
1991;PALCIC, 1994). the high acceptor concentrations required and
Glucuronosyltransferases, which transfer poor regioselectivity. Equally, chemical syn-
glucuronic acid from UDP-glucuronic acid to thetic methods of glycosidic bond formation
acceptor substrates are very important en- often fail on macromolecules, consequently,
zymes in the metabolism of endogenous and the oligosaccharide must be assembled before
exogenous lipophilic compounds, since glucu- attachment to the macromolecule. Glycosyl-
\
p-Mannosyl-
transferase 14-19
GDP-Man
Ho
HO 0 0
w.uo
84
Fig. 18 .o 0
GlcNAc transferases
GlcNAcbl-6
GlcNAcp14
a
GlcNAcpl-2Man a14
\ p1
GlcNAc~l4Man 4R
GlcNAcT V
GlcNAcT VI
GlcNAcT 11
GlcNAcT I l l
GlcNAcb14Mana 1 4
/ GlcNAcT IV
GlcNAcfil-2 / GlcNAcT I
+h
Ho
no
HO
OR Ho
Ho O(W)FHs
OH
OH
acceptor for GlcNAcT I and I I &# acceptor for GlcNAcT V

Fig. 19
transferases are, therefore, important tools for cussed earlier (Fig. 18; WATT et al., 1997;
the biochemist for modifying the glycosylation IMPERIALI and HENRICKSON, 1995).
of cell surfaces, proteins, and lipids and for in- Another important class of glycolipids are
vestigating structure-function relationships. A glycosphingolipids such as gangliosides,which
few examples are given in the following sec- are commonly found in eukaryotic cells and
tions. participate in a number of cell recognition
events (KARLSSON,1989; HAKOMORI,1990;
ZELLERand MARCHASE, 1992). These lipids
3.4.1 Synthesis of Glycolipids contain ceramide as their membrane-associat-
ed hydrophobic anchor and complex oligosac-
Glycolipids are ubiquitous membrane com- charide headgroups, which contain sialic acids
ponents of cells and are involved in a wide in the case of gangliosides. The biosynthetic
range of biological processes, which makes pathways of glycosphingolipids appear similar
them important synthetic targets. Examples of to that of other glycoconjugates, in that the
the enzymatic synthesis of glycolipid interme- oligosaccharide headgroup is assembled by
diates in glycoprotein biosynthesis were dis- specific glycosyltransferases from the reducing
end (BOUHOURS and BOUHOURS, 1991). Al- peptide side chain. Thirdly, glycosyltransfer-
though glycosidic linkages in glycolipids are ases can extend an existing mono- or oligosac-
quite similar to those in glycoproteins, it ap- charide that is already attached to the protein
pears that distinctly separate glycolipid and by further glycosylation.
glycoprotein transferases are used in biosyn- The most common monosaccharide linked
thesis (MELKERSON-WATSON and SWEELEY, to the serine or threonine side chain in O-gly-
1991; ITOet al., 1993). Indeed, glycoceramides can core structures is an a-GalNAc residue
themselves are often very poor substrates for (SCHACHTER, 1991).Biosynthesis of the O-gly-
the glycoprotein glycosyltransferases discus- can then occurs by successive addition of indi-
sed earlier. On the other hand, the glycolipid- vidual monosaccharide units from the corre-
specific transferases are often not available on sponding activated sugar nucleotides. The first
a sufficient scale for application in millimole glycosyltransferase in this pathway, peptide
glycolipid synthesis (PREUSSet al., 1993). GalNAc-transferase, has been isolated and is
Several practical solutions have been found available for the glycosylation of peptides
to overcome these problems. ZEHAVI and col- (CLAUSEN and BENNEIT,1996) (YANGet al.,
leagues demonstrated that enzymatic glyco- 1992). Considerable effort has gone into stud-
sphingolipid synthesis was possible on solid ying the relationship between acceptor pep-
support using bovine milk galactosyltransfer- tide sequence and enzyme activity. Although
ase (ZEHAVIet al., 1990). More recently, this the enzyme might glycosylate different threo-
approach was extended to sialyltransferases, nine and serine residues within a given poly-
with transfer of the oligosaccharide product peptide sequence at different rates, so far, no
from solid support onto ceramide using cera- peptide motif for 0-glycosylation has been
mide glycanase (NISHIMURAand YAMADA, identified (CLAUSEN and BENNEP, 1996), and
1997).Alternatively, more water-soluble chem- hence specific glycosylation remains elusive.
ical precursors of ceramide such as azido- The formation of N-glycans occurs by a very
sphingosine derivatives were good acceptor different biosynthetic process. N-glycosylation
substrates for glycosyltransferases, which led is very selective for a tripeptide motif includ-
to efficient chemo-enzymatic routes of gangli- ing the asparagine that is to be glycosylated
oside GM3 and analogs (GUILBERT et al., 1992; (Asn-Xaa-Thr/Ser, where Xaa cannot be pro-
GUILBERT and FLITSCH, 1994). line). Furthermore, monosaccharide units are
not assembled sucessively on the polypeptide,
but are first biosynthesized on a phospholipid
(dolichol) and then transferred from the lipid
3.4.2 Glycopeptides to the nascent polypeptide chain by an oligo-
and Glycoproteins saccharide transferase (KORNFELD and KORN-
FELD,1985;IMPERIALI and HENRICKSON, 1995).
Oligosaccharides are linked to peptides and The natural substrate for the oligosaccharyl-
proteins through two main types of linkage: transferase is a tetradecasaccharide lipid con-
the so-called “0-linkage’’ where the hydroxyl sisting of to GlcNAc, 9 mannose and 2 glucose
groups of serine and threonine provide sites units, but the enzyme also accepts smaller
for glycosylation and the “N-linkage” where substrates down to the disaccharide-lipid
glycosylation occurs through the amide of (GlcNAc/31-4GlcNAc-lipid).A crude enzyme-
asparagine (SCHACHTER, 1991; IMPERIALI and containing extract has been used to glycosylate
HENRICKSON, 1995).Three main types of enzy- peptides containing the Asn-Xaa-Thr/Ser
matic methods have been reported for the syn- motif (LEEand COWARD, 1993),but glycosyla-
thesis of glycopeptides and glycoproteins: first- tion of full-length proteins appears to be more
ly, the group of WONGhas used subtilisin-cata- difficult (LIU et al., 1994; XU and COWARD,
lyzed glycopeptide condensation for the syn- 1997; IMPERIALI, 1997). Thus, the biomimetic
thesis of ribonuclease glycoforms ( W m et approach for the synthesis of N-glycosylated
al., 1997). Secondly, enzymes have been used proteins using the biosynthetic glycosyltrans-
to catalyze the formation of the glycosidic ferases, despite their availability, is still diffi-
bonds that attach the oligosaccharide to the cult.
An interesting alternative non-biomimetic try, and there is a considerable interest in ap-

way of generating N-glycans has involved the plying it to carbohydrate chemistry. Advantag-
use of endo-P-N-acetyl-glucosaminidase (En- es are the ease of purification and the potential
do-A) from Arthrobacter protophormiae (FAN for construction of combinatorial libraries.
et al., 1995), which transfers Man9GlcNAc However, development of solid-phase methods
from Man9GlcNAc2Asn onto GlcNAc-pep- has been slow in this area, because of the inher-
tide to form Man9GlcNAc2-peptide. This en- ent difficulties of regio- and stereo-control in
zyme can also be used to make N-glycopeptide the chemical formation of glycosidic linkages.
analogs with C-glycosidic linkages to the pep- The usefulness of solid-phase synthesis in
tide (WANGet al., 1997). enzymatic glycolipid synthesis, where one of
Galactosyltransferases, sialyltransferases, the major problems is the insolubility of the
and fucosyltransferases previously described acceptor lipid in aqueous media, has already
can also be used to extend oligosaccharides on been discussed (ZEHAVIet al., 1990; NISHIMU-
peptides and proteins (UNVERZAGT et al., RA and YAMADA, 1997). Several examples of
1994; UNVERZAGT, 1996; SEITZ and WONG, oligosaccharide and glycopeptide synthesis us-
1997).The disadvantage of all these methods is ing galactosyl- and sialyltransferases have
that they require initial attachment of a single been reported since 1994,such as the synthesis
monosaccharide specifically onto the polypep- of a sialyl Lewis x glycopeptide (SCHUSTER et
tide chain, which can be achieved either chem- al., 1994). One of the practical problems en-
ically or by truncating the natural oligosaccha- zyme-catalyzed reactions on solid support has
ride back to a single GlcNAc residue, using ap- been the choice of enzyme-compatible poly-
propriate glycosidases such as Endo-H. Fur- meric support, which has to render support-
ther development of these methods should ul- bound substrates available to the enzyme in
timately lead to the synthesis of pure “glyco- aqueous media. The commonly used polysty-
forms” of proteins, which remains a major rene resins do not swell in water and are,
challenge to scientists (BILL and FLITSCH, therefore, generally unsuitable. Among the
1996;VERBERT, 1996;STANLEY, 1992). resins used successfully are controlled pore
glass (HALCOMB et al., 1994),polyethylene gly-
col polyacrylamide co-polymers (MELDALet
3.4.3 Cell Surface Glycosylation al., 1994), polyacrylamide (KOEPPER,1994),
and sepharose (BLIXTand NORBERG, 1997).
An interesting application carrying the use Soluble polyacrylamide supports can also be
of glycosyltransferases even further into bio- used in combination with glycosyltransferases
logical systems is the glycosylation of cell sur- (NISHIMURA et al., 1994; YAMADA and NISHI-
faces (PAULSEN and RODGERS, 1987).Thus de- MUM, 1995; WIEMANN et al., 1994). Various
sialylated erythrocytes were treated with sia- linkers have been used for oligosaccharides on
lyltransferases of different specificity resulting solid support which can be cleaved with chy-
in samples of erythrocytes with different motrypsin (YAMADAand NISHIMURA, 1995;
surface linkages (e.g., Neu-5-Aca2-6Galpl- SCHUSTERet al., 1994), by hydrazinolysis
4GlcNAc-R,Neu-5-Aca2-3Galpl-(3)4GlcNAc- (HALCOMB et al., 1994),by hydrogenation (NI-
R, Neu-5-Aca2-3Galpl-3GalNAc-Thr/Ser,).SHIMURA et al., 1994),by photolysis (WIEMANN
These preparations were used to test the spec- et al., 1994; KOEPPER, 1994), and by reductive
ificity of sialo-oligosaccharide binding pro- cleavage of disulfide bonds (BLIXTand NOR-
teins such as influenza virus hemagglutinins by BERG,1997).
measuring its ability to agglutinate the resialy-
lated cells.
3.6 Acceptor-Donor Analogs
3.5 Solid Phase Synthesis Glycosyltransferases can show remarkable
specificity for both acceptor and donor sub-
Solid-phase synthesis is a method well es- strates, often beyond even the terminal non-
tablished in peptide and nucleic acid chemis- reducing saccharide of the acceptor. For exam-
ple, an a-2,3-sialyltransferase isolated from However, when unnatural, chemically synthe-

porcine submaxillary gland was highly specific sized donor and acceptor analogs were further
for acceptor substrates terminating with the investigated, a number of unnatural glycosidic
Galpl3GalNAc sequence found in 0-linked linkages could be formed on a milligram scale
oligosacchandes,but did not glycosylate those although the relative rates of reaction were of-
terminating in Galpl4Glc or Galpl4GlcNAc, ten much reduced (WONGet al., 1995).
found in N-linked chains (REARICKet al., The best studied system is the p-1,4-galacto-
1979).Such findings have led to the general be- syltransferase from bovine colostrum (Fig. 20).
lief that glycosyltransferases are highly specific Instead of UDP-Gal as a donor substrate,
and cannot be used for the synthesis of analogs. UDP-Glc, UDP-GalNAc, UDP-GlcNH,, and
b+
galactosyl- OH OH
t ransfe rase
Ho HoOUDP
Ho
no* Muc R
J&oHo&
Ho Ho
NHAC R
*
G a no
l - l p sR G a l
HO - l pOH s R
hB
OH
6
6z
Gal-1%
Gal-1%no R Ma0 OH
u
R
w
LQ
Gal-lp- HO R
OH
1l
Gal-1% +
&
Ho
OH
R
Fig. 20
all the 2,3,4,6-deoxy- and 6-deoxy-6-fluoro- stituents (BAISCHet al., 1996a, b). Sialyltrans-
UDP-Gal analogs were successfully transferase have also been used for the synthesis of
ferred to acceptor substrates (PALCICand Lewis x analogs (ICHIKAWA et al., 1992) biva-
HINDSGAUL, 1991; KAJIHARAet al., 1995). An lent (DEFREESet al., 1995) and clustered sialo-
even wider range of acceptor substrates has sides (SABESAN et al., 1991).
been used to generate a number of non-natu- The substrate specificity of the Lewis x and
ral disaccharides such as (67-75) in Fig. 20. a fucosyltransferases ( 4 3 and a-l,4) which
Substitutions in the 3- and 6-positions of the transfers fucose to the internal GlcNAc resi-
acceptor substrate appear to be well tolerated, due in Galpl3/4GlcNAc seems to be particu-
whereas any modifications in the 4-position, larly broad (Fig. 21).Apart from deoxygenated
not surprisingly,leads to loss of activity.The 2- acceptor substrates (GOSSELINand PALCIC,
position appears also to be sensitive to change, 1996), they can be either sialylated (WONGet
such that a 2-hydroxyl group as in glucose can al., 1995) or sulfated (AUGEet al., 1997).With-
be tolerated (more so in the presence of a co- in the donor substrate, a large substituent can
enzyme, lactalbumin). Glucal is also a substra- be tolerated at the C-6 position, which has
te leading to (74), but mannose (the C-2-epi- been used to transfer carbon-backbone elon-
mer) is not a substrate.The enzyme is also very gated GDP-fucose derivatives and even oligo-
sensitive to negative charge, glucuronic acid saccharides linked via a spacer to the C-6 posi-
and glucose-1-phosphates are not accepted tion of GDP-fucose in one step to appropriate
(WONGet al., 1995).When using acceptor an- acceptor substrates (VOGELet al., 1997).
alogs with lower binding constants to the en-
zyme the high regioselectivity of the enzyme
might potentially be lost and it is, therefore, 3.7 Whole-Cell Glycosylation
important to check authentity of the glycosidic
linkage.This has mainly been done using NMR As an alternative approach to in v i m syn-
methods, in particular NOE effects, and look- thesis of oligosaccharides and glycoconjugates
ing at deshielding effects of ring protons is the use of whole-cell systems. In particular in
(WONGet al., 1991; NISHIDAet al., 1993a, b). the area of glycoprotein synthesis, the ap-
An interesting case of changed regioselectivity proach of “glycosylation engineering” by het-
of the galactosyltransferase has been reported erologous expression of specific glycosyltrans-
by THIEM and colleagues (NISHIDA et al., 1993a, ferases such that the glycosylation pattern of
b) for acceptor substrates containing 3-N-ace- the glycoproteins is changed, is an area of in-
tyl substituents such as N-acetyl5-thio-gentos- tense interest and has been reviewed else-
amine which led to the formation of 1,l-O- where (STANLEY, 1992; VERBERT,1996; BILL
linked disaccharide (75). This work has sug- and FLITSCH,1996).
gested that perhaps the N-acetyl group of the In addition, recombinant whole cells, which
acceptors N-acetyl glucosamine and N-acetyl had originally been developed as expression
5-thio-gentosamine is a key substituent in de- systems for glycosyltransferases, have been
termining regioselectivity. used directly as catalysts for the synthesis of
Various deoxy-UDP-GlcNAc analogs have oligosaccharides (HERRMANNet al., 1994;
been studied as substrate donors for N-acetyl HERRMANN et al., 1995a). The advantage of
glucosaminyltransferases I and I1 (GnT-I and such an approach is that the glycosyltransfer-
GnT-11) from human milk. Whereas all were ases do not need to be isolated, although pur-
accepted by GnT-I, deoxygenation of HO-3 ification of the product from the crude cell
completely abolished ability to act as a donor mixtures is more difficult. Thus, E. coli XL1-
(SRIVASTAVA et al., 1990). Blue cells, harboring a plasmid expressing an
Analog studies for sialyltransferases have a-1,2-mannosyltransferase expressed at a level
been limited to 9-substituted CMP-Neu-5-Ac of about 1 Unit per liter, were incubated with
(ITO et al., 1993) and to various disaccharide GDP-mannose and various mannose accep-
acceptor analogs where the 2-NHAc group has tor substrates (mannose, a-methyl-mannoside,
been replaced by a number of substituents Cbz-aManThr-OMe or Boc-Tyr-aManThr-
such as azido, 0-pivaloyl and other N-acyl sub- Val-OMe) to give the corresponding a-1-2-
OR
Ho
HO NHAC Fucosyltransf erase OR
HO
Ho NHAC
Alternative Acceptor Substrates: Alternative Donor Substrates:
&o*" HO OH OR Y OH
c F o ~ D p
Ho
OR
HO
Ho OH
&
"o* RY) Ho NHAc OR
R' = H, N w ~ A C U Fig. 21
mannosides in 42-75% isolated yields (HERR- ferases" these "Non-Leloir glycosyltransferas-

MANN et al., 1994). Similarly,a human P-1,Cga- es" are involved both in oligosaccharide and
lactosyltransferase expressed in yeast was used polysaccharide synthesis to catalyze mostly re-
to synthesize N-acetyl lactosamine by incuba- versible reactions. In v i m they have been used
tion with UDP-Gal and N-acetyl glucosamine as biocatalysts for the synthesis of sucrose
(HERRMANN et al., 1995a). from glucose-1-phosphate and fructose using
sucrose phosphorylase, of trehalose from glu-
cose and glucose-1-phosphate, and for various
3.8 Glycosyltransferases Using polysaccharides (WONGet al., 1995).
Non-Nucleotide Donor Substrates Another important group of targets are cy-
clodextrins,which have been synthesized enzy-
A number of glycosyltransferases involved matically using cyclodextrin glycosyltransfer-
in the biosynthetic formation of glycosidic ases from bacteria (BORNAGHI et al., 1996).Al-
linkages do not use sugar nucleotides as shown though polysaccharides such as starch and re-
in Fig. 14 as donor substrates, but more simple lated malto-oligosaccharides are the natural
glycosyl phosphates or glycosides. In contrast glycosyl donor substrates, it has been shown
to the previously discussed transferases, which that a-maltosyl fluoride (Glcal-4Glcal-F) can
are sometimes called "Leloir glycosyltrans- be incorporated into cyclodextrins. The sub-
strate specificity of this enzyme system has pensive and particularly the thermophilic en-
been investigated, with the aim to synthesize zyme libraries might provide a wide range of
new derivatives of cyclodextrins for supramo- useful glycosidation biocatalysts in the future
lecular studies. It was found that modifications (LI and WANG,1997).The number of glycosyl-
at C-6 of the a-maltosyl fluoride were tolerat- transferases available is still very limited and
ed by the system and that cyclothiomaltins these enzymes need to be purified before use,
could be prepared by using 4-thio-a-maltosyl but a number of reliable purification protocols
fluoride as the activated disaccharide. from mammalian tissue have been published
(PALCIC,1994; SADLERet al., 1982). Affinity
chromatography using immobilized nucle-
osides such as CDP-agarose for sialyltrans-
4 Combination of ferases has been successful (PAULSON et al.,
1977). The amount of transferases that can be
Glycosidases and isolated from natural sources variies greatly.A
a-2,6-sialyltransferase from porcine liver con-
Glycosyltransferases tains 40 Units per kg (AUGE et al., 1990)
whereas 250 mL of human milk yielded about
Glycosyltransferases and glycosidases can 20 milliunits of an a-1,3/4-fucosyltransferase
of course be used in consecutive glycosylation (PALCIC, 1994).
reactions. This is particularly advantageous Where glycosyltransferases are usually only
when a highly acceptor-specific transferase is found in very low abundance in natural sourc-
used subsequently to a glycosidase-catalyzed es, considerable effort has been spent on de-
step, which produces regioisomers. Thus, veloping efficient overexpression systems. So
NILSSON has reported the synthesis of sialylat- far, a lot of the mammalian glycosyltransfer-
ed trisaccharides by firstly using a p-galactos- ases have required mammalian expression
idase from E. coli to obtain a mixture of pl-3- systems,such as those reported for sialyltrans-
and pl-4-linked Gal-GlcNAc-OMe disaccha- ferases (GILLESPIE et al., 1992), fucosyltrans-
rides. Since the p-D-galactoside 3-a-sialyl- ferases (DEVRIESet al., 1995; DEVRIESet al.,
transferase from porcine submaxillary glands 1993;WONG et a]., 1992;BAISCH et al., 1996a,b)
has a higher selectivity for Galpl3GlcNAc and GlcNAc-transferases (D’AGOSTARO et al.,
subsequent sialylation of the product mixture 1995). More efficient and higher yielding
yielded selectively Neu-5-Aca2-3 Galpl-3- expression was achieved with insect cells
GlcNAc-OMe (NILSSON, 1989). (BAISCHet al., 1996a,b) and yeast (MALISSARD
A further avantage of using a combination et al., 1996;HERRMANN et al., 1995b;BORSIGet
of both enzymes is that the glycosidase-cata- al., 1995).The yeast system provided 200 Units
lyzed reaction is reversible, but the transferase of the p-1,4-galactosyltransferasefrom a 290L
reaction is irreversible, such that yields can be fermentation and 47 Units of a-2,6-sialyltrans-
improved by using one-pot synthesis (KREN ferase from a 150 L bioreactor.
and THIEM,1995; HERRMANN et al., 1993). E. coli expression at a level of about 1Unit
per liter in shake-flask cultures has been
achieved for two mannosyltransferases a-1,2-
(WANGet al., 1993) and p-1,4- (WATT et al.,
5 Practical Aspects 1997). The p-1,4-mannosyltransferase yielded
much better conversion, when an N-terminal
ofSynthesis and Analysis hydrophobic peptide sequence was deleted,
resulting in a more soluble enzyme.
5.1 Isolation and Purification
of Enzymes for Biocatalysis 5.2 Biocatalytic Conversions
Many of the glycosidases discussed in this Biocatalytic conversions with glycosidases
chapter are commercially available and inex- and transferases have been reported for im-
5 Practical Aspects of Synthesis and Analysis 269
mobilized and soluble enzymes. Immobiliza- graphic methods need to be employed which
tion has the advantage that recovery of expen- can be complicated and lengthy. A general
sive enzyme and purification of products is method for the assay of glycosyltransferase ac-
easier, and some enzymes are more stable tivity makes use of synthetic glycoside accep-
when immobilized (AUGEet al., 1984, 1986, tors attached to hydrophobic aglycones (such
1990; WATT et al., 1997). However, most gly- as (CH,),COOMe glycosides) which allow
cosidase- and transferase-catalyzed conver- rapid adsorption of the radiolabeled product
sions have been performed with soluble en- on to reverse-phase C-18 cartridges (PALCICet
zyme preparations (PALCIC, 1994). al., 1988).
Glycosyltransferase-catalyzed reactions of- Alternative assay methods relying on non-
ten suffer from product inhibition, in particu- radioactive methods have also been published
lar by the released nucleotide phosphates. A (KRENand THIEM,1997). If glycoproteins or
simple way of removing these products is by glycopeptides are synthesized, assays based on
further hydrolysis using alkaline phosphatase specific lectins are very useful (CLARKet al.,
(UNVERZAGT et al., 1990).Alternatively, cofac- 1990).
tor recycling systems discussed earlier keep A major problem with using conventional
the nucleotide phosphate concentration low, HPLC techniques for analysis of non-radioac-
such that product inhibition is not a problem. tive oligosaccharide products is the lack of
Although the majority of transformations suitable chromophores for UV detection.
using glycosyltransferases have been reported Thus, refractive index detection (YAMASHITA
on a milligram scale, scale-up to kilogram et al., 1982) or pulsed amperometry (WILLEN-
quantities of sialyl Lewis x has been achieved BROCK et al., 1991) can be used, which are,
by Cytel Co., California, for tests as a drug can- however, not always compatible with all
didate for the treatment of reperfusion tissue solvent systems and presence of cofactors.
injury (WONGet al., 1995). Scale-up should in Very recently, quantitative electrospray mass
future also be facilitated by the use of enzyme spectrometry was used for screening poten-
membrane reactors, which allow the use of sol- tial inhibitors against galactosyltransferase by
uble enzymes with tight control on cofactor measuring the amounts of benzyl N-acetyl-
and product concentrations. Such a system has lactosamine formed in the presence of inhibi-
been used for the synthesis of sialic acid on a tors. This promises to be a very fast method
15 g scale (KRAGLet al., 1991). for enzyme assays in the future (Wu et al.,
1997).
5.3 Analysis of Products

Since glycosyltransferases are frequently 5.4 Chromatographic Methods
only available in small quantities, initial analy- for the Isolation of Products
sis of potential substrates and optimization of
reaction conditions can make convenient use The reaction products of the glycosylation
of radiolabeled sugar-nucleotide donor sub- reactions described here are mostly highly
strates, which are labeled in the sugar and are water-soluble compounds, which need to be
commercially available. The assays then in- isolated from unreacted starting materials and
volve a separation protocol in which labeled other side products in addition to enzymes,co-
glycosylated product can be effectively separ- factors, and buffers after the biotransforma-
ated from unreacted donor substrate and any tion. In particular, glycosidase-catalyzed gly-
side products, such as those resulting from hy- cosylations are frequently contaminated with
drolysis of substrates. If the acceptor substrate large amounts of starting materials, which are
is a lipid, simple partition into organic solvent used in excess and are present due to overall
can be used for separation (WILSONet al., low yields. Hence purification using inexpen-
1995). Otherwise, paper electrophoresis, thin sive chromatography such as activated carbon
layer chromatography, or other chromato- chromatography (AJISAKAet al., 1995) or car-
bon-celite chromatography (SINGHet al.,

1995) has been useful as a purification step for
7 References
such crude mixtures.
Since glycosyltransferase-catalyzed reac- AJISAKA, K., FUJIMOTO, H. (1989), Regioselective
tions tend to be better yielding and highly se- synthesis of trisaccharides by use of a reversed
hydrolysis activity of a- and P-galactosidase, Car-
lective, separation of isomeric mixtures of olig- bohydr. Res. 185,139-146.
osaccharides is not required and the purifica- AJISAKA, K., FUJIMOTO, H. et al. (1988), Enzymic
tion from enzymes, buffer, salts, and starting synthesis of disaccharides by use of the reversed
material is often straightforward. HPLC separ- hydrolysis activity of P-galactosidases, Carbo-
ation, gel filtration, ion exchange chromato- hydr. Res. 180,3542.
graphy or gel permeation chromatography AJISAKA, K., MATSUO, I. et al. (1995), Enzymatic syn-
(YAMASHITA et al., 1982) are the most widely thesis of mannobiosides and mannotriosides by
used techniques for oligosaccharide isolation, reverse hydrolysis using a-mannosidase from As-
pergillus niger, Carbohydr. Res. 270,123-130.
in particular on a milligram scale. AUGE,C., DAVID, S. et al. (1984), Synthesis with im-
mobilized enzymes of two trisaccharides, one of
them active as the determinant of a stage antigen,
Tetrahedron Lett. 25,1467-1470.
AWE, C., MATHIEU, C. et al. (1986), The use of an
6 Conclusions immobilized cyclic multi-enzyme system to syn-
thesize branched penta- und hexa-saccharides as-
sociated with blood-group I epitopes, Carbohydr.
Both natural and unnatural oligosaccha- Res. 151,147-156.
rides and glycoconjugates are accessible by AWE, C., FERNANDEZ-FERNANDEZ, R. et al. (1990),
synthetic enzymatic methods using either gly- The use of immobilized glycosyltransferases in
cosidases or glycosyltransferases.Both enzyme the synthesis of sialo-oligosaccharides, Carbo-
systems are highly stereospecific and often hydr. Res. 200,257-268.
substrate-specific, such that each particular AUGE,C., DAGRON, F. et al. (1997), Synthesis of sul-
glycosidic linkage requires its own biocatalyst. fated derivatives as sialyl Lewis a and sialyl Lew-
So far, there is no known general biocatalyst is x analogs, in: Carbohydrate Mimics: Concepts
for formation of glycosidic linkages and, given and Methods (CHAPLEUR, Y., Ed.), pp. 365-383.
Weinheim: WILEY-VCH Verlag.
the high degree of stereo- and regioselectivity BAISCH, G.,OHRLEIN, R. et al. (1996a), Enzymatic fu-
required, such a catalyst would have limited cosylation of non-natural trisaccharides with
use, given that oligosaccharide biosynthesis cloned fucosyltransferase VI. Bioorg. Med. Chem.
does not involve a template as is available for Lett. 6,759-762.
oligonucleotide and polypeptide biosynthesis. BAISCH, G., OHRLEIN, R. et al. (1996b), Enzymatic
A great deal of current research is, therefore, a(2-3)-sialylation of non-natural oligosaccharides
focused on finding glycosylation catalysts with with cloned sialyltransferase, Bioorg. Med. Chem.
new stereo-, regio-, and substrate selectivities, Lett. 6,755-758.
and on then investigating their substrate spec- BILL,R. M., FLITSCH, S. L. (1996), Chemical and bio-
logical approaches to glycoprotein synthesis,
ificity, such that eventually perhaps a complete Chem. Biol. 3,145-149.
set of catalysts for each glycosidic linkage will BJORKLING, F., GODTFREDSEN, S. E. (1988), New en-
become available. It should be kept in mind zyme catalyzed synthesis of monoacyl galactogly-
that natural sources might- -provide only limit- cerides. Tetrahedron 44.2957-2962.
ed activities, since of the thousands of possible BLIXT,O.,NORBERG,T. (1997), Solid-phase enzymat-
oligosaccharide isomers (if one assumes every ic synthesis of a Lewis a trisaccharide using an ac-
possible permutation of stereo- and regiose- ceptor reversibly bound to sepharose, J. Carbo-
lectivity) only a small subset actually occur in hYdr. Chem. 16, l4SM4.
natural systems.A very interesting area of re- BOONS,G-J. (1996), Strategies in oligosaccharide
synthesis, Tetrahedron 52,1095-1121.
search therefore?the generation Of new bio- BORNAGHI, L., UTILLE, J,-p.et al. (1996), Enzymic
catalysts using either rational site-specific synthesis of cyc~othiomaltins, them. sot.,
(SETO et al., 1997) or random mutagenesis Chem. commun., 2541-2542.
techniques combined with directed evolution BORSIG, L., IVANOV, S. x. et al. (1995), Scaled-up ex-
(MOORE and ARNOLD, 1996). pression of human (~-2,6(iV)sialyltransferasein
7 References 271
Saccharomyces cerevisiae, Biochim. Biophys. Res. FAN,J.-Q., TAKEGAWA, K. et al. (1995), Enhanced
Commun. 210,14-20. transglycosylation activity of Arthrobacter proto-
BOUHOURS, D., BOUHOURS, J.-F. (1991), Genetic phormiae endo-P-N-acetyl glucosaminidase in
polymorphism of rat liver gangliosides, J. Biol. media containing organic solvents,J. Biol. Chem.
Chem. 266,12 944-12 948. 270,17 723-17 729.
BROCKHAUSEN, I., CARVER, J. P. et al. (1988), Control FEIZI, T. (1993), Oligosaccharides that mediate
of glycoprotein biosynthesis. The use of oligosac- mammalian cell-cell adhesion, Curr. Opin. Struct.
charide substrates and HPLC to study the se- Biol. 3,701-710.
quential pathway for N-acetyl glucosaminyltrans- FIELD,M. C., WAINWRIGHT, L. J. (1995), Molecular
ferases I, 11,111, IV, V, and V1 in the biosynthesis cloning of eukaryotic glycoprotein and glycolipid
of highly branched N-glycans by hen oviduct glycosyltransferases: a survey, Glycobiology 5,
membranes, Biochem. Cell Biol. 66,1134-1151. 463-472.
BROCKHAUSEN, I., MOLLER,G. et al. (1992), Con- FLITSCH, S. L., WAn, G. M. (1997), Chemical Synthe-
trol of glycoprotein-synthesis - characterization sis of Glycoprotein Glycans. Glycopeptides and
of (~-]4)-N-acetyl-P-~-glucosaminyltransferases Related Compounds (LARGE,D. C., WARREN, C.
acting on the a-D-(1-]3) 0-linked and a-D-(1-]6)- D., Eds.), pp. 207-244. New York: Marcel Dekker.
linked arms of N-linked oligosaccharides,Carbo- GAIS,H.-J., ZEISSLER, A. et al. (1988), Diastereose-
hydr. Res. 236,281-299. lective D-galactopyranosyl transfer to meso-diols
BROWN, R. T., CARTER, N. E. et al. (1995), Synthesis catalyzed by P-galactosidases, Tetrahedron Lett.
of morphine-5-glucuronide via a highly selective 29,5743-5744.
enzyme-catalyzed hydrolysis reaction, Tetrahe- GELO-PUJIC, M., GUIBE-JAMPEL, E. et al. (1997), En-
dron Lett. 36,1117-1120. zymatic glycosidation in dry media under micro-
CANTACUZENE, D.,ATTAL, S. et al. (1991), Stereospe- wave irradiation, J. Chem. SOC.,Perkin Trans. I ,
cific chemoenzymatic synthesis of galactopyrano- 1001-1002.
syl-L-serine,Bioorg. Med. Chem. Lett. 1,197-200. GIJSEN,H. J. M., QIAO,L. et al. (1996), Recent ad-
CLARK,R. S., BANEWEE, S. et al. (1990), Yeast oligo- vances in the chemo-enzymaticsynthesisof carbo-
saccharyltransferase:glycosylationof peptide sub- hydrates and carbohydrate mimetics, Chem. Rev.
strates and chemical characterization of the glyco- %, 443-473.
peptide product,J. Org. Chem. 55,6275-6285. GILLESPIE, W., KELM,S. et al. (1992), Cloning and ex-
CLAUSEN, H., B E N N E ~E., F? (1996), A family of pression of the Galbl-3GalNAc a-2,3-sialyltrans-
UDP-GalNAc :polypeptide N-acetylgalactosami- ferase,J. Biol. Chem. 267,2100&21010.
nyl-transferases control the initiation of mucin- GOSSELIN, S., PALCIC,M. M. (1996), Acceptor hy-
type 0-linked glycosylation, Glycobiology 6, droxyl group mapping for human milk al-3 and
635-646. al-3/4 fucosyltransferases,Bioorg. Med. Chem. 4,
CROUT,D. H. G., MACMANUS, D. A. (1990), Enzy- 2023-2028.
matic synthesis of glycosides using the P-galactos- GUILBERT, B., FLITSCH,S. L. (1994), A short chemo-
idase of Escherichia coli: regio- and stereo-chem- enzymic route to glycosphingolipids using soluble
ical studies, J. Chem. Soc., Perkin Trans. Z, glycosyltransferases,J. Chem. Soc., Perkin Trans.
1865-1868. I , 1181.
D’AGOSTARO, G. A. F., ZINGONI,A. et al. (1995), Mo- GUILBERT, B., KHAN,T.H. et al. (1992), Chemo-enzy-
lecular cloning and expression of cDNA encoding matic synthesis of a glycosphingolipid,J. Chem.
the rat UDP-N-acetyl glucosaminyltransferase11, SOC.,Chem. Commun., 15261527.
J. Biol. Chem. 270,15211-15221. GYGAX, D., SPIES,I? et al. (1991), Enzymatic synthe-
DEFREES,S. A., KOSCH, W. et al. (1995), Ligand rec- sis of P-D-glucuronides with in situ regeneration
ognition by E-selectin: synthesis, inhibitory activ- of uridine-5 ‘-diphosphoglucuronic acid, Tetrahe-
ity, and conformational analysis of bivalent sialyl dron 47,5119-5123.
Lewis x analogs,J. Am. Chem. SOC.117,6679. HAKOMORI, S.-I. (1990), Bifunctional role of glycos-
DEVRIES,T., NORBERG,T., LO”, H.,VAN DEN EYNDEN, phingolipids,J. Biol. Chem. 265,18713-18716.
D. H. (1993),The use of human milk fucosyltrans- HALCOMB, R. L., HUANG,H. et al. (1994), Solution-
ferase in the synthesis of tumor-associatedtrimer- and solid-phase synthesis of inhibitors of H. pylo-
ic X determinants Eur. J. Biochem. 216,769-777. ri attachment and E-selectin-mediated leukocyte
DEVRIES,T., SRNKA,C. et al. (1995),Acceptor speci- adhesion,J. Am. Chem. SOC.116,11315-11 322.
ficity of different length constructs of human re- HEIDELBERG,T., THIEM, J. (1997), Synthesis of novel
combinant a-l,3/4-fucosyltransferases- replace- amino acid glycoside conjugates, Carbohydr. Res.
ment of the stem region and the transmembrane 301,145-153.
domain of fucosyltransferase-V by protein-A re- HERRMANN, G., ICHIKAWA, Y. et al. (1993), A new
sults in an enzyme with GDP-fucosyl hydrolysing multi-enzyme system for a one-pot synthesis of
activity,J. Biol. Chem. 270,8712-8722. sialyl oligosaccharides:combined use of P-galac-
tosidase and a(2,6)sialyltransferase coupled with KORNFELD, R., KORNFELD, S. (1985), Assembly of
regeneration in sifu of CMP-sialyc acid, Tetrahe- asparagine-linked oligosaccharides, Ann. Rev.
dron Lett. 34,3091-3094. Biochem. 54,631464.
HERRMANN, G., WANG,F! et al. (1994), Recombinant KRAGL,U., GYM, D. et al. (1991), Enzymatic two-
whole cells as catalysts for the enzymatic synthe- step synthesis of N-acetyl neuraminic acid in the
sis of oligosaccharides and glycopeptides, Angew. enzyme membrane reactor, Angew. Chem. (Int.
Chem. (Int. Edn. Engl.) 33,1241-1242. Edn. Engl.) 30,827-828.
HERRMANN, G. F., ELLING, L. et al. (1995a), Use of KREN,V.,THIEM, J. (1995),A multienzyme system for
transformed whole yeast cells expressing p-1,4- one-pot synthesis of sialyl T-antigen, Angew.
galactosyltransferase for the synthesis of N-acetyl Chem. (Int. Edn. Engl.) 34,893-895.
lactosamine, Bioorg. Med. Chem. Lett. 5,673476. KREN,V., THIEM,J. (1997), Simple and non-radioac-
HERRMANN, G. F., KREZDORN, C. et al. (1995b), tive method for determination of sialyltransfer-
Large-scale production of a soluble human p-1,4- ase activity,Biotechnol. Tech. 11,323-326.
galactosyltransferase using a Saccharomyces ce- LASKY, L. A. (1994), A sweet success, Nature Struct.
revisiae expression system, Protein Expr. Purijic. Biol. 1,139-141.
6,72-78. LEE, J., COWARD, J. K. (1993), Oligosaccharyltrans-
ICHIKAWA, Y., LIN,Y.-C. et al. (1992),Chemical-enzy- ferase: synthesis and use of deuterium-labeled
matic synthesis and conformational analysis of peptide substrates as mimetic probes, Biochemis-
sialyl Lewis-x and derivatives,J. Am. Chem. SOC. try 32,6794-6801.
114,9283-9290. LI, J., WANG,P.G. (1997), Chemical and enzymatic
ICHIKAWA, Y., WANG,R. et al. (1994), Regeneration synthesis of glycoconjugates. 2. High yielding re-
of sugar nucleotide for enzymatic oligosaccharide gioselective synthesis of N-acetyl lactosamine by
synthesis,Methods Enzymol. 247,107-127. use of recombinant thermophilic glycosidase li-
IMPERIALI, B. (1997), Protein glycosylation:the clash brary, TetrahedronLett. 38,7967-7970.
of the titans, Acc. Chem. Res. 30,452459. LIU,Y.-L., HOOPS,G. C. et al. (1994), A comparison
IMPERIALI, B., HENRICKSON,T. L. (1995),Asparagine- of proteins and peptides as substrates for micro-
linked glycosylation: specificity and function of soma1 and solubilized oligosaccharyltransferase,
oligosaccharyltransferase, Bioorg. Med. Chem. Bioorg. Med. Chem. 2,1133-1141.
Lett. 3,1565-1578. MALISSARD, M., BORSIG,L. et al. (1996), Recombi-
ITO,Y., GAUDINO, J. et al. (1993), Synthesis of bioac- nant soluble ~-1,4-galactosyltransferasesex-
tive sialosides,Pure Appl. Chem. 65,753-762. pressed in Saccharomyces cerevisiae - purifica-
KAJIHARA, Y., ENDO,T.et al. (1995), Enzymic trans- tion, characterization and comparison with hu-
fer of 6-modified D-galaCtOSyl residues: synthesis man enzyme, Eur. J. Biochem. 239,340-348.
of biantennary penta- and heptasaccharides hav- MELDAL, M., AUZANNEAU, E-I. et al. (1994), A PE-
ing two 6-deoxy-~-galactoseresidues at the non- GA resin for use in the solid-phase chemical-en-
reducing end and evaluation of 6-deoxy-~-galac- zymatic synthesis of glycopeptides,J. Chem. SOC.,
tosyl transfer to glycoprotein using bovine p- Chem. Commun., 1849-1850.
(1,4)-galactosyltransferase and UDP-6-deoxy-~- MELKERSON-WATSON, L. J., SWEELEY, C. C. (1991),
galactose, Carbohydr. Res. 269,273-294. Purification to apparent homogeneity by immu-
KARLSSON, K.-A. (1989), Animal glycosphingolipids noaffinity chromatography and partial character-
as membrane attachment sites for bacteria, Annu. ization of the GM3 ganglioside-formingenzyme,
Rev. Biochem. 58,309-350. CMP-sialic acid :lactosylceramide a2,3-sialyl-
KAUR,K. J., ALTON,G. et al. (1991), Use of N-acetyl transferase (SAT-l), from rat liver Golgi, J. Biol.
glucosaminyltransferases I and I1 in the prepara- Chem. 266,4448-4457.
tive synthesis of oligosaccharides,Carbohydr. Res. MOORE,J. C., ARNOLD, F. H. (19%), Directed evolu-
210,145-153. tion of a para-nitrobenzyl esterase for aqueous-or-
KOBAYASHI, S., KASHIWA, K. et al. (1991), Novel ganic solvents, Nature Biotechnology 14,458-467.
method for polysaccharide synthesis using an en- NILSSON, K. G. I. (1987),A simple strategy for chang-
zyme: the first in vitro synthesis of cellulose via a ing the regioselectivity of glycosidase-catalyzed
nonbiosynthetic path utilizing cellulase as cata- formation of disaccharides, Carbohydr. Res. 167,
lyst,J. Am. Chem. SOC.ll3,3079-3084. 95-103.
KOBAYASHI, S., KIYOSADA, T. et al. (1997), A novel NILSSON, K. G. I. (1988),A simple strategy for chang-
method for synthesis of chitobiose via enzymatic ing the regioselectivity of glycosidase-catalyzed
glycosylation using a sugar oxazoline as glycosyl formation of disaccharides:Part 11. Enzymic syn-
donor, Tetrahedron Lett. 38,2111-2112. thesis in situ of various acceptor glycosides, Car-
KOEPPER, S. (1994),Polymer-supported enzymic syn- bohydr. Res. 180,53-59.
thesis on a preparative scale, Carbohydr. Rex 265, NILSSON, K. G. I. (1989),Enzymic synthesis of di- and
161-166. trisaccharide glycosides, using glycosidases and p-
7 References 273
D-galactoside 3-a-sialyltransferase, Carbohydr. (GM3-synthase) from rat brain, J. Biol. Chem.

Res. 188,9-17. 268,26 273-26 278.
NILSSON, K. G. I. (1997), Glycosidase-catalyzessyn- REARICK, J. I., SADLER, J. E. et al. (1979), Enzymatic
thesis of di- and trisaccharide derivatives related characterization of p-~-galactosidecu2-3 sialyl-
to antigens involved in the hyperacute rejection transferase from porcine submaxillary gland, J.
of xenotransplants, TetrahedronLett. 38,133-136. Biol. Chem. 254,44444l51.
NILSSON, K. G. I., LJUNGER, G. et al. (1997), Glycosi- SABESAN, S., DUUS,J. et al. (1991), Synthesis of clus-
dase-catalyzed synthesis of glycosylated amino ter sialoside inhibitors for influenza virus, J. Am.
acids: Synthesis of GalNAc a-Ser and GlcNAc p- Chem. SOC.113,5865-5866.
Ser derivatives,Biotechn. Lett. 19,8894392. SADLER, J. E., BEYER, T. A. et al. (1982), Purification
NISHIDA, Y., WIEMANN, T. et al. (1993a), A new type of mammalian glycosyltransferases,Methods En-
of galactosyltransferase reaction: transfer of ga- zymol. 83,458-514.
lactose to the anomeric position of N-acetyllac- SAUEREIREI, B.,THIEM, J. (1992),Galactosylation and
tosamine, J. Am. Chem. SOC.115,2536-2537. glucosylation by use of P-galactosidase, Tetrahe-
NISHIDA,~., WIEMANN,T. et al. (1993b), Extension of dron Lett. 33,201-204.
the p-Gall,l,-transfer to N-acetyl-5-thio-gentosa- SCHACHTER, H. (1991),Enzymes associated with gly-
mine by galactosyltransferase, Tetrahedron Lett. cosylation, Cum Opin. Struct. Biol. 1,755-765.
34,2905-2906. SCHMIDT, R. R. (1991), Synthesis of glycosides.Com-
NISHIMURA, S.-I.,MATSUOKA, K. et al. (1994), Chemo- prehensive organic synthesis, 6,3343.
enzymatic oligosaccharide synthesis on a soluble SCHMIDT, R. R., KINZY,W. (1994),Anomeric-oxygen
polymeric camer, Tetrahedron Lett. 35,5657-5660. activation for glycoside synthesis. The trichloro-
NISHIMURA, S., YAMADA, K. (1997),Transfer of gan- acetimidate method, Adv. Carbohydr. Chem. Bio-
glioside GM3 oligosaccharide from a water solu- chem. 50,21-123.
ble polymer to ceramide by ceramide glycanase. SCHUSTER, M., WANG,P. et al. (1994), Solid-phase
A novel approach for the chemical-enzymatic chemical-enzymatic synthesis of glycopeptides
synthesis of glycosphingolipids,J. Am. Chem. SOC. and oligosaccharides, J. Am. Chem. SOC. 116,
119,10555-10556. 1135-1136.
O O I , ~HASHIMOTO,T.
., et al. (1984),Enzymic synthe- SEITZ,O., WONG,C.-H. (1997), Chemoenzymatic so-
sis of chemically unstable cardiac glycosides by p- lution- and solid-phase synthesis of O-glycopep-
galactosidase from Aspergillus oryzae, Tetrahe- tides of the mucin domain of MAdCAM-1. A
dron Lett. 25,2241-2244. general route to 0-LacNAc, 0-sialyl-LacNAc
PALCIC,M. M. (1994), Glycosyltransferases in gly- and 0-sialyl-Lewis-X peptides, J. Am. Chem. SOC.
cobiology,Methods Enzymol. 230,300-360. 119,8766-8776.
PALCIC, M. M., HEERZE,L. D. et al. (1988),The use of SETO,N. 0.L., PALCIC,M. M. et al. (1997), Sequential
hydrophobic synthetic glycosides as acceptors in interchange of four amino acids from blood
glycosyltransferase assays, Glycoconjugate J. 5, group B to blood group A glycosyltransferase
4943. boosts catalytic activity and progressively modi-
PALCIC, M. M., HINDSGAUL, 0. (1991), Flexibility in fies substrate recognition in human recombinant
the donor substrate specificity of pl,4-galactosyl- enzymes,J. Biol. Chem. 272,14 133-14 138.
transferase: application in the synthesis of com- SINGH,S., PACKWOOD, J. et al. (1995), Glycosidase-
plex carbohydrates, Glycobiology 1,205-209. catalyzed oligosaccharide synthesis: preparation
PAREKH, R. B., EDGE,C. J. (1994), Selectins - glyco- of N-acetyl chitooligosaccharides using the p-N-
protein targets for therapeutic intervention in in- acetyl hexosaminidase from Aspergillus oryzae,
flammation, TZBTECH 12,339-345. Carbohydr. Res. 279,293-305.
PAULSEN, H. (1982), Advances in selective chemical SINGH,S., SCIGELOVA, M. et al. (1996), Glycosidase-
syntheses of complex oligosaccharides, Angew. catalyzed synthesis of oligosaccharides: a two-
Chem. (Int. Edn. Engl.) 21,155-173. step synthesis of the core trisaccharide of N-
PAULSEN, J. C., RODGERS, G. N. (1987), Resialylated linked glycoproteins using the p-N-acetyl hexosa-
erythrocytes for assessment of the specificity of minidase and the Pmannosidase from Aspergil-
sialooligosaccharide binding proteins, Methods lus oryzae, Chem. Commun.,993-994.
Enzymol. 138,162-168. SRIVASTAVA, G., ALTON,G. et al. (1990), Combined
PAULSON, J. C., BERANEK, W. E. et al. (1977),Purifica- chemical-enzymic synthesis of deoxygenated
tion of a sialyltransferase from bovine colostrum oligosaccharide analogs: transfer of deoxygenat-
by affinity chromatography on CDP-agarose, J. ed D - G ~ c ~ N Aresidues
c from their UDP-
Biol. Chem. 252,2356-2362. GlcpNAc derivatives using N-acetyl glucosamj-
PREUSS,U., Gu, X. et al. (1993), Purification and nyltransferase I, Carbohydr. Res. 207,259-276.
characterization of CMP-N-acetylneuraminic STANLEY, P. (1992), Glycosylation engineering, Gly-
acid :lactosylceramide (a2-3) sialyltransferase cobiology 2,99-107.
TURNER, N. J., WEBBERLEY, M. C. (1991), Stereospe- WIEMANN,T.,TAUBKEN,N. et al. (1994),Enzymicsyn-

cific attachment of carbohydrates to amino acid thesis of N-acetyl lactosamine on a soluble light-
derivatives using P-glucosidase and P-xylosidase. sensitive polymer, Carbohydr. Res. 251, Cl-C6.
J. Chem. Soc., Chern. Commun., 1349-1350. WILLENBROCK, F. W., NEVILLE, D. C. A. et al. (1991),
UNVERZAGT, C. (1996), Chemoenzymatic synthesis The use of HPLC-pulsed amperometry for the
of a sialylated undecasaccharide-asparagine con- characterization an assay of glycosidases and gly-
jugate, Angew. Chem. (Int. Edn. Engl.) 35, cosyltransferases,Glycobiology 1,223-227.
2350-2353. WILSON, I. B. H., WEBBERLEY, M. C., REVERS, L.,
JNVERZAGT, C., KUNZ,H. et al. (1990), High-effi- FLITSCH, S. L. (1995), Dolichol is not a necessary
ciency synthesis of sialyloligosaccharides and moiety in lipid-linked oligosaccharidesubstratesfor
sialoglycopeptides, J. Am. Chem. SOC. 112, the mannosyltransferasesinvolved in N-linked olig-
9308-9309. osaccharidebiosynthesis, Biochern.J. 310, W 9 1 6 .
JNVERZAGT, C., KELM,S. et al. (1994), Chemical and W m , K., SEARS,P. et al. (19!Z'), Enzymatic glycopro-
enzymatic synthesis of multivalent sialoglycopep- tein synthesis: Preparation of ribonuclease glyco-
tides, Carbohydr. Res. 251,285-301. forms via enzymatic glycopeptidecondensation and
VERBERT, A. (1996), The fascinating challenge to glycosylationJ Am. Chem. SOC.119,2114-2118.
mimic nature in producing recombinant glyco- WONG,C.-H., HAYNIE,S. L. et al. (1982), Enzyme-
proteins, Chimica Oggi, 9-14. catalyzed synthesis of N-acetyl lactosamine with
VIC,G., THOMAS, D. (1992), Enzyme-catalyzed syn- in situ regeneration of uridine 5 '-diphosphate
thesis of alkyl p-D-glucosides in organic media, glucose and uridine 5 '-diphosphate galactose, J.
Tetrahedron Lett. 33,45674570. Org. Chem. 47,5416-5418.
VIC,G., CROUT,D. H. G. (1994), Synthesis of gluco- WONG,C.-H.,ICHIKAWA,Y. et al. (1991),Probingthe ac-
sidic derivatives with a spacer arm by reverse hy- ceptor specificity of j3-1,4-galactosyltransferasefor
drolysis using almond P-D-glucosidase, Tetrahe- the development of enzymatic synthesis of novel
dron:Asyrnrnetry 5,2513-2516. oligosaccharides,J.Am. Chem. Soc. 113,81374145.
VIC, G., CROUT,D. H. G. (1995), Synthesis of ally1 WONG,C., DUMAS, D. et al. (1992), Specificity inhibi-
and benzyl P-D-glucopyranosides and ally1 p-D- tion and synthetic utility of a recombinant human
galactopyranoside from D-glucose or D-galactose c~-1,3-fucosyl-transferase. J. Am. Chem. SOC. 114,
and the corresponding alcohol using almond p-D- 7321-7322.
glucosidase,Carbohydr. Res. 279,315-319. WONG,C.,HALCOMB, R. L. et al. (1995), (Part 2) En-
VIC,G., HASTINGS, J. J. et al. (1996), Glycosidase-cat- zymes in organic synthesis: Application to the
alyzed synthesis of glycosides by an improved problems of carbohydrate recognition, Angew.
procedure for reverse hydrolysis: Application to Chern. (Int. Edn. Engl.) 34,521-546.
the chemoenzymatic synthesis of galactopyrano- Wu, J.,TAKAYAMA, S. et al. (1997), Quantitative elec-
syl-(1-4)-0-a-galactopyranosidederivatives, Tet- trospray mass spectrometry for the rapid assay of
rahedr0n:Asymmetry I,1973-1984. enzyme inhibitors, Chem. Biol. 4,653-657.
VILADOT, J.-L., MOREAU, V. et al. (1997),Transglyco- Xu, T., COWARD, J. K. (1997), C-13 and N-15-labeled
sylation activity of Bacillus 1,3-1,4-p-~-glucan4- peptide substratesas mechanistic probes of oligosac-
glucanohydrolases. Enzymic synthesis of alter- charyltransferase,Biochemistry 36,14683-14689.
nate 1,3-1,4-~-~-gluco-oligosaccharides, J. Chem. YAMADA, K., NISHIMURA, S.-I. (1995), An efficient
SOC.,Perkin Trans. I 16,2383-2387. synthesis of sialoglycoconjugateson a peptidase-
VOGEL,C., BERGEMANN, C. et al. (1997),Synthesis of sensitive polymer support, Tetrahedron Lett. 36,
carbon-backbone-elongated GDP-L-fucose de- 9493-9496.
rivatives as substrates for fucosyltransferase-cata- YAMASHITA, K., MIZUOCHI, T. et al. (1982), Analysis
lyzed reactions, Liebigs Ann. Rec. 3,601-612. of oligosaccharidesby gel filtration, Methods En-
WANG,P., SHEN,G.-J. et al. (1993), Enzymes in oligo- zymol. 83,105-124.
saccharide synthesis: active-domain overproduc- YANG,W.,ABERNETHY, J. L. et al. (1992),Purification
tion, specificity study, and synthetic use of an a- and characterization of a UDP-GalNAc-polypep-
1,2-mannosyltransferase with regeneration of tide N-acetyl galactosaminyltransferase specific
GDP-mannose, J. Org. Chem. 58,3985-3990. for the glycosylation of threonine residues,J. Biol.
WANG,L. X., TANG,M. et al. (1997), Combined Chem. 267,12709-12716.
chemical and enzymatic synthesis of a C-glyco- ZEHAVI,U., HERCHMAN, M. et al. (1990), Enzymic
peptide and its inhibitory activity towards glycoa- glycosphingolipid synthesis on polymer supports.
midases,J.Arn. Chern.SOC.119,11137-11 146. 11. Synthesis of lactosyl ceramide, Glycoconjugate
WATT,G. M., REVERS, L. et al. (1997),Efficient enzy- J. I,229-234.
matic synthesis of the core trisaccharide of N-gly- ZELLER,C. B., MARCHASE, R. B. (1992), Ganglio-
cans using a recombinant P-mannosyltransferase. sides as modulators of cell function, Am. J. Phys-
Angew. Chem. (Int. Edn. Engl.) 36,2354-2356. iol. 262, C1341-1355.
Applications
6 Industrial Biotransformations
UWE T. BORNSCHEUER
Greifswald, Germany
1 Introduction 278
1.1 Basic Considerations 278
2 Enantiomerically Pure Pharmaceutical Intermediates 278
2.1 Diltiazem 279
2.2 Amines 279
2.3 6-Aminopenicillanic Acid 280
2.4 7-Aminocephalosporanic Acid 280
2.5 Naproxen 281
2.6 Pyrethroid Precursors 282
2.6.1 Via Oxynitrilases 282
2.6.2 Via a Monooxygenase 282
2.6.3 Via Esterase 283
2.7 Production of Chiral C, Building Blocks 283
2.8 Other Pharmaceutical Intermediates 283
3 AminoAcids 285
3.1 Natural Amino Acids 285
3.2 Non-Natural Amino Acids 285
3.3 Aspartame 286
4 Other Applications 287
4.1 Acrylamide/Nicotinamide 287
4.2 L-Carnitine 288
4.3 Lipid Modification 289
4.3.1 Cocoa Butter Equivalents 289
4.3.2 Other Structured Lipids 289
5 References 290
278 6 Industrial Biotransformations
1 Introduction In the following survey, some examples for

the industrial use of a wide range of biocata-
lysts are given. They are organized by product
In the last two decades, the application of not by enzyme or microorganism used, be-
biocatalysts in industry has considerably in- cause often several biocatalytic routes have
creased. This is due to a number of reasons, of been developed for the same target. Most ex-
which the most important ones might be the amples are taken from the recent literature.
better availability of enzymes in large quan- For further industrialized processes readers
tities (mainly due to the progress in genetic are referred to a number of excellent books
engineering) and an increasing demand for (COLLINS et al., 1992,1997;SHELDON, 1993).
enantiomerically pure compounds for phar- It should be pointed out that it is very diffi-
maceuticals/agrochemicals due to changes in cult to provide a complete overview, because
legislation. Furthermore, organic chemists information about commercialized processes
more and more accept biocatalysts as a useful is hard to get. Moreover, even if details are re-
alternative to chemical catalysts. The recent vealed in the (patent) literature, processes
development in the field of directed evolution might have changed in the meantime.
(STEMMER,1994; ARNOLD,1998; BORN-
SCHEUER, 1998; REETZand JAEGER, 1999)
might further increase the availability of suit-
able biocatalysts. 2 Enantiomerically Pure
Pharmaceutical
1.1 Basic Considerations
Intermediates
The successful application of biotransfor-
mations in an industrial environment depends The worldwide sales of single-enantiomer
on a number of factors, such as drugs are increasing dramatically, e.g., from
1996 to 1997 by 21% to almost 90 billion US$.
0 availability (and price) of suitable en- Of the top 100 drugs, 50 are marketed as single
zymes or microorganisms, enantiomers (STINSON,1998). As a conse-
0 up- and downstream processing, quence, the need for enantioselective technol-
0 competition with (in-house) chemical ogies is also increasing, and companies as well
methods/established processes, as academia are making considerable efforts
0 time requirements for process develop- to develop efficient synthetic routes including
ment, biocatalysis and biotransformations.
0 wastewater treatment, solvent disposal, A considerable proportion of successful ex-
0 legislation/approval of the process or amples for the enzymatic synthesis of optically
product, pure intermediates is based on the action of li-
0 public perception. pases. This is not surprising keeping in mind
that lipases probably represent the most easy-
All these factors determine whether a biocata- t o m e enzymes for organic synthesis. They do
lytic route is superior to a chemical one and not require any cofactors, a wide range of en-
the final decision has to be made case-by-case. zymes from various sources are commercially
ROZZELL(1999) pointed out five commonly available, and they are active and stable in or-
held ideas (myths) about enzymes (too expen- ganic solvents. In contrast to many other en-
sive, too unstable, productivity is low, redox zymes, they accept a huge range of non-natu-
factors cannot be recycled, they do not cata- ral substrates, which are often converted with
lyze industrially interesting reactions). Indeed, high stereoselectivity. Structures of 12 lipases
the examples shown in his publication as well have been elucidated, and this might make the
as those shown here, clearly demonstrate that design of tailor-made biocatalysts feasible.
these myths are rather misconceptions. Properties and applications of lipases are doc-
umented in several thousand publications, and
readers are referred to a number of recent re- lipase catalyzes hydrolysis of the unwanted
views (JAEGERand IZEETZ,1998; SCHMIDand (-)-MPGM to the acid, which then passes
VERGER,1998), book sections (KAZLAUSKASthrough the membrane into an aqueous phase.
and BORNSCHEUER, 1998; BORNSCHEUER and Spontaneous decarboxylation of the acid
KAZLAUSKAS, 1999), or books (WOOLLEY and yields an aldehyde which reacts with the bisul-
PETERSEN, 1994) for further reading. fite in the aqueous phase. In the absence of bi-
sulfite, this aldehyde deactivates the lipase.
The desired (+)-MPGM remains in the to-
2.1 Diltiazem luene phase and circulates back to the crystal-
lizer where it crystallizes. Lipase activity drops
Both DSM-Andeno (Netherlands) and Ta- significantly after eight runs and the mem-
nabe Pharmaceutical (Osaka, Japan) in collab- brane must be recharged with additional lip-
oration with Sepracor (Marlborough, MA) ase. Although the researchers detected no
have commercialized lipase-catalyzed resolu- lipase-catalyzed hydrolysis of ( - )-MPGM,
+
tions of ( )-(2S,3R)-truns-3-(4-methoxy-phe- chemical hydrolysis lowered the apparent
ny1)-glycidic acid methylester (MPGM), a key enantioselectivity to E = 135 under typical re-
precursor to diltiazem (HULSHOFand Ros- action conditions.The yield of crystalline ( + )-
KAM, 1989;MATSUMAE et al., 1993,1994;FURUI (2R,3S)-MPGM is > 43% with 100% chemical
et al., 1996). The DSM-Andeno process uses and enantiomeric purity.
lipase from Rhizomucor miehei (RML), while
the Tanabe process uses a lipase secreted by
Serrutiu marcescens Sr41 8000. In both cases 2.2 Amines
the lipase catalyzed hydrolysis of the unwant-
ed enantiomer with high enantioselectivity BASF produces enantiomerically-pure
(E > 100).The resulting acid spontaneously de- amines using a Pseudomonas lipase-catalyzed
composes to an aldehyde (Fig. 1). acylation (BALKENHOHL et al., 1997). A key
In the Tanabe process, a membrane reactor part of the commercialization of this process
and crystallizer combine hydrolysis, separa- was the discovery that methoxyacetate esters
tion, and crystallization of ( +)-(2R,3S)- reacted much faster than simple esters. Acti-
MPGM. Toluene dissolves the racemic sub- vated esters are not suitable due to a compet-
strate in the crystallizer and carries it to the ing uncatalyzed acylation (Fig. 2). In the case
membrane containing immobilized lipase. The of ( R ) or (S)-1-phenylethylamine, classical
COOMe
lipase from + ""F)H + MeOH
"'"0
n H \ A o Serratia marcescens
toluene-water/NaHSOs MeO O OMe

racemic membrane reactor (+)-(PR,3S)-MPGM
I
trans-isomer
3steps
OMe
+ CO,
Me0
Fig. 1. Commercial synthesis of diltiazem by Tanabe Pharmaceutical uses a kinetic resolution

catalyzed by lipase from Serratia marcescens.
0 0
L O M e NH2
c + x
R
-
Pseudomonas sp. lipase
IR-,
racemate
R = H, 4-Me,3-OMe
Fig. 2. Large-scale resolution of amines involves a Pseudomonas sp. lipase and methoxyacetic acid deriva-
tives.
resolution via diastereomeric salts yielded at 2.4 7-Aminocephalosporanic Acid

best an enantiomeric ratio of 98:2, whereas the
biocatalytic product contains less than 0.25% The enzymatic production of 7-aminoceph-
of the opposite enantiomer. In a similar man- alosporanic acid (7-ACA) represents an im-
ner a wide range of other amines is resolved. pressive example, where the biocatalytic route
The process is run in a continuous manner us- was highly superior to the well-established
ing immobilized lipase in a fixed-bed reactor chemical synthesis. Whereas an enzymatic
and without additional solvents with an annu- route to the closely related 6-aminopenicillan-
al production capacity of > 2,000 metric tons. ic acid (6-APA), a key precursor for the syn-
thesis of semi-synthetic penicillins,was well es-
tablished in the early 1970s and relies on the
2.3 6-AminopenicillanicAcid action of penicillin G amidase (see Fig. 3), no
enzymatic method could be found for 7-ACA.
Penicillin G acylase (PGA, penicillin amid- The biocatalytic route was developed by
ase; for reviews, see BALDARO et al., 1992;TUR- Hoechst researchers and is currently conduct-
NER,1998) catalyzes hydrolysis of the phenyl- ed at Biochemie GmbH (Austria). Two en-
acetyl group in penicillin G (benzylpenicillin) to zymes are involved in the transformation of
give 6-aminopenicillanic acid (6-APA) (Fig. 3). cephalosporin C to 7-ACA (Fig. 4) (CONLON et
Penicillin G acylase also cleaves the side al., 1995; BAYERand WULLBRANDT, 1999). In
chain in penicillin V, where the phenylacetyl the first step, an immobilized D-amino acid ox-
group is replaced by a phenoxyacetyl group. idase (EC 1.4.3.3) converts cephalosporin C to
The commercially available enzymes are de- a-keto-adipinyl-7-ACA. Hydrogen peroxide
rived from E.coli strains. Both penicillin G and generated during this step is directly con-
V are readily available from fermentation, so sumed in the decarboxylation to yield glutaryl
penicillin manufacturers carry out a PGA-cat- 7-ACA. Finally, glutaric acid is cleaved by the
alyzed hydrolysis to make 6-APA on a scale of action of an immobilized glutaryl amidase (EC
approximately 5,000 metric tons per year 3.5.1.3) yielding 7-ACA. The commercial suc-
(MATSUMOTO, 1992). They use 6-APA to pre- cess was mainly based on ecological reasons. In
pare semi-synthetic penicillins such as ampicil- contrast to the chemical route, no toxic sub-
lin, where a D-phenylglycine is linked to the stances are produced and the wastewater is
free amino group of 6-APA, or amoxicillin, readily biodegradable. Thus the amount of
where a D-4-hydroxyphenylglycine is linked. waste to be treated was reduced from 31 met-
penicillin G 6-APA
Fig. 3. Commercial process for the production of 6-APA from penicillin G using penicillin G acylase.
NH3 H202
o-amino acid
oxidase
COOH 0
cephalosporinC
a-keto-adipinyl-7-ACA
I - glutaric
glutaryl arnidase
acid e & o y c H 3
0
COOH 0
glutaryl-7-ACA
Fig. 4. Biocatalytic route to 7-amino cephalosporanic acid.
ric tons (chemical synthesis) to 0.3 metric tons selectivity toward Naproxen, this esterase is
(enzymatic route) in the production of 1 met- abbreviated in most references as carboxyl-
ric ton of 7-ACA. The cost share for environ- esterase NP. It has a molecular weight of 32
mental protection on the total process costs kDa, a pH optimum between pH 8.5-10.5, and
was reduced from 21% to only 1% (BAYER a temperature optimum between 35-55 "C.
and WULLBRANDT, 1999). Carboxylesterase NP is produced as intracel-
lular protein; its structure is unknown.
Although the process gave (S)-naproxen
2.5 Naproxen with excellent optical purity (99% ee) at an
overall yield of 95%, it has not reached com-
Although a wide range of esterases (EC mercialization.
qo/
3.1.1.1) has been described in the literature
(for reviews, see PHYTIAN,1998; BORN-
SCHEUER and KAZLAUSKAS, 1999),their indus- Me0
trial application is very limited. This is mostly
due to the restricted availability of esterases
/ \
(R,S)-naproxenmethylester
compared to lipases (with the exception of pig
liver esterase). Another exception is carboxylesterase NP getion
pH 9.0,40°C
esterase NP, which was originally isolated from
aoH
Bacillus subtilis (strain Thail-8) and was cloned
and expressed in B. subtilis (QUAX and BROEK-
HUIZEN, 1994). The esterase shows very high Me0 + Me0
activity and stereoselectivity towards 2-aryl-
propionic acids, which are, e.g., used in the syn- (S)-naproxen (R)-naproxen methylester
99% ee, 95% overall yield
thesis of (S)-naproxen - (+)-(S)-2-(6-meth-
oxy-Znaphthyl) propionic acid - a non- Fig. 5. Synthesis of (S)-naproxen by kinetic resolu-
steroidal anti-inflammatory drug (Fig. 5). (S)- tion of the (R,S)-methyl ester with carboxylesterase
naproxen is ca. 150-times more effective than NP followed by chemical racemization of the (R)-
(R)-naproxen, the latter also might promote naproxen methylester (QUAX and BROEKHUIZEN,
unwanted gastrointestinal disorders. Due to its 1994).
In contrast, Chiroscience (UK) commercial- hydrine on a multi-ton scale. The product is an

ized the resolution of the ethylester of naprox- important precursor for the synthesis of pyr-
en at ton scale, in which another recombinant ethroids such as (S, S)-fenvalerate and delta-
esterase is used (BROWN et al., 1999). methrin (Fig. 6). The (S)-oxynitrilase ex-
pressed recombinantly in the yeast Pichia pas-
toris presumably originates from Hevea brasi-
2.6 Pyrethroid Precursors liensis and is produced by Roche Diagnostics
(Penzberg, Germany).
2.6.1 Via Oxynitrilases
Oxynitrilases (also named hydroxynitrile ly- 2.6.2 Via a Monooxygenase
ases, HNL) comprise a group of enzymes
which are capable of creating a carbonxarbon BASF has commercialized a process in
bond utilizing HCN as donor and an aldehyde which (R)-2-phenoxypropionic acid is selec-
(or ketone) as acceptor (BUNCH,1998).Initial- tively hydroxylated to (R)-2-(4-hydroxyphen-
ly, enzymes isolated from various plant sources 0xy)propionic acid (H-POPS). H-POPS is an
such as cassava, Sorghum bicolor, and Hevea intermediate in the synthesis of optically pure
sp. had been employed. In recent years, espe- herbicides of the aryloxyphenoxypropionate
cially the groups of EFFENBERGER (Stuttgart, type. Out of 7,900 strains tested, the fungus
Germany) and GRIENGL(Graz, Austria) suc- Beauveria bassiana was identified (Fig. 7).
cessfully cloned the genes encoding either ( S ) - Considerable effort was spent for strain im-
or (R)-specific HNLs into heterologous hosts provement by mutagenesis to increase produc-
thus making the enzymes available at compet- tivity as well as tolerance of the microorgan-
itive prices and in sufficient amounts (WAJANT ism towards high substrate and product con-
et al., 1994; EFFENBERGER, 1 994; WAJANTand centrations. Thus productivity was increased
EFFENBERGER, 1996; HASSLACHER et al., 1997; from 0.2 g L-l d-l to 7 g L-l d-'.
JOHNSON and GRIENGL, 1998).
A process based on a HNL-catalyzed reac-
tion was developed by DSM in collaboration
with the university of Graz. A prerequisite for
a successful commercialization was the usage
of an already existing plant, which allowed a
safe handling of HCN. Currently, DSM is pro- Fig. 7. Synthesis of (R)-2-(4-hydroxyphenoxy)pro-
ducing (S)-m-phenoxybenzaldehyde cyano- pionic acid by BASF uses Beauveria bassiana.
NC. A
(S, S)-fenvalerate
(8-HNL from
+ HCN Hevea brasiieiensis-
Br
Fig. 6. Synthesis of pyrethroid precursors using a hydroxynitrilase(NHL) from Hevea brusiliensis.

2 Enantiomerically Pure pharmaceutical Intermediates 283
2.6.3 Via Esterase "-prxok PPL, E=13_ pprTol + HO, I
( + )-trans-( 1R,3R) chrysanthemic acid is an 0

(R,S)-glycidyl
0
(R)-glycidyl
oi
(3-glycidol
important precursor of pyrethrin insecticides. butyrate bulyrate
An efficient kinetic resolution starting from
the ( f)-cis-trans ethylester was achieved us- Fig. 9. Resolution of glycidol butyrate by DSM-An-
ing an esterase from Arthrobacter globiformis den0 using porcine pancreatic lipase (PPL).
resulting in the sole formation of the desired
enantiomer (> 99% ee, at 77% conversion)
(Fig. 8). The enzyme was purified and the gene Other groups described resolution of epox-
was cloned in E. coli (NISHIZAWA et al., 1993). ides using an epoxide hydrolase or by microbi-
In a 160 g scale process reported by Sumitomo al degradation. Researchers at Daiso, Japan,
researchers, hydrolysis is performed at pH 9.5 discovered an (R)-2,3-dichloro-l-propanol as-
at 50 "C.Acid produced is separated through a similating bacterium, Pseudomonas sp. OS-K-
hollow-fiber membrane module and the ester- 29 and a (S)-selective strain from Alcaligenes
ase was very stable over four cycles of 48 h sp. DS-K-S38 (Fig. 10). Both strains exhibited
(NISHIZAWA et al., 1995). It is unclear, whether excellent selectivity and allowed for the isola-
the process is currently run on an industrial tion of 50% remaining substrate having either
scale. (S) or @)-configuration (KASAIet al., 1990,
1992a,b). Although one enantiomer is lost, it is
Arthrobacter claimed that the fermentative process estab-
globiforrnis
esterase
lished in 1994 is cost-effective (KASAIet al.,
COOEt,
-~~~ *CCOH 1998). In a similar manner, 3-chloro-1,2-pro-
(+)-cis-trans- (+)-transchrysanthemic pane diol can be selectivelydegraded by micro-
chrysanthemic acid acid (>99% ee)
organisms, and a fermentation process has
Fig. 8. Synthesis of (+)-trans chrysanthemic acid by been developed on an industrial scale at Daiso
kinetic resolution of the ethylester using an esterase (SUZUKIand KASAI,1991; SUZUKIet al., 1992,
from Arthrobacter globiformis. 1993).Further examples for industrial-scale bi-
ocatalysis by dehalogenases have recently
been reviewed (SWANSON, 1999).
_
2.7 Production of Chiral C,
Building Blocks
C l y O H Pseudomonassp. CI-OH
CI d
Optically active C , compounds are versatile 100% ee, 38%
building blocks for organic synthesis, and the
most important ones are epichlorohydrin, 3- C I T O H Alcaligenes sp. CI-OH
chloro-1,2-propane diol, and glycidol. Stereo- OH OH
selective synthesis can be performed by chem- >99% ee. 40-45%
ical means (e.g., using the Jacobsen-Katsuki
catalyst, Sharpless epoxidation, or D-manni- Fig. 10. Microbial resolution of C,-building blocks
tol), as well as by a range of biocatalytic routes. by Daiso, Japan.
KASAIet al. (1998) provide an excellent over-
view for both approaches.
For instance, DSM-Andeno (Netherlands) 2.8 Other Pharmaceutical
produce (R)-glycidol butyrate using porcine Intermediates
pancreatic lipase (Fig. 9) by kinetic resolution,
but they did not reveal details of the process Glaxo developed a process to resolve (lS,
(LADNERand WHITESIDES, 1984; KLOOSTER- 2S)-trans-2-methoxy cyclohexanol, a secon-
MAN et al., 1988). Several groups have since dary alcohol for the synthesis of a tricyclic p-
studied this reaction and its scale-up in more lactam antibiotic (STEADet al., 1996).The slow
detail (WALTSand Fox, 1990; Wu et al., 1993; reacting enantiomer needed for synthesis is re-
VAN TOLet a]., 1995a, b). covered in 99% ee from an acetylation of the
racemate with vinyl acetate in cyclohexane. Researchers reported a number of other

Immobilized lipase B from Candida antarctica kilogram scale routes to pharmaceutical pre-
(CAL-B) and lipase from Pseudomonas cursors that involve lipases. Selected examples
fluorescens (PFL) both showed high enantio- are summarized in Fig. 12.
selectivity, but CAL-B was more stable over Other carboxylic acids are also important
multiple use cycles. Other workers had re- intermediates in the synthesis of pharmaceuti-
solved this alcohol by hydrolysis of its esters cals. Researchers have published kilogram-
with lipase from Pseudomonas cepacia (PCL), scale resolutions by using proteases (Fig. 13).
Candida rugosa (CRL), or pig liver acetone Chiroscience (UK) also established a pro-
powder (LAUMENet al., 1989; HONIG and cess for the large-scale production of a key
SEUFER-WASSERTHAL, 1990; BASAVAIAH and intermediate for the synthesis of the reverse
KRISHNA, 1994),but Glaxo chose resolution by transcriptase inhibitor Abacavir (Ziagen). The
acylation of the alcohol because it yields the process relies on a recombinant p-lactamase
required slow-reacting alcohol directly (Fig. yielding the required ( -)-lactam in > 98% ee
11). (E > 400) and is operated by Glaxo-Wellcome
(Fig. 14) (BROWN et al., 1999).
CAL-B,37 s/L
vinyl acetate, 1.7 M
triethylamine, 0.16 M
\,.OMe cyclohexane, 6-8 h .
racemic >99% ee antibiotic
36% yield
Fig. 11. Glaxo resolves a building block for antibiotic synthesis.
HO, ,OBn
OAc *OMe
A for cafbovir, an anti-HIV agent COOnPr

for side chain of taxol, enantiomer used for anti- PCL, E = 32 - 68
an anti-cancer drug hypercholestemicagents isopropenylacetate
PATEL et al. (1994) MACKEITH et al. (1993, 1994) SIH(1996), HENEGAR et al. (1997)
U
Jy30
H H
HOzC CI
elastase inhibitor
experimental treatment LTD4 antagonist for asthma treatment
for cystic fibrosis (did not pass clinical trials)
CVETOVICH et al. (1996) HUGHES et al. (1989, 1990)
for a thromboxane A2
4 OBn
CRL, vinyl acetate for antifungal agent
antagonist configuration at '*'set by synthesis SAKSENA et al. (1995)
PATEL et al. (1992) MORGAN et al. (1997) MORGAN et al. (1997)
Fig. 12. Kilogram-scale routes to pharmaceutical precursors involving lipases.

3 AminoAcids 285
I subtilisin
renin inhbitors
MAZDIYASNIet al. (1993)
0
P h H X p N > N
L o X R ‘COOH
subtiliiin subtilisin PGA
for renin inhibitors for a colhgenase inhibitor for p-lactam antibiotic
DOSWALD et al. (1994) WIRZand SOUKUP (1997) ZUIJEWSKI et al. (1991)
Fig. 13. Kilogram-scale routes to pharmaceutical precursors involving proteases or

amidases.
0
Fig. 14. Process for the resolution of (-)-lactarn
( k )-2-azabicyclo[2.2.1]hept-5-en-3- >98% ee HOI Abacavir
one using enantiocomplementary H
..
p-lactamases. The enzyme (*)-lactarn
furnishing the ( -)-lactam has been
cloned and is currently used in a
multi-ton scale process for the pro- H
duction of an Abacavir intermedia- (+)-lactarn
te. >98% ee
3 AminoAcids 3.2 Non-Natural Amino Acids

In principle, some of the routes developed
3.1 Natural Amino Acids for the production of L-amino acids can also be
applied for the synthesis of non-natural amino
A wide range of naturally occumng (protein- acids which consist of either natural amino ac-
ogenic) L-amino acids are currently produced ids, but in the D-configuration or non-protein-
by biotransformation. Especially in Japan, sev- ogenic amino acids (usually also in the D-con-
eral L-amino acids are produced by fermenta- figuration). The most prominent examples are
tion (see Chapter 8, this volume). For instance, D-phenylglycine and D-4-hydroxyphenylglyc-
L-glutamic acid is produced annually at the ine, which are precursors of the semi-synthetic
300,000 metric ton scale by Ajinomoto, Japan, penicillins Ampicillin and Amoxicillin and are
using Corynebacterium glutamicum. On the currently produced in a hydantoinasekarba-
other hand, L-amino acids can be produced moylase process at a >1,000 tonnes per year
from chemically synthesized racemic mixtures scale (see also Sect. 2.3).
by kinetic resolution of, e.g., N-acetyl deriva- Most non-natural amino acids are produced
tives (see also Sect. 3.2). L-Aspartate is prod- commercially via acylase-, hydantoinase- and
uced by Tanabe Seiyaku and Kyowa Hakko amidase-catalyzed routes (for reviews, see
Kogyo (both Japan) from fumaric acid using BOMMARIUS et al., 1992; KAMPHUISet al.,
an aspartate ammonia lyase as catalyst. 1992). A few examples are shown in Fig. 15.
286 6 IndustrialBiotransformations
Acylase-catalyzed routes are best for the synthesis of 4-methylthio- and 4-methylsulfo-
L-amino acids because acylases favor the nyl substituted (2S,3R)-3-phenyIserines, (S)-
L-enantiomer. Racemization of unreacted +
( )-cericlamine or L-methylphenylalanine
N-acyl derivative of the D-amino acid avoids (VANDOORENand VAN DEN TWEEL,1992; VAN
wasting half of the starting material. Hydanto- DEN TWEELet al., 1993; KAPTEINet al., 1994,
inase-catalyzed routes are best for producing 1995,1998;SCHOEMAKER et al., 1996).
D-amino acids because the most common hyd- Chiroscience (UK) has scaled up the dy-
antoinases favor the D-enantiomer. Amidase- namic kinetic resolution of (S)-tert-leucine, an
catalyzed resolutions are best for unusual intermediate for the synthesis of conforma-
amino acids whose derivatives are not sub- tionally restricted peptides and chiral auxiliar-
strates for acylases or hydantoinases. For ex- ies (TURNERet al., 1995; McCague and TAY-
ample, a-alkyl-a-amino acids are resolved by LOR,1997). However, the only commercialized
amidases as are the cyclic amino acids 2-piper- route is a process by Degussa (Hanau, Germa-
idine carboxylic acid (pipecolic acid) and pi- ny) utilizing a leucine dehydrogenase. The
perazine-2-carboxylic acid. Amidases usually NADH consumed during the reductive amina-
favor the natural L-enantiomer. tion of the a-keto acid is recycled with a for-
NSC Technologies has succeeded in produc- mate dehydrogenase/ammonium formate sys-
ing D-phenylalanine and D-tyrosine on a multi- tem. Recycling of the cofactor allows for total
ton scale.The biocatalytic route is based on the turnover numbers in the range of >lO,OOO
shikimic acid metabolic pathway and relies on making the process cost-effective (BOMMA-
a D-transaminase acting on phenylpyruvic acid RIUS et al., 1992,1995).
(STINSON, 1998).
Kyowa Hakko Kogyo researchers also re-
ported the synthesis of D-alanine using a D,L- 3.3 Aspartame
alaninamide hydrolase found in Arthrobacter
sp. NJ-26 (YAGASAKIand OZAKI, 1998). The largest scale application (hundreds to
D-Glutamate is produced by the same compa- thousands of tons) of protease-catalyzed pep-
ny starting from cheap L-glutamate. A combi- tide synthesis is the thermolysin catalyzed syn-
nation of a glutamate racemase (from Lacto- thesis of aspartame, a low calorie sweetener
bacillus brevis ATCC8287) and an L-glutamate (Fig. 16) (ISOWA et al., 1979; OYAMA,1992; see
decarboxylase (from E. coli ATCC11246) al- Chapter 2, this volume). Precipitation of the
lowed the synthesis of D-glutamate (99% ee) product drives this thermodynamically con-
at 50% yield by a two-step fermentation. In a trolled synthesis. The high regioselectivity of
similar manner D-proline can be produced thermolysin ensures that only the a-carboxyl
(YAGASAKI and OZAKI,1998). group in aspartate reacts. Thus, there is no
Researchers at DSM (The Netherlands), de- need to protect the P-carboxylate. The high
scribed a new amidase activity discovered in enantioselectivity allows Tosoh to use racemic
Ochrobactrum anthropi NCIMB 40321, which amino acids; only the L-enantiomer reacts.
accepts a,a-disubstituted amino acids as sub-
strates. The amidase gene was successfully
cloned and overexpressed in a host organism,
allowing the application of the enzyme in a
commercial process, probably dealing with the
acylase hydantoinase arnidase arnidase

BOMMARIUS
et al. (1992) BOMMARIUS
et al. (1992) KAMPHUIS
et al. (1992) EICHHORNet al. (1997)
Fig. 15. Examples of non-natural amino acids produced via acylase, hydantoinase,or amidase.
coo0
G
HYCbz O H + H3'+o~e thermolysin - HYCbz
4 ' Oph>
1 0 M e + OMe
0 Ph Ph
excess insoluble
Fig. 16. Commercial process for the production of aspartame (a-L-aspartyl-L-phenylalan-

ine methyl ester).
4 Other Applications in whole cell preparations. Furthermore, the

nitrile hydrolyzing activity must be induced
first. .
4.1 Acrylamide/Nicotinamide Two applications based on nitrile hydratase
in Rhodococcus rhodochrous originally isolat-
Although nitriles can also be hydrolyzed to ed by Yamada's group (NAGASAWA and YAMA-
the corresponding carboxylic acid by strong DA,1995) have been commercialized.The large
acid or base at high temperatures, nitrile hy- production of the commodity chemical acryla-
drolyzing enzymes have the advantages that mide (Fig. 18) is performed by Nitto Chemical
they require mild conditions and do not pro- (Yokohama, Japan) on a > 30,000 metric tons
duce large amounts of by-products. In addi- per year scale. Initially,strains from Rhodococ-
tion, during hydrolysis of dinitriles, they are of- cus sp. N-774 or Pseudornonas chlororaphis
ten regioselective so that only one nitrile B23 were used, however the current process
group is hydrolyzed and they can be used for uses the 10-fold more productive strain R. rho-
the synthesis of optically active substances. dochrous J1. The productivity is >7,000 g
The enzymatic hydrolysis of nitriles follows acrylamide per g cells at a conversion of acry-
two different pathways (Fig. 17). Nitrilases lonitrile of 99.97%. Formation of acrylic acid is
(EC 3.5.5.1) directly catalyze the conversion of barely detectable at the reaction temperature
a nitrile into the corresponding acid plus am- of 2-4 "C. In laboratory-scale experiments with
monia. In the other pathway, a nitrile hydrat- resting cells up to 656 g acrylamide per liter re-
ase (NHase, E C 4.2.1.84; a lyase) catalyzes the action mixtures were achieved (KOBAYASHI et
hydration of a nitrile to the amide, which may al., 1992).
be converted to the carboxylic acid and ammo- One of the most important characteristics of
nia by an amidase (EC 3.5.1.4) (BUNCH,1998). the R. rhodochrous strain is its tolerance to-
Both pathways occur in the biosynthesis of ward high concentrations of acrylamide (up to
the phytohormone indole-3-acetic acid from 50%). Induction of NHase activity is per-
indole-3-acetonitrile for a nitrilase from Alcal- formed using urea resulting in more than 50%
igenes faecalis JM3 (KOBAYASHI et al., 1993) of high molecular weight NHase of the total
and for the nitrile hydratase/amidase system in soluble protein. Cobalt ions are essential to get
Agrobacteriurn turnefaciens and Rhizobium sp. active NHase. Besides acrylamide, a wide
(KOBAYASHI et al., 1995). range of other amides can also be produced,
Pure nitrilases and nitrile hydratases are e.g., acetamide (150 g L-'), isobutyramide
usually unstable; so most researchers use them (100 g L-l), methacrylamide (200 g L-'),
propionamide (560 g L-'), and crotonamide
(200 g L-l) (KOBAYASHI et al., 1992).
- Furthermore, R. rhodochrous J1 also accepts
rRCIOINH2
1
nitrilase
RCN RCOOH + NH3 aromatic and arylaliphatic nitriles as sub-
strates. For instance, also the conversion of
hydratase amidase
3-cyanopyridine to nicotinamide (a vitamin in
animal feed supplementation, Fig. 18) is cata-
Fig. 17. Hydrolysis of nitriles follows two different lyzed (NAGASAWA et al., 1988), which was in-
pathways. dustrialized by Switzerland's Lonza on a 3,000
metric tons per year scale in their plant in 4.2 L-Carnitine

Guangzhou, China. In contrast to the chemical
process, no formation of the by-product nico- L-Carnitine [(R)-3-hydroxy-4-(trimethylam-
tinic acid is observed using the nitrile hydrat- monio)butanoate] belongs to a group of vita-
ase system. min-like nutrients. L-Carnitine plays an essen-
DuPont researchers described a route to tial role in the @-oxidationof long-chain fatty
1,5-dimethyl-2-piperidone from 2-methylglu- acids by mitochondria and is synthesized in the
taronitrile (MGN). MGN is first hydrolyzed to human liver from lysine and methionine. In-
4-cyanopentanoic acid ammonium salt using sufficient production causes muscle weakness,
immobilized cells of Acidovorax facilis 72W fatigue, and elevated levels of triglycerides in
(ATCC55746) which contain a nitrilase. The the blood. Besides its use in infant, health,
selectivity of this biocatalyst is > 98% yielding sport and geriatric nutrition, it might also lead
the desired monoacid as major product in to enhanced growth rates in the animal feed
concentrations between 150-200 g L-', which sector. Because D-carnitine competes with the
after chemical hydrogenation furnishes the de- L-form for active transport into the eukaryotic
sired product. Compared to the chemical cell, the pure L-enantiomer is required for use
route, the biocatalytic approach yields a single in the medical, nutritional and feed applica-
lactam product, less waste, and higher overall tions of carnitine. Several routes to L-carnitine
yields (DICOSIMOet al., 1997; GAVAGAN et al., have been described in the literature including
1998). resolution of racemic mixtures (see ZIMMER-
MANN et al., 1997, and references cited there-
in). For instance, researchers at Daiso, Japan,
reported a route starting from optically pure
epichlorohydrin (KASAIand SAKAGUCHI, 1992;
0 KASAI et al., 1998). However, it is unclear
acrylonitrile acrylamide whether the process has been commercialized.
Another access by Italians Sigma-Tau might
be based on the reduction of y-chloroacetoac-
etate ester to (R)-y-chloro-P-hydroxy butan-
oate mediated by a P-ketoreductase from Suc-
Scyano pyridine nicotinamide. a vitamin
charomyces cerevisiae.
Large-scale production by Lonza (Switzer-
Fig. 18. Commercial production of acrylamide and land) starts from easily available butyrobe-
nicotinamide using resting cells of Rhodococcus rho- taine which is converted in a multi-enzyme re-
dochrous J1. action to L-carnitine (Fig. 19) (ZIMMERMANN
ATP, CoA AMP + PPi
Me&
, -' M e 3 6 y S c o A
synthetase
0 0
butyrobetaine 4- butyrobetainyl-CoA
dehydrogenase
FADHp
-
H20
Me&
,-'
OH 0 hydrolase 0 ATP 0
(Rj-carnitine (100% ee) crotonobetainyl-CoA crotonobetaine
Fig. 19. Biocatalytic route to L-carnitine.

et al., 1997). The initially found most active tional properties and enzymatic synthesis of
strain (HK4) was related taxonomically to the structured triglycerides.
soil microorganisms Agrobacterium and Rhi-
zobium. For large-scale production, a strain
improvement program was undertaken with 4.3.1 Cocoa Butter Equivalents
the aim to increase the tolerance of the strain
towards high concentrations of substrates and Cocoa butter is predominantly 1,3-disatu-
products. In addition, a dehydrogenase activity rated-2-oleyl-glyceride,where palmitic, stearic
was irreversibly inactivated by frame shift mu- and oleic acids account for more than 95% of
tation to avoid degradation via undesired the total fatty acids. Cocoa butter is crystalline
metabolic pathways. The thus obtained strain and melts between 25 and 35 “C imparting the
(HK1349) quantitatively converts 4-butyrobe- desirable “mouth feel”. Unilever (COLEMAN
taine (and crotonobetaine) into L-carnitine and MACRAE,1977) and Fuji Oil (MATSUOet
(100% ee), which is excreted into the medium. al., 1981) filed the first patents for the lipase-
Maximum productivity is in the range of 100 g catalyzed synthesis of cocoa butter equiva-
L-’. Although a fed-batch process gives lower lents. Both companies currently manufacture
productivity, this route was chosen due to an cocoa butter equivalents on a multi-ton scale
easier downstream processing and lower in- using 1,3-selective lipases to replace palmitic
vestment costs. Researchers at Lonza also de- acid with stearic acid at the sn-1 and sn-3 posi-
veloped a recombinant production strain; tions (for reviews, see MACRAE, 1983;MACRAE
however, this one is not yet used in the process. and HAMMOND, 1985; QUINLAN and MOORE,
1993). The Unilever subsidiary Quest-Loders
Croklaan (The Netherlands) uses RML and
4.3 Lipid Modification palm oil mid fraction or high oleate sunflower
oil as starting materials (Fig. 20). Other suit-
Already in the early 1970s,the application of able starting oils are rape seed (ADLER-
lipases for the modification of their natural CREUTZ,1994) or olive oils (CHANGet al.,
substrates - fats and oils - was exploited by 1990).
many researchers in industry and academia.
Although strong efforts were undertaken to
use lipases to obtain free fatty acids by hydrol- 4.3.2 Other Structured Lipids
ysis or to produce monoglycerides by glycerol-
ysis, these enzymatic processes were never ef- Another structured triglyceride is Betapol, a
fective enough to compete with well estab- formula additive for premature infants. Hu-
lished chemical methods. Current processes man milk contains the more easily digested
rather exploit 1,3-regiospecificityof lipases to OPO, but vegetable oils contain the P O 0 iso-
produce so-called structured triglycerides mer (OPO: 1,3-dioley1-2-palmitoyl glyceride,
(ST). ST are triglycerides modified in either POO: mixture of 1,2-dioley1-3-palmitoylglyc-
the type of fatty acid or the position of the fat- eride and its enantiomer). Interesterification
ty acids and the most prominent examples are of tripalmitin with oleic acid using RML at low
cocoa butter equivalents and ABA lipids (tri- water activity yields OPO. Evaporation re-
glycerides with fatty acids A at sn-1 and sn-3 moves excess fatty acids and crystallization re-
and fatty acid B at sn-2-position). CHRISTOPHE moves remaining PPP. Betapol is currently
(1998) provides an excellent overview of nutri- produced by a Unilever subsidiary.
2
oc16:o
EocIB:~+ 3 c18:O 1,3-selectivelipase*
m16:O
E m j R l + EE::; + 3c16:o
OC160 ~ 1 8 : O m1eo
palm oil fraction coma butter equivalent
Fig. 20. Lipase-catalyzed synthesis of cocoa-butter equivalent.

Other processes under development focus (1995), Synthesis and use of enantiomerically
on the enrichment or isolation of polyunsatu- pure tert-leucine, Tetrahedron: Asymmetry 6,
rated fatty acids such as eicosapentaenoic acid 2851- 2888.
(EPA) or docosahexaenoic acid (DHA) from BORNSCHEUER, U. T. (1998), Directed evolution of
enzymes, Angew. Chem. (Int. Edn. Engl.) 37,
fish oil. Diets supplemented with EPA or 3105-3108.
DHA in the triglycerides are reported to show BORNSCHEUER, U. T., KAZLAUSKAS, R. J. (1999), Hy-
a range of nutritional benefits. drolases in Organic Synthesis - Regio- and Stereo-
selective Biotransformations. Weinheim: Wiley-
VCH.
Acknowledgements BROWN, R. C.,TAYLOR,S. J. C.,TAYLOR, I. N., KEENE,
The author thanks Dr. P. RASOR(Roche Diag- P.A., BAUER,S. (1999), Different cloning approa-
nostics, Penzberg, Germany), Dr. J. PETERS ches for industrially useful biocatalysts,Abstract
(Bayer AG, Wuppertal, Germany), Dr. B. Book, Biotrans '99Conference, Taormina,Italy.
BUNCH,A. (1998), Nitriles, in: Biotechnology 2nd
HAUER(BASF AG, Ludwigshafen, Germany), Edn., Vol. 8a (REHM,H.-J., REED,G., WHLER,A.,
Dr. A. KIENER(Lonza,Visp, Switzerland), and STADLER, P., Eds.), pp. 277-324. Weinheim: Wiley-
Prof. R.J. KAZLAUSKAS (McGill University, VCH.
Montreal, Canada) for their support during CHANG, M. K., ABRAHAM, G., JOHN,V. T. (1990), Pro-
preparation of the manuscript. duction of cocoa butter-like fat from interesterifi-
cation of vegetable oils, J. Am. Oil Chem. SOC.67,
832-834.
CHRISTOPHE, A. B. (Ed.) (1998), Structural Modified
Food Fats: Synthesis, Biochemistry, and Use.
5 References Champaign, ILAOCS Press.
COLEMAN, M. H., MACRAE,A.R. (1977), Rearrange-
ment of fatty acid esters in fat reaction reactants,
ADLERCREUTZ. F! (1994). Enzvme-catalvzed b i d German Patent DE 2 705 608 (Unilever N.V.)
modification, Bibtechnol. &net. En; Rev. L12, (Chem.Abstr.87,166 366).
231-254. COLLINS,A. N., SHELDRAKE, G. N., CROSBY, J. (Eds.)
ARNOLD, F. H. (1998), Design by directed evolution, (1992), Chirality in Industry I. New York John
Acc. Chem. Res. 31,125-131. Wiley & Sons.
BALDARO, E., FUGANTI, C., SERVI,S., TAGLIANI, A., COLLINS,A. N., SHELDRAKE, G. N., CROSBY, J. (Eds.)
TERRENI, M. (1992),The use of immobilized pen- (1997), Chirality in Industry IZ. Chichester: John
icillin G acylase in organic synthesis, in: Microbial Wiley & Sons.
Reagents in Organic Synthesis (SERVI,S., Ed.), pp. CONLON,H. D., BAQAI,J., BAKER,K., SHEN,Y. Q.,
175-188. Dordrecht: Kluwer Academic. WONG,B. L. et al. (1995), Tko-step immobilized
BALKENHOHL, F., DITRICH,K., HAUER,B., LADNER, enzyme conversion of cephalosporin C to 7-amin-
W. (1997), Optically active amines via lipase-cata- ocephalosporanic acid, Biotechnol. Bioeng. 46,
lyzed methoxyacetylation, J. Prakt. Chem. 339, 51&513.
381-384. CVETOVICH, R. J., CHARTRAIN, M., HARTNER, F. W.,
BASAVAIAH, D., KRISHNA, F! R. (1994), Pig liver acet- ROBERGE,C., AMATO,J. S., GRABOWSKI, E. J.
one powder (PLAP) as biocatalyst: enantioselec- (1996), An asymmetric synthesis of L-694,458, a
tive synthesis of trans-2-alkoxycyclohexan-l-ols, human leukocyte elastase inhibitor, via novel
Tetrahedron 50,10521-10530. enzyme resolution of p-lactam esters, J. Org.
BAYER,T., WULLBRANDT, D. (1999), Enzymatische Chem. 61,65754580.
Herstellung von 7-Aminocephalosporansaure, DICOSIMO, R., FALLON, R. D., GAVAGAN, J. E. (1997),
in: Industrielle Nutzung von Biokatalysatoren Preparation of 5- or 6-membered lactams from
(HEIDEN, S., BOCK,A.-K.,ANTRANIKIAN, G., Eds.), aliphatic a,o-dinitriles, Int. Patent Appl.
pp. 187-194. Berlin: Erich-Schmidt-Verlag. W09744318 (DuPont) (Chem. Abstr. 128,89231;
BOMMARIUS, A. S., DRAUZ, K., GROEGER, U., WAND- Corr. of Us,48589).
REY, C. (1992), Membrane bioreactors for the DOSWALD, S.,ESTERMANN,H., KUPFER, E., STADLER,
production of enantiomerically pure a-amino H., WALTHER, W. et al. (1994), Large scale prepa-
acids, in: Chirality in Industry Vol. I (COLLINS, A. ration of chiral building blocks for the P3 site of
N., SHELDRAKE, G. N., CROSBY, J., Eds.), pp. 371- renin inhibitors, Bioorg. Med. Chem. 2,403-410.
397. Chichester: John Wiley & Sons. EFFENBERGER, F. (1994), Synthesis and reactions of
BOMMARIUS, A. S., SCHWARM, M., STINGL,K., KOT- optically-activecyanohydrins,Angew. Chem. (Int.
TENHAHN, M., HUTHMACHER, K., DRAUZ, K. Edn. Engl.) 33,1555-1564.
5 References 291
EICHHORN, E., RODUIT, J.-P., SHAW,N., HEINZMANN, (SCHEPER, T., Ed.), pp. 31-55. Berlin: Springer-
K., KIENER,A.(1997),Preparation of ( S ) - pipera- Verlag.
zine-2-carboxylic acid, (R)-piperazine-2-carboxy- KAMPHUIS, J., BOESTEN, W. H. J., KAFTEN, B., HER-
lic acid, and (S)-piperidine-2-carboxylicacid by MES,H. F. M., SONKE,T.et al. (1992),The produc-
kinetic resolution of the corresponding racemic tion and uses of optically pure natural and un-
carboxamides with stereoselective amidases in natural amino acids, in: Chirality in Industry Vol. I
whole bacterial cells, Tetrahedron:Asymmetry 8, (COLLINS, A. N., SHELDRAKE, G. N., CROSBY, J.,
2533-2536. Eds.), pp. 187-208. Chichester: John Wiley &
FURUI,M., FURUTANI, T., SHIBATANI, T., NAKAMOTO, Sons.
Y., MORI,T. H. (1996), A membrane bioreactor KAF~EIN, B., MOODY,H. M., BROXTERMAN, Q. B.,
combined with crystallizer for production of opti- KAMPHUIS, J. (1994), Chemo-enzymic synthesis
cally active (2R,3S)-3-(4-methoxyphenyl)glycidic of (S)-(+ )-cericlamine and related enantiomeri-
acid methyl ester,J. Ferment. Bioeng. 81,21-25. cally pure 2,2-disubstituted-2-aminoethanols,J.
GAVAGAN, J. E., FAGER,S. K.,FALLON, R. D.,FOLSOM, Chem. SOC.,Perkin Trans. 1,1495-1498.
P. W., HERKES, F. E. et al. (1998), Chemoenzymic KAETEIN,B., MONACO,V., BROXTERMAN, Q. B.,
production of lactams from aliphatic apdinitri- SCHOEMAKER, H. E., KAMPHUIS, J. (1995), Synthe-
les, J. Org. Chem. 63,47924801. sis of dipeptides containing a-substituted amino
HASSLACHER, M., SCHALL, M., HAYN,M., BONA,R., acids; their use as chiral ligands in Lewis acid-ca-
RUMBOLD, K. et al. (1997), High-level intracellu- talyzed reactions, Recl. Trav. Chim. Pays-Bas 114,
lar expression of hydroxynitrile lyase from the 231-238.
tropical rubber tree Hevea brasiliensis in microbi- KAFTEIN,B.,VANDOOREN,T. J. G. M., BOESTEN, W. H.
al hosts, Protein Expr. Purif 11,61-71. J., SONKE,T., DUCHATEAU, A. L. L. et al. (1998),
HENEGAR, K. E., ASHFORD, S. W., BAUGHMAN, T. A., Synthesis of 4-sulfur-substituted (2S,3R)-3-
SIH,J. C., Gu, R. L. (1997), Practical asymmetric phenylserines by enzymic resolution. Enantiopu-
synthesis of (S)-4-ethyl-7,8-dihydro-4-hydroxy- re precursors for Thiamphenicol and Florfenicol,
lH-pyran0[3,4-flindolizine-3,6,10(4H)-trione,a Org. Process Res. Dev. 2,lO-17.
key intermediate for the synthesis of irinotecan KASAI,N., SAKAGUCHI, K. (1992), An efficient syn-
and other camptothecin analogs,J. Org. Chem. 62, thesis of (R)-carnitine, TetrahedronLett. 33,1211-
6588-6597. 1212.
HONIG,H., SEUFER-WASSERTHAL, P.(1990), A gene- KASAI,N., TSUJIMURA, K., UNOURA, K., SUZUKI, T.
ral method for the separation of enantiomeric (1990), Degradation of 2,3-dichloro-l-propanol
trans-2-substituted cyclohexanols, Synthesis, by a Pseudomonas sp., Agric. Biol. Chem. 54,
1137-1 140. 3185-3190.
HUGHES, D. L., BERGAN, J. J.,AMATo,J. S., REIDER, P. KASAI,N., TSUJIMURA, K., UNOURA, K., SUZUKI, T.
J., GRABOWSKI, E. J. J. (1989), Synthesis of chiral (1992a), Isolation of (S)-2,3-dichloro-l-propanol
dithioacetals: a chemoenzymic synthesis of a no- assimilating bacterium, its characterization, and
vel LTD4 antagonist,J. Org. Chem. 54,1787-1788. its use in preparation of (R)-2,3-dichloro-l-pro-
HUGHES, D. L., BERGAN, J. J.,AMATo,J. S.,BHUPATHY, panol and (S)-epichlorohydrin, J. Ind. Microbiol.
M., LEAZER,J. L. et al. (1990), Lipase-catalyzed 10,3743.
asymmetric hydrolysis of esters having remote KASAI,N., TSUJIMURA, K., UNOURA, K., SUZUKI, T.
chirallprochiral centers, J. Org. Chem. 55, 6252- (1992b), Preparation of (S)-2,3-dichloro-l-pro-
6259. panol by Pseudomonas sp. and its use in the syn-
HULSHOF, L. A., ROSKAM, J. H. (1989), Phenylglycid- thesis (R)-epichlorohydrin, J. Ind. Microbiol. 9,
ate stereoisomers, conversion products thereof 97-101.
with e.g. 2-nitrophenol and preparation of diltia- KASAI,N., SUZUKI, T., FURUKAWA, Y. (1998), Chiral
zem, European Patent EP0343714 (Stamicarbon) C3 epoxides and halohydrins: Their preparation
(Chem.Abstr. 113,76603). and synthetic application, J. Mol. Catal. B: Enzy-
ISOWA, Y., OHMORI, M., ICHIKAWA, T., MORI,K., No- matic 4,237-252.
NAKA, Y. et al. (1979), The thermolysin-catalyzed KAZLAUSKAS, R. J., BORNSCHEUER, U. T. (1998), Bio-
condensation reactions of N-substituted aspartic transformations with lipases, in: Biotechnology
acid and glutamic acids with phenylalanine alkyl Vol. 8a (REHM,H.J., REED,G.,PUHLER,A.,STAD-
esters, Tetrahedron Lett. 2611-2612. LER,P. J. W., Eds.), pp. 37-191. Weinheim: John Wi-
JAEGER, K.-E., REETZ,M.T. (1998),Microbial lipases ley & Sons.
form versatile tools for biotechnology, Trends KLOOSTERMAN, M., E L F E R I N KH. , ~M., IERSEL, J. v.,
Biotechnol. 16,396403. ROSKAM, J. H., MEIJER,E. M. et al. (1988),Lipases
JOHNSON, D. V., GRIENGL, H. (1998), Biocatalytic ap- in the preparation of p blockers, Trends Biotech-
plications of hydroxynitrile lyases,in: Advances in nol. 6,251-256.
Biochemical Engineering/Biotechnology Vol. 63 KOBAYASHI, M., NAGASAWA, T., YAMADA, H. (1992),
Enzymatic syntheses of acrylamide: a success DA, w. (1981), The enzyme and method for
story not yet over, Trends Biotechnol. 10,402408. enzymatic transesterification of lipid, European
KOBAYASHI, M., IZUI,H., NAGASAWA,T.,YAMADA, H. Patent EP 0035883 (Fuji Oil Co.) (Chem. Abstr.
(1993), Nitrilase in biosynthesis of the plant hor- 96,4958).
mone indole-3-acetic acid from indole-3-acetoni- MAZDIYASNI, H., KONOPACKI, D. B., DICKMAN, D. A.,
trile: Cloning of the Alcaligenes gene and site-di- ZYDOWSKY, T. M. (1993), Enzyme-catalyzed syn-
rected mutagenesis of cysteine residues, Proc. thesis of optically-pure p-sulfonamidopropionic
Natl. Acad. Sci. USA 90,247-251. acids. Useful starting materials for P-3 site modi-
KOBAYASHI, M., SUZUKI, T., FUJITA, T., MASUDA, M., fied renin inhibitors, Tetrahedron Lett. 34, 435-
SHIMIZU, S. (1995), Occurrence of enzymes in- 438.
volved in biosynthesis of indole-3-acetic acid MCCAGUE, R.,TAYLOR, S. J. C. (1997), Four case stu-
from indole-3-acetonitrile in plant-associated dies in the development of biotransformation-
bacteria, Agrobacterium and Rhizobium, Proc. based processes, in: Chirality in Industry Vol. I1
Natl. Acad. Sci. USA 92,714-718. (COLLINS, A. N., SHELDRAKE, G. N., CROSBY, J.,
LADNER, W. E.,WHITESIDES, G. M. (1984),Lipase-ca- Eds), pp. 183-206. Chichester:John Wiley & Sons.
talyzed hydrolysis as a route to esters of chiral MORGAN, B., STOCKWELL, B. R., DODDS, D. R., AND-
epoxy alcohols,J.Am. Chem. SOC.106,7250-7251. R E W ~D., R., SUDHAKAR, A. R. et al. (1997),
LAUMEN, K., BREITGOFF, D., SEEMAYER, R., SCHNEI- Chemoenzymatic approaches to SCH 56592, a
DER, M. P. (1989), Enantiomerically pure cyclo- new azole antifungal, J. Am. Oil Chem. SOC. 74,
hexanols and cyclohexane-1,2-diol derivatives, 1361-1370.
chiral auxiliaries and substitutes for (-)-8- NAGASAWA, T., YAMADA, H. (1995), Microbial pro-
phenylmenthol. A facile enzymic route, J. Chem. duction of commodity chemicals, Pure Appl.
SOC.,Chem. Commun. 148-150. Chem. 67,1241-1256.
MACKEITH,R.A., MCCAGUE, R., OLIVO,H. F., PAL- NAGASAWA, T., MATHEW,C. D., MAUGER, J., YAMA-
MER,C. F., ROBERTS,S. M. (1993), Conversion of DA,H. (1988),Nitrile hydratase-catalyzed produc-
( - )-4-hydroxy-2-oxabicyclo[3.3.0]oct-7-en-3-one tion of nicotinamide from 3-cyanopyridine in
into the anti-HIV agent carbovir, J. Chem. SOC., Rhodococcus rhodochrous J1, Appl. Environ.
Perkin Trans. I, 313-314. Microbiol. 54,1761769.
MACKEITH,R. A., MCCAGUE,R., OLIVO,H. F., NISHIZAWA, M., GOMI,H., KISHIMOTO, F. (1993), Pu-
ROBERTS, S. M.,TAYLOR,S. J. C., XIONG, H. (1994), rification and some properties of carboxylester-
Enzyme-catalyzed kinetic resolution of 4-endo- ase from Arthobacter globijormis; stereoselective
hydroxy-2- oxabicyclo[3.3.0]oct-7-en-3-oneand hydrolysis of ethyl chrysanthemate, Biosci. Bio-
employment of the pure enantiomers for the syn- tech. Biochem. 51,594-598.
thesis of antiviral and hypocholestemic agents, NISHIZAWA, M., SHIMIZU, M., OHKAWA, H., KANAO-
Bioorg. Med. Chem. 2,387-394. KA, M. (1995), Stereoselective production of (+)-
MACRAE, A. R. (1983), Lipase-catalyzed interesteri- trans-chrysanthemic acid by a microbial esterase:
fication of oils and fats, J. Am. Oil Chem. SOC.60, cloning, nucleotide sequence, and overexpression
291-294. of the esterase gene of Arthrobacter globiformis
MACRAE,A. R., HAMMOND, R. C. (1985),Present and in Escherichia coli, Appl. Environ. Microbiol. 61,
future applications of lipases, Biotechnol. Genet. 3208-321 5.
Eng. Rev. 3,193-217. OYAMA,K. (1992), Industrial production of asparta-
MATSUMAE, H., FURUI,M., SHIBATANI, T. (1993), Li- me, in: Chirality in Industry Vol. I (COLLINS,A. N.,
pase-catalyzed asymmetric hydrolysis of 3-phenyl- SHELDRAKE, G. N., CROSBY, J., Eds.), pp. 237-247.
glycidic acid ester, the key intermediate in the Chichester: John Wiley & Sons.
synthesis of diltiazem hydrochloride, J. Ferment. PATEL,R. N., LIU,M., BANEWEE, A., SZARKA, L. J.
Bioeng. 75,93-98. (1992), Stereoselective enzymatic hydrolysis of
MATSUMAE, H., FURUI,M., SHIBATANI, T., TOSA,T. (exo,exo)-7-oxabicyclo[2.2.1]heptane-2,3-dimeth-
(1994), Production of optically active 3-phenyl- anol diacetate ester in a biphasic system, Appl.
glycidic acid ester by the lipase from Serratia mar- Microbiol. Biotechnol. 37,180-183.
cescens on a hollow-fiber membrane reactor, J. PATEL,R. N., BANERJEE,A., KO,R. Y., HOWELL, J. M.,
Ferment. Bioeng. 78,5943. LI, W.3. et al. (1994), Enzymic preparation of
MATSUMOTO,K. (1992), Production of 6-APA, 7- (3R-cis)-3-(acetyloxy)-4-phenyl-2-azetidinone -a
ACA, and 7-ADCA by immobilized penicillin taxol side-chain synthon, Biotechnol. Appl. Bio-
and cephalosporin amidases, in: Industrial Appli- chem. 20,23-33.
cations of Immobilized Biocatalysts (TANAKA, A., PHYTIAN,S. J. (1998), Esterases, in: Biotechnology
TOSA,T., KOBAYASHI, T., Eds.). New York: Marcel Vol. 8a (REHM,H. J., REED,G., PUHLER,A.,STAD-
Dekker. LER,P. J. W., Eds.), pp. 193-241. Weinheim:Wiley-
MATSUO, T., SAWAMURA, N., HASHIMOTO, Y., HASHI- VCH.
5 References 293
QUAX, W. J., BROEKHUIZEN, C. P. (1994), Develop- SUZUKI, T., KASAI,N., YAMAMOTO, R., MINAMIURA,
ment of a new Bacillus carboxyl esterase for use N. (1993), Production of highly optically active
in the resolution of chiral drugs, Appl. Microbiol. (R)-3-chloro-1,2-propanediolusing a bacterium
Biotechnol. 41,425431. assimilating the (S)-isomer, Appl. Microbiol. Bio-
QUINLAN,l?, MOORE,S. (1993), Modification of technol. 40,273-278.
triglycerides by lipases: process technology and SWANSON, F! E. (1999), Dehalogenases applied to in-
its application to the production of nutritionally dustrial-scale biocatalysis, Curr. Opin. Biotechnol.
improved fats, Inform 4,579-583. 10,365-369.
REETZ,M. T., JAEGER,K.-E. (1999), Superior bio- TAYLOR, S. J. C., MCCAGUE, R., WISDOM, R., LEE,C.,
catalysts by directed evolution, Topic Curr. Chem. DICKSON, K. et al. (1993), Development of the
ZOO, 31-57. biocatalytic resolution of 2-azabicyclo[2.2.1]-
ROZZELL, J. D. (1999), Commercial scale biocataly- hept-5-en-3-one as an entry to single-enantiomer
sis: myths and realities, Bioorg. Med. Chem. 7, carbocyclic nucleosides, Tetrahedron:Asymmetry
2253-2261. 4,1117-1128.
SAKSENA,A. K., GIRIJAVALLABHAN, V. M., LOVEY, R. TURNER,M. (1998), Perspectives in Biotransforma-
G., PIKE,R. E., WANG,H. et al. (1995), Highly ste- tions, in: Biotechnology 2nd Edn., Vol. 8a (REHM,
reoselective access to novel 2,2,4-trisubstituted H.-J., REED,G., PUHLER,A., STADLER, P., Eds.),
tetrahydrofurans by halocyclization: practical pp. 15-17. Weinheim: Wiley-VCH.
chemoenzymic synthesis of SCH 51048, a broad- TURNER,N. J., WINTERMAN, J. R., MCCAGUE, R., PAR-
spectrum orally active antifungal agent, Tetrahe- RAIT,J. ~.,TAYLOR, S. J. C. (1995), Synthesis of ho-
dron Lett. 36,1787-1790. mochiral L-(S)-tert-leucine via a lipase catalyzed
SCHMID, R. D., VERGER,R. (1998), Lipases - interfa- dynamic resolution process, Tetrahedron Lett. 36,
cial enzymes with attractive applications,Angew. 1113-1116.
Chem. (Int. Edn. Engl.) 37,1608-1633. VAN DEN TWEEL,W. J. J., VAN DOOREN,T. J. G. M., DE
SCHOEMAKER, H. E., BOESTEN, W. H. J., KAPTEIN, B., JONGE,P. H., KAPTEIN, B., DUCHATEAU, A. L. L.,
Roos, E. C.,BROXTERMAN, Q. B. et al. (1996), En- KAMPHUIS,J. (1993), Ochrobactrum anthropi
zymic catalysis in organic synthesis. Synthesis of NCIMB 40321: a new biocatalyst with broad-
enantiomerically pure Ca-substituted a-amino spectrum L-specific amidase activity,Appl. Micro-
and a-hydroxy acids, Acta Chem. Scand. 50,225- biol. Biotechnol. 39,296-300.
233. VAN DOOREN, T. J. G. M., VANDEN TWEEL,W. J. J.
SHELDON, R. A. (1993), Chirotechnology - Industrial (1992), Enzymic preparation of optically active
Synthesis of Optically-Active Compounds. New carboxylic acids, Eur. Patent Appl. EP494716
York: Marcel Dekker. (DSM) (Chem.Abstr. 117,210758).
SIH,J. C. (1996),Application of immobilized lipase in VAN TOL, J. B. A., JONGEJAN, J. A., DUINE,J. A.
production of Camptosar (CPT-ll), J. Am. Oil (1995a), Description of hydrolase-enantioselec-
Chem. SOC.73,1377-1378. tivity must be based on the actual kinetic mecha-
STEAD, P., MARLEY, H., MAHMOUDIAN, M., WEBB,G., nism: analysis of the kinetic resolution of glycidyl
NOBLE,D. et al. (1996), Efficient procedures for (2,3-epoxy-l-propyl) butyrate by pig pancreas
the large-scale preparation of (lS,2S)-trans-2- lipase, Biocatal. Biotransform. U , 99-117.
methoxycyclohexanol, a key chiral intermediate VAN TOL,J. B. A., KRAAYVELD, D. E., JONGEJAN, J. A.,
in the synthesis of tricyclic p-lactam antibiotics, DUINE,J. A. (1995b),The catalytic performance of
Tetrahedr0n:Asymmetry 7,2247-2250. pig pancreas lipase in enantioselective transeste-
STEMMER, W. l? C. (1994), DNA shuffling by random rification in organic solvents, Biocatal. Biotrans-
fragmentation and reassembly: In vitro recombi- form. 12,119-136.
nation for molecular evolution, Proc. Natl. Acad. WAJANT, H., EFFENBERGER, F. (1996),Hydroxynitrile
Sci. USA 91,10747-10751. lyases of higher plants, Biol. Chem. 377, 611-
STINSON, S. C. (1998), Counting on chiral drugs, 617.
Chem. Eng. News Sept. 21,83-104. WAJANT, H., MUNDRY,K. W., PFIZENMAIER, K.
SUZUKI,T., KASAI,N. (1991),A novel method for the (1994), Molecular cloning of hydroxynitrile lyase
generation of (R)- and (S)-3-chloro-1,2-propan- from Sorghum bicolor (L.). Homologies to serine
ediol by stereospecific dehalogenating bacteria carboxypeptidases,Plant. Mol. Biol. 26,735-746.
and their use in the preparation of (R)- and (S)- WALTS,A. E., FOX,E. M. (1990),A lipase fraction for
glycidol, Bioorg. Med. Chem. Lett. 1,343-346. resolution of glycidyl esters to high enantiomeric
SUZUKI, T., KASAI,N., YAMAMOTO, R., MINAMIURA, excess, US Patent 4923810 (Genzyme) (Chem.
N. (1992), Isolation of a bacterium assimilating Abstr. 113,113879).
(R)-3-chloro-1,2-propanediol and production of WIRZ,B., SOUKUP,M. (1997), Enzymatic preparation
(s)-3-chloro-1.2-~rooanediol using microbial re- of homochiral2-isobutvl succinic acid derivatives.
solution, J. Ferment. Bioeng. 73,44?-448. Tetrahedron:Asymmetry 8,187-189.
WOOLLEY, P., PETERSEN, S. B. (1994), Lipases: Their ZIMMERMANN, T. P., ROBINS,K. T., WERLEN,J.,
Structure, Biochemistry, and Application. Cam- HOEKS,F. W. J. M. M. (1997), Bio-transformation
bridge: Cambridge University Press. in the production of L-carnitine, in: Chirality in In-
Wu, D. R., CRAMER, S. M., BELFORT,G. (1993), Kine- dustry Vol. I1 (COLLINS, A. N., SHELDRAKE, G. N.,
tic resolution of racemic glycidyl butyrate using a CROSBY,J., Eds.), pp. 287-305. New York: John
multiphase membrane enzyme reactor: experi- Wiley & Sons.
ments and model verification, Biotechnol. Bioeng. ZMIJEWSKI, M. J., JR., BRIGGS,B. S., THOMPSON, A. R.,
41,979-990. WRIGHT,I. G. (1991), Enantioselective acylation
YAGASAKI, M., OZAKI,A. (1998), Industrial biotrans- of a p-lactam intermediate in the synthesis of lor-
formations for the production of D-aminO acids, acarbef using penicillin G amidase, Tetrahedron
J. Mol. Catal. B: Enzymatic 4,1-11. Lett. 32,1621-1622.
7 Regioselective Oxidation of
Aminosorbitol with Gluconobacter
oxydans, Key Reaction in the
Industrial 1-Deoxynojirimycin
Synthesis
MICHAEL
SCHEDEL
Wuppertal, Germany
1 Introduction 296
2 Nojirimycin, l-Deoxynojirimycin, and Miglitol 297
3 Three Routes to Produce l-Deoxynojirimycin 298
3.1 Extraction from Plants 298
3.2 Fermentation 298
3.3 Chemical Synthesis 299
4 Concept for a Combined Biotechnological-ChemicalSynthesis of l-Deoxynojirimycin 299
5 Oxidation of l-Amino-l-Deoxy-D-Sorbitolby Gluconobacter oxydans 300
6 Biotransformation of N-Formyl-l-Amino-l-Deoxy-D-Sorbitol on the Industrial Scale 303
7 Fermentative Production of Gluconobacter oxydans Cells on the Industrial Scale 304
8 Conclusions and Outlook 306
9 References 307
296 7 Regioselective Oxidation ofAminosorbitol with Gluconobacter oxydans
1 Introduction The industrial production of l-deoxynoji-

rimycin is a new example of a combined bio-
technological-chemical synthesis carried out
1-Deoxynojirimycin is the precursor to the at a large scale. This synthesis integrates the
potent a-glucosidase inhibitor Miglitol, its N- selectivity offered by an enzymatic reaction
substituted analog (GERARD et al., 1987; into a sequence of chemical steps and results
Scorr and TATTERSALL,1988). Miglitol was in an elegant, short and economical process
launched as a new therapeutic drug for the (KINASTand SCHEDEL,1981). The biotechno-
treatment of non-insulin-dependent diabetes logical key reaction is the regioselective oxi-
mellitus in 1998 (BERGMAN, 1999) in Europe, dation of 1-amino-1-deoxy-D-sorbitol to 6-
North America, and some other countries. The amino-6-deoxy-~-sorbose.Whole cells of Glu-
structures of 1-deoxynojirimycinand of Migli- conobacter oxydans having a high specific ac-
to1 are shown in Fig. 1. tivity of the membrane bound polyol dehy-
O
H
*" D-glucose
OH
nojirimycin
'OH
H - - oH 1-deoxynojirimycin
OH
H
o
H
zO
* Miglitol
OH
Fig. 1. The structures of ~-glucose,nojirimycin, 1-deoxynojirimycin,and Miglitol.

2 Nojirimycin, 1 -Deoxynojirimycin, and Miglitol 297
drogenase are used as catalyst. This central bi-

otransformation step is flanked by four chemi-
2 Nojirimycin,
cal reactions. 1-Deoxynojirimycin, and
The fruitful combination of biotechnology
and chemistry opens up new and creative syn- Miglitol
thetic pathways. One of the best known exam-
ples is the synthesis of vitamin C (REICHSTEIN l-Deoxynojirimycin is a natural compound
and GRUSSNER, 1934;KULHANEK, 1970;BOUD- which occurs in plants and in moths feeding on
RANT, 1990).In this efficient process the oxida- such plants; it can also be found in fermenta-
tion of D-sorbitol to L-sorbose with Glucono- tion broths of various bacteria. Its isolation
bacter oxydans (Acetobacter suboxydans) is from natural sources was first described in a
part of a five-step synthesis starting from D- patent applied for by the Japanese company
glucose.After its publication by REICHSTEIN it Nippon Shinyaku in 1976 (YAGIet al., 1976,
was for more than 60 years the method of 1977;MURAIet al., 1977);the inventors named
choice - due to the short reaction sequence, this strong a-glucosidase inhibitor Moranoline
the cheap availability of D-glucose as starting and claimed its extraction from Morus plants
substrate, and the chemical stability of the and its use as antidiabetic agent.
intermediates. Various improvements have Fig. 1 shows the structure of l-deoxynojiri-
been introduced over the years. mycin. It can be described as 1,5-dideoxy-1,5-
The industrial synthesis of l-deoxynojirimy- imino-D-glucitol or as 5-hydroxymethyl-2,3,4-
cin is similar to the vitamin C process. In both trihydroxypiperidine. This piperidinose shows
cases D-glucose is the starting material and the structural similarities to D-glucose; it has the
ability of G. oxydans to regioselectively oxi- same steric configuration at four carbon at-
dize straight chain polyhydric alcohols having oms, however, nitrogen replaces oxygen in the
a well defined steric configuration is em- ring. Ten years before l-deoxynojirimycin was
ployed. However, in the vitamin C synthesis D- found as a natural compound PAULSEN (1966)
sorbitol, a naturally occurring hexitol, is the already had published its synthesis from 6-
substrate of the microbial oxidation step amino-6-deoxy-~-sorbose.The early work on
whereas in the l-deoxynojirimycin case a l-deoxynojirimycin was closely related to
chemically modified polyol not found in na- studies with its parent compound nojirimycin
ture is used. The oxidation of such a terminally (Fig. 1) first isolated in 1965 as potent antibac-
modified polyol was possible because G. oxy- terial substance from the fermentation broth
duns demands a specific steric configuration at of Streptomyces roseochromogenes R-468 and
one side of the substrate to be oxidized where- later also detected in the growth medium of
as structure and size of the other part of the other Streptomyces and of Bacillus strains
molecule are of little importance. (NISHIKAWA and ISHIDA,1965; INOUYEet al.,
The present chapter describes the develop- 1966,1968;ISHIDA et al., 1967a,b; ARGOUDELIS
ment of the combined biotechnological-chem- and REUSSER, 1976; ARGOUDELIS et al., 1976;
ical l-deoxynojirimycin synthesis, compares it SCHMIDT et al., 1979). l-Deoxynojirimycin can
to other production alternatives, and sum- be prepared from nojirimycin by catalytic hy-
marizes relevant aspects of the oxidation of drogenation or reduction with sodium borohy-
l-amino-l-deoxy-D-sorbitol with G. oxydans dride (INOUYE et al., 1966).
at the production scale. Both nojirimycin and l-deoxynojirimycin
The name Gluconobacter oxydans is used strongly inhibit a-glucosidases isolated from
according to the taxonomical classification de- the intestinal tract of animals and man (NIWA
scribed in Bergey’s Manual of Systematic Bac- et al., 1970; REESEet al., 1971; MURAIet al.,
teriology (DE LEYet al., 1984).In some earlier 1977;FROMMER et al., 1978a,b, 1979a;SCHMIDT
literature this bacterium was named Gluco- et al., 1979;KODAMA et al., 1985) and immedi-
nobacter suboxydans or Acetobacter suboxy- ately attracted the interest of various research
duns. If such literature is cited the name used groups.As lead structures they offered a signif-
by the authors is given. icant potential for the development of new
therapeutic drugs to treat diabetes. Many se-
298 7 Regioselective Oxidation of Aminosorbitol with Gluconobacter oxydans
mi-synthetic N-substituted derivatives of l-de- 3.1 Extraction from Plants

oxynojirimycin have been prepared (JUNGEet
al., 1979;MATSUMURA et al., 1979a) and Migli- l-Deoxynojirimycin can be extracted with
tol, the N-hydroxyethyl analog, was identified water or polar solvents from the bark, the
as one of the most interesting candidates roots, and the leaves of the mulberry tree
showing a desired enzyme inhibitory profile (Morus alba, M. bombycis, M. nigra) and also
(GERARDet al., 1987; SCOTTand TATTERSALL, from other plants including Jacobinia suberec-
1988;JUNGE et al., 1996). ta and J. tinctoria, the Chinese herbs Vespae
Miglitol was developed by Bayer as drug for nidus and Bombyx batryticatus, and two Eu-
the treatment of type I1 (non-insulin-depen- phorbiaceae species,the rain forest tree Endo-
dent) diabetes mellitus. It was authorized in spermum medullosum and the liana Omphalea
1996for marketing in Europe (trade name: Di- queenslandiae (YAGIet al., 1976,1977;MATSU-
astabol@)and the United States (Glysetm) and MURA et al., 1980;EVANS et al., 1985; DAIGOet
launched in 1998 in cooperation with licensing al., 1986;KITEet al., 1991;YAMADA et al., 1993;
partners first in Germany and later in many SIMMONDS et al., 1999).The extraction of l-de-
other countries including the United States, oxynojirimycin from plant material as a route
Canada, and Australia. Miglitol is the third a- of production on the industrial scale has, how-
glucosidase inhibitor to reach the market - af- ever, never seriously been regarded as feasible.
ter Acarbose (GlucobayB, Precosea), a secon- The content of l-deoxynojirimycin in plants is
dary metabolite of pseudotetrasaccharide low and the purification process would not be
structure produced by fermentation of Acti- simple as structurally very similar substances
noplanes sp. (SCHMIDT et al., 1977; CLISSOLD are also present in these plants like nojirimy-
and EDWARDS, 1988;BISCHOFF,1994) and Vog- cin and l-deoxymannojirimycin (DAIGOet al.,
libose (Basen@),an N-substituted valiolamine 1986;ASANOet al., 1994a,b).
derivative which is on the market in Japan and Moreover, the sufficient and steady supply
some other Far Eastern countries (HORIIet al., would be difficult to establish, pose an im-
1982;NAKAMURA et al., 1993;ODAKAand IKE- mense logistic problem, and need the avail-
DA, 1995). ability of sufficient land.
3.2 Fermentation
3 Three Routes to Produce The fermentative route offers an interesting
large scale production alternative. A number
1-Deoxynojirimycin of Bacillus and Streptomyces strains were
found to synthesize l-deoxynojirimycin in
For the industrial production of Miglitol 1- appreciable amounts and secrete it into the me-
deoxynojirimycin is needed as starting materi- dium. SCHMIDT et al. (1979) and FROMMER et
al. There are three principal routes to prepare al. (1978a, 1979b) isolated l-deoxynojirimycin
l-deoxynojirimycin (HUGHES and RUDGE, from the culture broth of Bacillus amylolique-
1994; STCJTZ,1999): faciens, B. polymyxa, and B. subtilis. FROMMER
and SCHMIDT(1980) claimed a fermentation
(1) Extraction from plants like the mul- process using Bacillus strains; they were able
berry tree. to isolate 360 g of pure l-deoxynojirimycin
(2) Fermentation of various Bacillus or base after a multistep purification process
Streptomyces strains. starting from 360 L of fermentation broth. 1-
(3) Chemical synthesis following different Deoxynojirimycin production using Strepto-
synthetic strategies. myces lavendulae was reported by MATSUMU-
RA et al. (1979b), MURAOand MIYATA(1980),
in a patent of Amano Pharmaceuticals (SUMI-
TA and MURAO,1980), and by EZUREet al.
(1985). HARDICK et al. (1991,1992) and HAR-
4 Concept for a Combined Biotechnological-Chemical Synthesis of 1 -Deoxynojirimycin 299
DICK and HUTCHINSON (1993) investigated the have chiral centers like glucosylamine
biosynthesis of 1-deoxynojirimycin in Strepto- (BERNOTAS and GANEM, 1985),manno-
myces subrutilis and Bacillus subtilis var. niger. se or idose derivatives (FLEET,1989;
To produce 1-deoxynojirimycineconomical- FLEETet al., 1990),tartaric acid (IIDAet
ly by fermentation a yield approaching 50g al., 1987), pyroglutamic acid (IKOTA,
per liter would be necessary to reach a price of 1989),or phenylalanine (RUDGEet al.,
less than 100 US$ per kg. It does not seem un- 1994).An example of a chemo-enzy-
realistic that this goal can be achieved as some matic process has been reported by
of the wild type strains reported in the literatu- WONGet al. (1995). In their synthesis
re already produced 1-deoxynojirimycin in dihydroxyacetone phosphate is stereo-
gram quantities. However, an intensive genetic selectively connected to 3-azido-2-
strain development program and the optimiza- hydroxypropan-a1catalyzed by rabbit
tion of the fermentation process over several muscle aldolase.
years would be necessary.
All synthetic routes are complex; most of them
have a relatively large number of individual
3.3 Chemical Synthesis reaction steps and need a substantial amount
of protection group chemistry. In some of the
There are many publications describing dif- syntheses proposed the lack of selectivity in
ferent synthetic routes to 1-deoxynojirimycin; crucial steps led to significant amounts of one
they were reviewed by NISHIMURA (1991), or more of the 15 other possible stereoisomers.
HUGHESand RUDGE(1994), JUNGE et al. 1-Deoxynojirimycin production by chemical
(1996), and LA FERLAand NICOTRA (1999). syntheses on an industrial scale following the
The synthesis of 1-deoxynojirimycinpresents a above mentioned strategies was not economi-
stereochemical challenge due to the presence cal in those cases considered.
of four contiguous chiral centers and the same
functional group occurring several times. The
various synthetic routes described in the litera-
ture may be classified into three groups:
4 Concept for a Combined
Starting material is D-glucose, the nitro-
gen is introduced at C-1, the hydroxyl Biotechnological-Chemical
group at C-5 is oxidized to the keto
group, and 1-deoxynojirimycinis
Synthesis of
obtained by reductive ring closure. An 1-Deoxynojirimycin
example is the original synthesis pub-
lished by PAULSEN (PAULSEN, 1966, An interesting concept for a combined bio-
1999;PAULSEN et al., 1967). technological-chemical synthesis was pro-
Starting material is again D-glucose, the posed by KINAST and SCHEDEL (1981) which is
nitrogen is introduced at C-5 while shown in Fig. 2. It took advantage of the ability
maintaining the configuration present of Gluconobacter oxydans to regio- and ster-
in D-glucose followed by reductive ring eoselectively oxidize polyol substrates with
closure. This synthetic strategy was first high productivity according to the rule of BER-
described for nojirimycin by INOUEet TRAND and HUDSON (BERTRAND, 1904; HANN
al. (1968). The synthetic routes in this et al., 1938).The key reaction in the proposed
and the first group take advantage of three-step synthesis was the regioselective mi-
the fact that already three correct ste- crobial oxidation of l-amino-l-deoxy-D-sorbi-
reocenters needed in 1-deoxynojirimy- to1 to 6-amino-6-deoxy-~-sorbose.This crucial
cin are contributed by the homochiral step was flanked by well established and com-
starting material D-glucose. paratively simple chemical reactions: the re-
A number of other syntheses start from ductive amination of D-glucose to give 1-ami-
building blocks which do or do not no-1-deoxy-D-sorbitol and the stereoselective
- f: Hot:
300 7 Regioselective Oxidation ofArninosorbitol with Gluconobacter oxydans
CHO
OH reducpe NH2 Gluconobacter NH2 ring closure,
Ho{oH aminabon oxydans reduction)
HO HO
OH
D-glucose 1-amino-D+orbitd B-amino-~-sorbose 1deoxynojirimycin
Fig. 2. Concept for the combined biotechnological-chemicalsynthesis of 1-deoxynojirimycin.
reductive ring closure of 6-amino-6-deoxy-~- states that G. oxydans regioselectively oxidizes

sorbose to lead to 1-deoxynojirimycin. the middle of three terminal hydroxyl groups
The strategy of this synthesis was compar- if they have the D-erythro configuration. Ac-
able to the original synthesis by PAULSEN cording to the literature the size and structure
(PAULSEN, 1966; PAULSEN et al., 1967): Use of of the remaining part of the molecule had in
D-glucose as starting material which contains the majority of cases little or no effect on the
at carbon atoms 2, 3, and 4 three correct oxidation capability of Gluconobacter (KUL-
stereocenters, introduction of nitrogen at car- HANEK, 1989).There are more than 30 publica-
bon atom C-1, oxidation of the hydroxyl group tions demonstrating the successful oxidation
at C-5 followed by reductive ring closure. Use of the penultimate hydroxyl group of polyols
of the selectivity of the polyol dehydrogenase carrying the favorable Bertrand-Hudson con-
enzyme of G. oxydans to oxidize l-amino-l- figuration at one end of the molecule but are
deoxy-D-sorbitol made a short reaction se- chemically modified or differ in carbon chain
quence possible with no need for protection length or configuration at the other end; some
group chemistry. Regarding the final stereo- relevant publications are summarized in Tab.
selective ring closure and reduction step it was 1. BERTRAND(1898, 1900), FULMER and
known from the studies of PAULSENet al. UNDERKOFLER (1947), HANNet al. (1938),
(1967) that the microbial oxidation product 6- HANNand HUDSON (1939), ONISHIand Suzu-
amino-6-deoxy-~-sorbose existed in solution KI (1969), MOSESand FERRIER (1962), BER-
at alkaline pH-values in the piperidinose form TRAND and NITZBERG (1928), TILDEN(1939),
and could readily be reduced with appropriate MACLAYet al. (1942), ETTELand LIEBSTER
reducing agents like sodium borohydride (KO- (1949), PRATT and RICHTMYER (1955), and
BERNICK, 1982) to give 1-deoxynojirimycin. others oxidized polyols with different carbon
chain length ranging from glycerol to heptitols
and octitols. Particularly the oxidation of sev-
5 Oxidation of 1-Amino-l- eral heptitols showed that the configuration
outside the Bertrand-Hudson group was of lit-
Deoxy-D-Sorbitol by tle effect on the oxidation reaction (PRATTand
RICHTMYER, 1955). It is of interest that even a
Gluconobacter oxydans cyclitol (inositol) could be oxidized (DUNNING
et al., 1938;CHARGAFFand MAGASANIK, 1946).
1-Amino-1-deoxy-D-sorbitol, the substrate JONESand MITCHELL(1959), JONESet al.
of the microbially catalyzed key reaction, is a (1962), and HOUGHet al. (1959) used Aceto-
terminally modified polyol. For the success of bacter suboxydans for the oxidation of modi-
the proposed 1-deoxynojirimycin synthesis it fied pentitols and BOSSHARD and REICHSTEIN
was essential that the introduction of the ami- (1935), HOUGH et al. (1959), JONESet al.
no group at carbon atom C-1 did not influence (1961a, b), KULHANEK et al. (1977), BUDES~N-
the capability of Gluconobacter oxydans to s a et al. (1984), and TIWARIet al. (1986) re-
oxidize the hydroxyl group at carbon atom C-5 ported the oxidation of several chemically
according to the Bertrand-Hudson rule (BER- modified hexitols. In these studies various de-
TRAND,1904; HA" et al., 1938). This rule oxy-, deoxyamino-, deoxyhalogen- and deoxy-
5 Oxidation of I-Amino-1-Deoxy-D-sorbitolby Gluconobacter oxydans 301
Tab. 1.Oxydation of Various Polyols According to the Rule of BERTRAND
and HUDSON
~______
Polyol(s) Oxidized References
Glycerol BERTRAND (1898)

meso-Erythritol BERTRAND (1900)
WHISTLER and UNDERKOKER (1938)
FULMER and UNDERKOFLER (1947)
Hu et al. (1965)
D-Arabitol HANNet al. (1938)
ONISHIand SUZUKI (1969)
Ribitol MOSESand FERRIER(1962)
D-Sorbitol BERTRAND (1904)
D-Allitol CARRet al. (1968)
D-Mannitol CUSHING and DAVIS(1958)
D-Fructose AVIGARD and ENGLARD (1965)
meso-, I-, d-, epi-Inositol DUNNING et al. (1938)
CHARGAAF and MAGASANIK (1946)
alpha-Glucoheptit BERTRAND and NITZBERG (1928)
D-alpha-Mannoheptitol (perseitol) HA" et al. (1938)
D-alpha,beta-Glucooctitol
Other polyols
D-Manno-D-gala-heptitol(perseitol) HANNand HUDSON (1939)
TILDEN(1939)
L-Gluco-L-gulo-heptitol(alpha-glucoheptitol) MACLAY et al. (1942)
Volemitol (alpha-sedoheptitol) E ~ andLLIEBSTER (1949)
STEWART et al. (1949)
D-Gluco-D-ido-heptitol PRAI-I et al. (1952)
beta-Sedoheptitol STEWART et al. (1952)
(D-altro-D-gluco-heptitol or L-gulo-D-talo-heptitol)
meso-Glycero-allo-heptitol PUTT and RICHTMYER
(1955)
D-Glycero-D-altro-heptitol
D-Erythro-D-galacto-octitol CHARLSON and RICHTMYER (1960)
2-Deoxy-D-erythro-pentitol LINEKet al. (1979)
1-Deoxy-1-S-ethyl-D-arabitol JONESand MITCHELL (1959)
~-Sorbitol-3-methyl-ether BOSSHARD and REICHSTEIN (1935)
I-Deoxy-D-glucitol KAUFMANN and REICHSTEIN (1967)
6-Deoxy-~-allitol
2-Deoxy-~-sorbitol FULMERand UNDERKOFLER
(1947)
1-Deoxy-1-S-ethyl-D-glucitol HOUGHet al. (1959)
1-Deoxy-1-S-ethyl-D-arabitol
1-Deoxy-1-S-ethyl-D-galactitol
2-Amino-2-deoxy-~-glucitol
2-Acetamido-2-deoxy-~-glucitol
5-Deoxy-~-ribitol
6-Deoxy-~-galactitol
5-O-Methyl-~-ribitol
6-O-Acetyl-~~-galactitol
6-Deoxy -6-S-ethyl-L-galactitol
1-0-Acetyl-DL-galactitol
2-Acetamido-2-deoxy-~-glucitol JONESet al. (1961a)
1-Deoxy-1-N-methylacetamido-D-glucitol JONESet al. (1961b)
2-Acetamido-l,2-dideoxy-~-glucito1
2-Deoxy-2-fluoro-~-glucitol KULHANEK et al. (1977)
3-Deoxy-3-fluoro-~-mannitol BUDESfNS& et al. (1984)
2-Deoxy-~-arabino-hexitol TIWARI
et al. (1986)
L-Fucitol (6-deoxy-~-galactito1) RICHTMYER et al. (1950)
D-Rhamnitol ANDERSON and LARDY(1948)
omega-Deoxy sugar alcohols BOLLENBACK and UNDERKOFLER
(1950)
sulfuralditols were employed as substrates. ever, not stable in water at near neutral pH
ANDERSON and LARDY(1948), RICHTMYER et under the conditions of the biotransformation
al. (1950), and BOLLENBACK and UNDER- reaction: spontaneous ring closure occurred
KOFLER (1950) oxidized w-deoxy sugars and followed by removal of water leading to
HOUGHet al. (1959) in addition w-0-methyl- 3-hydroxy-2-hydroxymethyl-pyridine(Fig. 3).
and w-deoxy-acetyl sugars. In these polyols the PAULSEN et al. (1967) had reported that under
hydroxyl group at the third to last carbon atom their conditions the pyridine formation from
was oxidized. To stay in accord with the Ber- 6-amino-6-deoxy-~-sorbosewas quantitative
trand-Hudson rule the authors regarded the after five days. Due to the loss of 6-amino-6-
terminal methyl group as equal to hydrogen, deoxy-L-sorbose the necessary high l-deoxy-
i.e., the terminal two-carbon group nojirimycin yield could not be obtained. To
CH,-CHOH was considered as a slightly ex- prevent the spontaneous intramolecular ring
tended CH,OH group. closure reaction the amino group had to be
All the above mentioned and in Tab. 1 sum- protected. Various protection groups could
marized polyols could be oxidized according successfully be employed. In a series of patents
to the rule of BETRAND and HUDSON with G. different protection groups were claimed
oxyduns. In some studies the yield reported which could be removed either by hydrogeno-
was, however, low and the fermentation time lytic cleavage (KINASTand SCHEDEL, 1980b),
needed long (up to two or three weeks). Earli- under alkaline or acidic conditions (KINASTet
er reviews summarizing the oxidation of poly- al., 1982; SCHRODER and STLJBBE, 1987),or en-
hydric alcohols by G. oxyduns were written by zymatically (SCHUIT, 1993). Astonishingly,
FULMERand UNDERKOFLER (1947), JANKE many of these N-protected polyols were readi-
(1960), SPENCER and GORIN(1968), and KUL- ly oxidized by G. oxyduns even if the protec-
HANEK (1989). tion group used - like the benzyloxycarbonyl
Examples of polyhydroxy compounds which group - was large and significantlylowered the
were not oxidized by G. oxyduns although they water solubility of the substrate to be em-
have the favorable Bertrand-Hudson configu- ployed.
ration are D-glucose dimethylacetal (ISELIN, In the reaction sequence of the combined
1948), D-mannose diethylmercaptal (HA” biotechnological-chemical synthesis of 1-de-
et al., 1938), the 1,l-diethyldithioacetals of oxynojirimycin two additional steps were thus
D-arabinose, D-glucose, and D-galactose and included (Fig. 4): Introduction of a favorable
the 1,l-dibenzyldithioacetal of D-arabinose protection group before the oxidation step and
(HOUGHet al., 1959). These results indicate its removal afterwards prior to reduction.
that there are additional factors which are rel- Small and hydrophilic groups like formyl-,
evant for the oxidation of open chain polyols. dichloroacetyl-, or trichloroacetyl- which
1-Amino-1-deoxy-D-sorbitol contains the could be cleaved off under acidic or alkaline
Bertrand-Hudson-configuration and could conditions were preferred. All further work to
readily be oxidized to 5-amino-5-deoxy-~-sor- be described in the following sections was
bose employing various G. oxyduns strains done with N-formyl-l-amino-l-deoxy-o-sorbi-
(KINASTand SCHEDEL, 1980a). The oxidation to1 as example.
product 6-amino-6-deoxy-~-sorbosewas, how-
OH
3-hydroxy-2-hydroxymethyl-
I-amino-o-sorbitd 6-amino-~-sorbose pyridine
Fig. 3. Formation of 3-hydroxy-2-hydroxymethyl-pyridine

from 6-amino-6-deoxy-sorbose.
6 Biotransformation of N-Formyl-I-Amino-1-Deoxy-D-Sorbitol
at Industrial Scale 303
OH
OH OH OH OH OH
l+mlno-D+orbitol ’*minO-DBorbitd &amino-~~orbose 6-smino-L+orbose
DglUCOSS ldeoxynojirimycin
N-protected N-protected
Fig. 4. The combined biotechnological-chemical synthesis of 1-deoxynojirimycin.
6 Biotransformation of dized per hour and g cell dry weight. A typical

time course is shown in Fig. 5.
N-Formyl-1-Amino-1- It is of interest to note that under these con-
ditions resting G. oxydans cells oxidized D-sor-
Deoxy-D-Sorbitol on the bitol, N-formyl-1-amino-1-deoxy-D-sorbitol,
or other polyols completely uncoupled: The
Industrial Scale electrons removed from the substrate were
transferred to oxygen without conservation of
The large scale industrial production of metabolically utilizable energy; only heat was
L-sorbose as part of the vitamin C process is produced. The non-existence of a respiratory
carried out with Gluconobacter oxyduns cells regulation was the prerequisite for this indus-
growing on D-sorbitol under fermentation trial biotransformation process employing
conditions (ROSENBERG et al., 1993).N-Formyl resting cells suspended simply in water. The
1-amino-1-deoxy-D-sorbitolcould, however, uncoupled dehydrogenation of monosaccha-
not be oxidized in the same way:This modified rides by G. oxydans had been pointed out by
polyol did not promote growth of G. oxydans KULHANEK (1989) and USPENSKAYA and
when added in high concentrations instead of LOITSYANSKAYA (1979).
D-sorbitol as sole polyol substrate to a yeast Four main aspects of the N-formyl-l-amino-
extracthalt medium. The same result was ob- 1-deoxy-D-sorbitolbiotransformation reaction
tained when other protecting groups were em- were important on the production scale under
ployed. N-Formyl-amino-1-deoxy-D-sorbitolreaction conditions as described above, i.e., a
even inhibited growth in a concentration de- Gluconobacter biomass concentration of
pendent manner when added together with D- about 2.5 kg m P3 and a substrate concentra-
sorbitol. The biotransformation reaction had, tion of 250 kg m-3:
therefore, to be carried out as a two-step pro-
cess (SCHEDEL, 1997): In the first step G. oxy- (1) High oxygen demand (about 6 kg
duns biomass was produced by fermentation 0, mP3h-’).
on a “good” growth substrate, preferably D- (2) Removal of ihe process heat (about
sorbitol, separated from the broth and stored 10 KW m-3).
under cooling as slurry in a stirred tank. In the (3) Labor intensive handling of large quan-
second step N-formyl-1-amino-1-deoxy-D-sor- tities of solid substrate.
bitol which had been dissolved in water was (4) Stability of the G. oxydans biocatalyst.
oxidized with G. oxydans biomass as catalyst
under “resting cell” conditions with intensive Regarding point (1) and (2) an adequately
aeration and at a slightly acidic pH value. The equipped stirred fermenter was necessary to
productivity of the microbial oxidation reac- meet the high oxygen demand and to effec-
tion using G. oxydans strain DSM 2003 was tively remove the heat which was produced by
very high: 250 kg of substrate per m3 could the biological reaction and introduced by the
quantitatively be oxidized in less than 16 h stirrer. To cope with the solid substrate hand-
with a biomass concentration of about 2.5 kg ling - about 10 t of material had to be filled
cell dry weight per m3. The specific oxidation into the fermenter within a reasonably short
activity was around 50 mmol of substrate oxi- period of time - an automated bigbag delivery
304 7 Regioselective OxidationofAminosorbitol with Gluconobacter oxydans
300
P55 250
100
O i
0 1 2 3 4 5 6 7 8 910111213
Time [h]
100
80
60
40
20
0 Fig. 5. Time course of the oxidation of
0 1 2 3 4 5 6 7 8 910111213 N-formyl-1-amino-1-deoxy-D-sorbitolon
m]
the production scale with Gluconobacter
Time oxydarts DSM 2003.
system to charge the fermenter was installed.

Due to instability problems after prolonged
7 Fermentative Production
storage it was not possible to supply N-formyl-
1-amino-1-deoxy-D-sorbitol as a concentrated
of Gluconobacter oxydans
solution which could be pumped from a stor- Cells on the Industrial Scale
age tank to the medium preparation tank. The
activity loss of G. oxydans cells under “resting The fermentative production of Glucono-
cell conditions” limited their reuse and also bacter oxydans cells was carried out in a yeast
the possibilities to develop an immobilized extracthalt medium containing D-sorbitol;
biocatalyst. After one biotransformation cycle other oxidizable substrates like glycerol could
Gluconobacter cells had lost about half of their also be used. Fig. 6 gives a typical time course
specific activity (SCHEDEL,1997). Successful of a fermentation on the 30 m3 scale with G.
immobilization was also hindered by the very oxydans strain DSM 2003 on D-sorbitol.The fi-
high oxygen demand and the enormous sub- nal biomass yield was low: about 5 g cell dry
strate turnover rate which caused a severe weight per liter. Only a very small portion of
transport limitation within immobilization the D-sorbitol was used as carbon source by G.
pearls. The oxidation of D-sorbitol to oxydans DSM 2003 and flowed into the metab-
L-sorbose with immobilized Gluconobacter olism, about 95% of the substrate was oxidized
cells had repeatedly been reported in the liter- to L-sorbose and deposited in the medium.
ature (SCHNARR et al., 1977; STEFANOVA et al., Correspondingly, the respiratory coefficient
1987; TRIFONOV et al., 1991; KOSSEVAet al., for such a “tight” Gluconobacter strain was
1991). low throughout the fermentation and ranged
7 Fermentative Production of Gluconobacter oxydans Cells at Industrial Scale 305
0 5 10 15 20 25 30
Time [h]
200
150
100
50
0
Fig. 6. Time course of the Gluconobacter oxy-
duns fermentation on the production scale 0 5 10 15 20 25 30
(strain DSM 2003). Time [h]
around a value of 0.15.A~ reported in the liter- free conditions are very rarely the system of
ature the specific oxidation activity was high- choice. There are several reasons for this: In-
est at the entry to the stationary phase (BAT- creased risk of non-sterility, possible genetic
ZING and CLAUS,1973; WHITE and CLAUS, instability of the production organism during
1982).Therefore, when the D-sorbitol substrate long-term fermentation necessitating exten-
was used up and the biomass yield no longer sive analytical characterization work to assure
increased, the cells were separated from the constant product quality, high investment into
medium and stored as a cooled slurry. storage tanks upstream and downstream from
The Gluconobacter biomass production the fermentation itself. The production of Glu-
could successfully be run at the 30 L laborato- conobacter biomass has, however, a good chance
ry scale as a continuous process under chemo- to become one of the very few large scale con-
stat conditions with D-sorbitol limitation; more tinuous fermentations in the pharmaceutical
than 25 volumes of medium were passed area. This is mainly due to the fact that no sig-
through the fermenter with no loss in specific nificant additional investment will be needed
oxidative activity of the Gluconobacter cells neither for the continuous preparation of me-
obtained (SCHEDEL,1997). There are several dium or its storage under sterile conditions nor
reports in the literature that the L-sorbose fer- for the harvest and storage of large volumes of
mentation using Gluconobacter was carried product. The medium can be continuously
out continuously (see, for instance: ELSWORTHmixed together from three liquid streams (wa-
et al., 1959; MULLER,1966; NICOLSKAYA et al., ter, D-sorbitol syrup, concentrated basal medi-
1984). In the pharmaceutical industry, how- um containing salts and yeast extract; see Fig.
ever, continuous fermentations to be run at 7) and passed via a continuous sterilizer into
large scale under completely contamination the fermenter.The microbial biomass is a small
306 7 Regioselective Oxidation ofAminosorbitol with Gluconobacteroxydans
sobitol svruD
1
medium'
>El--+
water
+ continuous I I
sterilizer
supernatant
(waste water)
+biomass slurry
(product)
production fermenter continuous
*concentrated separator
yeast extractlsalt
Fig. 7. Concept for the continuous fermentation of Gluconobacter oxydans on the production scale under
chemostat conditions.
volume product which is harvested continu- need cofactors like NAD or NADP as report-
ously with an existing separator; the culture ed for the sorbitol dehydrogenases which had
supernatant, the large volume side product is been isolated from the soluble fraction by
directly passed to the wastewater plant with- CUMMINS et al. (1957) or HAHNet al. (1989).
out intermediate storage. The existing batch
process plant needs, therefore, only minor
amendments to set up a fully continuous Glu-
conobucter fermentation.
The enzymatic activity for the oxidation of
N-protected 1-amino-1-deoxy-D-sorbitol
8 Conclusions and
is lo-
cated in the membrane fraction. Kinetic stud- Outlook
ies indicated close similarity between D-sorbi-
to1 and N-formyl-1-amino-1-deoxy-D-sorbitol The combined biotechnological-chemical
oxidation. It is likely - but not yet proved - synthesis of 1-deoxynojirimycin is meanwhile
that both substrates are oxidized by the same a well established process on the industrial
enzyme which belongs to either of the two scale which enables the economic production
types of membrane bound D-sorbitol dehydro- of this precursor to Miglitol. Combination of
genases described for G. oxydans: The cyto- biotechnology and chemistry has led to a short
chrome containing three-subunit enzyme with and elegant synthesis with little protection
a total molecular weight of about 140,000 Da group chemistry.
described by SHINAGAWA et al. (1982) and Regarding potential safety risks and envi-
CHOIet al. (1995) or the one-subunit enzyme ronmental aspects the central biotransforma-
with a molecular weight of around 80,OOO Da tion step has significant advantages: The mi-
reported by HOSHINO et al. (1996). The mem- crobially catalyzed polyol oxidation is run
brane bound polyol dehydrogenases do not under physiological conditions and - apart
9 References 307
from acids and bases needed for pH-control - ration of enantiomerically pure cyclic aminoaldi-
involves no toxic, easly inflammable, or other- tols, total synthesis of 1-deoxynojirimycinand 1-
wise hazardous substances. The microorgan- deoxymannojirimycin, Tetrahedron Lett. 26,
ism used is safe. All organic components are 1123-1126.
BERTRAND, M. G. (1898), Action de la bactCrie du
readily degradable. sorbose sur les alcools plurivalents, C. R. Acad.
Compared to a fully chemical synthesis, Sci. 126,762-765.
however, a significant investment is necessary BERTRAND, M. G. (1900),Sur l’oxidation de 1’Crythri-
into a large fermenter with state-of-the-art te par la bactCrie du sorbose; production d’un
technology.A working volume of 30,50, or 100 nouveau sucre: YCrythrulose, C. R. Acad. Sci. 130,
m3 is generally not standard in chemical pro- 1330-1333.
duction. The Gluconobacter fermentation step BERTRAND, M. G. (1904), Etude biochimique de la
has to be run under completely contamination bactCrie du sorbose, Ann. Chim. Phys. 3,181-288.
free conditions, a challenge to the equipment BERTRAND, G., NITZBERG, G. (1928), La fonction
cktonique de l’a-glucoheptulose, C. R. Acad. Sci.
and the qualification of the operators. The 134,1172-1175.
Gluconobacter fermentation produces a large BISCHOFF, H. (1994),Pharmacology of a-glucosidase
volume wastewater stream with a high biolog- inhibition, Eur. J. Clin. Invest. 24,3-10.
ical oxygen demand. If the fermentation is to BOLLENBACK, G. N., UNDERKOFLER, L.A. (1950),The
be run continuously the capacity of the action of Acetobacter suboxydans upon wdesoxy
wastewater plant will soon set the limit to the sugar alcohols,J.Am. Chem. SOC.72,741-745.
overall process. BOSSHARD, W., REICHSTEIN, T. (1935), l-Sorbose-4-
methylather, Helv. Chim.Acta 18,959-961.
BOUDRANT, J. (1990), Microbial processes for ascor-
bic acid biosynthesis: a review, Enzyme Microb.
Technol.U , 322-329.
BUDESfNSK?, M., C E R ~M., , DOLEZALOVA, J., KUL-
9 References HANEK,M.,PAcAK, J.,TADRA,M. (1984),4-Deoxy-
4-fluoro-~-fructose: Preparation and structure,
ANDERSON, L., LARDY, H. A. (1948),The synthesis of Coll. Czech. Chem. Commun. 49,267-274.
D-fructomethylose by biochemical oxidation, J. CARR,J. G., COGGINS, R. A., HOUGH, L., STACY, B. E.,
Am. Chem. SOC.70,596597. WHITING, G. C. (1968), Microbiological oxidation
ARGOUDELIS, A. D., REUSSER, F. (1976), Process for of allitol to L-ribo-hexulose by Acetomonas oxy-
producing antibiotic U-51640, US Patent 3998698. duns, Phytochemistry 7 , 1 4
ARGOUDELIS, A. D., REUSSER, F., MIZSAK,S. A., CHARGAFF, E., MAGASANIK, B. (1946), Oxidation of
BACZYNSKYJ, L. (1976), Antibiotics produced by stereoisomers of the inositol group by Acetobac-
Streptomyces ficellus 11. Feldamycin and noji- ter suboxydans, J. Biol. Chem.165,379-380.
rimycin, J. Antibiot. 29,1007-1014. CHARLSON, A. J., RICHTMYER, N .K. (1960), The iso-
ASANO,N., OSEKI, K., TOMIOKA, E., KIZU,H., MAT- lation of an octulose and an octitol from natural
SUI, K. (1994a), N-Containing sugars from M o w sources: D-glycero-D-manno-octulose and D-
alba and their glycosidase inhibitory activities, erythro-D-galacto-octitol from the avocado and
Carbohydr. Res. 259,243-255. D-glycero-D-manno-octulose from Sedum spe-
ASANO,N.,TOMIOKA, E., KIZU,H., MATSUI,K. cies,J. Am. Chem. SOC.82,3428-3434.
(1994b), Sugars with nitrogen in the ring isolated CHOI,E.-S., LEE,E.-H.,RHEE,S.-K. (1995), Purifica-
from the leaves of Morus bombycis, Carbohydr. tion of a membrane-bound sorbitol dehydrogen-
Res. 253,235-245. ase from Gluconobacter suboxydans, FEMS
AVIGARD, G., ENGLARD, S. (1965),5-Keto-D-fructose. Microbiol. Letters U5,45-50.
I. Chemical characterization and analytical deter- CLISSOLD, S. P., EDWARDS, C. (1988), Acarbose, a
mination of the dicarbonyl hexose produced by preliminary review of its pharmacodynamic and
Gluconobacter cerinus, J. Biol. Chem. 240,229C pharmacokinetik properties, and therapeutic po-
2296. tential, Drugs 35,214-243.
BATZING, B. L., CLAUS,G. W. (1973), Fine structural CUMMINS, J. T., CHELDELIN, V. H., KING,T. S. (1957),
changes of Acetobacter suboxydans during Sorbitol dehydrogenases in Acetobacter suboxy-
growth in a defined medium, J. Bacteriol. 113, dam, J. Biol. Chem. 226,301-306.
1455-1461. CUSHING, I. B., DAVIS,R. V. (1958), Purification of
BERGMAN, H. D. (1999), Major new drugs. Part 2, fructose on ion exchange resins,J.Am. Pharm.As-
Cornmun. Pharm. 90,3539. SOC. 47,765-768.
BERNOTAS, R. C., GANEM, B. (1985), Efficient prepa- DAIGO, K.,INAMORI,Y.,TAKEMOTO,T. (1986),Studies
on the constituents of the water extract of the HAHN,H., HEETHOFF, M., LIST,H.-J., GASSEN, H. G.,
root of mulberry tree (Morus bombycis KOIDZ), JANY,K. D. (1989), Polyol-dehydrogenase from
Chem. Pharm. Bull. 34,2243-2246. Gluconobacter oxydans: Identification, cloning
DE LEY,J., GILLIS,M., SWINGS, J. (1984), Family VI. and expression of the NADH-dependent sorbitol
Acetobacteraceae, in: Bergey s' Manual of System- dehydrogenase 11, DECHEMA Biotechnology
atic Bacteriology, Vol. 1 (KRIEG,N. R., HOLT,J. G., Conferences 3, pp. 345-349. Weinheim: VCH.
Eds.), pp. 267-278. Baltimore: William and Wil- HA", R. M., HUDSON,C. S. (1939), Proof of the
kins. structure and configuration of perseulose (L-gala-
DUNNING, J. W., FULMER, E. I., GUYMON, J. F., UN- heptulose), J. Am. Chem. SOC.61,336-340.
DERKOFLER, L. A. (1938),The growth and chemi- HA", R. M.,TILDEN, E. B., HUDSON, C. S. (1938),The
cal action of Acetobacter suboxydans upon i-ino- oxidation of sugar alcohols by Acetobacter sub-
sitol, Science 87,72. oxydans, J.Am. Chem. SOC.60,1201-1203.
ELSWORTH, R., TELLING, R. C., EAST,D. N. (1959), HARDICK, D. J., HUTCHINSON, D. W. (1993), The bio-
The investment value of continuous culture, J. synthesis of 1-deoxynojirimycinin Bacillus subti-
Appl. Bacteriol. 22,138-152. lis var. niger, Tetrahedron 49,6707-6716.
EITEL, V., LIEBSTER, J. (1949), Oxydation biochi- HARDICK, D. J., HUTCHINSON, D. W.,TREW,S. J., WEL-
mique de la volCmite, Coll. Czech. Chem. Com- LINGTON, E. M. H. (1991), The biosynthesis of
mun. 40,80-90. deoxynojirimycinand deoxymannonojirimycinin
EVANS, S. V., FELLOWS, L. E., SHING, T. K. M., FLEET, Streptomyces subrutilis, J. Chem. SOC., Chem.
G. W. J. (1985), Glycosidase inhibition by plant al- Commun. 729-730.
kaloids which are structural analogues of mono- HARDICK, D. J., HUTCHINSON, D. W.,TREW,S. J., WEL-
saccharides,Phytochemistry 24,1953-1955. LINGTON, E. M. H. (1992), Glucose is a precursor
EzuRE,~., MARUO, S., MIYAZAKI, K., KAWAMATA, M. of 1-deoxynojirimycin and l-deoxymannonoji-
(1985), Moranoline (1-deoxynojirimycin) fer- rimycin in Streptomyces subrutilis, Tetrahedron
mentation and its improvement, Agric. Biol. 48,6285-6296.
Chem. 49,1119-1125. HORII,S., KAMEDA, Y., FUKASE, H. (1982), N-substi-
FLEET,G. W. J. (1989), Homochiral compounds from tuted pseudo-aminosugars, their production and
sugars, Chem. in Britain 25,287-292. use, European Patent 56194.
FLEET,G. W. J., CARPENTER, N. M., PETURSSON, S., HOSHINO,T., OJIMA,s.,SUGISAWA,T. (1996),D-Sorbi-
RAMSDEN, N. G. (1990), Synthesis of deoxynoji- to1 dehydrogenase, European Patent 728840.
rimycin and of nojirimycin Slactam, Tetrahedron HOUGH,L., JONES,J. K. N., MITCHELL, D. L. (1959),
Lett. 31,409-412. The oxidation of some terminal-substituted poly-
FROMMER, W., SCHMIDT, D. D. (1980), 1-Desoxynoji- hydric alcohols by Acetobacter suboxydans, Can.
rimycin-Herstellung,German Patent Offenlegung J. Chem. 37,725-730.
2907190. Hu, C. L., MCCOMB, E. A., RENDIG,~. V. (1965), Iden-
FROMMER, W., MULLER,L., SCHMIDT, D. D., PULS,W., tification of altro-heptulose and L-threitol as pro-
KRAUSE,H.-P. (1978a), Inhibitoren fur a-Gluc- ducts of meso-erythritol oxidation by Acetobacter
osidasen, German Patent Offenlegung 2658561. suboxydans, Arch. Biochem. Biophys. 110, 35CL
FROMMER, W., MULLER,L., SCHMIDT, D. D., PULS,W., 353.
KRAUSE, H.-P., HEBER,U. (1978b), Verfahren zur HUGHES, A. B., RUDGE,A. J. (1994), Deoxynojirimy-
Herstellung von Saccharase-Inhibitoren, die im cin: Synthesis and biological activity, Nut. Prod.
Verdauungstrakt wirksam werden, aus Bacillen, Rep. 11,135-162.
D E 2658563. IIDA, H., YAMAZAKI, N., KIBAYASHI, C. (1987), Total
FROMMER, W., MULLER,L., SCHMIDT, D. D., PULS,W., synthesis of (+)-nojirimycin and (+)-1-deoxyno-
KRAUSE,H . 2 (1979a), Inhibitoren fur a-Gluc- jirimycin,J. Org. Chem.52,3337-3342.
osidasen German Patent Offenlegung 2726898. IKOTA, N. (1989), Synthesis of ( + )-1-deoxynojirimy-
FROMMER, W., MULLER,L., SCHMIDT, D. D., PULS,W., cin from (S)-pyroglutamic acid, Heterocycles 29,
KRAUSE, H.-P. (1979b), Inhibitoren fur Glykosid- 1469-1472.
Hydrolasen aus Bacillen, German Patent Offenle- INOUYE, S.,TSURUOKA,T., NIIDA,T.(1966),The struc-
gung 2726899. ture of nojirimycin, a piperidinose sugar antibio-
FULMER, E. I., UNDERKOFLER, L. A. (1947), Oxida- tic, J.Antibiot. 19,288-292.
tion of polyhydric alcohols by Acetobacter sub- INOUYE,S., TSURUOKA, T., ITO,T., NIIDA,T. (1968),
oxydans, Zowa State Coll. J. Sci. 21,251-270. Structure and synthesis of nojirimycin, Tetra-
GERARD, J., HILLEBRAND, I., LEF&BVRE, P. J. (1987), hedron 24,2125-2144.
Assessment of the clinical efficacy and tolerance ISELIN, B. (1948), Oxidations by Acetobacter suboxy-
of two new a-glucosidase inhibitors in insulin- duns, J. Biol. Chem.175,997-998.
treated diabetics, Int. J. Clin. Pharmacol. 25, ISHIDA, N., KUMAGAI, K., NIIDA,T., HAMAMOTO, K.,
483-488. SHOMURA, T. (1967a), Nojirimycin, a new antibio-
9 References 309
tic. I Taxonomy and fermentation, J. Antibiot. 20, von 1,5-Didesoxy-1,5-imino-D-glucitol und des-
62-65. sen N-Derivaten, European Patent 55431.
ISHIDA,N., KUMAGAI, K., NIIDA,T., HAMAMOTO, K., KODAMA,Y., TSURUOKA, T., NIWA,T., INOUYE,S.
SHOMURA,T. (1967b), Nojirimycin, a new antibio- (1985), Molecular structure and glycosidase-inhi-
tic. I1 Isolation, characterization and biological bitory activity of nojirimycin bisulfite adduct, J.
activity,J. Antibiot. 20,6671. Antibiot. 38,116-118.
JANKE,A. (1960), Die Essigsauregarung, Handbuch KOSSEVA,M., BESCHKOV, V., POPOV,R. (1991), Bio-
der Pflanzenphysiologie Vol. 12,pp. 670-746. Ber- transformation of D-sorbitol to L-sorbose by im-
lin: Springer-Verlag. mobilized cells of Gluconobacter suboxydans in a
JONES,J. K. N., MITCHELL, D. L. (1959),The synthesis bubble column, J. Biotechnol. 19,301-308.
of 5-deoxy-5-S-ethyl-~-threo-pentulose, Can. J. KULHANEK, M. (1970), Fermentation processes em-
Chem. 37,1561-1566. ployed in vitamin C synthesis, Adv. Appl. Micro-
JONES,J. K. N., PERRY,M. B., TURNER,J. C. (1961a), biol. l2,ll-30.
The synthesis of acetamido-deoxy ketoses by KULHANEK, M. (1989), Microbial dehydrogenation
Acetobacter suboxydans. Part I, Can. J. Chem. 39, of monosaccharides, Adv. Appl. Microbiol. 34,
965-972. 141-182.
JONES,J. K. N., PERRY,M. B.,TURNER,J. C. (1961b), KULHANEK, M., TADRA,M., PACAK,J., TREJBALOVA,
The synthesis of acetamido-deoxy ketoses by H., CER&, M. (1977), 5-Deoxy-5-fluoro-~-sorbo-
Acetobacter suboxydans. Part 11, Can. J. Chem. 39, se originating from 2-deoxy-2-fluoro-~-glucitol
2400-2410. by fermentation with Acetomonas oxydans, Folia
JONES,J. K. N., PERRY,M. B., TURNER, J. C. (1962), Microbiol. 22,295-297.
The synthesis of acetamido-deoxy ketoses by LA FERLA,B., NICOTRA, F. (1999), Synthetic methods
Acetobacter suboxydans. Part 111, Can. J. Chem. for the preparation of iminosugars, in: Iminosu-
40,503-510. gars as Glycosidase Inhibitors. Nojirimycin and
JUNGE,B., KRAUSE,H.-P., MOLLER,L., PULS, W. Beyond (STiiTz,A. E., Ed.), pp. 69-92. Weinheim:
(1979), Neue Derivate von 3,4,5-Trihydroxypipe- Wiley-VCH.
ridin, Verfahren zu ihrer Herstellung und ihre LINEK,K., SANDTNEROVA, R., STICZAY,T., KOVACIK,
Verwendung, European Patent 947. V. (1979), The synthesis of 4-doxy-~-glycero-pen-
JUNGE,B., MATZKE,M., STOLTEFUSS, J. (1996), Che- tulose by biochemical dehydrogenation of 2-
mistry and structure-activity relationships of glu- deoxy-D-erythro-pentitol, Carbohydr. Res. 76,
cosidase inhibitors, in: Handbook of Experimen- 290-294.
tal Pharmacology: Oral Antidiabetics (KUHL- MACLAY, W. D., HA", R. M., HUDSON,C. S. (1942),
MANN,J., PULS,W., Eds.), pp. 411482. Berlin: Some studies on L-glucoheptulose, J. Am. Chem.
Springer-Verlag. SOC. 64,1606-1609.
KAUFMANN, H., REICHSTEIN,T. (1967), 6-Desoxy-~- MATSUMURA, S., ENOMOTO, H.,AoYAGI,Y.,YOSHIKI-
idose, 6-Desoxy-~-sorboseund 6-Desoxy-~-pisco- NI,Y.,KURA,K.,YAGI,M. (1979a), Neue N-substi-
se, Helv. Chim. Acta 50,2280-2287. tuierte Moranolinderivate, German Patent Offen-
KINAST,G.,SCHEDEL, M. (1980a),Verfahren zur Her- legung 2915037.
stellung von 6-Amino-6-desoxy-~-sorbose, Euro- MATSUMURA, S., ENOMOTO, H., AOYAGI,Y., EZURE,
pean Patent 8031. Y.,YOSHIKUNI,Y.,YAGI, M. (1979b),Verfahren zur
KINAST, G.,SCHEDEL,M. (1980b),Verfahren zur Her- Gewinnung von Moranolin, German Patent Of-
stellung von N-substituierten Derivaten des 1- fenlegung 2850467.
Desoxynojirimycins, European Patent 12278. MATSUMURA, S., ENOMOTO, H.,AOYAGI,Y.,YOSHIKU-
KINAST,G., SCHEDEL, M. (1981), Vierstufige 1-Des- NI,Y., YAGI,M. (1980), Moranoline, Chem. A bstr.
oxynojirimycin-Synthese mit einer Biotransfor- 93,66581s.
mation als zentralem Reaktionsschritt, Angew. MOSES,V., FERRIER,R. J. (1962), The biochemical
Chem. 93,799-800. preparation of D-XylOSe and L-ribulose. Details of
KINAST,G., SCHEDEL,M., K~BERNICK, W. (1982), the action of Acetobacter suboxydans on D-arabi-
Verfahren zur Herstellung von N-substituierten tol, ribitol and other polyhydroxy compounds,
Derivaten von 1-Desoxynojirimycin, European Biochem. J . 83,8-14.
Patent 49858. MULLER,J. (1966), Untersuchungen iiber die Sorbo-
KITE,G. C.,FELLOWS, L. E., LEES,D. C., KITCHEN, D., segarung in stationarer und kontinuierlicher Kul-
MONTEITH,G. B. (1991), Alkaloidal glycosidase tur, Zbl. Bakt. 1u),349-378.
inhibitors in nocturnal and diurnal uraniine MURAI,H., OHATA,K., ENOMOTO, H., YOSHIKUNI, Y.,
moths and their respective foodplant genera, En- KONO,T., YAGI, M. (1977), 2-Hydroxymethyl-
dospermum and Omphalea, Biochem. System. 3,4,5-trihydroxypiperidin, Extraktionsverfahren
Ecol. 19,441445. zu seiner Herstellung und seine Verwendung als
K~BERNICK, W. (1982), Verfahren zur Herstellung Arzneimittel, German Patent Offenlegung
2656602. to1,J. Am. Chem. Soc. 72,49344937.

MURAO,S., MIYATA, S. (1980), Isolation and charac- ROSENBERG, M.,SVITEL,J., ROSENBERGOVA, I., STUR-
terization of a new trehalase inhibitor, S-GI, DfK, E. (1993), Optimization of sorbose produc-
Agric. Biol. Chem. 44,219-221. tion from sorbitol by Gluconobacter oxydans, Ac-
NAKAMURA,T.,TAKEBE, K., KUDOH, K.,TERADA, A., ta Biotechnol. 35,269-274.
TANDOH, Y. et al. (1993), Effect of an a-glucosid- RUDGE, A. J., COLLINS, I., HOLMES, A. B., BAKER,R.
ase inhibitor on intestinal fermentation and faec- (1994),An enantioselectivesynthesis of deoxyno-
al lipids in diabetic patients, J. Int. Med. Res. 21, jirimycin, Angew. Chem. (Int. Edn. Engl.) 33,
257-267. 2320-2322.
NICOLSKAYA, N., BELAYKOVA, M., STATKEVITSCH, B., SCHEDEL, M. (1997), Oxidation von Aminosorbit
POMORZEVA, N., ABRAMOVA, N. (1984), Plant for durch Gluconobacter oxydans: Ein wichtiger
continuous microbiological oxidation of D-sorbi- Schritt der technischen Miglitolsynthese, Ab-
to1 to L-sorbose, Khim. Farm. Zh. 18,879-892. stracts of 15th Annual Meeting of Biotechnolo-
NISHIKAWA, T., ISHIDA,N. (1965), A new antibiotic gists, p. 178. Frankfurt: DECHEMA.
R-468 active against drug-resistantShigellaJ An- SCHMIDT, D. D., FROMMER, W., JUNGE, B., MULLER,
tibiot. 18,132-133. L., WINGENDER, W. et al. (1977), a-Glucosidase
NISHIMURA, Y. (1991), The synthesis and biological inhibitors. New complex oligosaccharides of
activity of glucosidase inhibitors, J. Synth. Org. microbial origin, Naturwissenschajien 64, 535-
Chem.49,846-857. 536.
NIWA,T., INOUYE,S., TSURUOKA, T., KOAZE,Y., NI- SCHMIDT, D. D., FROMMER, W., MULLER,L., TRU-
IDA, T. (1970), “Nojirimycin”as a potent inhibitor SCHEIT, E. (1979), Glucosidase-Inhibitoren aus
of glucosidase,Agr. Biol. Chem.34,966-968. Bazillen, Natunvissenschajien 66,584-585.
ODAKA,H.,IKEDA,H.(1995),Voghbose (AO-128):A SCHNARR, G. W., SZAREK,W. A., JONES,J. K. N.
hypoglycemic agent,J. Takeda Res. Lab. 54,21-33. (1977), Preparation and activity of immobilized
ONISHI,H., SUZUKI, T. (1969), Microbial production Acetobacter suboxydans cells, Appl. Environ.
of xylitol from glucose, Appl. Microblol. 18,1031- Microbiol. 33,732-734.
1035. SCHRODER, T., STUBBE,M. (1987), Verfahren zur
PAULSEN, H. (1966), Kohlenhydrate mit Stickstoff Herstellung von 1-Desoxynojirimycinund dessen
oder Schwefel im “Halbaceta1”-Ring, Angew. N-Derivaten, European Patent 240868.
Chem. 78,495-510. S c m , H. (1993), Enzymatic deacylation of acyl-
PAULSEN, H. (1999), The early days of monosacchari- aminosorboses, US Patent 5177004.
des containing nitrogen in the ring, in: Iminosu- SCOTT, A. R., TATTERSALL, R. B. (1988), a-Glucosid-
gars as Glycosidase Inhibitors. Nojirimycin and ase inhibition in the treatment of non-insulin-de-
Beyond (STUTZ,A. E., Ed.), pp. 1-7. Weinheim, pendent diabetes mellitus,Diabet. Med. 5,4246.
Wiley-VCH. SHINAGAWA, E., MATSUSHITA, K., ADACHI,O.,
PAULSEN, H., SANGSTER, I., HEYNS,K. (1967), Mono- AMEYAMA, M. (1982), Purification and character-
saccharide mit stickstoffhaltigemRing, XIII. Syn- ization of D-sorbitol dehydrogenase from mem-
these und Reaktionen von Keto-piperidinosen, brane of Gluconobacter suboxydans var. a,Agric.
Chem. Ber. 100,802-815. Biol. Chem. 46,135-141.
PRATT, J. W., RICHTMYER, N. K. (1955), D-Glycero-D- SIMMONDS, M. S. J., KITE,G. C., PORTER,E. A. (1999),
allo-heptose, L-allo-heptulose, D-talo-heptulose Taxonomic distribution of iminosugars in plants
and related substances derived from the addition and their biological activities, in: Iminosugars as
of cyanide to D-allOSe,J.Am. Chem. SOC.77,6326- Glycosidase Inhibitors. Nojirimycin and Beyond
6328. (STOTZ,A. E., Ed.), pp. 8-30. Weinheim: Wiley-
PRATT,J. W., RICHTMYER, N. K., HUDSON, L. C. VCH.
(1952), D-Idoheptulose and 2,7-anhydro-p-~-ido- SPENCER, J. F.T., GORIN, P. A. J. (1968), Microbiologi-
heptulopyranose, J. Am. Chem. SOC. 74, 2210- cal transformations of sugars and related com-
2214. pounds, Progr. Ind. Microbiol. 7,177-220.
REESE,E. T., PARRISH, F. W., ETTLINGER, M. (1971), STEFANOVA, S., KOSEVA,M., TEPAVICHAROVA, I.,
Nojirimycin and D-glUCOnO-1,5-laCtOne as inhibi- BESCHKOV, V. (1987), L-Sorbose production by
tors of carbohydrases, Carbohydr. Res. 18, 381- cells of the strain Gluconobacter suboxvdans en-
388. trapped in a polyacrylamide gel, Biotechnol. Lett.
REICHSTEIN, T., GRUSSNER, A. (1934), Eine ergiebige 9.475-477.
Synthese der 1-Ascorbinsaure(C-Vitamin),Helv. STEWART,L. C., RICHTMYER, N. K., HUDSON, C. S.
Chim.Acta 17,311-328. (1949),The oxidation of volemitol by Acetobacter
RICHTMYER, N. K., STEWART, L. C., HUDSON, C. S. suboxydans and by Acetobacter xylinum, J. Am.
(1950), ~-Fuco-4-ketose,a new sugar produced by Chem. SOC.71,3532-3534.
the action of Acetobacter suboxydans on L-fuci- STEWART, L. C., RICHTMYER, N. K., HUDSON, C. S.
9 References 311
(1952), L-Guloheptulose and 2,7-anhydro-P-~-gu- nobacter oxydans, Mikrobiologiya 48,400405.

loheptulopyranose, J. Am. Chem. SOC. 74,2206- WHISTLER,R. L., UNDERKOFLER, L. A. (1938), The
2210. production of 1-erythrulose by the action of Ace-
STUTZ,A. E. (Ed.) (1999), Zminosugars as Glycosid- tobacter suboxydans upon eryihritol, J. Am. Sac.
use Inhibitors. Nojirimycin and Beyond, Wein- 60,2507-2508.
heim: Wiley-VCH. WHITE,S. A., CLAUS,G. W. (1982), Effect of in-
SUMITA, M., MURAO,S. (1980),Fermentative produc- tracytoplasmic membrane development on oxi-
tion of 1-deoxynojirimycin by cultivating - Strep-
- dation of sorbitol and other polyols by Glucono-
tomyces microorganisms Japanese Patent bacter oxydans,J. Bacteriol. 150,934-943.
55120792. WONG,C.-H., HALCOMB, R. L., ICHIKAWA, Y., KAJI-
TILDEN,E. B. (1939), The preparation of perseulose MOTO, T. (1995), Enzyme in der organischen Syn-
by oxidation of perseitol with Acetobacter sub- these: Das Problem der molekularen Erkennung
oxydans, J. Bacteriol. 31,629-637. von Kohlenhydraten (Teil 1), Angew. Chem. 107,
TIWARI, K. N., DHAWALE, M. R., SZAREK, W. A., HAY, 453-474.
G. W., KROPINSKI, A. M. B. (1986), A synthesis of YAGI,M., KOUNO, T., AOYAGI, Y., MURAI,H. (1976),
2-deoxy-~-arabino-hexitol and its oxidation to 5- The structure of Moranoline, a piperidine alkalo-
deoxy-D-threo-hexulose (“~-deoxy-~-fructose”) id from Morus species, Nippon Nogeikagaku
using immobilized cells of Gluconobacter oxy- Kaishi 50,571-572.
duns, Carbohydr. Res. 156,19-24. YAGI,M., KUONO, T., AOYAGI, Y., MURAI,H. (1977),
TRIFONOV,A., STEFANOVA, S., KONSTANTINOV, H.,TE- The structure of Moranoline, a piperidine alkal-
PAVICHAROvA, I. (1991), Biochemical oxidation of oid from Morus species, Chem.Abstr. 86,167851r.
D-sorbitol to L-sorbose by immobilized Glucono- YAMADA, H., &A, I., NAGAI,T., MATSUMOTO, T.,
bacter oxydans cells, Appl. Biochem. Biotechnol. KIYOHARA, H., OMURA, S. (1993), Screening of cr-
28129,397405. glucosidase inhibitor from Chinese herbs and its
USPENSKAYA, S. N., LOITSYANSKAYA, M. S. (1979), Ef- application on the quality control of mulberry
fectiveness of the utilization of glucose by Gluco- bark, Chem. Abstr. 119,146433r.
8 Engineering Microbial Pathways

for Amino Acid Production
IAN G. FOTHERINGHAM
Mt. Prospect, IL, USA
1 Introduction 314
2 Bacterial Production of L-Phenylalanine 314
2.1 The Common Aromatic and L-Phenylalanine Biosynthetic Pathways 314
2.2 Classical Mutagenesis/Selection 315
2.3 Deregulation of DAHP Synthase Activity 317
2.4 Deregulation of Chorismate Mutase and Prephenate Dehydratase Activity 317
2.5 Precursor Supply 320
2.6 Secretion of Phenylalanine from the Cell 320
3 Bacterial Production of L-Lysine and L-Threonine 321
3.1 Biochemical Pathway Engineering in Corynebacteria 321
3.2 Engineering the Pathways of L-Lysine and L-Threonine Biosynthesis 321
4 Engineering Novel Biochemical Pathways for Amino Acid Production 324
4.1 A Novel Biosynthetic Pathway to L-2-Aminobutyrate 324
4.2 A Novel Biosynthetic Pathway to D-Phenylalanine 325
5 Conclusions 327
6 References 328
314 8 Engineering Microbial Pathways for Amino Acid Production
1 Introduction duction. It will also address aspects of meta-

bolic engineering which have been applied in
the coryneform organisms due to the rapidly
Many thousands of tons of different amino increasing understanding of the molecular ge-
acids are produced annually for a variety of in- netics of those organisms, and their impor-
dustrial applications. In particular, monosodi- tance in amino acid production. Additionally,
um glutamate, phenylalanine, aspartic acid, it will examine the increasing potential to con-
and glycine are produced as human food addi- struct completely novel biochemical pathways
tives and lysine, threonine, methionine, and in organisms such as E. coli in order to pro-
tryptophan are manufactured as animal feed duce non-proteinogenic or unnatural amino
additives (ABEand TAKAYAMA, 1972; BATT et acids.
al., 1985; GARNERet al., 1983; SHIIO,1986).
These and other amino acids are also used as
pharmaceutical intermediates and in a variety
of nutritional and health care industries. In
many cases bacteria are used to produce these 2 Bacterial Production of
amino acids through large scale fermentation,
particularly when a high degree of enantio- L-Phenylalanine
meric purity is required. In some cases chemo-
enzymatic methods have also been successful- 2.1 The Common Aromatic and
ly employed, particularly for L-phenylalanine
and non-proteinogenic amino acids. L-Phenylalanine Biosynthetic
The development of strains for fermenta- Pathways
tion approaches initially consisted of classical
random mutagenesis methods and screening Efforts to develop L-phenylalanine overpro-
with toxic amino acid analogs. In this way com- ducing organisms have been vigorously pur-
mercially viable amino acid overproducing sued by Nutrasweet Company, Ajinomoto,
strains were developed. However, in the 1980s Kyowa Hakko Kogyo, and others. The focus
this approach began to be complemented by has centered upon bacterial strains which have
the availability of molecular biological meth- previously demonstrated the ability to over-
ods and a rapid increase in the understanding produce other amino acids. Such organisms in-
of the molecular genetics of amino acid pro- clude principally the coryneform bacteria,
duction in particular bacterial species. The Brevibacterium j7avum (SHIIOet a]., 1988) and
availability of plasmid vector systems, trans- Corynebacterium glutamicum (HAGINOand
formation protocols, and general recombinant NAKAYAMA, 1974b; IKEDAet al., 1993) used
DNA methodology enabled biochemical path- in L-glutamic acid production. In addition
ways to be altered in much more precise ways Escherichia coli (TRIBE,1987) has been exten-
to further enhance amino acid titer and pro- sively studied in L-phenylalanine manufacture
duction efficiency in Escherichia coli and in due to the detailed characterization of the mo-
the coryneform bacteria Corynebacterium and lecular genetics and biochemistry of its aro-
Brevibacterium, the most prominent amino matic amino acid pathways and its amenability
acid producing bacteria. This chapter will to recombinant DNA methodology. The bio-
center upon the most significant aspects of chemical pathway which results in the synthe-
biochemical pathway engineering such as the sis of L-phenylalanine from chorismate is iden-
identification of rate limiting enzymatic steps tical in each of these organisms and shown in
and the elimination of allosteric feedback inhi- Fig. 1.The common aromatic pathway to chor-
bition of key enzymes. Considerable emphasis ismate in E. coli is shown in Fig. 2. In each case
will be placed upon the shikimate and phenyl- the L-phenylalanine biosynthetic pathway
alanine pathways of E. coli which are among comprises three enzymatic steps from choris-
the best characterized biochemically and ge- mic acid, the product of the common aromatic
netically and have been the subject of some of pathway. The precursors of the common aro-
the most widespread efforts in amino acid pro- matic pathway, phosphoenolpyruvate (PEP)
2 Bacterial Production of i>-Phenylalanine 315
Chorismate Prephenate
&A%___, “TCr
I I
I
m Chorismate
mutase OH
IPhW
Prephenate
dehydratase
(PheN
Aromatic
transaminase
(W r B )
Aspartate
transaminase
- 0
(asPC)
Fig. 1. The biosynthetic pathway

from chorismate to L-phenyl-
alanine in E. coli K12. L-Phenylalanine Phenylpyruvate
and erythrose-4-phosphate (E4P) derive re- ino-heptulosonate-7-phosphate(DAHP) syn-

spectively from the glycolytic and pentose thase and prephenate dehydratase. Classical
phosphate pathways of sugar metabolism. Al- mutagenesis approaches using toxic amino
though the intermediate compounds in both acid analogs and the molecular cloning of the
pathways are identical in each of the organ- genes encoding these enzymes have led to
isms, there are differences in the organization very significant increases in the capability of
and regulation of the genes and enzymes in- host strains to overproduce L-phenylalanine.
volved (HUDSONand DAVIDSON, 1984; OZAKI This has resulted from the elimination of the
et al., 1985; SHIIOet al., 1988). Nevertheless, regulatory mechanisms controlling enzyme
the principal points of pathway regulation are synthesis and specific activity. The cellular
very similar in each of the three bacteria mechanisms which govern the activity of these
(HUDSONand DAVIDSON, 1984; IKEDAet al., particular enzymes are complex and illustrate
1993; SHIIOand SUGIMOTO, 1981b). Converse- many of the sophisticated means by which bac-
ly, tyrosine biosynthesis which is also carried teria control gene expression and enzyme ac-
out in three biosynthetic steps from choris- tivity. Chorismate mutase, the first step in the
mate, proceeds through different intermedi- phenylalanine specific pathway and the shiki-
ates in E. coli than in the coryneform organ- mate kinase activity of the common aromatic
isms (HUDSON and DAVIDSON, 1984; SHIIOand pathway are subject to a lesser degree of regu-
SUGIMOTO, 1981b). lation and have also been characterized in de-
In E. coli, regulation of phenylalanine bio- tail (MILLARet al., 1986;NELMSet al., 1992).
synthesis occurs both in the common aromat-
ic pathway, and in the terminal phenylalanine
pathway and the vast majority of efforts to de- 2.2 Classical Mutagenesis/Selection
regulate phenylalanine biosynthesis have fo-
cused upon two specific rate limiting enzymat- Classical methods of strain improvement
ic steps. These are the steps of the aromatic have been widely applied in the development
and the phenylalanine pathways carried out of phenylalanine overproducing organisms
respectively by the enzymes 3-deoxy-~-arab- (SHIIOet al., 1973;TOKORO et al., 1970;TRIBE,
3-Deoxy-~-arabino-
Erythrose 4-phosphate
heptulosonate 7-phosphate
DAHP synthase (aroF-Tyr)
Isoenzymes (aroG-Phe)
(aroH-Trp)
OH P H2
I
OH
Phosphoendpyruvate Dehydroquinate
synthase
(aroB)
Shikimate Dehydroquinate
dehydrogenase dehydratase
(aroEl (aroD)
e---
OH OH OH
I
Shikimate 3-Dehydroshikimate 3-Dehydroquinate
Shikimate kinases
(I-aroK, 11-aroL)
ate synthase 'f"
Shikimate 3-phosphate 5-Enolpyruvylshikimate- Chorismate

3-phosphate
Fig. 2. The common aromatic pathway to chorismate in E. coli K12. The mnemonic of the genes involved are
shown in parenthesesbelow the enzymes responsible for each step.
1987; TSUCHIDA et al., 1987). qrosine auxo- steric deregulation of common biosynthetic
trophs have frequently been used in efforts to steps (WALLACEand PITTARD, 1969). Such
increase phenylalanine production through strains have been subjected to a variety of mu-
mutagenesis. These strains often already over- tagenesis procedures to further increase the
produce phenylalanine due to the overlapping overall titer and the efficiency of phenylala-
nature of tyrosine and phenylalanine biosyn- nine production. In general this has involved
thetic regulation (HAGINOand NAKAYAMA,the identification of mutants which display re-
1974b; HWANGet al., 1985). Limiting tyrosine sistance to toxic analogs of phenylalanine or
availability leads to partial genetic and allo- tyrosine such as @-2-thienyl-~,~-alanine
and
p-fluoro-D,L-phenylalanine (CHOIand TRIBE, whereas the aroH gene product is subject to

1982; HAGINO and NAKAYAMA, 1974b; TRIBE, maximally 40% feedback inhibition by trypto-
1987). Such mutants can be readily identified phan (GARNER et al., 1983).In Brevibacterium
on selective plates in which the analog is flavum, DAHP synthase forms a bifunctional
present in the growth medium. The mutations enzyme complex with chorismate mutase and
responsible for the phenylalanine overproduc- is feedback inhibited by tyrosine and phenylal-
tion have frequently been located in the genes anine synergistically but not by tryptophan
encoding the enzymatic activities DAHP syn- (SHIIO et al., 1974;SUGIMOTO and SHIIO, 1980).
thase, chorismate mutase, and prephenate de- Similarly in Corynebacterium glutamicum
hydratase. In turn this has prompted molecular DAHP synthase is inhibited most significantly
genetic approaches to further increase phenyl- by phenylalanine and tyrosine acting in
alanine production through the isolation and concert (HAGINO and NAKAYAMA, 1975b) but,
in vitro manipulation of these genes as de- unlike Brevibacterium flavum, reportedly it
scribed below. does not show tyrosine mediated repression of
transcription (HAGINO and NAKAYAMA, 1974c;
SHIIOet al., 1974).
2.3 Deregulation of DAHP Many analog resistant mutants of these or-
ganisms display reduced sensitivity of DAHP
Synthase Activity synthase to feedback inhibition (HAGINO and
NAKAYAMA, 1974b; OZAKIet al., 1985; SHIIO
The activity of DAHP synthase commits and SUGIMOTO, 1979; SHIIOet al., 1974; SUGI-
carbon from intermediary metabolism to the MOT0 et al., 1973; TRIBE,1987). In E. coli the
common aromatic pathway converting equi- genes encoding the DAHP synthase isoen-
molar amounts of PEP and E4P to DAHP zymes have been characterized and sequenced
(HASLAM, 1974). In E. coli there are three iso- (DAVIESand DAVIDSON, 1982; HUDSONand
enzymes of DAHP synthase of comparable DAVIDSON, 1984; RAY et al., 1988).The mecha-
catalytic activity encoded by the genes aroF, nism of feedback inhibition of the aroF, aroG,
aroG, and aroH (PITTARDand GIBSON, 1970). and aroH isoenzymes has been studied in con-
Enzyme activity is regulated respectively by siderable detail (RAY et al., 1988) and variants
the aromatic amino acids tyrosine, phenylala- of the aroF gene on plasmid vectors have been
nine, and tryptophan (BROWN, 1968; BROWN used to increase phenylalanine overproduc-
and SOMERVILLE, 1971; CAMAKARIS and PIT- tion. Simple replacement of transcriptional
TARD, 1973; I M et al., 1971; WALLACE and PIT- control sequences with powerful constitutive
TARD, 1969).In each case regulation is mediat- or inducible promoter regions and the use of
ed both by repression of gene transcription high copy number plasmids has readily en-
and by allosteric feedback inhibition of the enabled overproduction of the enzyme (ED-
zyme, though to different degrees. WARDS et al., 1987;FOERBERG et al., 1988),and
The aroF gene lies in an operon with tyrA reduction of tyrosine mediated feedback inhi-
which encodes the bifunctional protein choris- bition has been described using resistance to
mate mutase/prephenate dehydrogenase. Both the aromatic amino acid analogs P-2-thi-enyl-
genes are regulated by the TyrR repressor pro- D,L-alanine and p-fluoro-D,L-phenylalanine
tein complexed with tyrosine. The aroG gene (EDWARDS et al., 1987;TRIBE, 1987).
product accounts for 80% of the total DAHP
synthase activity in wild type E. coli cells. The
aroG gene is repressed by the TyrR repressor 2.4 Deregulation of Chorismate
protein complexed with phenylalanine and
tryptophan. Repression of aroH is mediated Mutase and Prephenate
by tryptophan and the TrpR repressor protein Dehydratase Activity
(BROWN, 1968).The gene products of aroF and
aroG are almost completely feedback inhibit- The three enzymatic steps by which choris-
ed respectively by low concentrations of tyro- mate is converted to phenylalanine appear to
sine or phenylalanine (GARNER et al., 1983) be identical between C. glutamicum, B. flavum,
and E. coli although only in E. coli have de- ER and DIJKHUIZEN, 1990; HAGINOand NA-
tailed reports appeared upon the charac- KAYAMA, 1974a,1975a).The only transcription-
terization of the genes involved. In each case al repression reported is that of chorismate
the principal regulatory step is that catalyzed mutase by phenylalanine. The C. glutamicum
by prephenate dehydratase. In E. coli, choris- genes encoding prephenate dehydratase and
mate is converted firstly to prephenate and chorismate mutase have been isolated and
then to phenyl pyruvate by the action of a bi- cloned from analog resistant mutants of C. glu-
functional enzyme, chorismate mutase/pre- tamicum (IKEDAand KATSUMATA, 1992;OZAKI
phenate dehydratase (CMPD) encoded by the et al., 1985) and used along with the cloned
pheA gene (HUDSONand DAVIDSON, 1984). D A W synthase gene to augment L-phenylala-
The final step, in which phenyl pyruvate is con- nine biosynthesis in overproducing strains of
verted to L-phenylalanine, is camed out pre- C. glutumicum (IKEDAand KATSUMATA, 1992).
dominantly by the aromatic aminotransferase Many publications and patents have de-
encoded by fyrB (GARNERet al., 1983). How- scribed successful efforts to reduce and elimi-
ever both the aspartate aminotransferase, en- nate regulation of prephenate dehydratase ac-
coded by aspC and the branched chain amino- tivity in phenylalanine overproducing organ-
transferase encoded by ilvE can catalyze this isms (FOERBERG et al., 1988;NELMSet al., 1992;
reaction (FOTHERINGHAM et al., 1986).Phenyl- TRIBE,1987).As with DAHP synthase the ma-
alanine biosynthesis is regulated by control of jority of the reported efforts have focused
CMPD through phenylalanine mediated at- upon the E. coli enzyme encoded by the pheA
tenuation of pheA transcription (HUDSON and gene which is transcribed convergently with
DAVIDSON, 1984) and by feedback inhibition of the tyrosine operon on the E. coli chromosome
the prephenate dehydratase (PD) and choris- (HUDSONand DAVIDSON, 1984). The detailed
mate mutase (CM) activities of the enzyme. In- characterization of the pheA regulatory region
hibition is most pronounced upon the prephen- has facilitated expression of the gene in a va-
ate dehydratase activity,with almost total inhi- riety of transcriptional configurations leading
bition observed at micromolar phenylalanine to elevated expression of CMPD, and a num-
concentrations (DOPHEIDE et al., 1972; ber of mutations in pheA which affect phenyl-
GETHINGand DAVIDSON, 1978). Chorismate alanine mediated feedback inhibition have
mutase activity in contrast is maximally inhib- been described (BACKMAN and BALAKRISH-
ited to only 40% (DOPHEIDE et al., 1972).In B. NAN,1988; EDWARDS et al., 1987; NELMSet al.,
jlavum, prephenate dehydratase and choris- 1992). Increased expression of the gene is
mate mutase are encoded by distinct genes. readily achieved by cloning pheA onto multi-
Prephenate dehydratase is again the principal copy plasmid vectors and deletion of the nu-
point of regulation with the enzyme subject to cleotide sequences comprising the transcrip-
feedback inhibition, but not transcriptional re- tion attenuator illustrated in Fig. 3. Most muta-
pression, by phenylalanine (SHIIOand SUGI- tions which affect the allosteric regulation of
MOTO, 1976;SUGIMOTO and SHIIO,1974). Chor- the enzyme by phenylalanine have been iden-
ismate mutase which in this organism forms a tified through resistance to phenylalanine ana-
bifunctional complex with DAHP synthase is logs such as P-Zthienylalanine, but there are
maximally inhibited by phenylalanine and ty- examples of feedback resistant mutations aris-
rosine to 65%, but this is significantly dimin- ing through insertional mutagenesis and gene
ished by the presence of very low levels of truncation (BACKMANand BALAKRISHNAN,
tryptophan (SHIIO and SUGIMOTO,1981a). 1988;EDWARDS et al., 1987).Two regions of the
Expression of chorismate mutase is repressed enzyme in particular have been shown to re-
by tyrosine (SHIIOand SUGIMOTO, 1979; SUGI- duce feedback inhibition to different degrees.
MOTO and SHIIO,1985).The final step is carried Mutations at position Trp338 in the peptide se-
out by at least one transaminase (SHIIOet al., quence desensitize the enzyme to levels of
1982).Similarly in C. glutumicum, the activities phenylalanine in the 2-5 mM range but are in-
are encoded in distinct genes with prephenate sufficient to confer resistance to higher con-
dehydratase again being the more strongly centrations of L-phenylalanine (BACKMAN and
feedback inhibited by phenylalanine (DE Bo- BALAKRISHNAN, 1988; EDWARDS et al., 1987).
- -35 - -1 0
TGTATCGCCA?CGCGCCTTCGGGCGCGTTTTTT(YMYUCMT
A AAAaTCACTTAAGGAAACAAACATGAAACACATACCGTTTTTCTTCGCATTCTTTTTTACCTTCCCC
AllENUATOR REGION
TGAATGGGAGGCGTTTCGTCGTGTGAAACAGAATGCGAAGAATGCG~GACGAACAAT~GGCC~CCAAATCGGG
-35 - -1 0
- M T S E N P
GAATTCTPTTTTG?TGACAGCCTGAAAACAGTAC~~A~TACT~~CAC~~C~~CTATGA~TC~~CCCG
-
COOING SEQUENCE
Fig. 3. A. Sequence of the wild type promoter region of the E. coli K12pheA gene. The -35 and -10 hexamers
are indicated. Bases retained in the deregulated promoter are in bold type. Sequence involved in the at-
tenuator region is shown underlined. B. Sequence of the deregulated pheA promoter region used to produ-
ce chorismate mutase/prephenate dehydratase. Altered bases in the -10 region are shown underlined.
Mutations in the region of residues 304-310 (JN305-JN308) are shown in Fig. 4, in compar-
confer almost total resistance to feedback inhi- ison to the profile of wild-type enzyme
bition at L-phenylalanine concentrations of at (JN302). It is not clear, if the mechanism of re-
least 200 mM (NELMSet al., 1992). Feedback sistance is similar in either case, but the differ-
inhibition profiles of four such variants ence is significant to commercial application as
120
100
80
60
40
-
-
IJN302
-
PI
c)
JN305
c 20 IJN306
c JN307
n
n
e JN308
0
0 50 100 150 200
L-phrnylalanlno concentration (mM)
Fig. 4. L-Phenylalanine mediated feedback inhibition of wild type E. coli K12 prephenate
dehydratase (JN302) and four feedback inhibition resistant enzyme variants
(JN305-JN308).Activity is expressed as a percentage of normal wild-type enzyme activity.
overproducing organisms readily achieve ex- successful in directing additional flux of PEP
tracellular concentrations of L-phenylalanine or E4P into the aromatic pathway, although
over 200 mM. their effect has not proved to be as predictable
as the deregulation of rate limiting pathway
steps and their overall impact on L-phenylala-
2.5 Precursor Supply nine overproduction has not been well charac-
terized.
Rate limiting steps in the common aromatic
and phenylalanine biosynthetic pathways are
obvious targets in the development of phenyl- 2.6 Secretion of Phenylalanine
alanine overproducing organisms. However, from the Cell
the detailed biochemical and genetic charac-
terization of E. coli has enabled additional ar- Exodus of phenylalanine is of manifest
eas of its metabolic function to be specifically importance in the large scale production of
manipulated to determine their effect on aro- phenylalanine as the amino acid is typically re-
matic pathway throughput. Besides efforts to covered only from the extracellular medium
eliminate additional lesser points of aromatic and washed cells. Lysis of cells to recover addi-
pathway regulation, attempts have been made tional phenylalanine is not generally practical
to enhance phenylalanine production by in- and so L-phenylalanine remaining within the
creasing the supply of aromatic pathway pre- cells following washing is usually lost. Since
cursors and by facilitating exodus of L-phenyl- cell biomass is extremely high in large scale
alanine from the cell. The precursors of the fermentations this can represent up to 5% of
common aromatic pathway D-erythrose 4- total phenylalanine produced. Additionally,
phosphate and phosphoenolpyruvate are the since L-phenylalanine is known to regulate its
respective products of the pentose phosphate own biosynthesis at multiple points through
and glycolytic pathways. Precursor supply in feedback inhibition, attenuation, and TyrR
aromatic amino acid biosynthesis has been re- mediated repression, methods to reduce intra-
viewed recently (BERRY,1996; FROSTand cellular concentrations of phenylalanine
DRATHS,1995). Theoretical analyses of the through reduced uptake or increased exodus
pathway and the cellular roles of these metab- throughout the fermentation have been
olites suggest that the production of aromatic sought. Studies have addressed the means by
compounds is likely to be limited by PEP which L-phenylalanine is both taken up and
availability (PATNAIK and LIAO,1994; PATNAIK excreted by bacterial cells, and whether this
et al., 1995), since phosphoenolpyruvate is in- can be altered to increase efflux. In overpro-
volved in a number of cellular processes inducing strains it is likely that most phenyl-
cluding the generation of metabolic energy alanine leaves the cell by passive diffusion but
through the citric acid cycle (MILLERet al., specific uptake and exodus pathways also ex-
1987) and the transport of glucose into the cell ist. In E. coli L-phenylalanine is taken up by at
by the phosphotransferase system (POSTMA, least two permeases (WHIPP and PITTARD,
1987).Strategies to reduce the drain of PEP by 1977), one specific for phenylalanine encoded
these processes have included mutation of sug- bypheP, and the other encoded by aroP a gen-
ar transport systems to reduce PEP dependent eral aromatic amino acid permease respon-
glucose transport (FLORESet al., 1996) and sible for the transport of tyrosine and trypto-
modulation of the activities of pyruvate kin- phan in addition to phenylalanine. The genes
ase, PEP synthase, and PEP carboxylase which encoding the permeases have been cloned and
regulate PEP flux to pyruvate, oxalo- sequenced and E. coli mutants deficient in ei-
acetate, and the citric acid cycle (BERRY,1996; ther system have been characterized (HONORE
BLEDIG,1994; MILLERet al., 1987). Similarly, and COLE,199QP1et al., 1991).The effect of an
the availability of E4P has been increased by aroP mutation has been evaluated in L-phenyl-
altering the levels of transketolase, the enzyme alanine overproduction (TRIBE,1987).In addi-
responsible for E4P biosynthesis (DRATHSet tion specific export systems have been identi-
al., 1992). In general these efforts have been fied which though not completely character-
3 Bacterial Production of L-Lysine and L-Threonine 321
ized have been successfully used to increase 1986; DUPERRAY et al., 1992). The enzyme glu-
exodus of L-phenylalanine from strains of tamate dehydrogenase encoded by the gdh
E. coli (FOTHERINGHAM et al., 1994;MULCAHY, gene is principally responsible for the biosyn-
1988). In one such system the Cin invertase of thesis of L-glutamate in the corynebacteria
bacteriophage P1 has been shown to induce a from the keto acid precursor 2-ketoglutarate
metastable phenylalanine hyper-secreting (TESCHet al., 1998). Although relatively few
phenotype upon a wild type strain of E. coli. genetic studies have been published on this en-
The phenotype can be stabilized by transient zyme (BOERMANN et al., 1992),many advances
introduction of the invertase on a temperature in both the genetic organization and the tech-
sensitive plasmid replicon and is sufficient to nology to manipulate DNA in the corynebac-
establish L-phenylalanine overproduction in teria have been made in the last two decades
the absence of any alterations to the normal (ARCHERand SINSKEY,1993; MARTINet al.,
biosynthetic regulation (FOTHERINGHAM et al., 1987; SANTAMARIAet al., 1987). This has ena-
1994). bled molecular genetic approaches to comple-
The incremental gains made from the vari- ment conventional strain development for the
ous levels at which phenylalanine biosynthesis production of amino acids such as L-threonine
has been addressed have led to the high effi- and L-lysine in Corynebacterium (ISHIDAet al.,
ciency production strains currently in use. Al- 1993,1989; JEITEN and SINSKEY, 1995). These
most all large scale L-phenylalanine manufac- advances have been thoroughly reviewed
turing processes in present operation are fer- quite recently (JETEN et al., 1993;JEITENand
mentations employing bacterial strains such as SINSKEY,1995; NAMPOOTHIRI and PANDAY,
those described above in which classical strain 1998) and will be summarized here with only
development and/or molecular genetics have key aspects relevant to microbial pathway en-
been extensively applied to bring about gineering emphasized.
phenylalanine overproduction. The low sub- The use of E. coli has been a valuable tool to
strate costs and the economics of scale associ- the researchers in the corynebacteria as many
ated with this approach have resulted in signif- of the genes encoding the key enzymes in the
icant economic advantages. biosynthesis of these amino acids were initial-
ly isolated through complementation of the
corresponding mutants in E. coli (JEITENand
SINSKEY,1995). Similarly, transconjugation of
plasmids from E. coli to various Corynebacte-
3 Bacterial Production of rium strains, facilitating gene disruption and
L-Lysine and L-Threonine replacement, has helped characterize the roles
of specific genes, particularly in lysine and
threonine biosynthesis (PUHLERet al., 1990;
3.1 Biochemical Pathway SCHWARZER and PUHLER,1991). The recent
Engineering in Corynebacteria development of Corynebacterium cloning vec-
tors has further facilitated the studies of gene
The fermentative production of L-glutamate regulation and expression in these strains
and amino acids of the aspartate family such as (JEITENet al., 1994; MARTINet al., 1987;MIWA
lysine and threonine, has been dominated by et al., 1985).
the use of the coryneform organisms such as C.
glutamicum. Several strains of the corynebac-
teria have been used for decades to produce L- 3.2 Engineering the Pathways of
glutamic acid (ABE and TAKAYAMA,1972;
GARNERet al., 1983; YAMADAet al., 1973). L-Lysine and L-Threonine
These organisms have been found to secrete Biosynthesis
the amino acid at very high concentrations
through changes in the cell membrane induced The biosynthesis of the aspartate derived
either by biotin limitation or by the addition of amino acids is significantly impacted by the
various surfactants (CLEMENTand LANEELLE, regulation of aspartokinase, the enzyme gov-
erning the flow of carbon entering the initial diaminopimelate (CREMER et al., 1991;
common pathway, shown in Fig. 5, and encod- SCHRUMPF et al., 1991).
ed by the ask gene in C. gfutamicum.In the As a converse approach to the funneling of
case of C. glutamicum and B. flavum asparto- carbon to the lysine specific pathways by over-
kinase is tightly regulated by concerted feed- production of dihydropicolinate synthase, the
back inhibition, mediated by threonine and ly- elimination of this activity by mutation of the
sine (SHIIOand MIYAJIMA, 1969). Through dapA gene led to significant overproduction of
classical mutagenesishelection using the toxic L-threonine (SHIIOet al., 1989) to over 13 g
lysine analog S-(a-aminoethy1)-D,L-cysteine, L-l in a strain of B. flavum which also carried
lysine overproducing strains of C. glutamicum a feedback inhibition resistant aspartokinase.
were obtained which frequently carried vari- This was determined to be comparable in
ants of aspartokinase resistant to feedback in- productivity to the more typical overproduc-
hibition by lysine and/or threonine (KALINOW- ing strains of B. flavum carrying mutations in
SKI et al., 1991; TOSAKA and TAKINAMI, 1986). homoserine dehydrogenase which eliminate
Sequence comparisons between the wild type the normal threonine mediated feedback in-
and mutant ask gene sequences assigned hibition. This is typically selected by the now
mutations conferring feedback resistance to familiar mutagenesis/selection methods in-
the @-subunitof the enzyme (FOLLEITIE et al., volving resistance to the toxic threonine ana-
1993; KALINOWSKIet al., 1991), although the log D,L-a-amino-@-hydroxyvaleric acid. Sim-
mechanism of feedback inhibition and of resis- ilar levels of threonine overproduction have
tance remains unknown. Similar mutations been reported in recombinant E. coli strains in
have been identified in the @-subunitof C.fac- which the threonine operon from a classically
tofermentum and in B. flavum (SHIIOet al., derived overproducing mutant was cloned on
1993,1990). a multi-copy plasmid and re-introduced to the
By analogy to the feedback resistant muta- same host (MIWAet al., 1983). Significantly
tions in prephenate dehydratase and the greater titers of threonine production have
DAHP synthases of the E. cofi phenylalanine been reported by introducing the same cloned
and common aromatic pathways, the identifi- threonine operon into mutant strains of B. fla-
cation of feedback resistant variants of aspar- vum grown with rigorous plasmid mainte-
tokinase has contributed significantly to ef- nance (ISHIDAet al., 1989).
forts to engineer lysine and threonine overpro- The ability of the corynebacteria to over-
ducing strains of Corynebacterium. Introduc- produce these amino acids sufficiently for
tion of feedback resistant Ask variants to ly- commercial use is partly due to the extraordi-
sine overproducing strains of C. gfutamicum nary efficiency with which this type of organ-
and C. lactofermentum enhanced extracellular ism can secrete amino acids. For this reason it
lysine levels, the latter in a gene dosage depen- has been useful in the production of isoleucine
dent manner (CREMERet al., 1991; JETTEN et (COLONet al., 1995) and other amino acids
al., 1995). Overexpression of the wild type di- (NAMPOOTHIRI and PANDEY,1998) without ne-
hydropicolinate synthase, on a multi-copy cessitating the elimination of feedback inhibi-
plasmid also leads to elevated lysine production of key enzymes in the biochemical path-
tion (CREMER et al., 1991) as might be expec- ways involved. Nevertheless, in the examples
ted, as this is the branch point of lysine and described above the availability of detailed in-
threonine biosynthesis in Corynebacterium.No formation on the molecular genetic control of
increase in extracellular lysine was observed metabolic and biosynthetic pathways is of fun-
with the overexpression of each of the remain- damental importance in achieving optimal lev-
ing enzymes of the primary lysine biosynthetic els of amino acid production. Similarly the ap-
pathway. A secondary pathway of lysine bio- plication of recombinant DNA methodology
synthesis exists in C. gfutamicum,which allows to a wider array of microbes is enhancing the
complementation of mutations in the ddh gene potential to effectively screen for mutations
encoding diaminopimelate dehydrogenase, which relieve feedback inhibition, frequently
but was unable at least in the wild type state to the most crucial aspect of deregulating biosyn-
provide high throughput of precursors to D,L thesis of primary metabolites such as amino
3 Bacterial Production of L-Lysine and ~-Threonine 323
OH
I
Aspartokinase
L-Aspartyl
phosphate
1 Aspartate semialdehyde
dehydrogenase
(as4
L-Aspartate
semialdehyde
1
Homoserine
dehydrogenase
(horn)
OH
I
L-Lysine
H2N )K- O
L-Homoserine
H2N
0
L-Isoleucine L-Threonine L-Methionine

Fig. 5. The common pathway of the aspartate derived amino acids in corynebacteria.
The mnemonic of the genes involved are shown in parentheses below the enzymes re-
sponsible for each step. Dotted lines indicate multiple enzymatic steps.
acids.As a results the potential to engineer mi- phimurium to enable fermentative production
crobial pathways is increasing significantlyand of a number of D-amino acids from L-amino
includes opportunities to construct novel bio- acid starting materials. Using these approach-
chemical routes for the biosynthesis of non- es, compounds such as D-phenylalanine, L-ter-
proteinogenic amino acids. tiary leucine, and both isomers of 2-aminobu-
tyrate have been produced (AGERet al., 1997;
FOTHERINGHAM et al., 1997). Some aspects of
these processes are described below.
4 Engineering Novel
Biochemical Pathways for 4.1 A Novel Biosynthetic Pathway
to L-2-Aminobutyrate
Amino Acid Production
In addition to the identification of the ap-
The biosynthesis of most proteinogenic ami- propriate biosynthetic enzyme, the feasibility
no acids including those described above di- of all biotransformation processes depends
rectly or indirectly involves a transamination heavily upon other criteria such as the avail-
step (GARNERet al., 1983). Biochemical stud- ability of inexpensive starting materials, the re-
ies on a number of the bacterial L-amino acid action yield and the complexity of product re-
transaminases (aminotransferases) respon- covery. In the case of transaminase processes,
sible for this reaction have revealed that these the reversible nature of the reaction as shown
enzymes frequently display broad substrate in Fig. 6 and the presence of a keto acid by-
specificity. The aromatic transaminase of E. product is a concern which limits the overall
coli, e.g., is capable of synthesizing aspartate yield and purity of the amino acid product, and
and leucine in addition to the aromatic amino has led to efforts to increase the conversion
acids phenylalanine and tyrosine. Similarly,the beyond the typical 50% yield of product
E. coli branched chain transaminase can syn- (CRUMPand ROZZELL,1992; TAYLORet al.,
thesize phenylalanine and methionine in addi- 1998). Additionally, there are cost considera-
tion to the branched chain amino acids, isoleu- tions in the large scale preparation of keto
cine, leucine, and valine (CHIHARA, 1985).The acid substrates such as 2-ketobutyrate, which
relatively relaxed substrate specificity of mi- are not commodity chemicals.
crobial transaminases has been useful in the These issues are very readily addressed in
development of biotransformation approaches whole cell systems as additional microbial en-
for the synthesis of non-proteinogenic L-ami- zymes can be used to generate substrates from
no acids, which are now in increasing demand inexpensive precursors and convert unwanted
as intermediates for the synthesis of peptidomi- by-products to more easily handled com-
metic pharmaceuticals. Additionally the avail- pounds. For the biosynthesis of 2-aminobuty-
ability of a highly efficient screen has enabled rate using the E. coli aromatic transaminase
the cloning of a number of genes encoding D- (FOTHERINGHAM et al., 1999), the engineered
amino acid transaminase from a variety of mi- E. coli incorporates the cloned E. coli K12 ilvA
crobial species.One of these genes, from Bacil- gene encoding threonine deaminase to gener-
lus sphaericus, has been engineered into a syn- ate 2-ketobutyrate from the commodity amino
thetic pathway in E. coli along with an L-amino acid L-threonine, and the cloned alsS gene of
acid deaminase from Proteus myxofaciens and Bacillus subtilis 168 encoding acetolactate syn-
an amino acid racemase from Salmonella ty- thase which eliminates pyruvate, the keto acid
0 R transarninase
+
-
~
RKCOz- +Ii3Jco*-
Fig. 6. Transaminase reaction scheme.Transaminases occur as L-amino acid or D-amino acid specific.
4 Engineering Novel Biochemical Pathways for Amino Acid Production 325
by-product of the reaction, through the forma- acid impurity increases to 22.5 :1 from 2.4: 1
tion of non-reactive acetolactate. The B. subri- reducing the complexity of the product recov-
lis enzyme is preferable to the acetolactate ery. Incremental improvements remain to be
synthases of E. coli, which also use 2-ketobuty- made in the prevention of undesired catabo-
rate as a substrate, due to their overlapping lism of substrates by metabolically active
roles in branched chain amino acid biosynthe- whole cells as the overall product yield is only
sis. The process is operated as a whole cell 54% although the substrates are almost entire-
biotransformation in a single strain with the ly consumed.The detailed understanding of E.
reaction scheme as shown in Fig. 7 producing coli metabolism and genetics increases the
27 g L-' of L-Zaminobutyrate. The effect of likelihood of eliminating such undesirable cat-
the concerted action of these three enzymes abolic side reactions.
on the process of L-2-aminobutyrate biosyn-
thesis is very significant. Process economics
benefit from the use of an inexpensive amino 4.2 A Novel Biosynthetic Pathway
acid such as L-threonine as the source of 2-ke- to D-Phenylalanine
tobutyrate and L-aspartic acid as the amino
donor. Secondly with the additional acetolac- Unlike the L-amino acid transaminases
tate synthase activity present the ratio of L-2- (LAT), very few D-amino acid transaminases
aminobutyrate to L-alanine, the major amino (DAT) (E.C. 2.6.1.21) have been extensively
6 0
* Y 0O
,
2 -
acetolactate
7
synthase
HO
coz
& 0
acatdactate
HO a-acetoin
0
aminotransferase
Fig. 7. Transaminase/acetolactatesynthase coupled biotransformation reaction for biosynthesis of L- and

D-2-arninobutyrate.
studied. One of the best understood is that Bacillus sp. YM1 in a coupled reaction with
from Bacillus sp. YM1, which has been cloned, L-alanine dehydrogenase and alanine racem-
sequenzed (TANIZAWA et al., 1989), and the ase (KURODAet al., 1990; TANIZAWA et al.,
crystal structure solved (SUGIOet al., 1995). 1988) such that pyruvate is recycled to D-ala-
Recently, the dat genes from Staphylococcus nine via L-alanine. The process requires an
huemolyticus (PUCCIet al., 1995), ), Bacillus li- NADH regeneration system, which is supplied
cheniformis (TAYLOR and FOTHERINGHAM,by the action of a cloned, thermostable for-
1997), and Bacillus sphaericus (FOTHERING- mate dehydrogenase (GALKIN et al., 1995).The
HAM et al., 1998a) have been cloned, se- genes encoding each enzyme were cloned and
quenced, and overexpressed in E. coli. These expressed in a single E. coli strain. The overall
factors, plus their broad substrate specificity procedure works efficiently for D-glutamate
make them ideal candidates for use in the pro- and D-leucine while other keto acids tested
duction of D-amino acids. showed poor yields andor poor enantiomeric
As with the LATs, the DATs have an equi- excess. These problems were attributed to a
librium constant near unity. Fortunately, many number of causes including reaction of the
of the procedures devised to optimize product L-alanine dehydrogenase with a number of ke-
formation with the LATs are also applicable to to acids tested, racemization of some of the
the DATs. Product insolubility, high substrate amino acid products by the thermostable ala-
concentrations, unstable keto acid products nine racemase, and transamination of keto ac-
(e.g., oxaloacetate), and the removal of the ke- ids by the L-amino acid transaminases of the
to acid product enzymatically (e.g., conversion host. Other drawbacks include the need for
of pyruvate to acetolactate) can be used to al- relatively low substrate concentrations (by in-
ter the equilibrium of the DAT reaction in fa- dustrial standards) and the high cost of the ke-
vor of the D-amino acid product. The supply of to acid supply.
D-amino acid donor can be problematical be- A versatile, modular approach for the pro-
cause most D-amino acids are either unavail- duction of D-amino acids is currently being de-
able as commodity chemicals or are expensive. veloped which addresses both D-amino acid
This problem is generally solved by initially us- donor and the a-keto acid acceptor supply, but
ing an L-amino acid such as L-aspartate, L-glu- does not require exogenous regeneration of
tamate, or L-alanine, which is converted in situ co-factors. A generic depiction of this ap-
to a racemate using an appropriate racemase. proach is shown in Fig. 8.The key step is the in-
The DNA sequences of a number of racemas- clusion of the lad gene of Proteus myxofaciens,
es are available in the GenBank DNA data- encoding the L-amino acid deaminase which is
base (NCBI, Bethesda, MD, USA) and the used to produce the a-keto acid in situ from
genes are easily obtainable by PCR methodol- the L-amino acid which is provided as sub-
ogy. strate or overproduced by the host. In either
The whole cell bioconversion reaction de- case, the deamination occurs intracellularly.
scribed for L-amino acids is equally applicable The D-amino acid required as amino donor is
to the biosynthesis of D-amino acids using the similarly generated in situ from the L-isomer
D-amino acid transaminase as shown in Fig. 7. by an appropriate cloned racemase. The two
This has been successfully applied to the pro- substrates are then converted by a cloned
duction of a number of D-amino acids. These DAT to produce the corresponding D-amino
include both D-2-aminobutyrate (FOTHERING- acid. Because the reaction is carried out under
HAM et al., 1997) and D-glutamate.Theoretical- fermentative conditions, the reaction is shifted
ly, this route is applicable to the production of towards 100% yield by catabolism of the a-ke-
other D-amino acids, as long as the keto acid to product and by regeneration of the amino
cannot serve as a substrate for acetolactate donor by cellular enzymes. This system can be
synthase, and the product is not enzymatically used to produce D-amino acids with high
racemized by the recombinant cell. enantiomeric excess even in the presence of
SODAand colleagues (GALKINet al., 1997a, the endogenous L-transaminases of the host
b; NAKAJIMA et al., 1988) have described a pro- organism. Using a combination of the ap-
cedure which uses a thermostable DAT from proaches described, D-phenylalanine can be
5 Conclusions 327
L-amino add
D-amino acid lransaminase D-Pmino

(pmadnssrrtla)
D-Pmino aad donor u-keto add

(tMI4DdUWD-P) (ppv.te, a-KG or O M )
L-amino acid
L-amino add as amino donor

(exknully fed; L&, ~ g l or
u LIMP)
Fig. 8. Engineered biochemical pathway for whole cell biosynthesis of D-phenylalanine.
produced in high yields with 99% enantio- their propensity to overproduce and excrete
meric excess (FOTHERINGHAM et al., 1998b). very high concentrations of amino acids under
D-Tyrosine can similarly be synthesized using a specific process conditions and their early de-
fed batch fermentation process but with im- velopment for monosodium glutamate pro-
proved overall yields due to the insolubility of duction. However, other organisms including
the final product (R. F. SENKPIEL, unpublished E. coli have also been successfully employed in
data). The promiscuous substrate range of the production of amino acids such as phenyl-
L-amino acid deaminase (L-AAD)and DAT alanine.
facilitates the use of this type of approach to The engineering of bacterial metabolic
generate a wide range of D-amino acids from pathways to improve commercial fermentative
their L-amino acid counterparts. production of amino acids has traditionally in-
volved the use of relatively crude, non specific
mutagenesis methods coupled to repeated
rounds of arduous screening for resistance to
5 Conclusions toxic amino acid analogs. Although inelegant
in execution, these methods nevertheless led
A variety of bacterial species have been to highly efficient and economically important
used for almost 40 years in the large scale fer- organisms for large scale production of many
mentative production of amino acids for in- amino acids, even though the approach be-
dustrial uses. The corynebacteria have been comes increasingly self-limiting as production
most widely used in this application due to organisms accumulate non-specific mutations.
With the increasing understanding of the

biochemistry and molecular genetics of amino
6 References
acid production in bacteria and the availability
of recombinant DNA methodology in the ABE,S., TAKAYAMA, K. (1972), in: Amino Acid-Pro-
ducing Microorganisms. Variety and Classijicati-
1980s the rate limiting steps of biosynthetic on. pp. 3-38. Tokyo: Kodansha.
pathways and precursor supply were ad- AGER,D. J., FOTHERINGHAM, I. G., LANEMAN, S. A.,
dressed through the cloning and characteri- PANTALEONE, D. P., TAYLOR, P. P. (1997), The
zation of the genes encoding the key biosyn- largescale synthesis of unnatural amino acids,
thetic enzymes. This led to a greater under- Chim. Oggi 15,ll-14.
standing of the molecular mechanisms in- ARCHER, J. A. C., SINSKEY,A. J. (1993),The DNA se-
volved in biosynthetic pathway regulation and quence and minimal replicon of the Corynebacte-
the characterization of mutations introduced rium glutamicum plasmid pSR1: evidence of a
previously through classical methods. Deregu- common ancestry with plasmids from C. diphthe-
riae, J. Gen. Microbiol. 139,1753-1759.
lation of gene expression, re-introduction of BACKMAN, K. C., BALAKRISHNAN, R. (1988), Plasmids
specific genes on multi-copy plasmids, and the encoding pheA gene products resistant to
relief of end product mediated feedback inhi- phenylalanine inhibition for use in microbial ma-
bition has led to even greater titers of product nufacture of phenylalanine, US. Patent 4753883.
from amino acid overproducing bacterial BAIT, C. A., FOLLETTIE, M. T., SHIN,H. K., YEH,P.,
strains. SINSKEY, A. J. (1985), Genetic engineering of
Consequently, many successes of amino acid coryneform bacteria, Trends Biotechnol. 3, 305-
overproduction in bacteria have come from 310.
the powerful hybrid approach of rational de- BERRY, A. (1996), Improving production of aromatic
compounds in Escherichia coli by metabolic en-
sign and more traditional mutagenesis/selec- gineering, Trends Biotechnol. 14,250-256.
tion methodology. As microbial DNA se- BLEDIG, S. A. (1994), Investigation of the genetic re-
quence information becomes increasingly gulation affecting carbon flux through phospho-
available through genomic sequencing the enol pyruvate in Escherichia coli K12, Thesis,
possibility to combine genes from diverse or- University of Warwick, England.
ganisms in a single host is providing new op- BOERMANN, E. R., EIKMANNS, B. J., SAHM, H. (1992),
portunities to further engineer specific host Molecular analysis of the Corynebacterium gluta-
bacterial strains for amino acid overproduc- micum gdh gene encoding glutamate dehydro-
tion. Accordingly, there are increasing exam- genase, Mol. Microbiol. 6,317-326.
BROWN, K. D. (1968), Regulation of aromatic amino
ples of E. coli strains containing genes from acid biosynthesis in Escherichia coli K12, Genet-
multiple organisms to enable efficient whole ics 60 (Pt. l),31-48.
cell biosynthesis of D-amino acids and non- BROWN, K. D., SOMERVILLE, R. L. (1971), Repression
proteinogenic L-amino acids. of aromatic amino acid biosynthesis in Escheri-
As our understanding of microbial molecu- chia coli K12,J. Bacteriol. 108,386-399.
lar biology increases and with the availability CAMAKARIS, H., P ~ A R D ,
J. (1973), Regulation of ty-
of newer mutagenesis methods such as error rosine and phenylalanine biosynthesis in Escheri-
prone PCR and gene shuffling the capability chia coli K12. Properties of the tyrR gene pro-
to engineer microbial biosynthetic pathways to duct,J. Bacteriol. 115,1135-1144.
CHOI,Y. J., TRIBE, D. E. (1982), Continuous produc-
produce natural and unnatural amino acids tion of phenylalanine using an Escherichia coli re-
will continue to increase and diversify. gulatory mutant, Biotechnol. Lett. 4,223-228.
CLEMENT,^., LANEELLE, G. (1986), Glutamate excre-
Acknowledgement tion mechanism in Corynebacterium glutamicum:
I would like to thank Dr. PAULTAYLOR and Dr. triggering by biotin starvation or by surfactant
DAVIDPANTALEONE for their assistance in the addition, J. Gen. Microbiol. U2,925-929.
preparation of this chapter. COLON, G. E., NGUYEN, T. T., JETTEN, M. S. M., SINS-
KEY, A. J., STEPHANOPOULOS, G. (1995), Produc-
tion if isoleucine by overexpression of ilvA in a
Corynebacterium lactofermentum threonine pro-
ducer, Appl. Microbiol. Biotechnol. 43,482488.
CREMER, J., EGGELING, L., SAHM, H. (1991), Control
6 References 329
of the lysine biosynthesis sequence in Corynebac- FOTHERINGHAM, I. G., PANTALEONE,D. P., TAYLOR,
terium glutamicum as analyzed by overexpression P. P. (1997), Biocatalytic production of unnatural
of the individual corresponding genes, Appl. En- amino acids, mono esters, and N-protected deri-
viron. Microbiol. 57,1746-1752. vatives, Chim. Oggi 15,33-37.
CRUMP, S. P., ROZZELL, J. D. (1992), in: Biocatalytic FOTHERINGHAM, I. G., BLEDIG,S. A., TAYLOR, P. P.
Production of Amino Acids and Derivatives (RO- (1998a), Characterization of the genes encoding
ZZELL, D. J., WAGNER, F., Eds.), pp. 43-58. New D-amino acid transaminase and glutamate racem-
York Oxford University Press. ase, two D-glutamatebiosynthetic enzymes of Ba-
DAVIES, W. D., DAVIDSON, B. E. (1982),The nucleoti- cillus sphaericus ATCC 10208, J. Bacteriol. 180,
de sequence of aroG, the gene for 3-deoxy-~-ara- 43194323.
binoheptulosonate-7-phosphatesynthetase (phe) FOTHERINGHAM, I. G., TAYLOR,P. P., TON, J. L.
in Escherichia coli K12, Nucleic Acids Res. 10, (1998b), Preparation of D-amino acids by direct
40454058. fermentative means, US Patent 5,728,555.
DE BOER,L., DUKHUIZEN, L. (1990), Microbial and FOTHERINGHAM, I. G., GRINTER, N., PANTALEONE, D.
enzymic processes for L-phenylalanine produc- P., SENKPIEL, R. F.,TAYLOR, P. P. (1999), Engineer-
tion, Adv. Biochem. Eng./Biotechnol. 41 (Microb. ing of a novel biochemical pathway for the bio-
Bioprod.), 1-27. synthesis of L-2-aminobutyricacid in Escherichia
DOPHEIDE, T. A. A., CREWTHER, I?, DAVIDSON, B. E. coli K12, Bioorg. Med. Chem. 7,2209-2213.
(1972), Chorismate mutase-prephenate dehy- FROST, J. W., DRATHS,K. M. (1995), Biocatalytic syn-
dratase from Escherichia coli K12.11. Kinetic pro- theses of aromatics from D-glucose: renewable
perties, J. Biol. Chem. 247,4447452. microbial sources of aromatic compounds, Annu.
DRATHS,K. M., POMPLIANO, D. L., CONLEY, D. L., Rev. Microbiol. 49,557-579.
FROST,J. W., BERRY,A. et al. (1992), Biocatalytic GALKIN, A., KULAKOVA, L., TISHKOV, V., ESAKI,N.,
synthesis of aromatics from D-glucose: the role of SODA,K. (1995),Cloning of formate dehydrogen-
transketolase, J. Am. Chem. SOC.114,3956-3962. ase gene from a methanol-utilizing bacterium
DUPERRAY, F., JEZEQUEL, D., GHAZI,A., LETELLIER, Mycobacterium vaccae N10,Appl.Microbiol. Bio-
L., SHECHTER, E. (1992), Excretion of glutamate technol. 44,479483.
from Corynebacterium glutamicum triggered by GALKIN,A.,KULAKOVA, L.,YAMAMOTO, H.,TANIZA-
amine surfactants, Biochim. Biophys. Acta 1103, WA,K.,TANAKA, H. (1997a), Conversion of 0-ke-
25C258. to acids to D-aminO acids by coupling of four en-
EDWARDS, M. R., TAYLOR, P. P., HUNTER,M. G., Fo- zyme reactions, J. Ferment. Bioeng. 83,299-300.
THERINGHAM, J. G. (1987), Europ. Patent Appl. GALKIN, A., KULAKOVA, L., YOSHIMURA, T., SODA,
229,161. K., ESAKI,N. (1997b), Synthesis of optically active
FLORES,N., XIAO,J., BERRY, A., BOLIVAR, F., VALLE, amino acids from a-keto acids with Escherichia
F. (1996),Pathway engineering for the production coli cells expressing heterologous genes, Appl.
of aromatic compounds in Escherichia coli, Nat- Environ. Microbiol. 63,46514656.
ure Biotechnology 14,620-623. GARNER,C. C., HERRMANN, K. M., YOSHINAGA, F.,
FOERBERG, C., ELIAESON, T., HAEGGSTROEM, L. NAKAMORI, S.(1983),in: Amino Acids: Biosynthe-
(1988), Correlation of theoretical and experimen- sis and Genetic Regulation (HERRMANN, K. M.,
tal yields of phenylalanine from non-growing SOMMERVILLE, R. L., Eds), Reading, MA: Addi-
cells of a rec Escherichia coli strain, J. Biotechnol. son-Wesley.
7,319-332. GETHING, M. J., DAVIDSON, B. E. (1978), Chorismate
FOLLETTIE, M. T., PEOPLES, 0.P.,AGOROPOULOU, C., mutase/prephenate dehydratase from Escheri-
SINSKEY, A. J. (1993), Gene structure and expres- chia coli K12. Binding studies with the allosteric
sion of the Corynebacterium flavum N13 ask-asd effector phenylalanine, Eur. J. Biochem. 86,
operon,J. Bacteriol. 175,4096-4103. 165-174.
FOTHERINGHAM, I. G., DACEY,S. A., TAYLOR, P. P., HAGINO,H., NAKAYAMA, K. (1974a), Production of
SMITH,T. J., HUNTER,M. G. et al. (1986),The clon- aromatic amino acids by microorganisms.VI. Re-
ing and sequence analysis of the aspC and tyrB gulatory properties of prephenate dehydrogenase
genes from Escherichia coli K12. Comparison of and prephenate dehydratase from Corynebacteri-
the primary structures of the aspartate amino- um glutamicum,Agric. Biol. Chem. 38,2367-2376.
transferase and aromatic aminotransferase of E. HAGINO,H., NAKAYAMA, K. (1974b), Production of
coli with those of the pig aspartate aminotrans- aromatic amino acids by microorganisms. IV.
ferase isoenzymes,Biochem. J. 234,593-604. L-Phenylalanine production by analog-resistant
FOTHERINGHAM, I. G., TON,J., HIGGINS,C. (1994), mutants of Corynebacterium glutamicum,Agr. Bi-
Amino acid hypersecreting Escherichia coli and 01. Chem. 38,157-161.
their preparation, US Patent 5,354,672. HAGINO,H., NAKAYAMA, K. (1974c), Production of
aromatic amino acids by microorganisms. V. ISHIDA, M., SATO,K., HASHIGUCHI, K., ITO,H., ENEI,
DAHP [3-deoxy-~-arabinoheptulosonate 7-phos- H., NAKAMORI, S. (1993), High fermentative pro-
phate] synthetase and its control in Corynebacte- duction of L-threonine from acetate by a Brevi-
rium glutamicum, Agric. Biol. Chem. 38, 2125- bacterium flavum stabilized strain transformed
2134. with a recombinant plasmid carrying the Escheri-
HAGINO, H., NAKAYAMA, K. (1975a), Production of chia coli thr operon, Biosci. Biotechnol. Biochem.
aromatic amino acids by microorganisms. VIII. 57,1755-1756.
Regulatory properties of chorismate mutase from JETTEN,M. S. M., SINSKEY, A. J. (1995), Recent ad-
Corynebacterium glutamicum, Agric. Biol. Chem. vances in the physiology and genetics of amino
39,331-342. acid-producing bacteria, Crit. Rev. Biotechnol. 15,
HAGINO, H., NAKAYAMA, K. (1975b), Production of 73-103.
aromatic amino acids by microorganisms. X. Bio- JETTEN,M. S. M., GUBLER,M. E., MCCORMICK, M.
synthetic control in aromatic amino acid produc- M., COLON, G. E., FOLLETTIE, M. T., SINSKEY, A. J.
ing mutants of Corynebacterium glutamicum, (1993), Molecular organization and regulation of
Agric. Biol. Chem. 39,351-361. the biosynthetic pathway for aspartate-derived
HASLAM,E. (1974), The Shikimate Pathway. New amino acids in Corynebacterium glutamicum,
York: Halsted. Proc. Ind. Microorg. pp. 97-104.
HONORE, N., COLE,S.T. (1990),Nucleotide sequence JETTEN,M. S. M., FOLLETTIE, M. T., SINSKEY, A. J.
of the aroP gene encoding the general aromatic (1994), Metabolic engineering of Corynebacteri-
amino acid transport protein of Escherichia coli um glutamicum,Ann. h! Y Acad. Sci. 721 (Recom-
K-12: homology with yeast transport proteins, binant DNA Technology 11), 12-29.
Nucleic Acids Res. 18,653. JETTEN,M. S. M., FOLLETTIE, M. T., SINSKEY, A. J.
HUDSON, G. S., DAVIDSON, B. E. (1984), Nucleotide (1995), Effect of different levels of aspartokinase
sequence and transcription of the phenylalanine on the lysine production by Corynebacterium lac-
and tyrosine operons of Escherichia coli K12, J. tofermentum, Appl. Microbiol. Biotechnol. 43,
Mol. Biol. 180,1023-1051. 76-82.
HWANG, S. O., GIL, G. H., CHO,Y. J., KANG, K. R., KALINOWSKI, J., CREMER,J., BACHMANN, B., EGGE-
LEE,J. H., BAE,J. C. (1985),The fermentation pro- LING,L., SAHM,H., PRUEHLER, A. (1991), Genetic
cess for L-phenylalanine production using an and biochemical analysis of the aspartokinase
auxotrophic regulatory mutant of Escherichia from Corynebacterium glutamicum, Mol. Micro-
coli, Appl. Microbiol. Biotechnol. 22,108-113. biol. 5,1197-1204.
ICHIHARA, A. (1985), in: Transaminuses (CHRISTEN, KURODA, S., TANIZAWA, K., TANAKA, H., SODA,K.,
P.,METZLER, P. D., Eds.), p. 430. New York John SAKAMOTO, Y. (19W), Alanine dehydrogenases
Wiley & Sons. from two Bacillus species with distinct thermosta-
IKEDA,M., KATSUMATA, R. (1992), Metabolic en- bilities: molecular cloning, DNA and protein se-
gineering to produce tyrosine or phenylalanine in quence determination, and structural comparison
a tryptophan-producing Corynebacterium gluta- with other NAD(P) -dependent dehydrogen-
+
micum strain, Appl. Environ. Microbiol. 58,781- ases, Biochemistry 29,1009-1015.

785. MARTIN, J. F., SANTAMARIA, R., SANDOVAL, H., DEL
IKEDA,M., OZAKI,A., KATSUMATA, R. (1993), REAL,G., MATEOS,L. M. et a]. (1987), Cloning
Phenylalanine production by metabolically en- systems in amino acid-producing corynebacteria,
gineered Corynebacterium glutamicum with the Bio/Technology 5,137-146.
pheA gene of Escherichia coli, Appl. Microbiol. MILLAR,G., LEWENDON, A., HUNTER,M. G., COG-
Biotechnol. 39,318-323. GINS,J. R. (1986), The cloning and expression of
IM, S. W. K., DAVIDSON, H., PITTARD,J. (1971), the aroL gene from Escherichia coli K12. Purifi-
Phenylalanine and tyrosine biosynthesis in Es- cation and complete amino acid sequence of shik-
cherichia coli K-12. Mutants derepressed for 3- imate kinase 11, the aroL-gene product, Biochem.
deoxy-D-arabinoheptulosonic acid 7-phosphate J. 237,427-437.
synthetase (phe), 3-deoxy-~-arabinoheptulosonic MILLER,J. E., BACKMAN, K. C., O'CONNOR,M. J.,
acid 7-phosphate synthetase (tyr), chorismate HATCH,R. T. (1987), Production of phenylalanine
mutase T-prephenate dehydrogenase, and transa- and organic acids by phosphoenolpyruvate car-
minase A, J. Bacteriol. 108,400-409. boxylase-deficient mutants of Escherichia coli, J.
ISHIDA, M., YOSHINO, E., MAKIHARA, R., SATO,K., Ind. Microbiol. 2,143-149.
ENEI,H., NAKAMORI, S. (1989), Improvement of MIWA,K.,TSUCHIDA, T., KURAHASHI, O., NAKAMORI,
an L-threonine producer derived from Brevibac- S., SANO,K., MOMOSE, H. (1983), Construction of
terium flavum using threonine operon of Escheri- L-threonine overproducing strains of Escherichia
chia coli K-12, Agric. Biol. Chem. 53,2269-2271. coli K-12 using recombinant DNA techniques,
6 References 331
Agric. Biol. Chem. 47,2329-2334. stem for genetic engineering of amino acid pro-
MIWA,K., MATSUI,K., TERABE, M., ITO, K., ISHIDA, ducing corynebacteria and the analysis of AEC-
M. et al. (1985), Construction of novel shuttle vec- resistant mutants, Proc. ECB.5 (CHRISTIANSEN, C.,
tors and a cosmid vector for the glutamic acid- MUNCK, L., VILLADSEN, J., Eds.), pp. 975-978. Co-
producing bacteria Brevibacterium lactofermen- penhagen: Munksgaard.
turn and Corynebacterium glutamicum, Gene 39, RAY,J. M.,YANOFSKY, C., BAUERLE, R. (1988), Muta-
281-286. tional analysis of the catalytic and feedback sites
MULCAHY, M. (1988), Thesis, University of Dundee, of the tryptophan-sensitive 3-deoxy-~-arabino-
Scotland. heptulosonate-7-phosphate synthase of Escheri-
NAKAJIMA, N., TANIZAWA, K.,TANAKA, H., SODA,K. chia coli, J. Bacteriol. 170,550&5506.
(1988), Enantioselective synthesis of various SANTAMARIA, R.I., MARTfN, J. F., GIL, J. A. (1987),
D-amino acids by a multi-enzyme system, J. Bio- Identification of a promoter sequence in the plas-
technol. 8,243-248. mid pUL340 of Brevibacterium lactofermentum
NAMPOOTHIRI, M., PANDEY, A. (1998), Genetic tun- and construction of new cloning vectors for
ing of coryneform bacteria for the overproduc- corynebacteria containing two selectable mar-
tion of amino acids, Process Biochem. 33, kers, Gene 56,199-208.
147-161. SCHRUMPF, B., SCHWARZER, A., KALINOWSKI, J.,
NELMS,J., EDWARDS, R. M., WARWICK, J., FOTHE- PUHLER,A,, EGGELING, L., SAHM,H. (1991), A
RINGHAM, J. (1992), Novel mutations in the pheA functionally split pathway for lysine synthesis in
gene of Escherichia coli K-12 which result in hig- Corynebacterium glutamicum, J. Bacteriol. 173,
hly feedback inhibition-resistant variants 451M516.
of chorismate mutase/prephenate dehydratase, SCHWARZER,A., PUHLER,A. (1991), Manipulation of
Appl. Environ. Microbiol. 58,2592-2598. Corynebacterium glutamicum by gene disruption
OZAKI,A., KATSUMATA, R., OKA,T., FURUYA, A. and replacement, Bio/Technology 9,84-87.
(1985), Cloning of the genes concerned in SHIIO,I. (1986),Tryptophan,phenylalanine, and tyro-
phenylalanine biosynthesis in Corynebacterium sine, Prog. Ind. Microbiol. 24, (Biotechnol. Amino
glutamicum and its application to breeding of a Acid Prod.), 188-206.
phenylalanine producing strain, Agric. Biol. SHIIO,I., MIYAJIMA, R. (1969), Concerted inhibition
Chem. 49,2925-2930. and its reversal by end products as aspartate kin-
PATNAIK, R., LIAO, J. C. (1994), Engineering of ase in Brevibacterium flavum, J. Biochem. 65,
Escherichia coli central metabolism for aromatic 849-859.
metabolite production with near theoretical SHIIO,I., SUGIMOTO, S. (1976), Altered prephenate
yield, Appl. Environ. Microbiol. 60,3903-3908. dehydratase in phenylalanine-excreting mutants
PATNAIK, R., SPITZER, R. G., LIAO,J. C. (1995), Path- of Brevibacterium flavum, J. Biochem. 79, 173-
way engineering for production of aromatics in 183.
Escherichia coli: confirmation of stoichiometric SHIIO,I., SUGIMOTO, S. (1979), ' h o components of
analysis by independent modulation of AroG, chorismate mutase in Brevibacterium flavum, J.
TktA, and Pps activities, Biotechnol. Bioeng. 46, Biochem. 86,17-25.
361-370. SHIIO,I., SUGIMOTO, S. (1981a), Effect of enzyme
PI, J., WOOKEY, P. J., PIITARD,A. J. (1991), Cloning concentration on regulation of dissociable choris-
and sequencing of the pheP gene, which encodes mate mutase in Brevibacterium flavum, J. Bio-
the phenylalanine-specific transport system of chem. 89,1483-1492.
Escherichia coli, J. Bacteriol. 173,3622-3629. SHIIO,I., SUGIMOTO, S. (1981b), Regulation at meta-
PITTARD, J., GIBSON, F. (1970), Regulation of biosyn- bolic branch points of aromatic amino acid bio-
thesis of aromatic amino acids and vitamins, Curr. synthesis in Brevibacterium flavum, Agric. Biol.
Top. Cell Regul. 2,2943. Chem. 45,2197-2207.
POSTMA, P. W. (1987), in: Escherichia coli and Salmo- SHIIO,I., ISHII,K., YOKOZEKI, K. (1973), Production
nella Cellular and Molecular Biology (NEID- of L-tryptophan by 5-fluorotryptophan resistant
HARDT, F. C., Ed.), pp. 127-141. Washington, D C mutants of Bacillus subtilis, Agr. Biol. Chem. 37,
ASM Press. 1991-1200.
PUCCI,M. J., THANASSI, J. A., Ho, H.-T., FALK,P. J., SHIIO,I., SUGIMOTO, S., MIYAJIMA, R. (1974),Regula-
DOUGHERTY, T. J. (1995), Staphylococcus hemoly- tion of 3-deoxy-~-arabino-heptulosonate 7-phos-
ticus contains two D-glutamic acid biosynthetic phate synthetase in Brevibacterium flavurn, J.
activities, a glutamate racemase and a D-amino Biochem. 75,987ff.
acid transaminase, J. Bacteriol. 177,336-342. SHIIO,I., MORI,M., OZAKI,H. (1982), Amino acid
PUHLER,A., KASSING, F., WINTERFELDT, A., KALI- aminotransferases in an amino acid-producing
NOWSKI, J., SCHAEFER,A. et al. (1990),A novel sy- bacterium. Brevibacterium flavum, Agric. Biol.
Chem. 46,2967-2977. mistry 27,1311-1316.

SHIIO, I., SUGIMOTO,S., KAWAMURA, K. (1988), TANIZAWA, K., ASANO,S., MASU,Y., KURAMITSU, S.,
Breeding of phenylalanine-producing Brevibacte- KAGAMIYAMA, H. et al. (1989),The primary struc-
rium flavum strains by removing feedback regu- ture of thermostable D-aminO acid aminotrans-
lation of both the two key enzymes in its biosyn- ferase from a thermophilic Bacillus species and
thesis, Agric. Biol. Chem. 52,2247-2253. its correlation with L-amino acid aminotransfera-
SHIIO,I., TORIDE,Y., YOKOTA, A., SUGIMOTO, S., KA- ses, J. Biol. Chem. 264,2450-2454.
WAMURA, K. (1989), Threonine manufacture by TAYLOR, P. P., FOTHERINGHAM, I. G. (1997), Nucleoti-
dihydropicolinate synthase-deficient Brevibac- de sequence of the Bacillus licheniformis ATCC
terium, Can. Patent Appl. CAN 113:38946. 10716 dat gene and comparison of the predicted
SHIIO,I.,YOSHINO, H., SUGIMOTO, S. (1990), Isolation amino acid sequence with those of other bacterial
and properties of lysine-producing mutants with species, Biochim. Biophys. Acta 1350,38-40.
feedback-resistant aspartokinase derived from a TAYLOR,F! P., PANTALEONE, D. P., SENKPIEL, R. F., Fo-
Brevibacterium flavum strain with citrate syntha- THERINGHAM, I. G. (1998), Novel biosynthetic ap-
se- und pyruvate kinase-defects ans feedback-re- proaches to the production of unnatural amino
sistant phosphoenolpyruvate carboxylase, Agric. acids using transaminases, Trends Biotechnol. 16,
Biol. Chem. 54,3275-3282. 412-418.
SHIIO,I., SUGIMOTO, S., KAWAMURA, K. (1993), Isola- TESCH,M., EIKMANNS, B. J., DE GRAAF,A.A.,SAHM,
tion and properties of a-ketobutyrate-resistant H. (1998),Ammonia assimilation in Corynebucte-
lysine-producing mutants from Brevibacterium rium glutamicum and a glutamate dehydrogen-
flavum, Biosci. Biotechnol. Biochem. 57,51-55. ase-deficient mutant, Biotechnol. Lett. 20, 953-
SUGIMOTO, S., SHIIO,I. (1974), Regulation of pre- 957.
phenate dehydratase in Brevibacterium flavum, J. TOKORO, Y., OSHIMA,K., OKII,M., YAMAGUCHI, K.,
Biochem. 76,1103-1111. TANAKA, K., KINOSHITA, S. (1970), Microbial pro-
SUGIMOTO, S., SHIIO,I. (1980), Purification and production of L-phenylalanine from n-alkanes, Agr.
perties of bifunctional 3-deoxy-~-arabino-heptu- Biol. Chem. 34,1516-1521.
losonate 7-phosphate synthetase-chorismate TOSAKA,O., TAKINAMI, K. (1986), Lysine, Prog. Znd.
mutase component A from Brevibacterium flu- Microbiol. 24 (Biotechnol. Amino Acid Prod.),
vum, J. Biochem. 87,881-890. 152-172.
SUGIMOTO, S., SHIIO,I. (1985), Enzymes of common TRIBE,D. E. (1987), Preparation and use of novel Es-
pathway for aromatic amino acid biosynthesis in cherichia coli strains to manufacture phenylalani-
Brevibacterium flavum and its tryptophan-prod- ne, US Patent 4,681,852.
ucing mutants, Agric. Biol. Chem. 49,3943. TSUCHIDA, T., KUBOTA,K., MORINAGA, Y., MATSUI,
SUGIMOTO, S., MAKAGAWA, M.,TsucHIDA,T.,SHIIO,I. H., ENEI,H., YOSHINAGA, F. (1987), Production of
(1973), Regulation of aromatic amino acid bio- L-phenylalanine by a mutant of Brevibacterium
synthesis and production of tyrosine and lactofermentum 2256,Agric. Biol. Chem. 51,2095-
phenylalanine in Brevibacterium flavum, Agr. 2101.
Biol. Chem. 37,2327-2336. WALLACE, B. J., P I ~ A R D J. ,(1969), Regulator gene
SUGIO,S., PETSKO,G. A., MANNING, J. M., SODA,K., controlling enzymes concerned in tyrosine bio-
RINGE,D. (1995), Crystal structure of a D-amino synthesis in Escherichia coli, J. Bacteriol. 97,1234-
acid aminotransferase: how the protein controls 1241.
stereoselectivity, Biochemistry 34,9661-9669. WHIPP,M. J., PITTARD,A.J. (1977), Regulation of aro-
TANIZAWA, K., OHSHIMA,A., SCHEIDEGGER,A., INA- matic amino acid transport systems in Escherichia
GAKI,K.,TANAKA, H., SODA,K. (1988),Thermost- coli K-12,J. Bacteriol. 132,453-461.
able alanine racemase from Bacillus stearother- YAMADA, K., KINOSHITA, S., TSUNODA, T., AIDA,K.
mophilus: DNA and protein sequence determina- (1973), The Microbial Production of Amino
tion and secondary structure prediction, Bioche- Acids. New York: Halsted.
9 Biotechnological Production of
Natural Aroma Chemicals by
Fermentation Processes
JURGENRABENHORST
Holzminden, Germany
1 Introduction 334
2 Fermentation Processes 334
2.1 Fermentative Production of Vanillin 334
2.1.1 Outline of Different Processes Applied to the Formation of Vanillin 334
2.1.2 Production of Ferulic Acid as an Intermediate for Vanillin Production 336
2.1.3 Production of Vanillin from Ferulic Acid 338
2.2 Fermentative Production of Flavor-Active Lactones 340
2.3 Fermentative Production of Carboxylic Acids 344
2.4 Fermentation of Other Natural Aroma Compounds 345
2.4.1 Production of Flavor-Active Aldehydes and Alcohols 345
2.4.2 Phenolic Compounds 346
2.4.3 Methyl Ketones 347
3 Conclusions 347
4 References 347
334 9 Biotechnological Production of Natural Aroma Chemicals by Fermentation Processes
1 Introduction cream, baked goods or liqueurs, and also in

perfumery. Vanillin has an intensely sweet and
very tenacious creamy-vanilla-like odor and a
The demand for natural flavors by the cus- typical sweet vanillin-like taste.
tomers of the Western world increased during Synthetic vanillin is currently produced
the last decade. Naturalness is correlated by from guaiacol and lignin (CLARK,1990).
many people with health and other positive Natural vanilla flavor is classically obtained
meanings. In Europe and the USA natural fla- from the alcoholic extracts of cured vanilla
vors are clearly defined legally. pods (RANADIVE, 1994). Due to the limited
In the EU Directive 88/388/EEC the term availability of vanilla pods and the fluctuations
“natural” is allowed for a flavoring substance of delivery based on varying harvest yields, de-
which is obtained “by appropriate physical pending on the weather, efforts were under-
processes (including distillation and solvent taken to find alternative sources.
extraction) or enzymatic or microbiological If the price of natural vanillin was calculated
processes from material of vegetable or anion the yield in cured vanilla pods, which com-
mal origin either in the raw state or after pro- prise less than 2% vanillin, it would be in the
cessing for human consumption by traditional range of 2,000 U.S. $ kg-l, which is extremely
food preparation processes (including drying, high compared to this nature identical vanillin
torrefaction, and fermentation)”. obtained by chemical synthesis that only costs
In the USA the following definition of natu- about 12 U.S. $ kg-l. This is one of the incen-
ral flavors applies: “The term natural flavor or tives of the flavor industry for the search of
natural flavoring means the essential oil oleo- natural vanillin from other sources.
resin, essence or extractive, protein hydroly-
sate, distillate, or any product of roasting, hea-
ting, or enzymolysis,which contains the flavor- 2.1.1 Outline of Different
ing constituents derived from a spice, fruit Processes Applied to the Formation
juice, vegetable, or vegetable juice, edible
yeast, herb, bark, bud, root, leaf, or similar of Vanillin
plant material, meat, seafood, poultry, eggs,
dairy products, or fermentation products Since the beginning of the 1990s a number
thereof, whose significant function in food is of patents for the biotechnological production
flavoring rather than nutritional ...” (CFR, of vanillin have been disclosed. In some earlier
1993). studies vanillin was mentioned only as an in-
Since the 1970s several reports appeared on termediate in the microbial catabolism of dif-
the microbial and enzymatic synthesis of fra- ferent chemicals of plant origin. For example,
grance and aroma chemicals (for reviews, see TADASA described the degradation of eugenol
SCHINDLER and SCHMID,1982; and SCHARPF, with a Corynebacterium sp. (TADASA,1977)
JR. et al., 1986). and a Pseudomonas sp. (TADASA and KAYAHA-
RA, 1983) and found vanillin as one of the in-
termediates. Many studies have been perfor-
med on the degradation of lignin. Ferulic acid
has frequently been used as a simple model
2 Fermentation Processes compound in studies for the degradation of li-
gnin po1ymers.A number of workers found va-
nillin as an intermediate in the ferulic acid ca-
2.1 Fermentative Production tabolism of different microorganisms (TOMS
of Vanillin and WOOD,1970; SUTHERLAND et al., 1983;
OmK, 1985).
Vanillin is the most important aroma chem- The first patent for the alternative produc-
ical with an annual consumption of about tion of natural vanillin was disclosed by DOL-
12,000 tons. It is broadly used for the flavoring FINI et al. (1990). This was not a real biotech-
of many different foods like chocolate, ice- nological process because there turmeric oleo-
resin, in which curcumin is the main ingre- component is coniferyl benzoate, or isoeuge-
dient, was subjected to the action of heat and no1 and eugenol. Only with isoeugenol they
pressure in the presence of water by a conti- reached reasonable vanillin concentrations of
nuous or batch process to produce vanillin about 10 g L-' within 4 d. With benzoe siam
(Fig. 1). This process yields only 20% of vanil- resin and eugenol only concentrations of 2 to
lin. 4 g L-' and 0.3-0.5 g L-' were obtained, re-
The first enzymatic process for the produc- spectively. Due to the high price of lipoxygen-
tion of vanillin was disclosed by YOSHIMOTO et ase this process seems to be commercially un-
al. (1990a). They used a dioxygenase, isolated attractive. This is also true for all processes
from a new Pseudomonas sp. TMY1009 (YOS- based on natural isoeugenol, because it is only
HIMOTO et al., 1990b).As substrates they used available from some essential oils (ylang-
isoeugenol (Fig. 2c) and 1,2-bis(4-hydroxy-3- ylang, nutmeg) as a minor component. There-
methoxypheny1)ethylene (Fig. 2a) or the cor- fore, the price of this substrate is unacceptably
responding glucoside (Fig. 2b). high.
The first microbial fermentation process for An interesting approach was followed by a
the production of vanillin was disclosed by US biotech company, ESCAgenetics Corp.,
RABENHORST and HOPP(1991) with Haar- who tried to produce vanillin by plant cell cul-
mann & Reimer. They used bacteria of the ture (KNUTHand SAHAI,1991) in fermenters.
genera Klebsiella, Proteus, and Serratia and With a cell line with an extremely high dou-
eugenol or isoeugenol as substrate (Fig. 3). bling time of 106 h they obtained concentra-
Only with isoeugenol reasonable vanillin con- tions of 11,900mg L-' vanillin under high cell
centrations of 3.8 g L-' were obtained after density conditions (27 g cell dry weight per L;
9 d. SAHAI,1994) but they seemed not to be able to
MARKUS et al. (1993) with Quest disclosed a scale up the process to a commercial scale, be-
different enzymatic approach for the forma- cause the product never reached the market
tion of vanillin. They used lipoxygenase, also and the company does not exist anymore.
known as lipoxidase (EC.1.13.11.12), an en- A very ambitious approach was followed by
zyme common in different plants like soy, po- FROSTand coworkers, who were trying to ob-
tato, cucumber, grape, and tea. As substrates tain vanillin from glucose by metabolic engi-
they used benzoe siam resin, in which the main neering in Escherichia coli via the shikimic ac-
H,CO
\
316 "C, 1680 psi
CHO OH
w
Fig. 1. Hydrolysis of curcumin according to DOLFINI
et al. (1990).
a)
/‘IU0
CH-, CH =CH d:H -

dioxygenase * HOHC
J =+ -
Fig. 2. Formation of vanillin with dioxygenase according to YOSHIMOTO

et al. (1990a, b).
CH, -CH =CH 4:~ +

Serratia
- marcescens OHC
Fig. 3. Vanillin formation from isoeugenol by Serratia marcescens according to RABENHORST

and HOPP
(1990).
id pathway (LI and FROST,1998). The main 2.1.2 Production of Ferulic Acid
limiting steps are a lack of a sufficient cate-
chol-0-methvltransferase activitv for the for- as an Intermediate for Vanillin
mation of vkillic acid from p;otocatechuic Production
acid, and a lack of selectivity for the aryl alde-
hyde dehydrogenase, so that about 10% of iso- Ferulic acid is an ubiquitously found phenol-
vanillin were synthesized. Until now, obvious- ic cinnamic acid derivative in plants. It is
ly, only parts of the pathway have been cloned linked to various carbohydrates as glycosidic
within one strain. conjugates, occurs as an ester or amide in var-
ious natural products, and is a part of the com- Due to the toxicity of eugenol a repeated addi-
mon plant polymer lignin (ROSAZZAet al., tion of the substrate was necessary. They ob-
1995).Free ferulic acid is not easily available in tained a high molar conversion of eugenol to
nature (STRACK, 1990). ferulic acid of more than 50%.
In a patent ANTRIMand HARRISdisclosed By variation of the process parameters
the isolation of ferulic acid from corn hulls other interesting chemicals like coniferyl alco-
(ANTRIM and HARRIS,1977).Due to the chem- hol or vanillic acid could also be obtained in
ical alkali hydrolysis of the corn hulls to cleave good yields (RABENHORST, 1996).
the ester bonds, the resulting material cannot In the meantime the process has been fur-
be considered as natural. ther optimized for higher volumetric and mo-
Another possible source is eugenol, the lar yield and is run now successfully on a 40 m3
main component of the essential oil of the scale.
clove tree Syzigium aromaticum (syn. Eugenia Because the degradation of eugenol is ex-
cariophyllus). It is a cheap natural aroma tremely rare within the genus Pseudomonas
chemical and available in sufficient amounts (STEINB~CHEL, personal communication), and
on the world market. It is used in many per- the process of ferulic acid production is com-
fume and aroma compositions due to its orien- mercially important, the genes and enzymes of
tal and spicy clove odor (BAUERet al., 1990). the metabolic pathway were isolated and char-
When eugenol is metabolized by different bac- acterized (STJZINBUCHEL et al., 1998). This
teria, ferulic acid is formed as an intermediate pathway with the genes and enzymes, there-
(TADASA,1977; TADASAand KAYAHARA,fore, is outlined in Fig. 5.
: :r
1983). During these studies it was found that vanil-
In 1993, HOPPand RABENHORST disclosed a lin is also an intermediate of the degradation
patent application with Haarmann & Reimer of eugenol, but it was detected only occasion-
for a new Pseudomonas sp. HR 199, isolated ally in the culture broth in trace amounts. The
from soil, and a process for the production of reaction of ferulic acid to vanillic acid is ob-
methoxyphenols from eugenol. With this fer- viously very effective, probably due to the
mentation process ferulic acid concentrations higher reactivity and toxicity to the cells of the
of 5.8 g L-' within 75 h (Fig. 4) were reached. free aldehyde.
10000
s
s 7000 4000
E
6000 8
- 3000
s
2 5000
m a
a 4000
'E -:
0
2000
3000 i
m
a 2000 1000
1000
0 0
0 8 16 24 32 40 48 56 64 72
hours
Fig. 4. Production of ferulic acid by Pseudomonas sp. HR 199. A Eugenol addition; x eugenol con-
+
centration;* ferulic acid concentration; coniferyl alcohol concentration; vanillic acid concentration.
Eugenol Coniferyl alcohol Coniferyl aldehyde
Q-
CH,- CH =CH, CH =CH-CHzOH CH =CH-CHO
Eugenol Coniferyl alcohol
hydmxyla= dehydrqenase
*
+(OH OCH,
OH
OCH,
@
* b O C H 3
OH
Vanillin Feruloyl-CoA I Ferulic acid

CHO //O
v //O
CH=CH-C CH-CH-C
I \
S-COA I O
H
‘
Enoyl-CoA- Fendoyl-CoA-
OCH, P OH
O C H , P OH
O C H 3
I
I
OH betyl-CoA
I
Vanillic acid Protocatechuic acid 13-Carboxy-cis-cis-muconoate

COOH COOH COOH
OH OH
Fig. 5. Eugenol degradation pathway in Pseudomonas sp. HR 199 (STEINBUCHEL

et al., 1998).
2.1.3 Production of Vanillin from In 1992, a process from LABUDAet al. was
disclosed for Kraft General Foods, who pro-
Ferulic Acid duced vanillin from ferulic acid with different
There were several attempts to use ferulic microorganisms such as Corynebacterium glu-
acid as a substrate for the production of natu- tamicum, Aspergillus niger, Pseudomonas pu-
ral vanillin. The chemical reaction looks very tida, and Rhodotorula glutinis in the presence
easy: a hydrolytic cleavage with the release of of sulfhydryl compounds such as dithiothreitol
an acetate residue should give vanillin (Fig. 6). (LABUDAet al., 1993). The vanillin concentra-
H,CO*CH=CH-COOH
HO M \
Fig. 6. Vanillin formation CHXOOH
from ferulic acid. Ferulic acid Vanillin
tions were quite low and did not exceed The process with the highest yields of vanil-
210 mg L-l after 1,296 h. Due to the use of the lin so far is that disclosed by Haarmann &
expensive sulfhydryl compounds, the low yield, Reimer (RABENHORST and HOPP,1997).
and long process times this process seems not In this process a filamentous growing acti-
to be commercially feasible. 'Ikro groups at nomycete HR 167 was used. This strain was
INRA (Institut National de la Recherche Agro- identified by the DSMZ, Braunschweig, Ger-
nomique) together with Pernod-Ricard have many, as a new Amycolatopsis species.This re-
been working for several years on a fungal bio- sult was based on the typical fatty acid pattern
conversion process for the production of vanil- of isolanteiso- plus 10-methyl-branched satu-
lin from ferulic acid (GROSSet al., 1991; FAL- rated and unsaturated fatty acids plus 2-hy-
CONNIER et al., 1994;MICARD et al., 1995; LES- droxy fatty acids, which are diagnostic for re-
AGE-MEESSEN et al., 1996a,b, 1997).They used presentatives of the genus Amycolatopsis.
a strain of Pycnoporus cinnabarinus, but had Since HR 167 also displayed the typical ap-
problems to channel the metabolic flux from pearance of representatives of the genus Amy-
ferulic acid to vanillin. They found at least colatopsis - beige to yellow substrate myceli-
three pathways for the metabolism of ferulic um and, on some media, also a fine white aeri-
acid. A reductive pathway leads to coniferyl al mycelium - the assignment of HR 167 to the
aldehyde, another one by the propenoic side genus Amycolatopsis was additionally sup-
chain degradation to vanillic acid, and a third ported by the morphology.
one via laccase to unsoluble polymers. The The comparison of the fatty acid patterns of
formed vanillic acid is either decarboxylated the strain with the entries of the DSM fatty ac-
to methoxyhydroquinone or reduced to vanil- id databases by principal component analysis
lin and vanillyl alcohol. So the concentration resulted in an assignment to Amycolatopsis
of vanillin was only 64 mg L-' after 6 d (FAL- mediterranei for the new strain. However, the
CONNIER et al., 1994).To avoid the decarboxy- similarity index is too low (0.037 and 0.006) to
lation of vanillic acid they found that it was permit definitive species assignment.
advantageous to use cellobiose as carbon Additionally performed analyses of the 16s
source and fed additional cellobiose prior to rDNA and comparison of the diagnostic par-
the addition of ferulic acid. This resulted in an tial sequences with the 16s rDNA database
increase of vanillin up to 560 mg L-' after 7 d. entries of Amycolatopsis type strains support-
They postulated that cellobiose acts either as ed the results of the fatty acid analyses. In the
an easily metabolizable carbon source, re- case of the 16s rDNA sequences, high homol-
quired for the reductive pathway to occur, or ogy could also not be demonstrated with the
as an inducer of the cellobiose quinone oxido- known Amycolatopsis type strains. On the ba-
reductase, a known inhibitor of vanillic acid sis of the great differences in the 16s rDNA se-
decarboxylation (LESAGE-MEESSEN et al., 1997). quences (similarity 99.6%), it has to be stated
Another approach was a two-step process with that HR 167 is a new strain of a previously un-
the combination of two fungal strains, i.e., an known Amycolatopsis species.
Aspergillus niger fermentation together with With this new strain a fed-batch fermenta-
the Pycnoporus cinnabarinus or Phanero- tion was established. Within 32 h vanillin con-
chaete chrysosporium, where one strain concentrations of 11.5 g L-' vanillin with a molar
verted ferulic acid to vanillic acid, while the yield of nearly 80% were obtained on the 10 L
second strain reduced vanillic acid to vanillin. scale (Fig. 7).
But here vanillin concentrations were also This process has been successfully scaled up
<1 gL-1. to the 40 m3 production scale.
100
90
80
70
60
40
30
20
10
0
0 5 10 15 20 25 30 35
Time [h]
Fig. 7. Time course of vanillin production with Amycolatopsis sp. HR 167 in a 10 L fermenter.+Vanillin
concentration;+ferulic acid concentration;+ferulic acid addition;-pOz.
The vanillin is then isolated from the fer- 2.2 Fermentative Production of
mentation broth by well established physical
methods like extraction, distillation, and crys-
Flavor-Active Lactones
tallization.
The genes and the enzymes of this reaction A number of lactones are important flavor
were also characterized in Pseudomonas sp. chemicals. Most important is y-decalactone. It
(Fig. 5 ) .Ferulic acid is first activated by a ferul- has a typical peachy flavor (Tab. 1).Many pat-
ic acid CoA synthase to ferulic acid CoA ester. ents and articles on the formation of y-deca-
This ester is then cleaved by an enoyl CoA hy- lactone have been published over the years.
dratase to vanillin (NARBADet al., 1997; GAS- Most of the processes use ricinoleic acid, the
SON et al., 1998; NARBADand GASSON, 1998; main fatty acid in castor oil, or esters thereof
STEINBUCHEL et al., 1998). Vanillin is then fur- for the formation of y-decalactone.The forma-
ther metabolized via vanillic acid, protocate- tion of y-decalactone in the catabolism of ri-
chuic acid, and 3-carboxymuconolactone and cinoleic acid by yeasts of the genus Candida
3-oxoadipate to succinyl-CoA,which is part of was first observed by OKUIet al. (1963). Ricin-
the tricarboxylic acid cycle (PRIEFERT et al., oleic acid is degraded by four successive cycles
1997; OVERHAGE et al., 1999). of P-oxidation into 4-hydroxydecanoic acid,
Tab. 1. Sensoric Descriptions of Flavor Active Lactones
Name Formula Sensoric Description
y-Decalactone oily-peachy, extraordinarily tenacious odor; very

powerful, creamy-fruity, peach-like taste in concen-
4 0 trations < 5 ppm
y-Dodecalactone fatty-peachy, somewhat musky odor
g-Octalactone sweet-herbaceous coconut-like odor
SDecalactone very powerful and tenacious sweet creamy, nut-like

odor with a heavy fruity undertone; taste is creamy,
sweet coconut-peach-milk-like < 2 ppm
SDodecalactone powerful fresh-fruity, oily odor, pear-peach-plum-

like taste at 2-5 ppm
SOctalactone soft, lactonic, milk-like, cream-like, little fruity,

peach-like, coconut milk note
6-Pent yl-2-pyrone very tenacious, soft, lactonic, sweet, fatty, creamy,

butter-like, fruity flavor of peach or apricot
which lactonizes at lower pH values to y-de- CHEETHAMet al. (1988) used Sporobo-
calactone (GATFIELDet al., 1993; Fig. 8). It is lomyces odorus and Rhodotorula glutinis.
worth mentioning that the microbial lactone GATFIELDet al. (1993) reported the use of
formation results in the same enantiomeric castor oil and Candida lipolytica for the pro-
configuration of the lactone as it is found in duction of y-decalactone. They obtained y-de-
peaches and other fruits. calactone concentrations of 5 g L-' within 2 d.
A number of different yeasts have been In the fermentation broth they identified an
used for the production of y-decalactone. additional lactone, 3-hydroxy-y-decalactone
In the first patent FARBOOD and WILLIS (Fig. 9), as a by-product of y-decalactone pro-
(1983) with IFF claimed the production of duction. It is probably produced by the lacton-
y-decalactone with Yarrowia lipolytica and ization of 3,4-dihydroxy decanoic acid, which
various other yeasts from ricinoleic acid, but is formed as a result of the P-oxidation of 4-hy-
the yields were less than 1 g L-'. In a patent droxy decanoic acid.
WINKet al. (1988) with Hoechst disclosed a The group of SPINNLER studied the y-deca-
process for the production of peach flavor with lactone production with Sporidiobolus spp. like
Monilia fructicola. After extraction of the fer- Sporidiobolus salmonicolor, Sporidiobolus
mentation broth and distillation they obtained ruinenii, Sporidiobolus johnsonii, and Sporidi-
a mixture of y-octalactone (Tab. l),y-decalac- obolus pararoseus. These strains are very sen-
tone, and phenyl ethanol in a concentration of sitive to y-decalactone, while the open form,
0.2 g L-1-1 g L-1. i.e., 4-hydroxydecanoic acid, is less toxic (Du-
(CH,),-COOH 12-hydroxyoctadeo9enoic acid
OH
R-oxidation
CH,COSCoA
CH3-(CH2)5 7 OH
(CH,),-COOH 10-hydroxy hexadec-7enoic acid
3 R-oxidation
3 CH,COSCoA
C H 3 - ( C H , ) , y COOH 6-hydroxy dodec3enoic acid
I
OH
reduction
C H 3 - ( C H 2 ) 5 v C O O H 6-hydroxy dodecanoic acid
OH I
R-oxidation
4-hydroxy decanoic acid
OH
cyclization
y-decalactone
Fig. 8. P-Oxidation pathway of ricinoleic acid for the formation of ydecalactone in Yurrowia lipolytica (after
GATFIELD et al., 1993).
FOSSB et al., 1998). So the yields of y-decalac- y-decalactone from castor oil. Additionally
tone in fermentations with these yeasts were they produced 1 g L-' of y-octalactone from
always very low (< 1 g L-'). 10 g L-l coconut oil.
In another patent application CARDILLO et NICAUD et al. (1996) used a multiple auxo-
al. (1989) used Aspergillus niger, Pichia etch- trophic mutant, Yarrowia lipolytica POlD, to
ellsii, and Cladosporium suaveolens to produce obtain y-decalactone in high yields. At the end
4-hydroxy decanoic acid
OH
partial &oxidation
OH
OOH 3,4-dihydroxy decanoic acid
I
OH
cyclization
do
Fig. 9. Formation of 3-hydroxy- ydecalactone.
3-hydroxy-y -decalactone
of the growth phase they transferred the con- massoi lactones 2-decen-1,5-olideand 2-dode-
centrated biomass into an uracil limited medi- cen-1J-olide, which are the main components
um where the biotransformation took place. of massoi bark oil with 80% and 7%, respec-
After 75 h the culture broth yields 9.5 g L-' of tively, as substrate.These unsaturated lactones
the product (PAGOTet al., 1997). They used were hydrogenated with baker's yeast (Fig.
methyl ricinoleate as substrate. 11). By stepwise addition of 2-decen-5-olide
A different approach has been followed by they obtained about 1.2 g L-' Sdecalactone
KUMIN and MUNCH (1997). They used Mucor
circillenoides for the biotransformation of
ethyl decanoate. After 60 h they reached H,C -(CHJ7 - CH =CH -(CH,), - COOH
10.5 g L-' y-decalactone.
A synopsis of the different ways to y-deca-
lactone has been presented recently by
bacterial hydroxylation
KRINGSand BERGER (1998).
A Japanese group at T. Hasegawa Co. (Go-
OH
CHO et al., 1995) studied the biotransformation I
of oleic acid to optically active y-dodecalac- H3C -(CH,), - CH - CH -(CH,), - COOH
tone. They established a two-step process.
First, oleic acid is oxidized to lo-hydroxystear-
ic acid with a newly isolated gram-positive yeast &-oxidationand cyclization
bacterial strain, bakers' yeast was then used
for the biotransformation of the hydroxy acid
to (R)-y-dodecalactone (Fig. 10).The biotrans-
formation yield from oleic acid to y-dodeca-
lactone was 22.5% on the flask scale.
A process for the production of Sdecalac-
tone and Sdodecalactone was established by
PFw (VAN DER SCHAFT and DE LAAT,1991; Fig. 10. Formation of ydodecalactone from oleic
VAN DER SCHAFT et al., 1992). They used the acid.
tained with Pseudomonas putida ATCC 33015.

A 0 2decend-olide With this strain they were able to isolate near-
ly 6 g L-' Gdecalactone from the fermenta-
tion broth after 48 h of incubation.
yeast reduction
2.3 Fermentative Production of
Carboxylic Acids
A number of short-chain carboxylic acids
are also important as natural flavor ingre-
Fig. 11. Formation of Gdecalactone from massoi lac- dients, either for use per se or as substrates for
tone. the production of a broad number of flavor es-
ters, which can be obtained by enzymatic syn-
within 16 h. By addition of P-cyclodextrin this thesis with lipases and esterases (for a review,
process could be accelerated significantly. see GATFIELD, 1992). Acetic acid, which is
They also found that a number of molds per- probably the largest by volume and commonly
formed the same reaction. used as vinegar is not mentioned here.
The same reaction with the use of different In Tab. 2 examples of several important car-
bacteria has also been patented by Hasegawa boxylic acids and their sensory descriptions
(GOCHO et al., 1998).The best results were ob- are presented.
Tab. 2. Carboxylic Acids Used in Flavor Compositions
Name Structure Sensoric Description"
n-Butyric acid CH,-CH+H,.jOOH powerful, penetrating, diffusive sour odor, reminis-

cent of rancid butter; used in butter, cheese, nut,
fruit, and other flavors
Isobutyric acid powerful, diffusive sour odor, slightly less repulsive,

H&, and also less buttery than n-butyric acid; in extreme
CH-COOH dilution almost pleasant, fruity; the taste is, in pro-
/ per dilution and with adequate sweetening, pleasant
H3C creamy-fruity, while buttery-cheesy notes dominate
in the absence of sweeteners
Isovaleric acid H,C\ very diffusive, acid-acrid, in moderate dilution chee-

CH-CH,-COOH sy, unpleasant odor of poor tenacity; in extreme
/ dilution the odor becomes more agreeable, herb-
H3C aceous and dry; used in nut and coffee flavors due
to its peculiar warm-herbaceous taste in concentra-
tions < 20 ppm
2-Methyl butyric acid H3C- CH,- CH-COOH pungent, acrid odor reminiscent of Roquefort chee-
I se; acrid taste, which becomes quite pleasant and
CH3 fruity-sour at dilutions < 10 ppm; used in cheese,
butter, cream, and chocolate flavors
Propionic acid H,C- CH,- COOH pungent sour odor reminiscent of sour milk, cheese,
or sour butter; used in raspberry, strawberry,
cognac, butter flavors
a Sensoric descriptions according to ARCTANDER,

1969
For the production of butyric acid two dif- The alcohols used as substrates for the mi-
ferent ways are feasible. One route is the clas- crobial oxidations are cheaply available from
sical anaerobic fermentation with Clostridium fuse1 oil residues from ethanol fermentations
butyricum (VANDAKet al., 1996). The other of yeast.
one is the microbial oxidation of butanol with
Gluconobacter roseus (GATFIELD and SAND,
1988).With this process about 13 g L-' butyr- 2.4 Fermentation of Other Natural
ic acid was obtained in high molar yield. The Aroma Compounds
oxidation of butanol was also studied by DRU-
AUX et al. (1997) with Acefobacfer aceti.After a
bioconversion phase of 60 h with continuous 2.4.1 Production of Flavor-Active
feeding of the substrate they reached butyric Aldehydes and Alcohols
acid concentrations about 39 g L-', with 86%
molar yield. They also tested several other al- Aldehydes are another important group of
cohols like isoamyl alcohol, 3-methylbutanol, flavor chemicals. Most important are after va-
and 2-phenylethanol, but there the molar nillin, which has been mentioned above, the
yields were significantly lower and no product so-called "green notes". These are trans-2-hex-
concentrations were presented. enal, hexanal, and the alcohols cis-3-hexen-l-
Propionic acid can be obtained by de novo 01, trans-2-hexen-1-01,and hexanol.
synthesis with Propionibacterium shermanii or These compounds are formed from linolen-
Propionibacterium acidipropionici on cheap ic and linoleic acid through the action of lipox-
substrates like whey (CARRONDO et al., 1988; ygenase and hydroperoxide lyase. This reac-
CHAMPAGNE et al., 1989). Propionic acid can tion typically occurs in plant tissues such as
also be produced by oxidation of propanol leaves after damage (HATANAKA, 1993).
with Gluconobacter oxydans (SVITELand As early as 1965 COLLINSand KALNINS
STURDIK,1995). This process gives nearly found 2-hexenal together with acetaldehyde
44 g L-' after 70 h. and 2-methylbutanal in the culture broth of
The alcohol oxidation with Gluconobacter the oak wilt fungus Ceratocystisfagacearum. A
roseus was also applied by GATFIELD and commercial process for the production of
SANDfor the production of several other acids. these green notes does not use microorgan-
So after addition of 20 g L-' isobutanol to a isms but enzymes. So soybean lipoxygenase is
30 L fermentor 21 g L-' isobutyric acid was used to produce hydroperoxy acids which are
obtained after 15 h. then cleaved by lyases from plant homogen-
The addition of 10 g L-' 2-methyl butanol ates of guava (MULLER et al., 1993),or the fol-
to the Gluconobacter roseus culture resulted in iage of other plants (HOLTZet al., 1995). The
7 g L-l 2-methyl butyric acid after 24 h; obtained aldehydes can be reduced by bakers'
10 g L-' isoamyl alcohol were oxidized to yeast to the corresponding alcohols. The hy-
11 g L-' isovaleric acid. droperoxide lyase of banana leaves has been
Tab. 3. Alcohol Conversion to Aldehydes by Pichia pastoris (after MURRAY

et
al., 1988; MURRAYand DUFF,1990)
Product Concentration Conversion Period

[g L-'I [hl
Acetaldehyde 30.8 12
Propionaldehyde 28 24
Butyraldehyde 14 4
Isobutyraldehyde 10.8 8
Isovaleraldehyde 11.3 12
Hexanal 13.8 24
346 9 BiotechnologicalProduction of Natural Aroma Chemicals by Fermentation Processes
cloned recently (HAUSLERet al., 1997;HAus- bioconversion with a hollow-fiber membrane

LER and MUNCH,1997) and hence a microbial reactor they were able to increase the yield to
system for the production of the aldehydes about 35 g L-' (MOLINARI et al., 1997).
and alcohols can be established.
Another way to flavor-active aldehydes is
the oxidation of the corresponding alcohol 2.4.2 Phenolic Compounds
with an alcohol oxidase. For this process either
methylotrophicyeasts or several bacteria were In a review (ROSAZZA et al., 1995) an over-
used. view was presented of reactions of ferulic acid.
DUFFand MURRAY(1988) used cells of Pi- A number of reactions results in flavor chemi-
chia pastoris for the production of acetalde- cals. Vinyl guaiacol, which has a phenolic,
hyde from ethanol (MURRAYet al., 1989),and smoky, vanilla extract-like, roasty flavor is
expanded this technology to benzaldehyde used in roast, vanilla, and cocoa flavorings.
(DUFFand MURRAY,1989),and higher aliphat- Vinyl guaiacol is formed by decarboxylation
ic aldehydes up to C-11 (MURRAY et al., 1988; of ferulic acid (Fig. 12a).A number of different
DUFF and MURRAY, 1991). The aldehyde organisms are known, which perform this reac-
concentrations they obtained were very high tion, for example,Fusarium soluni (NAZARETH
(Tab. 3). and MAVINKURVE, 1986), Nocardia sp. (MAL-
A group at Takasago used Candida boidinii ARCZYK et al., 1990), Colletotrichum gloeospo-
for the production of flavor aldehydes. They roides (FUGANTIet al., 1995), several yeasts
obtained isovaleraldehyde concentrations of (HUANGet al., 1994;SUTHERLAND et al., 1995),
about 40 g L-l after 7 h and were able to pro- and Bacillus species (LEEet al. 1998).The de-
duce also trans-Zhexenal and hexanal in high- carboxylase enzyme from Bacillus pumilus
er amounts (NOZAKIet al., 1995). (DEGRASSI et al., 1995) and Pseudomonas flu-
MOLINARI et al. (1995) used a strain of Glu- orescens (HUANGet al., 1994)have been isolat-
conobacter oxydans to produce isovaleralde- ed and characterized and the gene has also
hyde from isoamyl alcohol. They reached been cloned (ZAGOet al., 1995;AGOand KIK-
12 g L-' within 8 h. By the use of an extractive UCHI, 1998).
a)
CH=CH-COOH H3COaCH=CH,
HO HO
Ferulic acid co2 Vinylguaiacol
-7-
HOOC OCH,
aOH a O C OH
H 3
co2
Vanillic acid Guaiacol

Fig. 12.Formation of a vinylguaiacol and b guaiacol by decarboxylation of vanillic acid and ferulic acid by
Bacillus pumilus decarboxylase.
4 References 347
The only process with which higher yields of or other sources. It is important to realize that
vinyl guaiacol have been obtained was done chemical synthesis, which can produce these
with Bacillus pumilus. In an aqueous-organic simple chemicals much more cheaply, cannot
two-phase system LEE et al. (1998) obtained compete due to the legal status of natural fla-
9.6 g L-l vinyl guaiacol from ferulic acid with- vors. The increasing knowledge of the enzy-
in 10 h. matic pathways for the biosynthesis and me-
In an analogous reaction with vanillic acid tabolism of aroma chemicals gives new oppor-
guaiacol is obtained as product (Fig. 12b). tunities to create tailor-made genetically engi-
Guaiacol has a powerful, smoke-like, some- neered production strains.This is actually done
what medicinal odor and a warm, medicinal for the production of vanillin.
and somewhat sweet taste, but accompanied A problem remains in the low demand for
by a burning sensation. Guaiacol is used in fla- extremely active flavor specialities like some
vor compositions for coffee, vanilla, whisky, to- pyrazines or sulfur containing chemicals,
bacco, and in several fruit and spice complexes where the annual consumption is sometimes
(ARCTANDER,1969). only in the area of hundreds of grams or a few
kilograms. This prevents the establishment of
extensive research programs for these chemi-
2.4.3 Methyl Ketones cals.
The formation of flavors by the use of en-
Methyl ketones, especially 2-pentanone, zymes has not been mentioned within this
2-heptanone, 2-nonanone, and 2-undecanone, chapter, but this is an equally important bio-
are the flavor impact compounds of blue technological method for the production of
veined cheese, which is classically produced natural flavors (for reviews, see GATFIELD,
with the mold Penicillium Toqueforti. These 1992; BERGER, 1995; SCHREIER, 1997).
typical flavors are used for flavoring of prod-
ucts such as salad dressings, soups, crackers,
and cakes.
The methyl ketones are formed due to the
action of several enzymes of the mold during
cheese ripening, like lipase for the release of
4 References
free fatty acids from milk triglycerides, which AGO, S., KIKUCHI,Y. (1998), European Patent
act as precursors for the formation of methyl 857 789.
ketones. The C-6, C-8, C-10, and C-12 fatty ac- ANTRIM,R. L., HARRIS,D. W. (1977), US Patent
ids act as substrates for the P-ketoacyl decar- 4,038,481.
boxylase, which generates the corresponding A R ~ A N D ES.R(1969),
, Perfume and Flavor Chemi-
Cn-l methyl ketones. The biosynthesis of the cals. Montclair, N J Published by the author.
methyl ketones has been reviewed by KINSEL- BAUER,K., GARBE,D., SURFJURG, H. (1990), Com-
LA and HWANG(1976). Based on this basic
mon Fragrance and Flavor Materials. 2nd Edn.,
Weinheim:VCH.
knowledge several processes for the biotech- BERGER, R.G. (1995),Aroma Biotechnology. Berlin:
nological production of methyl ketones have Springer-Verlag.
been developed (LUKSAS,1973; WINKet al., CARDILLO, R.,FUGANTI, C., SACERDOTE, C., BARBE-
1988;LARROCHE et al., 1989). NI, M., CAB EL LA,^, SQUARCIA,F. (1989), Europe-
an Patent 356 291.
CARRONDO, M. J. T., CRES~O,J. P. S. G., MOURA,M. J.
(1988), Production of propionic acid using xylose
utilizing Propionibacterium, Appl. Biochem. Bio-
3 Conclusions technol. 17,295-312.
CWAGNE, C. F’., BAILLAGEON-COTE, C., Gou-
LET, J. (1989),Whey fermentation by immobilized
For the production of natural flavor chemi- cells of Propionibacterium shermanii, J. Appl.
cals microbial fermentation is a competitive Bacterial. 66,175-184.
technology to obtain chemicals which cannot CHEETHAM, P. S. J., MAUME, K. A., DE ROOJI,J. F.
be isolated from plant extracts, essential oils, (1988), European Patent 0258 993.
CLARK,G. S. (1990), Vanillin, perfum, Flavor 15, J. Biol. Chem. 273,4163-4170.

45-54. GATFIELD,1. L. (1992), Bioreactors for industrial
Code of Federal Regulations (1993), 21 Food and production of flavors: use of enzymes, in: Biofor-
Drugs, Parts 100-169, revised April 1,1993. Wash- mation of Flavors (PATTERSON, R. L. S., CHARL-
ington, DC: National Archives and Records Ad- WOOD, B.V., MACLEOD, G., WILLIAMS,A.A., Eds.),
ministration. pp. 171-185. Cambridge: The Royal Society of
COLLINS, R. P., KALNINS, K. (1965), Carbonyl com- Chemistry.
pounds produced by Ceratocystis fagacearum, GATFIELD,I. L., SAND,T. (1988), European Patent
Am. J. Bot. 52,751-754. 289 822.
DEGRASSI, G., DE LAURETO,P. P., BRUSCHI, C. V. GATFIELD, 1. L., GUNTERT,M., SOMMER, H., WERK-
(19959, Purification and characterization of feru- HOFF, P.(1993), Some aspects of microbiological
late and p-coumarate decarboxylase from Bacil- manufacture of flavor-activelactones with partic-
lus pumilus, Appl. Environ. Microbiol. 61, ular reference to y-decalactone, Chem. Mikrobi-
326-332. 01. Technol. Lebensm. 15,165-170.
DOLFINI, J. E., GLINKA, J., BOSCH,A. C. (1990), US GOCHO,S., RUMI,K., TSUYOSHI, K. (1998), US Patent
Patent 4,927,805. 5,763,233.
DRUAUX,D., MANGEOT, G., ENDRIZZI,A., BELIN, GOCHO,S., TABOGAMI, N., INAGAKI, M., KAWABATA,
J.-M. (1997), Bacterial bioconversion of primary C., KOMAI,T. (1999, Biotransformation of oleic
aliphatic and aromatic alcohols into acids: effects acid to optically active y-dodecalactone, Biosci.
of molecular structure and physico-chemical con- Biotech. Biochem. 59,1571-1572.
ditions,J. Chem. Tech.Biotechnol. 68,214-218. GROSS, B.,ASTHER, M., BRUNERIE, P. (1991), Europe-
DUFF,S. J. B., MURRAY, W. D. (1988), Comparison of an Patent 453 368.
free and immobilizedPichiapastoris cells for con- HATANAKA, A. (1993), The biogeneration of green
version of ethanol to acetaldehyde, Biotechnol. odor by green leaves, Phytochemistry 34, 1201-
Bioeng. 31,790-795. 1218.
DUFF,S. J. B., MURRAY, W. D. (1989), Oxidation of HAUSLER, A., MUNCH,T. (1997), Microbial produc-
benzyl alcohol by whole cells of Pichia pastoris tion of natural flavors, ASM News 63,551-559.
and by alcohol oxidase in aqueous and non-aque- HAUSLER,A., LERCH,K., MUHEIM,A., SILKE,N.
ous reaction media, Biotechnol. Bioeng. 34, 153- (1997), European Patent 801 133.
159. HOLTZ,R. B., MCCULLOCH, M. J., GARGER,S. J.
DUFF, S. 3. B., MURRAY,W. D. (1991), US Patent (1995), WO Patent 95123413.
5,010,005. HOPP,R., RABENHORST, J. (1993), European Patent
DUFOSSE,L.,FERON,G.,MAUVAIS,G.,BONNARME,P., 583 687.
DURAND, A., SPINNLER, H.-E. (1998), Production HUANG, Z., DOSTAL, L., ROSAZZA, J. I? N. (1994),Pur-
of y-decalactone and 4-hydroxy-decanoicacid in ification and characterization of a ferulic acid de-
the genus Sporidiobolus, J. Ferment. Bioeng. 86, carboxylase from Pseudomonas fluorescens, J.
169-173. Bacteriol. 176,5912-5918.
FALCONNIER, B., LAPIERRE, C., LESAGE-MEESSEN, L., KINSELLA, J. E., HWANG,D. H. (1976), Enzymes of
YONNET, G., BRUNERIE, P. et al. (1994),Vanillii as Penicillium roqueforti involved in the biosynthe-
a product of ferulic acid biotransforrnation by the sis of cheese flavor, Crit. Rev. Food Sci. Nutr. 8,
white-rot fungus Pycnoporus cinnabarinus 1-937: 191-228.
Identification of metabolic pathways, J. Biotech- KNUTH, M., SAHAI,0.(1991), US Patent 5,057,424.
nol. 37,123-132. KRINGS, U., BERGER, R. G. (1998), Biotechnological
FARBOOD, M. I., WILLIS,B. J. (1983), WO Patent production of flavors and fragrances, Appl. Mi-
83/01072. crobiol. Biotechnol. 49,1-8.
FUGANTI, C., MAZZOLARI, Y., ZUCCHI,G., BARBENI, KUMIN,B., MUNCH.,T. (1997), European Patent
M., CISERO, M.,VILLA,M. (1995), On the mode of 795-607.
biodegradation of cinnamic acids by Colletotri- LABUDA, I. M., GOERS,S. K., KEON,K. A. (1992), US
chum gloeosporoides: a direct acces to 4-vinyl Patent 5,128,253.
phenol and 2-methoxy-4-vinylphen01, Biotechnol. LABUDA, I. M., GOERS,S. K., KEON,K. A. (1993),Mi-
Lett. 17,707-710. crobial bioconversion process for the production
GASSON, M. J., KITAMURA, Y., MCLAUCHLAN, W. R., of vanillin, in: Progress in Flavor Precursor Stud-
NARBAD, A., PARR,A. J. et al. (1998), Metabolism ies, Proc. Int. Conf. Wurzburg, Germany, Septem-
of ferulic acid to vanillin. A bacterial gene of the ber 30-October 2, 1992 (SCHREIER, P., WINTER-
enoyl-SCoA hydrataselisomerase superfamily HALTER, P.,Eds.), pp. 477482. Car01 Stream, IL
encodes an enzyme for the hydration and cleav- Allured Publishing.
age of a hydroxy cinnamic acid SCoA thioester, LARROCHE, C.,ARPAH,M., GROS,J.-B. (1989), Meth-
4 References 349
yl-ketone production by Ca-alginateEudragit fragrances, in: Frontiers of Flavors, Proc. 5th Int.
RL entrapped spores of Penicillium roqueforti, Flavor Conf., Porto Karras, Chalkidiki, Greece,
Enzyme Microb. Technol. 11,106-112. 1-3 July, 1987 (CHARALAMBOUS, G., Ed.), pp.
LEE,I.-Y.,VOLM,T. G., ROSAZZA, J. P. N. (1998), De- 1-18. Amsterdam: Elsevier Science Publisher.
carboxylation of ferulic acid to 4-vinyl guaiacol MURRAY, W. D., DUFF,S. J. B., LANTHIER, P. H. (1989),
by Bacillus pumilus in aqueous-organic solvent US Patent 4,871,669.
two-phase system, Enzyme Microb. Technol. 23, NARBAD, A., GASSON, M. J. (1998), Metabolism of fe-
261-266. rulic acid via vanillin using a novel CoA-depen-
LESAGE-MEESSEN, L., DELAITRE,M., HAON,M., As- dent pathway in a newly isolated strain of Pseud-
THER, M. (1996a), WO Patent 96/08576. omonas jluorescens, Microbiology 144, 1397-
LESAGE-MEESSEN, L., DELAITRE,M., HAON,M.,THI- 1405.
BAULT, J. F., CECCALDI, B. C. et al. (1996b),A two- NARBAD, A., RHODES, M. J. C., GASSON, M. J., WAL-
step bioconversion process for vanillin produc- TON, N. J. (1997), WOPatent 97/35999.
tion from ferulic acid combiningAspergillus niger NAZARETH, S., MAVINKURVE, S. (1986), Degradation
and Pycnoporus cinnabarinus, J. Biotechnol. 50, of ferulic acid via 4-vinyl guaiacol by Fusarium
107-1 13. solani (Mart.) Sacc., Can. J. Microbiol. 32, 494-
LESAGE-MEESSEN, L., DELAITRE,M., HAON,M.,THI- 497.
BAULT, J. F., CECCALDI, B. c. et a]. (1997), An at- NICAUD, J. M., BELIN,J. M., PAGOT,Y., ENDRIZZI, A.
tempt to channel the transformation of vanillic (1996), French Patent 2734-843.
acid into vanillin by controlling methoxy hydro- NOZAKI,M., WASHIZU, Y., SUZUKI, N., KANISAWA, T.
quinone formation in Pycnoporus cinnabarinus (1995), Microbial oxidation of alcohols by Candi-
with cellobiose, Appl. Microbiol. Biotechnol. 47, da boidinii, in: Bioflavor 95 (ETIEVANT,P.,
393-397. SCHREIER, I?,Eds), pp. 255-260. Paris: INRA.
LI, K., FROST,J. W. (1998), Synthesis of vanillin from OKUI,S., UCHIYAMA, M., MIZUGAKI, M. (1963), Me-
glucose,J. Am. Chem. SOC.120,10545-10546. tabolism of hydroxy fatty acids. 11. Intermediates
LUKSAS, A. J. (1973), US Patent 3,720,520. of the oxidative breakdown of ricinoleic acid by
MALARCZYK, E., KOCHMANSKA-RDEST, J., APALOVIC, genus Candida, J. Biochem. 54,536-540.
R., LEONOWICZ, A. (1990), Production of vinyl OTOK,G. (1985), Degradation of ferulic acid by Es-
guaiacol, isoeugenol and other aromas from lig- cherichia coli, J. Ferment. Technol.63,501-506.
nin-related materials by Nocardia, Prog. Biotech- OVERHAGE, J., KRESSE,A.U., PRIEFERT,H., SOMMER,
nol. 6,403-409. H., KRAMMER, G. et al. (1999), Molecular charac-
MARKUS, P. H., PETERS,A. L. J., Roos, R. (1993), terization of the genes pcaG and pcaH, encoding
European Patent 0542 348. protocatechuate 3,4-dioxygenase, which are es-
MICARD,V., RENARD,C., THIBAULT, J. F., LESAGE- sential for vanillin catabolism in Pseudomonas sp.
MEESSEN, L., HAON,M. et al. (1995), Est-il pos- strain HR 199, Appl. Environ. Microbiol. 65,
sible d’obtenir de la vanilline naturelle i partir de 951-960.
pulpes de betterave?, Colloq.-Inst. Natl. Rech.Ag- PAGOT,Y., ENDRIZZI, A., NICAUD, J. M., BELIN,J. M.
ron. 71,149-153. (1997), Utilization of an auxotrophic strain of the
MOLINARI, F., VILLA,R., MANZONI, M., ARAGOZZI- yeast Yarrowia Iipolytica to improve gamma-de-
NI, F. (1995),Aldehyde production by alcohol ox- calactone production yields, Lett. Appl. Microbi-
idation with Gluconobacter oxydans, Appl. Mi- 01.25,113-116.
crobiol. Biotechnol. 43,989-994. PRIEFERT,H., RABENHORST, J., STEINBUCHEL, A.
MOLINARI, F.,ARAGOZZINI, F., CABRAL, J. M. S., PRA- (1997), Molecular characterization of genes of
ZERES, D. M. F. (1997), Continuous production of Pseudomonas sp. Strain HP 199 involved in bio-
isovaleraldehyde through extractive bioconver- conversion of vanillin to protocatechuate, J. Bac-
sion in a hollow-fiber membrane bioreactor, En- teriol. 179,2595-2607.
zyme Microb. Technol.20,604-611. RABENHORST, J. (1996), Production of methoxyphe-
MULLER,B., GAUTIER,A., DEAN,C., KUHN,J.-C. nol-type natural aroma chemicals by biotransfor-
(1993), WO Patent 93/24644. mation of eugenol with a new Pseudomonas sp.,
MURRAY, W. D., DUFF,S. J. B. (1990),Bio-oxidation of Appl. Microbiol. Biotechnol. 46,47&474.
aliphatic and aromatic high-molecular weight al- RABENHORST, J., HOPP,R. (1991), European Patent
cohols by Pichia pastoris alcohol oxidase, Appl. 405 197.
Microbiol. Biotechnol. 33,202-205. RABENHORST, J., HOPP,R. (1997), German Patent
MURRAY, W. D., DUFF, S. J. B., LANTHIER, I? H.,ARM- 19532 317.
STRONG, D. W., WELSH,D. W., WILLIAMS, R. E. RANADIVE, A. S. (1994),Vanilla - cultivation, curing,
(1988), Development of biotechnological pro- chemistry, technology and commercial products,
cesses for the production of natural flavors and Dev. Food Sci. 34,517-577.
ROSAZZA, J. P. N., HUANG, Z., DOSTAL, L., ROSEAU, sion to propionic acid by Gluconobacter oxydans,
B. (1995), Review: Biocatalytic transformation of Enzyme Microb. Technol. 17,549-550.
ferulic acid: an abundant natural product, J. Ind. TADASA,K. (1977), Degradation of eugenol by a
Microbiol. 15,457471. microorganism,Agric. Biol. Chem. 41,925-929.
SAHAI,0.(1994), Plant tissue culture, in: Bioprocess TADASA, K., KAYAHARA, H. (1983), Initial steps of
Production of Flavor, Fragrance and Color Ingre- eugenol degradation pathway of a microorgan-
dients (GABELMAN, A., Ed.), pp. 239-275. New ism, Agric. Biol. Chem. 47,2639-2640.
York: John Willey & Sons. TOMS,A., WOOD, J. M. (1970), The degradation of
SCHARPF, JR.,L. G., SEITZ,E. W., MORRIS, J. A., FAR- trans-ferulic acid by Pseudomonas acidovorans,
BOOD, M. I. (1986), Generation of flavor and odor Biochemistry 9,337-343.
compounds through fermentation, in: Biogenera- VANDAK, D., TELGARSKY, M., STURDIK, E. (1996), In-
tion of Aromas, ACS Symp. Ser. 317 (PARLAMENT, fluence of growth factor supplementation on bu-
T. H., CROTEAU, R., Eds), pp. 323-346. Washing- tyric acid production from sucrose by Clostridium
ton, D C American Chemical Society. butyricum, Folia Microbiol. 40,669-672.
SCHINDLER, J., SCHMID, R. D. (1982), Fragrance or VAN DER SCHAFT,F! H., DE LA AT,^. T. A. M. (1991),
aroma chemicals - microbial synthesis and enzy- European Patent 425 001.
matic transformation, Proc. Biochem. 5,243. VAN DER SCHAFT, P. H., TER BURG,N., VAN DEN
SCHREIER, F! (1997), Enzymes and flavor biotechnol- BOSCH,S., COHEN.,A. M. (1992), Microbial pro-
ogy, in: Advances in Biochemical EngineeringlBi- duction of natural Sdecalactone and Gdode-
otechnology Vol. 55 (SCHEPER, T., Ed.), pp. 51-72. calactone from the corresponding cY,/3-unsaturat-
Berlin: Springer-Verlag. ed lactones in Massoi bark oil, Appl. Microbiol.
STEINBUCHEL, A., PRIEFERT,H., RABENHORST, J. Biotechnol. 36,712-716.
(1998), European Patent 0 845 532. WINK,J., FRICKE,U., DEGER,H.-M., MIXICH,J.,
STRACK, D. (1990), Metabolism of hydroxycinnamic BAUER,D., JUSTINSKI, U. (1988), German Patent
acid conjugates, Bull. Liaison - Groupe Poly- 3701 836.
phenols 15,5544. WINK,J.,VOELSKOW, H., GRABLEY, S., DEGER,H. M.
S U T H E R L m , J. B., CRAWFORD, D. L., POEmO 111, (1988), European Patent 286 950.
A. L. (1983), Metabolism of cinnamic,p-coumar- YOSHIMOTO,T., SAMEJIMA, M., HANYU, N., KOMAI, T.
ic, and ferulic acids by Streptomyces setonii, Can. (1990a),Japanese Patent 02195871.
J. Microbiol. 29,1253-1257. YOSHIMOTO, T., SAMEJIMA, M., HANYU, N., KOMAI,T.
SUTHERLAND, J. B., TANNER, A. A., MOORE,J. D., (1990b),Japanese Patent 02200192.
FREEMAN, J. P., DECK,J., WILLIAMS, A. J. (1995), ZAGO,A.,DEGRASSI, G., BRUSCHI, C.V. (1995), Clon-
Conversion of ferulic acid to 4-vinyl guaiacol by ing, sequenzing, and expression in Escherichia
yeasts isolated from frozen concentrated orange coli of the Bacillus pumilus gene for ferulic acid
juice,J. Food Prot. 58,1260-1262. decarboxylase, Appl. Environ. Microbiol. 61,
SVITEL,J., STURDIK, E. (1995), n-Propanol conver- 4484-4486.
10 Synthetic Applications of
Enzyme-CatalyzedReactions
JANE MCGREGOR-JONES
Tempe, AZ, USA
1 Introduction 353
2 Aliphatic Biotransformation Products 353
2.1 Hydrolysis/Condensation Reactions 353
2.1.1 Pig Liver Esterase 353
2.1.2 a-Chymotrypsin 354
2.1.3 Thermolysin Peptide Synthesis 355
2.1.4 Hog Kidney Acylase 356
2.1.5 Microbial Esterase 357
2.1.6 Porcine Pancreatic Lipase 358
2.2 Enzyme Catalyzed Reduction Reactions 359
2.2.1 Yeast Alcohol Dehydrogenase 359
2.2.1.1 Reduction of Ketones and Aldehydes 359
2.2.1.2 Reduction of P-Keto Esters 359
2.3 Oxidation Reactions 362
2.3.1 Horse Liver Alcohol Dehydrogenase 362
2.3.2 Pseudomonas putida 363
2.3.3 Lipoxygenases 363
2.4 Carbon-Carbon Bond Formation Reactions 365
2.4.1 Farnesyl Pyrophosphate Synthetase 365
2.4.2 Aldolases 365
2.4.3 Acyloin Condensation 366
2.4.4 Cyanohydrin Formation 366
2.5 Multiple Enzyme Reactions 366
3 Alicyclic Biotransformation Products 367
3.1.2 Lipases 368
3.1.2.1 Arthrobacter Lipase 368
3.1.2.2 Enzymic Ester Resolutions 368
3.1.2.3 Porcine Pancreatic Lipase 368
3.1.3 Yeast 370
352 10 Synthetic Applications of Enzyme-Catalyzed Reactions

3.2.1 Yeast 370
3.2.2 Rhizopus arrhizus 371
3.3.2 Microbial Enzymes 373
3.3.2.1 Pseudornonas putida 374
4 Polycyclic Biotransformation Products 376
4.2.1 Yeast 377
4.2.2 Microorganism Reductions 378
4.3.1 Microorganism Oxidation 380
4.3.2 Hydroxylation of Steroids 381
4.4.1 Yeast Cyclases 382
4.4.2 Reactions Involving Acetyl CoA 382
4.5 Exploiting Combinations of Enzyme Specificity 382
4.5.1 Combinations of Dehydrogenases 382
4.6 Multiple Enzyme Reactions 382
5 Heterocyclic Biotransformation Products 384
5.1.2 8- (L-a-Aminoadipyl)-L-cy steinyl-D-valine (ACV) Synthetase 385
5.1.3 Lipases 385
5.1.3.1 Pseudomonas Lipases 385
5.1.3.2 Mucor Species Lipases 385
5.1.4 Penicillin Acylase 386
5.1.4.1 Transacylations Using Penicillin Acylase 386
5.2.2 Dihydrofolate Reductase 387
5.2.3 Yeast 387
5.3.1 Rabbit Muscle Aldolase 388
5.4 Nucleotide Chemistry 389
5.4.1 Phosphorylation 389
5.4.2 Gene Synthesis 389
5.4.3 Base Exchange 389
6 Aromatic Biotransformation Products 390
6.2.1 Hydroxylation 390
6.2.2 Oxidative Degradation 391
6.3.1 Acyloin Condensation 393
7 References 393
1 Introduction matics. Each division is further divided ac-

cording to the type of biochemical transforma-
tion used to produce the bioproduct. Only a
The ability of microorganisms and enzymes few examples in each category are given -this
to act as selective and chiral catalysts has been chapter serves only as an overview of the
acknowledged for many years (see Chapter 1, usefulness of biotransformations. More ex-
this volume), but it is only in more recent times haustive texts should be consulted for further
that biotransformations have become accept- information (DAVIESet al., 1989; DRAUZand
ed as routine procedures in organic synthesis. WALDMANN, 1995; FABER,1995; WONG and
Synthetic chemists have been hesitant to learn WHITESIDES, 1994;JONES,1986).
the unfamiliar techniques required to use mi-
croorganisms and enzymes, especially since
new synthetic reagents and catalysts now ease
the synthesis of complex molecules that once 2 Aliphatic Biotransforma-
seemed unthinkable. While nonbiological cata-
lysts will continue to be developed and im- tion Products
proved, the enormous range of biological cata-
lysts provides a complementary set of reagents 2.1 Hydrolysis/Condensation
which have unique and competitive advan-
tages. The relative merits of the chiral pool, Reactions
asymmetric synthesis, and biotransformations
as means for preparing chiral intermediates 2.1.1 Pig Liver Esterase
can be judged from an extensive review of the
synthesis of chiral pheromones (MORI,1989). Hydrolytic enzymes require no cofactors,
Enzyme catalyzed biotransformations such but pH control is frequently essential. Pig Liv-
as the fermentation of sugar to ethanol by er Esterase (PLE) (GREENZAID and JENCKS,
yeast featured in some of the earliest scrip- 1971) catalyzes the stereoselective hydrolysis
tures. Modification and optimization continues of a wide variety of esters.The enantioselective
today. Countless examples of biotransforma- hydrolysis of substituted glutarate diesters (1)
tions can be found in the world around us: cit- to half esters (2) (Fig. 1) can be rationalized by
ric acid, obtained through fermentation, is JONES’model (JONES,1993; see Chapter 4,this
used in the food and drink industry as a fla- volume).
voring agent; the penicillins and cephalospo- If the undesired ester is formed the two
rins are both secondary metabolites produced enantiomeric series may be interconverted by
by fungi and are used clinically as antibacterial selective manipulation of the ester and acid
agents; anti-inflammatory steroids are pre- groups (e.g., ( S ) - and (R)-(3b)) or by selective
pared from more common naturally occurring hydrolysis of a methyl ester (2c) in the pres-
steroids and bacterial proteases are used as ad- ence of a t-butyl ester. The latter method was
ditives in biological washing powders. exploited in a synthesis (WANGet al., 1982) of
The aim of this chapter is to demonstrate the antibiotic negamycin (6) (Fig. 2) (HAMADA
the wide utility and applicability of biotrans- et al., 1970;KONDOet al., 1971).
formation products in synthesis today, with The half ester (2c)was also cleverly exploit-
particular reference to those that are flexible ed in the synthesis of trans-carbapenems (KA-
synthons and which can be used to reach com- RADY et al., 1981;SALTZMANN et al., 1980).PLE
mon targets of general interest. Such examples hydrolysis of the diester (lc) gave half ester
of utility abound in the pharmaceutical indus- (2c)with high enantiomeric purity which was
try where enantiomerically pure intermediates further enhanced by crystallization. Cleavage
are necessary, and are frequently easily ob- of the carbobenzyloxy (Z) group by hydrogen-
tained through biotransformations. ation and cyclization using Mukaiyama’s re-
The chapter has been subdivided according agent gave the p-lactam (9) in excellent yield
to the structure of the bioproduct, i.e., aliphat- (Fig. 3) (KOBAYASHI et al., 1981). Diastereose-
ics, alicyclics,polycyclics, heterocycles, and aro- lective alkylation adjacent to the chiral center
---
PIE iLiBH4 0 0
Z (S)-3b
62-93% yield
Me02C COzMe Ma2C C02H iB H ~
1 2 ii H+
a R = OH, R' = Me a 99% ee (R)-3b
b R = H, R' = Me b 90% ee
c R = NHZ, R' = H c 93% ee
Fig. 1. Pig liver esterase hydrolysis of glutarate diesters.
NHZ NHZ
1 isobutylene, H2S04
HOzC&C02'Bu
M e o z Sc ~ c o 2 H 2 NaOH, H@ R ~~
2c
Steps
QH
H2N&cT!JVC02H
NH2 0
6Negamycin fI
I
Me
- Steps
HN
2C
*H
20
QH NH2
Fig. 2. The use of pig liver esterase in negamycin synthesis.
C02Me
+N H R ~
===3
CO2H
7 8 1 H2, Pd-C
a R = Et, R1 = Ac; (+)-PS-5 2 Ph3P, F'ySSF'y
b R = 'Pr, R1 = Ac; (+)-PS-6
c R = (R)-MeCH(0H)-, R1 = H; (+)-Thienamycin COzMe 2c
NHZ
Fig. 3. Carbapenern antibiotic synthesis.
(8) and elaboration of the pyrroline ring com- matic or hydrophobic groups, however it also
pleted the synthesis (OKANO et al., 1983). has strong esterase activity. It can be used in
place of PLE in the hydrolyses of C-3 substi-
tuted glutarate diesters and generally exhibits
2.1.2 a-Chymotrypsin opposite enantiospecificities. The stereoselec-
tivity is easily rationalized by overlaying the
a-Chymotrypsin is a protease with a prefer- structure of the ester with that of the natural L-
ence for L-amino acid residues that bear aro- amino acid substrates.
2.1.3 Thermolysin Peptide lyzed by immobilized thermolysin (OYAMAet

al., 1981), with a yield of 82%. The use of an
Synthesis immobilized enzyme (e.g., on a solid support
of silica or porous ceramics) helps to drive the
Despite the emergence of several important reaction in the required direction with high
methods and coupling reagents for peptide yields, as does the insolubility of the dipeptide
bond formation over the last 50 years, almost (12).Thermolysin is highly specific in its cata-
all involve the possibility of side reactions and lytic activity, so that protection of the side
racemization. Conditions in chemical synthe- chain carboxyl group of the aspartic acid de-
ses must be carefully controlled to minimize or rivative is not necessary. A commercial pro-
eliminate these reactions. Condensation of duction route of the synthesis of aspartame
amino acids using proteolytic enzymes (the re- (13) involves the use of racemic phenylalanine
verse of the usual reaction) takes place effi- methyl ester ruc-(ll), in which the unreactive
ciently under mild conditions, opening up a D-isomer is recovered and recycled.
useful synthesis of peptides (ISOWAet al., Thermolysin and other proteolytic enzymes
1977b). It is the thermodynamic products that such as papain, pepsin, and nargase are com-
eventually accumulate in enzyme catalyzed monly used in the formation of small peptides
processes, as with all reactions. Unfortunately such as di-, tri-, and tetrapeptides. The synthe-
the equilibrium constant for peptide forma- sis of peptides, even by convergent techniques
tion usually lies heavily on the side of the con- requires many steps, consequently the yields of
stituent amino acids, but it can be displaced by individual steps need to be extremely high if
the formation of insoluble peptides, by contin- the route is to be viable. An outstanding exam-
uous product removal (e.g., two-phase reac- ple is provided by the octapeptide angiotensin
tions), the use of low water systems, or reac- I1 (Fig. 5) (ISOWAet al., 1977a) which was pre-
tions under kinetic control. pared in an overall yield of 85%. The general
The exploitation of the different specificities principles of peptide coupling by enzymes are
of various proteolytic enzymes provides con- illustrated by synthese of leucinyl- and methio-
vergent, multi-peptide bond syntheses in good nyl-enkephalins (15) and (16) (KULLMAN,
yields from the component amino acids 1981) and dynorphin (17) (KULLMAN, 1982)
(GLASS,1981). In some cases these reactions (Fig. 6). In these reactions selectivity is pre-
have been run on a multi-ton scale, for exam- dominantly determined by the residues at the
ple in the formation of the aspartame precur- carboxylic acid terminus of the peptide chain.
sor (12)(Fig. 4).Aspartame is a dipeptide syn- Thus chymotrypsin preferentially couples the
thetic sweetener, more commonly known carboxylic group of terminal aromatic amino
under the brand name NutrasweetB. acids with most other amino acids. In contrast,
The coupling of L-phenylalanine methyl es- for papain catalyzed couplings the penultimate
ter (11)with N-carbobenzyloxy-L-asparticacid amino acid at the carboxylic terminus is pref-
(lob) to give the dipeptide (12)(Fig. 4)is cata- erably phenylalanine, but other hydrophobic
RHN?J-
H02C’
L-10
a R=H
-. OH
H2N P C02Me
L-11
Thermolysin
82%yield
*
H
12R=Z H2
13 R = H J F ’ d / C
Aspartame
bR=Z
Fig. 4. Enzymatic aspartame synthesis.
H- Asn-Arg-Val-Tyr-Val-His-Pro-Phe-OH phenylalanine to Tyr-Gly-Gly. Finally, trypsin

catalyzed couplings require arginine or lysine
14 Angiotensin I1 to be present at the carboxylic terminus, but do
not discriminate between amino acid coupling
Fig. 5. Angiotensin 11. partners. Carboxypeptidases have comple-
mentary selectivity, i.e., they discriminate the
amino terminus of the peptide chain.
Papain
80% 80%
t t
TyrGly-Gly-Phe-R 2.1.4 Hog Kidney Acylase
t
70%
t
70%
The first major application of the resolution
of enantiomers by enzymes was the use of hog
Chymouypsin kidney acylase (HKA) to hydrolyze N-acyl
15 R = Leu 52% yield amino acids (GREENSTEIN, 1954). HKA ac-
16 R = Met 52% yield commodates a broad range of structural types
Enkephalins and is highly stereoselective. As with virtually
all mammalian enzymes that act on amino ac-
ids it is selective for the L-enantiomer (Fig. 7).
Papain Trypsin The remaining N-acyl D-enantiomer ~ - ( 2 1is)
71% 80% 65% 64% recycled via chemically induced racemization.
This reaction is still of industrial importance
It 1 .
Tyr-Gly-Gly-Phe-Leu-Arg-Arg-Ile today (CHIBATA et al., 1976).
t
72%
t t
52% 70%
Hog acylase I was used by BALDWIN (BALD-
WIN et al., 1976) in the first stereocontrolled
Chymonypsin synthesis of a penicillin from a peptide. Incu-
bation of the chloroacetyl amide (23) with
17 Dynorphin 50% yield Hog kidney acylase I and separation of the un-
reacted amide, followed by acid hydrolysis
Fig.6. Synthesis of leucyl and methionyl enkephal- gave the D-isodehydrovaline (24) in 60% yield
ins.
(Fig. @.The material obtained was identical to
a sample obtained by degradation of penicil-
lin.
amino acids such as leucine and valine are also In another example, MORI and IWASAWA
accepted. The nature of the terminal amino ac- (1980) prepared both enantiomers of thre0-2-
id plays only a minor role. In the examples amino-3-methylhexanoic acid (27) by enzy-
shown (Fig. 6), the influence of the aromatic matic resolution. These are precursors to
amino acid on papain catalyzed couplings en- rhreo-4-methylheptan-3-01(28), a pheromone
ables the coupling of glycine to Tyr-Gly, and component of the smaller european elm bark
extends a further residue in the coupling of beetle (Fig. 9).
Racernize
rac-2 1 D-2 1 L-22
Fig. 7. L-Stereospecificityof acylases.

2 Aliphatic Biotransforrnation Products 357
2.1.5 Microbial Esterase

Methyl trans-(2R,4R)-2,4-dimethylglutarate
(30) is a useful chiral synthon for macrolide
and polyether antibiotics (Fig. 10). One of the
1
HK.4 6 0 % y i e l d
most convenient routes to this intermediate is
by microbial esterase catalyzed hydrolysis of
the racemic diester (29). The unreactive trans-
diester (2S,4S)-(29) cannot be easily recycled
to give further amounts of (2R,4R)-(30) be-
cause its base mediated epimerization also
produces the unwanted meso-cis-diester
(2S,4R)-(29) (CHENet al., 1981). The bifunc-
)Xx
tJ tional chiral synthon (2R,4R)-(30) is a potental
precursor to the polyether antibiotic calcimy-
BzHN cin (31) a metabolite of Streptomyces microor-
ganisms (Fig. 11) (EVANS et al., 1979). Similar-
0 % 25 ly, treatment of dimethyl cis-2,4-dimethyl glu-
- % tarate (29) (Fig. 12) with microbial esterase re-
C02Me sults in stereospecific hydrolysis of the pro-R
ester group in high yield (75%, 98%ee). Pig
Fig. 8. Stereocontrolled synthesis of a penicillin liver esterase preferentially cleaves the p r o 4
system. ester grouping of the meso-diester (29), but
with a poor ee of 64%.
The bifunctional chiral synthon (2R,4S)-
(30) represents a partial structural unit com-
monly encountered in macrolide antibiotics,
"Pr
NHAc
Ma2 C02Me
rac-26
1
I
rap29
HKA
Gliodadium
roseum
( 2 S,4S)-2 9
(3S,4S)-threo28 (2R,4R)- 30 : 50% yield

up to 98%ee
Fig. 9. Enzymatic resolution to pheromone pre-
cursors. Fig. 10. A useful chiral synthon for antibiotics
358 I0 Synthetic Applications of Enzyme-Catalyzed Reactions
Me02 C02 H
32 Erythronolide B
Fig. 13. ErythronolideB.
31 Calcimycin lococcus strains, and are the drugs of choice to

Fig. 11. Synthesis of calcimycin. treat Legionnaires’ disease. Another macro-
lide antibiotic obtainable through the chiral
synthon (2R,4R)-(30) is methmycin (HIRAMA
et al., 1979).
Numerous polyether antibiotics are also ac-
MeOzC xx C02Me
cessible, including monensin (35) (Fig. 14)
(COLLUMet al., 1980a), which has a stereo-
chemically complex array of 17 asymmetric
centers. The approach to monensin is based on
the synthesis and coupling of three advanced
J
optically active fragments, within one of which,
Gliodadium the synthon (2S,4R)-(30) is a part.
roseurn
2.1.6 Porcine Pancreatic Lipase
The Sharpless enantioselective epoxidation
MeOz of allylic alcohols is one of the most reliable
abiotic asymmetric reactions (KATSUKIand
(2S,4R)-30
MARTIN, 1996; KATSUKIand SHARPLESS, 1980;
Fig. 12. Stereospecific microbial esterase hydroly- BEHRENS and SHARPLESS, 1985). Porcine pan-
sis. creatic lipase catalyzed hydrolysis of racemic
epoxy esters ruc-(36) provides a synthesis of
both enantiomers and is able to accept a large
variety of structures (Fig. 15) (MARPLES and
ROGER-EVANS, 1989; LADNERand WHITE-
and was used in COREY’S total synthesis of SIDES, 1984). These hydrolyses proceed with
erythronolide B (32) (Fig. 13) (COREYet al., high enantiospecificity with long alkyl ester
1978a, b). The erythromycins, produced by the groups R , and are simpler to perform than
fungus Streptomyces erythreus, constitute one Sharpless epoxidation. Porcine pancreatic lip-
of the most important, widespread and effec- ase is active at watedorganic solvent interfac-
tive of all known families of antibiotics comes, so the solubility of the substrate in water is
monly used against penicillin resistant Stuphy- not essential.
(2S,4R)-30 33 + 34
35 Monensin
'
Fig. 14. Synthesis of monensin.
2.2 Enzyme Catalyzed Reduction

Reactions
2.2.1 Yeast Alcohol
Dehydrogenase
2.2.1.1 Reduction of Ketones
and Aldehydes
A,.\\\
I
OH
An investigation of yeast reductions of sim-
ple ketones in the 1960's by MOSHER(MAC
"'5
R' LEODet al., 1964) showed that in most cases
37 the (S)-configuration alcohols were obtained
"'ht**fs
by hydride addition to the Re-face of the car-
Buffer bony1 group. The stereoselectivity can be ratio-
EK-3 6 O2CR nalized by Prelog's model which is based on
the differences in size of the groups, however
OzCR these are not always congruent with Cahn-In-
gold-Prelog priorities (see Chapter 9, this vo-
lume; SERVI,1990).
R' R ee %
H Et 98
2.2.1.2 Reduction of P-Keto Esters
H "C3H7 92
H nC4H9 96 The enantioselectivity of the reduction of
''C3H7 >90 P-keto acids by yeast can be modulated by
"C3H7
changing the aikoxyl moiety of the ester. For
Fig. 15. Porcine pancreatic lipase catalyzed hydro- example, comparison Of reduction Of the PO-
lysis. tassium salt (%a) with the methyl (38b) and
butyl (3&) esters shows a decline in enantio-

meric excess as the size of the alkoxyl moiety
increases (HIRAMAet al., 1983). Moreover LCoZEt 41
1
conversion to the carboxylic acid salt increases
the aqueous solubility of the substrate and Yeast
product relative to the corresponding esters
and the work-up is simplified. Filtration of the
reaction and extraction with organic solvents,
removes the biomass and nonpolar com-
pounds, respectively.Treatment with diazome-
thane and a second organic extraction yields
the carboxylic acid fraction as the correspond-
ing methyl esters. The versatile synthon (39b)
J Steps
was used in the total synthesis of compactin

(Ma) which was first isolated in 1976 from the 43
molds Penicillium citrinum and l? brevi com-
pactum and showed marked inhibitory activity
against HMG-CoA reductase, an enzyme in-
volved in the biosynthetic pathway to choles-
J Steps
terol. Mevinolin (4Ob) is even more potent and

is used in treatment of patients with danger-
ously high cholesterol levels (Fig. 16) (HIRAMA
and UEI,1982).
The reduction of ethyl acetoacetate (41)
(Fig. 17) with bakers’ yeast to ethyl (S)-3-hy-
droxybutanoate (42) has been extensively in- Fig. 17. Synthesis of a p eromone component of
Andrena wilkella.
vestigated and reported in an Organic Synthe-
ses preparation (SEEBACH et al., 1985). It was
used in an extraordinary synthesis of the main
component of the pheromone of the solitary cule of carbon dioxide were derived solely
bee, Andrena wikella (44).In a virtuoso dem- from two molecules of ethyl and one of methyl
onstration of synthetic mastery, methyl ace- acetoacetate (MORIand TANIDA, 1981;TENGO
toacetate was alkylated sequentially with two et al., 1990).
equivalents of the iodide (43). Thus the 11car- The tri-isopropylsilyl derivative (47) was
bon atoms of the pheromone (44)and a mole- used in a synthesis of the important carbape-
‘OzR 38 39,%ee
aR=K a 99
bR=Me b 92
c R = ”Bu c 81
40
a R = H; Compactin
b R = Me; Mevinolin
Fig. 16. Chiral total synthesis of compactin.

nem intermediate (49). The chiral center was

used to direct the stereochemistry of a ketene-
imine cycloaddition to generate the useful C-4
keto-substituted azetidinone (48) (Fig. 18) C02Et ( 9 - 4 2
(TSCHAEW et al., 1988) in 90% overall yield.
Ethyl (S)-3-hydroxybutanoate (42) was also
used as a source of the remote stereocenter in
griseoviridin (50), a member of the streptogra-
min family of antibiotics (Fig. 19) (MEYERS
and AMOS, 1980).
Many microorganisms such as Alcaligenes
eutrophus and Zoogloea ramigera I-16-M uti-
lize (R)-poly-3-hydroxybutanoateas an ener-
gy reserve, which is stored as granules within
the cells. The abundance of this material with-
in the cells is extraordinary. For example, etha-
nolysis of 50 g of Z. ramigera gave 33 g of the 5 0 Griseoviridin
monomer (R)-(42)(MORI,1989).
Ethyl (R)-3-hydroxybutyrate (R)-(42) has Fig. 19. Antibiotic synthesis using yeast.
been utilized in the synthesis of stegobinone
(54) - the pheromone of the drugstore beetle
(Fig. 20) (MORIand EBATA,1986a).Diastereo-
selective methylation of the dianion of (R)-
(42) anti to the alkoxide furnished the methyl tanoic acid with Candida rugosa (Fig. 21) (Mo-
group destined to be at C-3 of the pheromone RI and EBATA,1986b).The principal reactions
(54) (FRATER,1979a, b). The stereochemistry were diastereoselective methylation and Mit-
of putative C-2 was achieved by Mitsunobu in- sunobu inversion as used in the synthesis of
version with 2,4-dinitrobenzoic acid to give a stegobinone (54). Similarly diastereoselective
crystalline product. Methyl (R)-(-)-P-Hy- allylation of methyl (3R)-3-hydroxybutanoate
droxyisobutyric acid (52) is manufactured by (I?)-(&) and ethyl (3S)-3-hydroxybutanoate
P-hydroxylation of iso-butyric acid with Can- (S)-(42) (Fig. 22) furnished ( S ) - and (R)-la-
dida sp., followed by esterification. vandulol esters (57), respectively, which were
All four possible stereoisomers of 5-hy- used in the synthesis of optically active acyclic
droxy-4-methyl-3-heptanone(56), the phero- C45 and C50 carotenoids (VONKRAMER and
mone of the weevil of the genus Sitophilus, BANDER, 1982).(For other examples of the us-
were prepared from methyl (R)-3-hydroxy- es of 3-hydroxybutanoate esters see SEURLING
pentanoate (55) which was manufactured by and SEEBACH, 1977; FRATER, 1979a, b, 1980;
P-hydroxylation of methyl pentanoate or pen- FRATER et al., 1984.)
OH
- TIPS2
Ph -
2 O M F OMe
0
46 47 48 49
Fig. 18. P-Lactam intermediate synthesis.

+’
‘BuMe2SiQ
-
54
Fig. 20. Pheromone synthesis.
Fig. 21. Stereoisomersof Sitophilus weevil pheromone component.
2.3 Oxidation Reactions
2.3.1 Horse Liver Alcohol Dehy-

drogenase
(R)-46>97%ee
Horse liver alcohol dehydrogenase
Carotenoid precursors
(HLADH) is probably the most intensely
studied oxidoreductase. It accommodates a
wide range of substrates, but is highly stereose-
lective. HLADH is normally used for the re-
duction of aldehydes and ketones which is the
thermodynamically preferred direction, how-
ever, with a suitable cofactor regenerating
(3-42 > 97% ee )
, (R)-57 system, oxidations are also possible.
Oxidation of the diol (58) proceeds with
p r o 3 enantioselectivity to give the hydroxy al-
Fig. 22. Routes to carotenoids. dehyde (59).This undergoes in situ hemiacetal
formation to give the lactol (60) which is fur- are not generally applicable. In contrast, many
ther oxidized to the lactone (S)-(3b).Using the enzymes are capable of effecting such reac-
conditions indicated 5.85 g (68% yield) of the tions regio- and stereoselectively in the pre-
lactone was prepared in a single reaction (Fig. sence of most functional groups (JOHNSON,
23) (DRUECKHAMMER et al., 1985).It is a phy- 1978; DAVIESet al., 1989; DRAUZand WALD-
tyl chain synthon (FISCHLI, 1980).Similar ster- MA”, 1995).
eoselectivity is exhibited by the HLADH cata- A major area of interest has been the P-hy-
lyzed oxidation of glycerol (61) to L-(-)-glyc- droxylation of carboxylic acids and esters. ( S ) -
eraldehyde (62) (BALLY and LEUTHARDT, ( + )-P-hydroxyisobutyric acid (64)is manufac-
1970). tured in 48% yield by oxidation of the pro-S-
methyl group of isobutyric acid (63) by Pseu-
domonas putidu (Fig. 24) (GOODHUEand
2.3.2 Pseudomonas putida SCHAEFFER, 1971). It has been used as a syn-
thon in syntheses of a-tocopherol (66) (vita-
The conversion of an unactivated car- min E) (COHENet al., 1976),(R)-muscone and,
bon-hydrogen bond to a carbon-oxygen bond unnatural (S)-muscone (67) (BRANCAand
can be accomplished using ozone, peracids, or FISCHLI,1977).
high oxidation state iron reagents such as the The ansa macrocyclic maytansinoids (69)
Gif system. However these reagents have low have antitumor activity (KUPCHANet al.,
selectivity (usually for methine carbons) and 1977), and have been the focus of many phar-
do not tolerate most functional groups. The macological and synthetic efforts. The “north-
Barton reaction of steroidal 20-nitrites and eastern region” (68) synthon containing four
Breslow’s remote functionalization templates chiral centers was prepared in gram quantities
are regioselective due to proximity effects, but from (S)-( + )-P-hydroxyisobutyric acid (64)
(Fig. 25). Both centers destined to become C-5
and C-7 were sequentially converted to alde-
hydes and alkylated without epimerization at
C-6. The two “new” chiral centers at C-4 and
C-5 were introduced by Sharpless chiral epox-
idation, whereas that at C-7 resulted from dia-
stereoselective addition to an aldehyde (MEY-
oo 0
ERS and HUDSPETH, 1981).
58 Coenzymes:
NAD’, FMN,
Further examples of the importance of (64)
FMN reductase,
as a chiral synthon can be found throughout
catalase, pH 9.1 4 the literature, including the synthesis of cal-
-- -- cimycin (31) (Fig. 11) (EVANSet al., 1979) and
other polyether and macrolide antibiotics
+HLADH (JOHNSON et al., 1979; JOHNSON and KISHI,
1979).
OH
(9-3b70% yield, 87% ee 60 2.3.3 Lipoxygenases
(q-
Lipoxygenases are non-heme iron contain-
HLADH -H
O ing dioxygenases which catalyze the reaction
of an ally1 moiety with oxygen to give a hydro-
CHO peroxide. Overall the process is equivalent to
HO OH HO an ene reaction with oxygen acting as the elec-
trophile. The methylene group participating in
61 62 the reaction must be located between two al-
Fig. 23. Enantiotopic oxidation of prochiral meso- kene groups and hence in principle lipoxygen-
alcohols. ation of arachidonic acid (70) (Fig. 26) could
-
Pseudomonas putida
48%yield, >99% ee C02H
63 64
steps J
H
J J
I Steps
9
( R ) - 6 7 R 1 = Me, R2= H
I
66 Vitamin E, a-tocopherol
( 9 - 6 7 R l = H , R2= Me
Fig. 24. Enantiotopically specific hydroxylationof isobutyric acid and uses.
Hs O steps_
‘BuMesiO
&H
Steps_
23
M
7 C02H 7 OEE
(3-(+)-64 OHC
SEt
68 EE =Ethoxyethyl
69 R = H or acyl; Maytansines
Fig. 25. A biotransformationroutine to maytansinoids.
Potato
Lipoxygenase
15%yield
15
1
1 1 12
70 Arachidonic acid 71 (S)-S-HpETE
COzH
Leukotrienes B4, C4,D4and E&-

72 Leukotriene A
Fig. 26. The leukotrienes from arachidonic acid via lipoxygenase.
occur at carbons 5,8,9,11,12, or 15. Soybean been extremely difficult on this minute scale
lipoxygenase catalyzes the formation of (S)- (KOYAMA et al., 1980, 1987; KOBAYASHIet al.,
15-HPETE (15-hydroperoxyeicosatetraenoic 1980).
acid) and potato lipoxygenase (S)J-HPETE
(71).The p r o 3 hydrogen at C-7 is lost stereo-
specifically in this reaction and indeed thus far 2.4.2 Aldolases
all enzyme catalyzed lipoxygenations occur
such that the hydroperoxide group is intro- Asymmetric carbon-carbon bond formation
duced anti to the eliminated hydrogen (COREY based on catalytic aldol addition reactions re-
et al., 1980;COREYand LANSBURY, 1983). mains one of the most challenging subjects in
synthetic organic chemistry. Many successful
nonbiological strategies have been developed
2.4 Carbon-Carbon Bond Forma- (EVANSet al., 1982; HEATHCOCK, 1984), but
tion Reactions most have drawbacks - the need for stoichio-
metric auxiliary reagents and the need for
metal-enolate complexes for stereoselectivity
2.4.1 Farnesyl Pyrophosphate Syn- are two. However, examples of preparative
thetase scale aldolase catalyzed reactions abound in
the literature.
The enzymes of terpene biosynthesis are High yields of condensation products are
rarely employed in biotransformations, never- obtained with lower primary and secondary
theless they have tremendous potential. Both aldehydes, but as expected a tertiary carbon
enantiomers of 4-methyldihomofarnesol (75) atom a to the aldehyde stops the reaction (EF-
(Fig. 27) were prepared by coupling the iso- FENBERGER and STRAUB, 1987), and long
pentenyl pyrophosphate homologs (74) with chains or branching aliphatics lead to lower
tritiated dihomogeranyl pyrophosphate (73) yields. The reaction tolerates a wide range of
catalyzed by partially purified farnesyl diphos- functionality (EFFENBERGERand STRAUB,
phate synthetase from pig liver. Cleavage of 1987; O'CONNELL and ROSE,1973). It is worth
the pyrophosphate groups by alkaline phos- noting the mono-functionalization of the dial-
phatase gave the 4-methyldihomofarnesols dehydes since the high yields obtained
(S)-(75) (810 pg), (R)-(75)(590 pg). The radio (94-98%) would be very difficult using classi-
activity of the tritium label was used to guide cal chemistry without the use of protecting
the purification, which otherwise would have groups.
1 Farnesyl pyrophosphate synthetase (R)-75

2 Alkaline phosphatae
73
12% yield OH
(9-75
Fig. 27. Juvenile hormone 1 synthesis.
2.4.3 Acyloin Condensation CF3CH20H qR

Considerable attention in fluorine chemis- 0
try has been focused on the search of chiral 77 R = Me, Et
synthetic tools for the asymmetric synthesis of Yeast
fluorinated bioactive molecules (QUISTADet
al., 1981). Yeast catalyzed reaction has been $ 0
used as a means of preparing chiral trifluoro-
methyl compounds (KITAZUME and ISHIKAWA, F 3 c 4 R 78
1984).Fermentation of trifluoroethanol and an
a,p-unsaturated ketone (77) (Fig. 28) with OH
yeast, gave trifluoroketols (78) in yields of Fig. 28. Yeast catalyzed acyloin condensation.
26-41%, but with an ee of over 90%. These
acyloin-type reactions result in valuable chiral
synthons, as they do not necessarily corre-
spond to those easily obtained from the chiral them to operate independently on their own
pool of natural products. substrate in the presence of other enzymes and
their substrates. This allows multiple, sequen-
tial, synthetic transformations to be carried
2.4.4 Cyanohydrin Formation out in “one pot reactions” (Fig. 30).
Many amino acids can be prepared by lyase
Oxynitrilase enzymes, among others, cata- catalyzed addition of ammonia to the requisite
lyze the asymmetric addition of hydrogen cya- alkene. Aspartic acid (loa) is produced for the
nide to the carbonyl group of an aldehyde manufacture of aspartame (13) (cf. Fig. 4) by
(79), to form a chiral cyanohydrin (80) (Fig. the aspartase catalyzed addition of ammonia
29). These are versatile starting materials for to fumaric acid. Using a whole cell system both
the synthesis of several useful synthons such as this step and decarboxylation were used to
a-hydroxy acids (81), aminoalcohols (82), and prepare L-alanine (85) (Fig. 30) (TAKAMATSU
acyloins (83) (BECKERand PFEIL, 1966; see et al., 1982).Similarly a combination of aspart-
Chapter 6, this volume). Since only a single ase, aspartate racemase, and D-amino acid
enantiomer is produced during the addition to aminotransferase converts fumaric acid to
a prochiral substrate, the availability of differ- D-alanine (YAMAUCHI et al., 1992).
--
ent enzymes that give either (R)-or (S)-cya- WHITESIDES and WONG(WONGet al., 1983)
nohydrins is important. have combined enzyme catalyzed and conven-
tional steps for the preparation of unusual sug-
ars (Fig. 30). Aldolase catalyzed condensations
2.5 Multiple Enzyme Reactions
Most enzymes are specific with respect to COOH
the type of reaction they catalyze, enabling
H+OH 81
R
CN CHzNH;!
Oxynitrilase
RCHO c H+ OH H+OH 82
HCN
R R
79 45-100%yield
(85-99ee’stypical)
80
R
Fig. 29. Routes to versatile cyanohydrins.
3 Alicyclic Biotransforrnation Products 367
U*
L-lactaldehyde
Aldolase
r
-R
H+, Heat
Pyridine
Glycerol
HO OH HO OP
8
88 "=El@
9 R=
HO
87
92 Furaneol
D-Lactaldehyde
Aldolase
91 R == Hp J H o
Fig. 30. Examples of multiple enzyme transformations.
of dihydroxyacetone phosphate (87) with L- or sal of stereospecificity is observed as one goes

D-lactaldehyde lead to 6-deoxysorbose (89) from six-membered rings to three membered
and the blood group related monosaccharide (Fig. 31) (SABBIONI et al., 1984; MOHRet al.,
6-deoxyfucose (91), respectively. Either of 1983). The cyclopentyl diester marks the
these is readily converted into the flavor prin- "crossover" point with only a 17% ee. As with
ciple furaneol (92) - a caramel flavor compo- the acyclic half esters, either the ester or the
nent. carboxylic acid may be reduced selectively
with lithium borohydride or borane, respecti-
vely, and the products lactonized. For example,
oxidative ring cleavage of the lactone (96)
3 Alicyclic Biotransforma- gives the dicarboxylic acid, which after esterifi-
cation can be regioselectivelycyclized with po-
tion Products tassium t-butoxide to the cyclopentenolactone
(97) (Dieckmann cyclization). This has been
used in the synthesis of prostacyclin (98) (GAIS
3.1 Hydrolysis/Condensation et al., 1984) and brefeldin A (99) (GAISand
Reactions LUKAS,1984) (Fig. 32).
The diacetate (100) is hydrolyzed with high
enantioselectivity by PLE or PPL (Fig. 33) to
3.1.1 Pig Liver Esterase give the hydroxy ester (101). Moreover, the
corresponding diol is acetylated by ethyl ace-
A wide range of cyclic (and acyclic) meso- tate under PPL catalysis to give ent-(l01)
diesters are hydrolyzed by PLE. In the hydrol- (HEMMERLE and GAIS,1987). Similarly PLE
ysis of monocyclic cis-1,2-diesters (93) a rever- catalyzed hydrolysis of the diacetate (102)
Major hydrolysis site pyrethroid insecticides. The crude mixture of

hydrolyzed (105) and unhydrolyzed (106)
C02Me n = 3 , 4 products was heated with mesyl chloride fol-
lowed by aqueous base to selectively invert the
C02Me n = 2 , 3 stereochemistry of the alcohol (105) (Fig. 34).
In this manner, only one enantiomer was ob-
tained from racemic starting material (104).
93
n Yield % We 3.1.2.2 Enzymic Ester Resolutions
1 90 >97 (1R,2S) Enantiomeric distinctions are observed in
2 98 >97 (1R,2S) hydrolyses of esters of chiral alcohols using hy-
3 98 17 (1S,2R) drolytic enzymes. The synthesis of L-menthol
4 98 >97 ( 1 S 2 R ) ( - )-(108) through enzyme catalyzed hydroly-
sis of its racemic ester ( + )-(107) is of commer-
Fig. 31. Pig liver esterase specificity. cial interest (Fig. 35) (MOROEet al., 1970).
gives the hydroxy ester (103) which is a key 3.1.2.3 Porcine Pancreatic Lipase
intermediate in the 3-component synthesis of
prostaglandins, (+)-biotin (210)(Fig. 64), and The asymmetric hydrolysis of cyclic meso-
A-factor (WANGet al., 1984). diacetates using PPL is complementary to the
PLE catalyzed hydrolysis of the corresponding
meso-l,2-dicarboxylates.In fact the cyclopen-
3.1.2 Lipases tane derivative, obtained with low ee's using
PLE (Fig. 31), is produced with 86% ee with
3.1.2.1 Arthrobacter Lipase PPL (KASELet al., 1985;LAUMEN and SCHNEI-
DER, 1985).When a range of cyclic diesters (93)
A useful application of Arthrobacter lipase and (94) were subject to hydrolysis by PPL and
is the resolution of the alcohol moiety of the PLE. the reactions with PPL terminated when
0 Me02C 0
meso-94 95 99%Yield 96 97
>99%ee >85% Total Yield
/ 1
/
"C5Hll 98 Prostacyclin 99 Brefeldin A
Fig. 32. Enzymic synthesis and uses of chiral bicyclic lactones.
-8
0
PLE or PPL
HZO
rap107
AcO OAc HO OAc
100 101 Trichaderma
Acb
Species
PLE
H20
OH
AcO AcO
A
102 103 83%yield
82%- >96% ee (+)-lo7 (-)-lo8
Fig. 33. Examples of the use of pig liver esterase. Fig. 35. Resolution of a L-menthol ester.
Arrbrobacter
AcO
104 105 106
I 1 MsC1, Et3N
Insecticides -
ent-105 106
Fig. 34. Pyrethroid insecticides using lipase resolution.
only one ester group had been cleaved, where- concomitant, base catalyzed hydrolysis. These
as those catalyzed with PLE proceeded to mild conditions were exploited in the PPL cat-
cleave the “second” ester group unless the re- alyzed hydrolysis of the methyl ester of the
action was carefully monitored (LAUMEN and highly sensitive prostaglandin precursors (109)
SCHNEIDER, 1985; cf. SABBIONI et al., 1984). and (112)to the corresponding acids (110) and
PLE and PPL hydrolyses of esters are best run (113) (Fig. 36, PORTERet al., 1979; Fig. 37, LIN
at pH 7-8 (maintained with a pH-stat) to avoid et al., 1982, respectively).
3.1.3 Yeast 3.2 Enzyme Catalyzed Reduction

Although yeast are well known for reducing Reactions
ketones to alcohols however they also act as
esterases. Bakers' yeast was used to hydrolyze 3.2.1 Yeast
10,ll-dihydro-PGA, methyl ester (115)with-
out reduction of the ketone group or the 13,14- In analogy to the yeast reduction of P-keto
alkene bond (Fig. 38) (SIHet al., 1972). esters (Sect. 2.2.1.2), cyclic P-keto esters (117)
e,
reliably yield the (2R,3S) products (118)
(BROOKS et al., 1984).Reductions involving cy-
clic substrates are often more diastereo- and
enantioselective than the corresponding acy-
109 R = Me
110 R = H IPPL, p H
3h,
8, 37T,
92%yield
clic compound. The hydroxy esters (118)were
converted to unsaturated ketals which under-
Br went diastereoselective addition and alkyla-
tion to give (2S)-2-hydroxycyclohexane 6-al-
CO2R kyl esters (119)and (120) with three contigu-
0
ous stereogenic centers for use in natural
product synthesis (Fig. 39) (SEEBACH and HER-
Br - RADON, 1987). The hydroxy ester (118) has
OH
been used in an approach to the southern re-
gion (121) of avermectin (122) (Fig. 40)
t (BROOKSet al., 1982). Avermectins and mil-
bemycins are potent parasitic and anthelmintic
C4H
agents A BAR RE^ and CAPPS,1986).
BROOKS et al. (1982,1983,1984)investigated
the yeast reduction of a wide range of simple
cyclic P-diketones. Reduction of racemic cy-
clopentadiones, e.g., (123)gave predominantly
Fig. 36. Use of porcine pancreatic lipase in pros- (2S,3S)-3-hydroxycyclopentanones, e.g., (W),
taglandin synthesis. whereas cyclohexadiones, e.g., (127)gave pre-
dominantly (2R,3S)-3-hydroxycyclohexanones,
e.g., (l28).The other enantiomer of the start-
ing material, e.g., (123)and (l24)was either re-
covered or reduced to the other 3-hydroxy-
112 R = M e PPL, p H 8,37"C,
cycloalkanone diastereoisomer pair. With larg-
113 R = H _1 2h, 87% yield
?0 Z R
-
OH
H
a-\,*
t
H
- 115 R = M e
i3H 114 116 R = H Bakers' yeast
10,ll-Dihydro-PGAl
Fig. 37. Synthesis of prostaglandin endoperoxide
analogs. Fig. 38. Ester hydrolysis using yeast.
117 118 119 120

Fig. 39. Diastereoselectiveelaboration of P-hydroxyesters.
121 0
122 Avermectin Az6

oc
Fig. 40. The use of yeast in an approach to avermectin.
er membered rings (7-9) the stereochemical 3.2.2 Rhizopus arrhizus

outcome was less predictable, nevertheless the
enantiomeric excesses were still high, albeit Rhizopus arrhizus induced reduction of the
the yields were lower. The alcohol (124)was trione (132) (Fig. 43) is regiospecific and enan-
used to prepare an intermediate in the synthe- tiospecific with hydride addition being direct-
sis of anguidine (126) (BROOKS et al., 1982, ed to the Re-face of the pro-R-carbonyl group
1983). The synthesis of zoapatanol (129) to give the (2R,3S)-stereoisomer (133) (VEL-
requires a (2S,3R)-3-hydroxycyclohexanone LUZ, 1965).The triones (132) can be prepared
which was prepared from both the major by treatment of 2-methylcyclopenta-l,3-dione
(2R,3S)-(l28) and the minor (2S,3S)-diastereo- with base and an a@-unsaturated ketone. In
isomers (Fig. 41) (BROOKS et al., 1984). the presence of further base they cyclize by an
Yeast has also be used in large-scale reac- intramolecular aldol reaction to give bicyclic
tions, as illustrated in the reduction of the oxo- dione intermediates for steroid synthesis
isophorone (130) (Fig. 42) to the carotenoid (Robinson annulation). The need for reduc-
precursor (131),which has been performed on tion is questionable because treatment of the
13 kg of the starting enedione (LEUENBERGERtriones (132) with L- or D-proline effects an
et al., 1979). asymmetric aldol reaction to give the bicyclic
123 124 70% yield, 125 126 Anguidine

>98% ee
S
H
Yeast +-
___)
127 128 76% yield, 35% ee 129 Zoapatanol

Fig. 41. Routes to anguidine and zoapatanol.
130 131 08 32
Oxoisophorone 83% yield,
100% ee
Fig. 42. Synthesis of a carotenoid precursor.
ketones as single enantiomers (Hajos-Parrish

reaction).
3.3 Oxidation Reactions

3.3.1 Horse Liver Alcohol
Dehydrogenase
Fig. 43. Steroid intermediate from microbial re-
duction.
Unless protecting groups are used, discrimi-
nation between unhindered primary and sec-
ondary alcohol functions in diols such as (134)
and (136) (Fig. 44) is difficult to achieve in The initially formed hydroxyaldehyde (l37)
nonenzymic single step reactions. However, undergoes further oxidation via the hemi-
with HLADH only those hydroxyl groups that acetal (138) in another enantioselective
can locate at the oxidoreduction site will be process to yield lactone (+)-(139) of interest
oxidized, so the primary and secondary func- as a synthon for prostaglandin analogs. The
tions can be discriminated on a regional basis. other enantiomer of the bicyclic lactone (139)
4 4
OH
HLADH
* +
50% oxidation
YOH
OH OH
134 135 (-1-134
136
OH
HLADH
____t
50% oxidation
4""
137
CHO +
(-)-I36
-
c7
.\\\OH
OH
It
...-q
qo OH 0
138 (+)-139
Fig. 44. Prostaglandin synthons using HLADH.
which is the precursor of natural prostaglan- transformation - by searching the literature

dins, has been obtained by chemical oxidation for analogies. For example, the known conver-
of the enantiomer recovered from the sion of cinerone (140) to cinerolone (141) (Fig.
HLADH-catalyzed oxidation of rw(136) 45) (TABENKIN et al., 1969) was used to choose
(IRWINand JONES,1977; NEWTONand Ro- Aspergillus niger as a suitable microorganism
BERTS, 1982). for the stereospecific hydroxylation of the a,@-
unsaturated ketone (142) to the prostaglandin
synthon (143) (KUROZUMIet al., 1973).
3.3.2 Microbial Enzymes Fragrance and flavor chemicals have an
enormous world market. A considerable num-
The most useful enzymes for use in organic ber of these substances are monoterpenoids,
synthesis are those which accept a broad range sesquiterpenoids, and similar structures. Very
of substrates, while being able to act stereospe- often the special properties of terpenoids and
cifically on each. Microbial enzymes have nar- their derivatives depend on the absolute con-
rower structural specificity tolerances than figurations of the molecules, so the synthesis or
mammalian ones, however the larger selection modification of these substances demand reac-
of microorganisms available compensates for tions with high stereospecificity and methods
this. The identification of an enzyme capable of introducing chiral centers. Biotransforma-
of catalyzing a specific reaction on a particular tions are useful in this respect (ROSAZZA, 1982;
substrate is performed as for any chemical KIESLICH, 1976)with many applications having
AsperigiIIus niger
140 Cinerone 141 Cinerolone
(!k (CH2),COOH
142
Asperigjllus niger
67% yield
--c + Prostaglandins
Fig. 45. Stereospecifichydroxylations.
8 Penicillium
digitaturn
46%yield
>99% el?
3.3.2.1 Pseudomonas putida
GIBSON et al. (1970) reported the enantiose-
lective oxidation of benzene (146)to cis-cyclo-
hexadienediol (147a) (Fig. 47) and of toluene
AOH
to cis-dihydrotoluenediol(l53)(Fig. 49).These
compounds are often referred to (incorrectly)
as benzene and toluene cis-diol. Many arenes
(+)-( ~ - 1 4 4 145 a-Terpineol and aromatic heterocycles have been shown to
Limonene yield diols through microbial techniques (Su-
(Orange odour) GIYAMA and TRAGER, 1986).
It is important to note that these compounds
Fig. 46. Stereospecificmodification of terpenoids. cannot currently be made in quantity by con-
ventional abiotic chemistry. Hence they offer
unparalleled potential for use in natural prod-
been described (KRASNOBAJEW, 1984;SCHIND- uct and other syntheses.The microbial conver-
LER and SCHMID, 1982). sion is facile and high yielding. It is then easy
For example, limonene (144) (Fig. 46) is a to make derivatives of benzene-cis-diol in a
readily available and inexpensive natural standard radical-type polymerization, such as
product. Specific hydration at the double bond the polymer (148) (Fig. 47), which on heating
of the isopropenyl substituent using Penicilli- gives polyphenylene (149) by eliminating two
urn digitaturn resulted in complete transforma- molecules of H-OR (BALLARDet al., 1983).
tion of (+)-(R)-limonene (144) to a-terpineol Polyphenylene itself is intractable and not eas-
(145) (KRAIDMAN et al., 1969). Even racemic ily fabricated, but this method allows produc-
limonene affords pure a-terpineol. With mi- tion of polyphenylene films, fibers, coatings,
croorganisms other than Penicillium digitaturn, and liquid crystals.
limonene may undergo attack at the 1,Zdou- Benzene-cis-diol (147a) has also been used
ble bond to form 1,2-dihydro-l ,Ztrans-diols. A in the synthesis of both enantiomers of pinitol
number of fungi are useful in this biotransfor- (152) (Fig. 48). Esterification of the two hy-
mation, with Corynespora cassiicola and Di- droxyl groups with benzoyl chloride, pyridine,
plodia gossydina being the most appropriate and DMAP furnished the dibenzoate (147c)
strains.This provides an economical method to which underwent epoxidation anti to the ester
these glycols, useful starting materials in the groups. Treatment with acidified methanol ef-
synthesis of menthadienol, carvone, and other fected ring opening of the epoxide (150) re-
compounds. giospecifically adjacent to the alkene bond to
[GI
0 - aIl-[l@]- o n o n
I I
146 147
aR=H 148 149
bR=Ac
Fig. 47. The preparation of polyphenylene.
QH
2 MeOH.
-0, Et 3N --
OH
147c 150 151 152 (+)-Pinit01
Fig. 48. Synthesis of (+)-pinitol.
give the methyl ether (151).The final two hy- hydes (158) which underwent intramolecular
droxyl groups were then installed by osmyla- aldol condensation to give the cyclopentenyl
tion (once more anti to the ester groups), fol- carboxaldehydes (159), which are potential
lowed by deprotection to give ruc-pinitol ruc- synthons for bulnesene and kessane sesquiter-
(152). The individual enantiomers were pre- penes (HUDLICKY et al., 1988).
pared by a parallel route involving resolution Benzene-cis-diol(147a) was also used in the
by esterification with an enantiomerically pure synthesis of D-myo-inositol-l,4,5-triphosphate
acid chloride (LEYand STERNFELD, 1989).Es- (162) (Fig. 50). The key reactions are diaster-
sentially identical methodology was used in eoselective epoxidation and regioselective
the preparation of (+)- and (-)-pinit01 from ring opening of the epoxides, which resemble
1-bromobenzene-cis-diol (HUDLICKYet al., those used in the previous syntheses of pinitol
1990). (HUDLICKY et al., 1991).
The diol derived from toluene (153) (Fig. Pseudomonas putida also catalyzes the oxi-
49) was ketalized with 2,2-dimethoxypropane dation of styrene, chlorobenzene and deriva-
and pTsOH (85% yield) and then ozonolyzed tives to the corresponding cis-diols, which
at -60°C in ethyl acetate to give the keto were used for synthesis of natural products
aldehyde (154) (60-70% yield). Aldol ring clo- (HUDLICKY et al., 1989;HUDLICKY and NATCH-
sure catalyzed by alumina gave the @-unsat- us, 1992; ROUDENand HUDLICKY, 1993). The
urated ketone (155), a known prostaglandin acetone ketals of D- and L-erythrose, and ~ 4 -
intermediate (HUDLICKY et al., 1988). bonolactone which are frequently used in nat-
Hydrogenation of the toluene derived diol ural product synthesis (HANESSIAN,1983),
(153) was virtually nonselective, however, the were obtained from chlorobenzene (HUD-
diols (156) and (157) were easily separated. LICKY and PRICE,1990;HUDLICKY et al., 1989)
Treatment with periodate gave the dialde- in up to 50% yield.
376 10 SyntheticApplications of Enzyme-Catalyzed Reactions
157 24% yield en t- 15 8 en t- 159
Fig. 49. Uses of toluene cis-glycol synthons.
-- -- --
B n -
O_Bn
O a I B - o
n QBn p ~H 2 ~0 3 -
POP03H2
o q 1
HO
*'\
0
OP03H2
146 160 161 162

Fig. 50. Synthesis of myo-inositol phosphates.
proved to > 95% by recrystallization. Ozonol-

pO1ycyclic Biotransfor- ysis of the double bond yields 1,4-dialkylcyclo-
mation Products pentanes or tetrahydrofurans which have been
used in the synthesis of carbocyclic nucleo-
tides, aristeromycin (169) and neplanocin A
4.1 HydrolydCondensation (170) (ARITAet al., 1983) or conventional nu-
Reactions cleotides such as showdomycin, 6-azapseudou-
rine, and cordycepin (ARITAet al., 1984).
4.1.1 Pig Liver Esterase
PLE catalyzed hydrolysis of the diester 4.1.2 a-Chymotrypsin
(165) (Fig. 51, X=O or CH,) gives a quantita-
tive yield of the monoester (166), with an Acetate and dihydrocinnamate esters are
enantiomeric excess of 77% which can be im- hydrolyzed at almost identical rates using hy-
4 Polycyclic Biotransforrnation Products 377
1 Os04
2 Me2C0,CuS04
k02Me 164
1 mCPBA
% ~
C02R
o ~167 M
R = M~
e
I PLE
169
Aristerornycin
170
Neplanocin A
168 R = H
Fig. 51. Enantioselective hydrolysis and uses of tricyclic.
sin is the cleavage of the C-terminal amide

group of aromatic amino acids in peptides.
Hence in the hydrolysis of the diester (171)the
dihydrocinnamyl group is acting as a surrogate
for this group.
Chymotrypsin
1 4.2 Enzyme Catalyzed Reduction
Reactions
4.2.1 Yeast
The potent biological activity of prostaglan-
dins has spawned enormous synthetic efforts
(BINDRAand BINDRA, 1977; SCHIENMANN and
ROBERTS, 1982; NEWTONand ROBERTS, 1982).
Fig. 52. Hydrolysis using a-chymotrypsin. The majority of the activity resides in the nat-
ural enantiomer and hence early syntheses of
racemic prostaglandins initially sufficed, how-
ever, these were quickly supplanted by synthe-
droxide ion (BENDERet al., 1964),however a- ses of enantiomerically pure materials. In one
chymotrypsin regiospecifically cleaves dihy- approach, the racemic bicyclic ketone (173)
drocinnamate esters from simple mixed ace- was reduced with yeast to give the diastereoi-
tate-dihydrocinnamate diesters (Fig. 52) somers (174)and (175)derived from different
(JONESand LIN,1972).For example, the diest- enantiomeric series (Fig. 53). These were sep-
er (171)is hydrolyzed to give the lp-acetate arated by column chromatography and then
(172) in 53% yield with sodium hydroxide, reoxidized to the ketone and converted to the
with 35% of the diol also isolated. With a-chy- bromohydrins (176)in one step. Each of these
motrypsin, the lp-acetate is obtained in quan- was then converted to natural prostaglandins,
titative yield, although the rate of hydrolysis is e.g., (177) by different routes (NEWTONand
slower. The “normal” substrate for chymotryp- ROBERTS, 1980,1982;ROBERTS, 1985).
81
rac-173
178
I
Yeast
53% yield Microorganism
H3 H H
h
@;'
I #
M 179
(1R,5S,GS)-174 (lS,5R,65)-175
AcNHBr
H20, Me2C0
MeO
180 Estradiol-3-methyl ether

Fig. 54. Microorganism reductions in steroid syn-
( 1S3S)- 176 (lR,5R)-176 thesis.
p-diketones centered around the conversion

of diones such as (178) (Fig. 54) into chiral
intermediates, such as the hydroxy ketone
(179) (KOSMOLet al., 1967) using microorgan-
isms such as Bacillus spp. and Saccharomyces
spp. The intermediates could then be used in
the total synthesis of steroids, such as estradi-
01-3-methylether (180) (DAIand ZHOU,1985;
Fig. 53. Use of yeast in prostaglandin synthesis. REHM and REED,1984).
Hydroxysteroid dehydrogenases (HSDH)
catalyze the regiospecific reduction of ketones
(and oxidation of hydroxy groups) of steroids.
4.2.2 Microorganism Reductions Enzymes selective for reduction or oxidation
at positions 3,7,12, and 20 (Fig. 55) have been
As an extension to the reduction of cyclic p- reported (BONARAet al., 1986). In most cases
keto esters (Sect. 3.2.1) compounds with a sec- HSDHs have high regio- and diastereoselec-
ond, or third, ring are also reduced in the same tivity which cannot be achieved with conven-
manner with high selectivity (BROOKSet al., tional abiotic reagents. For example 12-dehy-
1987). Early interest in the reduction of cyclic drocholic acid (181) undergoes reduction at
He-
oH
4 Polycyclic Biotransformation Products
rac-173
TBADH
175 95%ee
379
Fig. 56. Preparation of optically active synthons for
I
prostaglandin synthesis.
7a-HSDH
ciently and hence iso-propanol or acetone are

frequently used as the donor or acceptor for
coupled redox reactions. However bicyclic ke-
tones, e.g., (173) (Fig. 56) are also efficiently re-
duced with Re-face delivery of hydride. In con-
trast to the corresponding yeast reduction
(Fig. 53) the other enantiomer of the ketone
(173) is only reduced. This is an advantage be-
cause it is easier to separate a ketone (173)
3a-HSDH. from an alcohol (175) than to separate two al-
cohols (174) and (175) (ROBERTS, 1985).
Fermentative reduction of the racemic dike-
tone (184) with Aureobasidium pullulans is
stereoselective for the Re-faces of both carbo-
nyl groups (184) (Fig. 57). The rrans-1,4-diol
product (185) was isolated in 33% yield ac-
companied by a cis-1,4-diol derived from ent-
(184) and other diastereoisomers. The trans-
Fig. 55. Regiospecific ketone reduction. 1,4-diol product (185) has a C,-axis of symme-
try (like the diketone (184)) and hence addi-
tions to the alkene give a single stereoisomer.
This was exploited in a synthesis of compactin
the 7-position (182) and oxidation at the 3-PO- (40a) (Fig. 16) (WANGet al., 1981).
sition (183) in 97-99% yield without affecting
the 1Zketo group (CARREAet al., 1984). It
should be noted that HSDH is a functional 4.2.3 Horse Liver Alcohol Dehy-
description usually derived from substrate
screening. In many cases the biologically sig- drogenase
nificant substrates for these enzymes are un-
known and are unlikely to be steroids. Howev- HLADH reduces all simple cyclic ketones
er, the ability to reduce large hydrophobic sub- from four- to nine-membered, and parallels
strates suggests that these enzymes will have the rate of reduction by sodium borohydride
broad applicability. in isopropanol (VANOSSELAER et al., 1978). It
Thermoanaerobium brockii is a thermophil- excels over traditional chemical methods in
ic organism which thrives best at high temper- combining regio- and enantiomeric specific-
atures. Its enzymes have adapted to this re- ities (JONES, 1985). HLADH catalyzes the re-
gime and hence may be sufficiently robust for duction of many cis- and rrans-decalindiones.
industrial applications. The alcohol dehydro- These highly symmetrical compounds are po-
genase from Thermoanaerobium brockii tentially useful chiral synthons.The reductions
(TBADH) reduces methyl ketones most effi- are specific for pro-R ketones only (186), to
184 185 33%yield 40a Compactin
ow:w-- .$
Fig. 57. The first route to compactin.
89%
HLADH
Yield 5 7% yield
overall
186 187 188 Twistanone
HLADH
25%Yield
0
189 190
Fig. 58. HLADH-catalyzed reductions.
give enantiomerically pure keto alcohols (187) 4.3 Oxidation Reactions

(Fig. 58). Even with more symmetrical diones,
for example, (189),which lacks a ring junction
prochiral center, the reductions are stereospec- 4.3.1 Microorganism Oxidation
ific.The decalin (187,R=H) has been convert-
ed to (+)-4-twistanone (188) (DODDSand Except in the area of steroid research, little
JONES, 1982,1988). work on the use of oxygenases to functionalize
These representative hydroxy ketones are nonactivated carbon centers has been done.
not readily available using traditional chemi- These provide useful synthons for the prepara-
cal methods, and they are clearly broadly use- tion of medicinally important compounds.
ful synthons for steroidal, terpenoid and relat- Sixty-one cultures were screened for their
ed structures. capacity to hydroxylate cyclohexylcyclohex-
NAKAZAKI and NAEMURA (NAKAZAKI et al., ane (191)(Fig. 59) (DAVIES et al., 1986). Two
1983;NAEMURA et al., 1984,1986) have shown species (Cunninghamella blakesleeana and
that HLADH accepts a variety of cage shaped Geotrichum lucrispora) gave the diequatorial
molecules as substrate, and reduces them with diol (192)as the major product, for use in the
enantioselectivity. Such rigid hydrocarbons synthesis of the carboxylic acid (l93),an ana-
and derivatives are of special interest as test log of the chemotactic agent, leukotriene B3
cases for chiroptic theories. (194).
&?
R e R ---) H02C(CH2) 3 C8H17
Geotrichlum lacrispora or OH
Cunninghamella blakesleena
191 R = H
I
H o 2 c ( ; ; w ;
192 R=OH -
OH 194 F8H17
Fig. 59. Preparation of leukotriene analogs.
Fig. 60. Transformations of progesterone and lithocholic acid.
4.3.2 Hydroxylation of Steroids optimum biological activity of hydrocortisone

and the corticosteroids, but difficult to obtain
using traditional chemistry. Nowadays, virtual-
The hydroxylation of nonactivated centers ly any center in a steroid can be regioselective-
in hydrocarbons is a very useful biotransfor- ly hydroxylated by choosing the appropriate
mation, since it has very few counterparts in microorganism (DAVIES et al., 1989).The high-
traditional organic synthesis. Intense research ly selective hydroxylation of lithocholic acid
on the stereoselective hydroxylation of al- (195) in the 7P-position was achieved using
kahes began in the late 1940s in the steroid Fusariurn equiseti (SAWADA et al., 1982). The
field, when progesterone (197)was converted product ursodeoxycholic acid (1%) (Fig. 60)is
to lla-hydroxyprogesterone (198) (Fig. 60), capable of dissolving cholesterol and can
thus halving the 37 steps needed using conven- therefore be used in the therapy of gallstones.
tional chemistry, and making (198) available There is a great deal of research activity in this
for therapy at a reasonable cost. This regiose- area due to the immense industrial impor-
lective oxidation became commercially importance, most notably by KIESLICH,JONES, HOL-
tant for the manufacture of cortisone, since LAND,and CRABB.
11P-hydroxy configuration is required for the
4.4 Carbon-Carbon Bond 4.4.2 Reactions Involving Acetyl

Formation Reactions CoA
Coenzyme A (CoA) thioesters are involved
4.4.1 Yeast Cyclases in the biosynthesis of steroids, terpenoids, mac-
rolides, fatty acids, and other substrates (BILL-
Some enzymes involved in the biosynthe- HARDT et al., 1989;PATEL et al., 1986).However,
sis of steroids have recently been used in these enzymes can only be used practically in or-
organic synthesis. 2,3-Oxidosqualene-lanoste- ganic synthesis if the CoA thioester is recycled,
rol cyclase, from bakers' yeast (Saccharornyces due to its high cost (BILLHARDT et al., 1989).
cerevisiae) catalyzes the synthesis of a number
of lanosterol analogs from the corresponding
2,3-oxidosqualene derivatives (MEDINAand 4.5 Exploiting Combinations
KYLER,1988). In the cyclization of the vinyl of Enzyme Specificity
derivative (199) (Fig. 61), the cyclization cas-
cade is followed by hydrogen and methyl
migrations as usual, but in addition the vinyl 4.5.1 Combinations
group also undergoes a 1,Zshift from C-8 to of Dehydrogenases
C-14 (200). The structure was confirmed
by conversion to the alcohol (201)(MEDINAet The degree of stereochemical control
al., 1989) which is a natural product and an in- achievable with nonenzymic methods in asym-
hibitor of HMG-CoA reductase (GRUNDY, metric synthesis has made great improvements
1988). in recent years. Still,no chemical chiral reagent
can yet approach the abilities of enzymes to
combine several different specificities in a sin-
gle step reaction.
Reduction of the racemic ketone (202)by
yeast is Re-face selective, consequently both
enantiomers are reduced to (S)-alcohols (Fig.
62).The desired alcohol (1 'S,7R)-(203) was re-
oxidized to the ketone (7R)-(202)and utilized
in the synthesis of 4-demethoxydaunorubicin
(205), a member of the adriamycin family of
anthracycline antibiotics. The unwanted (7s)-
epimer was similarly reoxidized to the ketone
(7S)-(202),racemized with pTsOH in acetic
2,3-O?<ido- acid at 110°C (TERASHIMA and TAMATO,
squalene 1982),and resubjected to yeast reduction.
cyclase
4.6 Multiple Enzyme Reactions

Interest in multienzyme synthesis has inten-
sified, as it has enormous potential, for the
manufacture of complex pharmaceuticals. For
example, the readily accessible Reichstein's
compound S (206)undergoes llp-hydroxyla-
tion with Curvularin lunata, but with other
201 R = C H z O H microorganisms dehydrogenation also occurs
to give prednisolone (207)(Fig. 63) (MOSBACH
Fig. 61. Use of lanosterol cyclase. et al., 1978).
*fpy
0 0
&JA "'OH Friedels-Craft

reaction
(7R)-202
. \
OMe
I 202 0 + 204
rac-20 2
DMSO, PY,
rt, 2h Yeast
OH
NH2
205 4-Demethoxydaunorubicin
OMe 203 32% yield
Fig. 62. Use of alcohol dehydrogenases.
206 Reichstein's Compound S
1I11p-Hydroxylase
A' - Dehydrogenase
210 (+)-Biotin
207 Prednisolone
Fig. 64. Enantioselective hydrolysis using pig liver
Fig. 63. Multienzyme synthesis. esterase.
5 Heterocyclic Biotrans- tive hydrolysis of a rneso-diester (208) which

affords an intermediate for the synthesis of
formation Products (+)-biotin (210) (IRIUCHIJIMA et al., 1978). Bi-
otin functions as a cocarboxylase in a number
of biochemical reactions. Initial experiments
5.1 Hydrolysis/Condensation showed that the pro-(S) group of the bis-ester
Reactions (208) was selectively cleaved, although the half
ester (209) was only obtained in 38% ee. In
5.1.1 Pig Liver Esterase contrast, the bis-propyl ester affords the corre-
sponding monoester in 85% yield, and with
The general hydrolysis of meso-diesters has 75% ee. The diacetate of the diol correspond-
already been discussed in Sect. 3.1.1. The ex- ing to (208) has been hydrolyzed by PPL to the
ample shown in Fig. 64 shows the enantioselec- mono-alcohol, by preferentially cleaving the
Fig. 65. Peptide synthesis.
H
0
3
co2
N mN
2 14
z
L
r
Sy nthetase
0
' 0
Isopenicillin N
+ H3NlyyN
@
co2
215
B
0 % O
co2
Epimerase
I co2
217 R = H
218 R=OH
2 Osygenase
Fig. 66. Formation of p-lactam derivatives.
pro-(R) acetoxy group, in 70% yield and 92% 5.1.3 Lipases

ee. This provides an alternative route to (+)-
biotin (WANGand SIH,1984). 5.1.3.1 Pseudomonas Lipases
The lipases isolated from different Pseu-
5.1.2 S(L-a-Aminoadipy1)-L- domonus species (PSL) are highly selective, es-
pecially for the hydrolysis of the esters of sec-
cysteinyl-D-valine (ACV) ondary alcohols, and the corresponding re-
Synthetase verse reactions (BOLAND et al., 1991).The low
cost and high selectivity and stability of PSL
In the biosynthesis of non-ribosomal pep- make it a very useful reagent for organic syn-
tides (e.g., peptide antibiotics) the carboxyl thesis (Fig. 67) (KANet al., 1985a,b).
group of amino acids is activated by esterifica- All commercially available Pseudomonus
tion with ATP with displacement of pyrophos- sp. lipases possess a stereochemical preference
phate to give aminoacyl adenylate (211). This for the (R)-configuration at the reaction
is transferred to an enzyme bound thioester, center of secondary alcohols. Pseudomonus
which then reacts with the amino group of lipase (P-3C) was found to be highly selective
another aminoacyl thioester to form a peptide (E > 100) for the hydrolysis of 3-hydroxy-4-
bond (Fig. 65) (LIPMANN, 1973). phenyl p-lactam derivatives, in an approach to
The peptide chain is thus extended from N- the synthesis of the C-13 side chain derivative
to C-terminus on a multienzyme template. An of taxol (BRIENAet al., 1993). The selectivity
example of this is seen in the biosynthesis of S remained high for the hydrolysis of the 3-acet-
(L-a-aminoadipy1)-L-cysteinyl-D-valine (ACV) oxy derivatives, with the ring nitrogen free or
(214) catalyzed by ACV synthetase (from protected.
Strepfomyces cluvuligerus) (Fig. 66) (BANKOet
al., 1987).The enzyme accepts many non-pro-
tein amino acids as well as hydroxy acids. Since 5.1.3.2 Mucor Species Lipases
ACV is a precursor of penicillins and cepha-
losporin, the enzymatically formed ACV ana- The lipases from Mucor species such as M .
logs may be converted to the corresponding p- miehei and M . javunicus have been used in syn-
lactam derivatives. ACV (214) is cyclized to thesis (CHANet al., 1988).Both enzymes seem
isopenicillin N (215) in a remarkable reaction to possess a stereochemical preference similar
which occurs in a single step with retention of to that of Pseudomonas lipase.
configuration at both carbon centers partici- M. miehei lipase was used in the resolution
pating in the cyclization. Epimerization gives of methyl-trans-p-phenylglycidate(223) via
penicillin N (216), which undergoes ring ex- transesterification in hexane:iso-butyl alcohol
pansion to give desacetoxycephalosporin C (1 :1) (Fig. 68) (YEEet al., 1992).The unreact-
(217) and allylic hydroxylation to desacetyl- ed substrate (2R,3S)-(223) and product
cephalosporin C (218) (BANKO, 1987). (2S,3R)-(224) were obtained in 95% ee. Both
P-Blocker s
2 19 220 22 1 222
R = 'Bu, 'Pr; R1 = Me, "Pr, n C ~ H l l
Fig. 67. Synthesis of P-blockers.
Enantiocomplementary to the process is the
ph4 use of protease N and some other microbial
1
C02Me proteases to produce the (S)-enantiomer
(227),which is reported to be more potent in
rac-223 animal studies.
MAP- 10
ROH
5.1.4 Penicillin Acylase

+'
/C02Me
0 ph
u. It has been shown that penicillin catalyzed
'C02R hydrolysis of the phenylacetamido group of
Ph ( 2 R , 3 S ) - 2 2 3 ( 2 S , 3 R ) - 2 2 4
42% yield 43% yield penicillin G (228)(Fig. 70), does not affect the
sensitive p-lactam ring (BRIENAet al., 1993).
This is now an important part of the procedure
for the industrial production of 6-aminopenic-
illanic acid (229)(LAGERLOF et al., 1976).
5.1.4.1 Transacylations Using Peni-

cillin Acylase
Transacylation reactions can be induced, as
represented in the penicillin and cephalospor-
in fields (Fig. 71). This methodology is advan-
tageous in that no protecting groups are re-
quired. The protease from Xunthomonas citri
condenses 6-aminopenicillanic acid (229)and
D-phenylglycine methyl ester (230a)or its p -
hydroxy derivative (230b)to give high yields
of ampicillin (231a)and amoxicillin (231b),re-
spectively (Fig. 71) (&TO et al., 1980). Similar-
ly 6-aminocephalosporanic acid (232)is con-
verted into cephalexin (233a) (CHOI et al.,
Paclitaxel, Taxol@ 1981).
Trypsin mediated exchange of threonine (as
Fig. 68. Use of lipases in taxol synthesis. its ester derivatives) for the terminal alanine
residue of porcine insulin is the basis of a com-
mercial process for the production of insulin
for human use.
enantiomers were converted to N-benzoyl-
(2R,3S)-3-phenyl isoserine (225), the C-13
side chain of the antitumor agent taxol. The 5.2 Oxidation Reactions
hindered iso-butyl alcohol was used to avoid
the reverse transesterification.
A kinetic resolution for the preparation of
5.2.1 Horse Liver Alcohol Dehy-
the anti-inflammatory agent ketorolac (227) drogenase
was achieved with M. miehei lipase catalyzed
hydrolysis of the racemic methyl ester (Fig. 69) As has been noted previously (Sects. 2.3.1
(FULLING and SIH,1987).Since the ester is eas- and 3.3.1) a broad range of meso-diols can be
ily racemized at pH. 9.7, both enantiomers are enantiospecifically oxidized using HLADH to
eventually converted to the @)-product. lactones via the corresponding hemiacetals
Fig. 69. Preparation of ketorolac.
Y tained in the oxidation of the cyclobutane diol

(237)which was used in a synthesis of grandi-
sol (239)a major component of male boll wee-
vil sex pheromone (JONES et al., 1982).Similar-
I
ly the cyclopropyl lactone (241)(Fig. 72) was
readily transformed into (+)-(lR,2S)-cis-
methylchrysanthanenate (242) providing an
attractive route to the pyrethroids (JONES,
Penicillin 1985). Further examples of such biotransfor-
Acylase mations in synthesis can be found in macrolide
(COLLUM et al., 1980b) and prostaglandin syn-
228 thesis.
5.2.2 Dihydrofolate Reductase

Dihydrofolate reductase catalyzes the in vi-
vo interconversion of folate and tetrahydrofo-
2 2 9 6-Aminopenicillanic acid late by NADPH. The reduction of dihydrofolic
acid to chiral tetrahydrofolic acid was investi-
Fig. 70. Hydrolysis of penicillin G. gated using enzymic and nonenzymic means
(REESet al., 1986).The results of the enzymic
route far exceeded the chemical methods, pro-
viding pure stable tetrahydrofolate derivatives
(Fig. 72) (JAKOVIC et al., 1982). Formation of whereas traditional chemical routes gave min-
the lactol or lactone boosts the enantiomeric imal enantiomeric excesses.The technique was
excess by protecting the less reactive hydroxyl applied to the synthesis of enantiopure 5-for-
group from oxidation. In support of this asser- myltetrahydrofolate for use in cancer “rescue”
tion, oxidation of the corresponding trans- therapy for patients undergoing cancer chemo-
compounds gives essentially racemic products. therapy with methotetrexate.
The lactone (235) was produced on a large
scale (JAKOVIC et al., 1982) in high yield and
excellent enantiomeric excess. It provided 5.2.3 Yeast
both chiral centers of the iridoid aglycone
methyl sweroside (236) (HUTCHINSON and Yeast biotransformation of the furanyl
IKEDA,1984). Equally good results were ob- acrolein (243) provided two intermediates
fl
0 s
C02H
23 1
a R = H; Ampicillin
230 b R = OMe; Amoxicillin
aR=H
bR=OH
R (>80 M Yield)
Xanthomonas citri protease
CO2H
233a R = H; Cephalexin
Fig. 71. Transacylation reactions.
(244) and (246)for the synthesis of a-tocophe- phate (248) as the nucleophilic component
rol (66) (Fig. 73). Fermentation supplemented (Fig. 74). The stereochemistry at the carbons
with pyruvate provided the diol (244) by acy- engaged in the newly formed bond is always
loin condensation, whereas standard reductive syn-3,4-(3S) which is equivalent to D-rhreo.
fermentation effected reduction of both the al- RAMA catalyzed aldol reaction of N-acetyl-
kene bond and the aldehyde group to give the aspartate P-semialdehyde (249) gave the diol
alcohol (246). Cleavage of the furan ring pro- (250) with a maximum of 40% conversion
vided the functionality to conjoin the frag- (37% yield). Reduction of the 2-keto group
ments (FUGANTI and GRASSELLI, 1985a). with sodium or tetramethylammonium triace-
toxyborohydride gave predominantly the de-
sired 2,3-anri-diol. The N-acetyl group was
5.3 Carbon-Carbon Bond cleaved with 6 N hydrochloric acid, to give the
amine which was converted to a ketone (251)
Formation Reactions (13% overall yield) by transamination with so-
dium glyoxylate. Surprisingly enzyme cataly-
5.3.1 Rabbit Muscle Aldolase zed transamination with a range of enzymes
was less effective than the abiotic reaction
Rabbit muscle aldolase (RAMA) has been (TURNERand WHITESIDES, 1989).
used in the synthesis of numerous oxygen het- Products from RAMA catalyzed aldol reac-
erocycles (BEDNARSKI et al., 1989). The en- tions have been used in efficient approaches to
zyme accepts a wide range of aldehydes, but is C-glycosides (254) and cyclitols (255) (Fig. 75)
virtually specific for dihydroxyacetone phos- (SCHMID and WHITESIDES, 1990) and the bee-
5 Heterocyclic Biotransforrnation Products 389
OH 80%yield
100 % ee
0
\\+ O
m eso-2 3 4 235 236
OMe
OH
OH
HLADH
90%yield
100 % ee
d""If
. d \ W
OH
0
meso-237 238 239 ( 1 R,ZS)-Grandisol
\OH
P O U .. HLADH
71% yield
100 % ee
*
\ A-
0
-- 6 CO, Me
meso-240 (-)-( l R , 2s)-241 (+)-(lR, 29-242
Fig. 72. Use of lactone biotransformation products.
+
tle pheromone ( )-em-brevicomin (259) cleotide synthesis enzyme catalyzed phos-
(SCHULTZ et al., 1990). phate bond formations provide solutions to
the problems of controlled couplings of oligo-
nucleotide intermediates. Gene synthesis
5.4 Nucleotide Chemistry relies heavily on this technique, as seen in the
structural genes for yeast analine tRNA and E.
5.4.1 Phosphorylation coli tyrosine suppressor tRNA (KHORANA,
1976).
Many structurally specific phosphate hydro-
lyzing enzymes are known, and have been
widely used in organic synthesis. Of particular 5.4.3 Base Exchange
synthetic importance is their use in selective
phosphate bond formation without the need Enzyme catalyzed base exchange has prov-
for protecting groups, for example, in the selec- ed to be of value in other areas of nucleotide
tive mono- and pyrophosphorylations of chemistry, such as in the preparation of pos-
monosaccharide moieties (SABINAet al., 1984; sible antiviral agents (MORISAWA et al., 1980).
LADNERand WHITESIDES, 1985). The antiviral or antitumor activity of 9 - p - ~ -
arabinofuranosylpurines has generated inter-
est in such nucleotides, and although they are
5.4.2 Gene Synthesis obtainable by a sugar-base coupling reaction
there remain definite practical limitations,
Enzyme mediated phosphorylation is of such as low yields through a laborious and
great value in the nucleic acid field. In polynu- time consuming process.
244 \
Fig. 73. Synthesis of natural a-tocopherol.
6 Aromatic 6.2 Oxidation Reactions

Biotransformation
6.2.1 Hydroxylation
Products
Selective hydroxylation of aromatic com-
pounds is a difficult task in preparative organ-
ic chemistry,particularly when the compounds
6.1 HydrolysidCondensation to be hydroxylated (or their products) are op-
Reactions tically active. In such cases the reaction should
be conducted rapidly and mildly to prevent ra-
cemization and decomposition. KLIBANOV
showed that under certain conditions horse-
6.1.1 a-Chymotrypsin radish peroxidase (HRPO) can be used for
fast, convenient, and selective hydroxylations
a-Chymotrypsin is a versatile enzyme ca- in yields of up to 75%. L-DOPA (263)was pro-
pable of showing enantiomeric specificity on a duced from L-tyrosine (262), and L-epineph-
broad range of racemic ester substrates (Fig. rine (adrenaline) (265) from L-(-)-phenyl-
76). The use of chymotrypsin as an enzymic ephrine (264) using HRPO catalyzed hydroxy-
catalyst is advantageous in that its stereospeci- lation (Fig. 77) (KLIBANOVet al., 1981).
ficity is predictable using a simple model. The The preparation of 2-arylpropionic acids by
reactive ester stereoisomers are those whose hydroxylation and oxidation of cumenes with
chiralities parallel those of the natural L-amino Cordyceps sp. (SUGIYAMA and TRAGER, 1986)
acids, and the unreactive enantiomers can all is possible, where the cumene is hydroxylated
be recycled via chemical racemization. not on the benzylic carbon as expected, but se-
6 Aromatic Biotransformation Products 391
JHA
I
HO OP 252 HO OP
249 2 48 2 48
Awop
RAMA 37%yield
I
Me02 -
OH 250
1 NaHB(OAc)3
2 GN HC1
3 Transamination
* " .H H C02-
OH
254 255
25 1 3-Wxy-D-arabine
heptulosonic acid
Fig. 74. Synthesis of 3-deoxy-~-arabino-heptuloso-
nic acid using RAMA.
HO OP
2 48
lectively at the pro-(R) methyl group. For ex-
ample, the naphthalene derivative (266) is
transformed by Cunninghamella milituris into
(S)-naproxen (267) in 98% ee (Fig. 78) (PHIL-
LIPS et al., 1986).
The hydroxylation of alkaloids often modi-
fies their biological activity and makes avail-
able compounds that are otherwise difficult to
synthesize. For example, acronycine (268), an
antitumor alkaloid, is hydroxylated in the 9-
position in 30% yield by Cunninghamella ech-
inulutu (Fig. 78) (BETTSet al., 1974).
6.2.2 Oxidative Degradation

259 (+)-exeBrevicomin
Hydroxylation of a substrate by an organism
is often a prelude to its utilization as an energy
source, which may involve complete conver- Fig. 75. ?he use of RAMA in carbocycle and
sion to CO,. Processes which effect substantial pheromone synthesis.
09
Chymotrypsin
RC02Me
=4 RC02Me RCOzH
H+ racemization
Me0
rac-260 D-260 L-261
Cunninghamella militaris
266 R = C H ,
267 R = C02H; (S)-Naproxen
0 OMe
Fig. 76. Aromatic chiral acids and esters.
HRPO, 0 2 , WC,
Dihydroxy-fumaric acid
OH Cunninghamella echinulata
J
268 R = H; Acronycine
269 R=OH
Fig. 78. Hydroxylation of cumenes and prepara-
tion of an antitumor alkaloid.
5
262 R = H; L-Tyrosine
263 R = OH: L-Dopa I O n H e p
75% yield
R EIC-2
70
Rhodococcus sp
I
17% Yield
BPM 1613
&
) 02H \
264 R = H; L-Phenylephrine
265 R = OH: L-Epinephrine 2
50% yield ( 4 - 2 7 1 Ibuprofen
Fig. 77. Enzymic hydroxylation in drug synthesis. Fig. 79. Ibuprofen from stereoselective degrada-
tion.
chemical modification but which do not lead to tiomer, however oxidation of the other enan-
complete degradation are particularly valuable. tiomer terminates at the carboxylic acid stage to
Treatment of ruc-(270)with a Rhodococcus sp., give the anti-inflammatory drug ibuprofen (R)-
results in complete degradation of one enan- (271) (Fig. 79) (SUGAIand Mom, 1984).
Tnprn
7 References 393
Bakers' yeast MeNH2
H ' a(
ph Ph? H,/W * Ph&
A
Sl-face co2 dN-Me
272 CH3 C02H 273 274 (-)-y-Ephedrine
++--Kg
CHO Bakers' yeast
Ph
a OH
2 75 276 277 Frontalin
Fig. 80. The synthesis of ( -)-ephedrine and frontalin.
6.3 Carbon-Carbon Bond centers created by the yeast reduction are used
to induce stereoselective addition of a Grig-
Formation Reactions nard reagent and subsequently both are des-
troyed by a periodate cleavage. Thus only
6.3.1 Acyloin Condensation three carbons and no chiral centers from the
biotransformation product are carried through
The formation of phenyl acetyl carbinol to (-)-frontalin (277) (Fig. 80) (FUGANTI et
(273) (Fig. 80) from benzaldehyde (272) by fer- al., 1983).
menting yeast was first observed in 1921
(CROUTet al., 1991).
The enzyme system involves pyruvic acid,
decarboxylation of which provides the C, unit 7 References
(an acyl anion equivalent) which is transferred
to the Si-face of the aldehyde to form an (3R)- ARITA,M., ADACHI, K., ITO, Y., SAWAI,H., OHNO,M.
a-hydroxy ketone (acyloin) (273). (1983), Enantioselective synthesis of the carbocy-
There is remarkable tolerance by the en- clic nucleoside (-)-aristeromycin and ( -)-
neplanocin A by a chemicoenzymatic approach,J.
zyme system with respect to changes in the Am. Chem. SOC.105,4049-4055.
structure of the aldehyde. a$-unsaturated ali- ARITA,M.,ADACHI, K., I T O , ~SAWAI,
., H., OHNO, M.,
phatic and aromatic aldehydes undergo alky- SHIBATA, K. (1984), Synthetic studies on biologi-
lation and reduction of the acyloin to give cally active natural products by a chemicoenzy-
(2S,3R)-diols (276) (FRONZA et al., 1982).The matic approach, Tetrahedron40,145-152.
yields of chiral diols are poor (10-35%), but BALDWIN, J. E.,CHRISTIE, M. A., HABER,S. B., KRUSE,
this is offset by the ease of reaction and the L. I. (1976), Stereospecificsynthesis of penicillins.
cheapness of starting reagents used. SERVIand Conversion from a peptide precursor, J. Am.
FUGANTI (FUGANTI and SERVI,1988;FUGANTI, Chem. SOC.98,3045-3047.
1986; FUGANTIand GRASSELLI, 1985b) have BALLARD, D. G., COURTIS, A., SHIRLEY,I. M.,
TAYLOR,S. C. (1983), A biotech route to poly-
exploited these compounds for numerous syn- phenylene, J. Chem. Soc., Chem. Commun.,
theses of chiral natural products. An interest- 954-955.
ing example is provided by the synthesis of BALLY,C., LEUTHARDT, F. (1970), Die Stereospezi-
(-)-frontalin (277) which is a pheromone of fitat der Alkoholdehydrogenase,Helv. Chim.Acta
several bark beetles (Fig. 80). The two chiral 53,732-738.
BANKO,G., DEMAIN, A. L., WOLFE,S. (1987), ACV BROOKS, D. W., MAZDIYASNI, H., CHAKRABARTI, S.
synthetase: A multifunctional enzyme with a (1984), Chiral cyclohexanoidsynthetic precursors
broad substrate specificity for the synthesis of via asymmetric microbial reduction of prochiral
penicillin and cephalosporin precursors, J. Am. cyclohexanediones, Tetrahedron Lett. 25, 1241-
Chem. SOC.109,2858-2860. 1244.
BARRETT, A. G. M., CAPPS,N. K. (1986), Synthetic BROOKS, D. W.,WILSON, M., WEBB,M. (1987), Differ-
approaches to the avermectins : Studies on the ent enzymatic reactions of an enantiomeric pair:
hexahydrobenzofuran unit, Tetrahedron Lett. 27, Simultaneous dual kinetic resolution of a keto
5571-5574. ester by bakers’ yeast, J. Org. Chem. 52, 2244-
BECKER, W., PFEIL,E. (1966), Continuous synthesis 2248.
of optically active a-hydroxynitrilesJ Am. Chem. CARREA, G., BONARA, R., CREMONESI, P., LODI,R.
SOC.88,42994300. (1984),Enzymatic preparation of 12-ketochenod-
BEDNARSKI, M. D., SIMON,E.S., BISCHOFBERGER,N., eoxycholic acid with NADP regeneration, Bio-
FESSNER, W.-F., KIM,M.-K. et al. (1989), Rabbit technol. Bioeng. 26,560-563.
muscle aldolase as a catalyst in organic synthesis, CHAN,C., COX,P. B., ROBERTS, S. M. (1988), Conver-
J. Am. Chem. SOC.111,627,635. gent stereocontrolled synthesis of 13-hydroxy-
BEHRENS, K. B., SHARPLESS, K. B. (1985), Selective 9Z,llE-octadecadienoic acid (13-HODE), J.
transformations of 2,3-epoxy alcohols and related Chem. Soc., Chem. Commun.,971-972.
derivatives - strategies for nucleophilic attack at CHEN,C.-S., FUJIMOTO, Y., SIH,C. J. (1981), Bifunc-
carbon-3 or carbon-2, J. Org. Chem. 50, 5687- tional chiral synthons via microbiological meth-
5696. ods. 1. Optically active 2,4-dimethylglutaric acid
BENDER, M. L., KEDZY,F. J., GUNTER, C. R. (1964), monomethyl esters, J. Am. Chem. SOC.103,358&
The anatomy of an enzymatic catalysis. a-Chymo- 3582.
trypsin, J. Am. Chem. SOC.86,3714-3721. CHIBATA, I., TOSA,T., SATO,T., MORI,T. (1976),Pro-
BEITS, R. E., WALTERS, D. E., ROSAZZA, J. P.(1974), duction of L-amino acids by aminoacylase adsor-
Microbial transformations of antitumor com- bed on DEAE-Sephadex, Methods Enzymol. 44,
pounds. 1. Conversion of acronycins to 9-hy- 746-759.
droxy-acronycine by Cunninghamella echinulata, CHOI,W. G., LEE,S. B., R w , D. D. Y. (1981), Cepha-
J. Med. Chem. 17,599-602. lexin synthesis by partially purified and immobi-
BILLHARDT, U. M., STEIN,P., WHITESIDES, G. M. lized enzymes, Biotechnol. Bioeng. 23,361-371.
(1989),Enzymatic methods for the preparation of COHEN,N., EICHEL, W. F., LOPRESTI, R. J., NEUKOM,
acetyl CoA and analogs,Bioorg. Chem. 17,l-12. C., SAUCY,G. (1976), Synthetic studies on (2R,
BINDRA, J. S., BINDRA, R. (1977),Prostaglandin Syn- 4’S, 8’R)-a-tocopherol. An approach utilizing
thesis. New York Academic Press. side-chain synthons of microbiological origin,
BOLAND, W., FROBL,C., LORENZ, M. (1991), Estero- J. Org. Chem. 41,3505-3511.
lytic and lipolytic enzymes in organic synthesis, COLLUM, D. B., MCDONALD 111, J. H., STILL,W. C.
Synthesis, 1049-1072. (1980a), The polyether antibiotic monensin. 1.
BONARA, R., CARREA, G., PASTA, P., RIVA,S. (1986), Strategy and degradations,J. Am. Chem. SOC.102,
Preparative scale regio- and stereospecific oxi- 2117-2118.
doreduction of cholic acid and dehydrocholic COLLUM, D. B., MCDONALD 111, J. H., STILL,W. C.
acid catalyzed by hydroxysteroid dehydrogen- (1980b), The polyether antibiotic monensin. 2.
ases, J. Org. Chem.51,2902-2906. Preparation of intermediates, J. Am. Chem. SOC.
BRANCA,Q., FISCHLI,A. (1977), Eine chiral-oko- 102,2118-2120.
nomische Totalsynthese von (R)- und (S)-Mus- COREY, E. J., TRYBULSKI, E. J., MELVIN,L. S.,
kon via Epoxysulfoncyclofragmentierung,Helv. NICOLAOU, K. C., SECRIST, J. et al. (1978a), Total
Chim.Acta. 60,925-944. synthesis of erythromycins. 3. Stereoselective
BRIENA, R., CRICH,J. Z., SIH,C. J. (1993), Chemoen- routes to intermediates corresponding to C( 1) to
zymatic synthesis of the C-13 side chain of taxol C(9) and C(10) to C(13) fragments of erythrono-
Optically active 3-hydroxy-4-phenyl p-lactam lide B, J. Am. Chem. SOC.100,4618-4620.
derivatives,J. Org. Chem. 58,1068-1075. COREY,E. J., KIM, S., Yoo, S., NICOLAOU, K. C.,
BROOKS,D. W., GROTHAUS, P. G., PALMER,J. T. MELVIN,L. S. et al. (1978b), Total synthesis of
(1982), Synthetic studies of trichothecenes, an erythromycins.4. Total synthesis of erythronolide
enantioselective synthesis of a C-ring, precursor B, J. Am. Chem. SOC.100,4620-4622.
of anguidine, Tetrahedron Lett. 23,41874190. COREY,E. J.,ALBRIGHT, J. O., BARTON,A. E., HASHI-
BROOKS, D. W., GROTHAUS, P. G., MAZDIYASNI, H. MOTO, S. (1980), Chemical and enzymic syntheses
(1983),Totalsynthesis of the trichothecene myco- of 5-HPETE, a key biological precursor of slow-
toxin anguidine, J. Am. Chem. SOC. 105, 4472- reacting substance of anaphylaxis (SRS), and 5-
4473. HETE, J. Am. Chem. SOC.102,1435-1436.
7 References 395
COREY, E. J., LANSBURY, P.T. (1983), Stereochemical FRATER,G. (1979a), Uber die Stereospezifitat der
course of 5-lipoxygenation of arachidonate by rat a-Alkylierung von P-Hydroxycarbonsaureestern,
basophil leukemic cell (RBL-1) and potato en- Helv. Chim.Acta. 62,2825-2828.
zymes,J. Am. Chem. SOC.105,40934094. FRATER,G. (1979b), Stereospezifische Synthese von
CROUT,D. H. G., DALTON, H., HUTCHINSON, D. W., (+)-(3R,4R)-4-methyl-3-Heptanol. Das Enan-
MIYAGOSHI, M. (1991), Studies on pyruvate de- tiomer eines Pheromons des kleinen Ulmen-
carboxylase acyloin formation from aliphatic, splintkafers,Helv. Chim.Acta. 62,2829-2832.
aromatic and heterocyclic aldehydes, J. Chem. FRATER,G. (1980), Uber die Stereoselektivitat der
Soc., Perkin. Trans.I, 1329-1334. a-Alkylierung von (1R,2S)-( + )-cis-2-hydroxycy-
DAI,W. M., ZHOU, w. s. (1985), New synthesis of two clohexancarbonsaureethylester,Helv. Chim.Acta.
optically active steroid C D ring synthons by 63,1383-1390.
microbial asymmetric reduction, Tetrahedron 41, FRATER, MULJ-ER, u.
7 GUNTHER, w. (1984), The
44754482. stereoselective a-alkylation of chiral P-hydroxy
DAVIES,H. G., DAWSON, M. J., LAWRENCE, G. C., esters and applications thereof, Tetrahedron 40,
MAYALL, J., NOBLE,D. et al. (1986), Microbial 1269-1277.
hydroxylation of cyclohexylcyclohexane;Synthe- G . ~FUGANT1, c., L.,
sis of an analog of leukotriene BJ, Tetrahedron FANTOW G.9 SPREAFICO,F- (l982), Synthesis Of
Lett. 27,1089-1092. enantiomerically pure forms of N-acyl derivatives
Of C-methyl Of the aminodeoxy War
DAVIES, H. G., GREEN,R. H., KELLY,D. R., ROBERTS,
S. M. (1989), Biotransformations in preparative L-acosamine from non-carbohydrate precursors,
organic chemistry. London: Academic Press. J. Org. Chem. 47,3289-3296.
FUGANT1, c' (1986), Bakers' yeast-mediated prepar-
DODDS,D, R., JONES,J. B. (1982), Selective and ster-
eospecific enzyme-catalyzed reductions of cis- ation of carbohydrate-like chiral synthons,in: En-
and trans-decalindiones to enantiomerically pure zymes as Catalysts in Organic Synthesis (SCHNEI-
DER, M. P., Ed.) NATO AS1 Series,Vol. 178. Dor-
hydroxy-ketones; an efficient access to (+)-4-
twistanone,J. Chem. Soc., Chem. Commun.,1080- drecht: Reidel-Gruyter.
FUGANTI,C., GRASSELLI, P. (1985a), Enzymes in
1081.
Organic synthesis, in: CIBA Foundation Sympo-
DODDS,D. R., JONES,J. B. (1988), Enzymes in organ-
sium III, pp. 112-127. London: Pitman.
ic synthesis' 38' Preparations Of enantiomerically
FUGANTI, C., GRASSELLI, p. (1985b),Stereochemistry
pure chiral hydroxydecalones via stereospecific and synthetic applications of products of fernen-
horse liver dehydrogenase-catalyzed tation of +unsaturated aromatic aldehydes by
reductions of decalindiones, J. Am. Chem. SOC. bakers' yeast, in: Enzymes as catalysts in Organic
110,577-583. Synthesis (CLARK, S., PORTER,R., Eds.). London:
DRAUZ,K., WALDMANN, H. (1995), Enzyme Cataly- Pitman.
sis in Organic Synthesis, A Comprehensive Hand- mGANTI, c., SERw, s. (1988), Bioflavour '87
book. Weinheim: VCH. (SCHEIER, P., Ed.). Berlin: de Gruyter.
DRUECKHAMMER, D. G., v. w.,WoNG* C.-H. FUGANTI, C., GRASSELLI, P., SERVI,S. (1983), Synthe-
(1985), FMN reductase catalyzed regeneration of sis of ( - )-frontalin from the (2S,3R)-diol pre-
NAD(P) for use in enzymatic synthesis, J . 0% pared from a-methylcinnamaldehyde and fer-
Chem. 50,5387-5389. menting bakers' yeast, J. Chem. SOC., Perkin
EFFENBERGER, F., STRAUB, A. (1987), A novel, con- T ~ ~ 241-244.
~ ~ . I ,
venient Preparation of dihYdroxYacetone Phos- FULLING, G., SIH,C. J. (1987), Enzymatic second order
phate and its use in Enzymatic aldol reactions, asymmetric hydrolysis of ketorolac esters: in situ
Tetrahedron Lett. 28,1641-1644. racemization,J. Am. Chem. SOC.109,2845-2846.
EVANS, D.A., SACKS, c.E., mSCHICK,W.A.,TABER, GAIS,H.-J., LUKAS,K. L. (1984), Enantioselective
T. R. (1979), Polyether antibiotics synthesis and and enantioconvergent syntheses of building
absolute configuration of the ionophore A-23187, blocks for the total synthesis of cyclopentanoid
J. Am. Chem. SOC.101,67894791. natural products, Angew. Chem. (Int. Edn. Engl.)
EVANS, D. A., NELSON, J. V.,TABER,T.R. (1982), Ster- 23,142-143.
eoselective aldol condensation, Top. Stereochem. GAIS,H.-J., LIED,T., LUKAS,K. L. (1984), Asymmet-
13,l-115. ric synthesis of a novel enantiomerically pure
FABER,K. (1995), Biotransformations in Organic prostaglandin building block, Angew. Chem. (Int.
Chemistry, 2nd Edn. Berlin, New York: Springer- Edn. Engl.) 23,511-512.
Verlag. GIBSON,D. T., HENSLEY, M., YOSHIOKA, H., MABRY,
FISCHLI, A. (1980), Modern Synthetic Methods, Vol. 2 T. J. (1970), Formation of ( + )-cis-2,3-dihydroxy-
(SCHEFFOLD, R., Ed.). Frankfurt: Salle-Sauerlan- l-methylcyclohexa-4,6-dienefrom toluene by
der. Pseudomonas putida, Biochemistry 9,1626-1630.
GLASS,J. D. (1981), Enzymes as reagents in the syn- HUDLICKY, T., PRICE,J. D., RULIN,F., TSUNODA, T.
thesis of peptides, Enzyme Microb. Technol. 3, (199O), Efficient and enantiodivergent synthesis
1-8. of (+)- and (-)-pinitol, J. Am. Chem. SOC.112,
GOODHUE, C. T., SCHAEFFER, J. R. (1971), Prepara- 9439-9440.
tion of (L)-( +)-/3-hydroxyisobutyric acid by bac- HUDLICKY, T.,LUNA,H., OLWO,H. F.,ANDERSEN, C.,
terial oxidation of isobutyric acid, Biotechnol. NUGENT,T., PRICE, J. D. (1991), Biocatalysis as the
Bioeng. 13,203-214. strategy of choice in the exhaustive enantiomeri-
GREENSTEIN, J. P. (1954), The resolution of racemic cally controlled synthesis of conduritols, J. Chem.
a-hydroxy amino acids, Adv. Protein Chem. 9, SOC.,Perkin Trans.I , 2907-2917.
121-202. HUTCHINSON, C. R., IKEDA, T. (1984), A general, en-
GREENZAID, P., JENCKS,W. P. (1971), Pig liver ester- antiospecific synthesis of cyclopentanoid mono-
ase reactions with alcohols, structure-reactivity terpenes (iridoids), The total synthesis of ( -)-1-
correlations and the acyl-enzyme intermediate, 0-methylsweroside aglucone, J. Org. Chem. 49,
Biochemistry 10,121&1222. 2837-2838.
GRUNDY, S. M. (1988), HMG-CoA reductase inhibi- IRIUCHIJIMA,S., HASEGAWA, K., TSUCHIHASHI, G.
tors for treatment of hypercholesterolemia, N. (1978), Structure of a new phenolic glycoside,
Eng. J. Med. 319,2433. chesnatin, from chestnut galls, Agric. Biol. Chem.
HAMADA,M., TAKEUCHI, T., KONDO,S., IKEDA, Y., 46,1907-1910.
NAGANAWA, H. et al. (1970), A new antibiotic, ne- IRWIN,A. J., JONES,J. B. (1977),Asymmetric synthesis
gamycin, J. Antibiot. 23,17&171. via enantiotopically selective horse liver alcohol
HANESSIAN, S. (1983), Total synthesis of natural dehydrogenase-catalyzed oxidations of diols con-
products: The ‘chiron’ approach. Oxford: Per- taining a prochiral center, J. Am. Chem. SOC.99,
gamon Press. 556-561.
HEATHCOCK, C. H. (1984), The aldol addition reac- ISOWA,Y., OHMORI, M., SATA,M., MORI,K. (1977a),
tion, Asymm. Synth. 3,111-212. The enzymatic synthesis of protected valine-5-an-
HEMMERLE, H., GAIS,H.-J. (1987), Asymmetric hy- giotensin I1 amide-1, Bull. Chem. SOC. Jpn. 50,
drolysis and esterification catalyzed by esterases 2766-2772.
from porcine pancreas in the synthesis of both ISOWA, Y., OHMORI, M., ICHIKAWA, T., KURITA,H.,
enantiomers of cyclopentanoid building blocks, SATO,M., MORI,K. (1977b), the synthesis of pep-
Tetrahedron Lett. 28,3471-3474. tides by means of proteolytic enzymes, Bull.
HIRAMA, M., UEI,M. (1982), Chiral total synthesis of Chem. SOC.Jpn. 50,2762-2765.
compactin,J. Am. Chem. SOC.104,42514253. JAKOVIC,~. J.,GOODBRAND,H. B.,LoK,P.K.,JONES,J.
HIRAMA, M., GARVEY, P. S., Lu, L. D. L., MASAMUNE, B. (1982), Enzymes in organic synthesis. 24. Prep-
S. (1979), Use of the E-vinyloxyborane derived arations of enantiomerically pure chiral lactones
from S-phenyl propanethioate for stkreospecific via stereospecific horse liver alcohol dehydro-
aldol-type condensation. A simplified synthesis of agenase-catalyzed oxidations of monocyclic
the Prelog-Djerassi lactonic acid, Tetrahedron meso-diols, J. Am. Chem. SOC.104,46594665.
Lett. 41,3937-3940. JOHNSON, R. A. (1978), Oxidation in organic chemis-
HIRAMA, M., SHIMIZU, T., IWASHITA, M. (1983), En- try, Part C (TRAHANOVSKY, W. S., Ed.). New York:
antiospecific syntheses of trifunctional (l9-3-h~- Academic Press.
droxy esters by bakers’ yeast reduction, J. Chem. JOHNSON,M. R., KISHI, Y. (1979), Cooperative effect
SOC.,Chem. Commun., 599400. by a-hydroxy and ether oxygen in peroxidation
HUDLICKY, T., NATCHUS, M. (1992), Chemoenzymat- with a peracid, Tetrahedron Lett. 45,43474350.
ic enantiocontrolled synthesis of ( - )-specionin, JOHNSON,M. R.,NAKATA,T., K I S H I ,(1979),
~. Stereo-
J. Org. Chem.57,4740-4746. and regioselective methods for the synthesis of
HUDLICKY, T., PRICE,J. D. (1990), Microbial oxida- three consecutive asymmetric units in many
tion of chloroaromatics in the enantioselective natural products, Tetrahedron Lett. 45, 4343-
synthesis of carbohydrates - L-ribonic y-lactone, 4346.
Synlett, 159-160. JONES, J. B. (1985), Enzymes in organic synthesis, in:
HUDLICKY, T., LUNA,H., BARBIERI, G., KWART,L. D. CIBA Foundation Symposium III (CLARK,S.,
(1988), Enantioselective synthesis through micro- PORTER, R., Eds.), pp. 3-21. London: Pitman.
bial oxidation of arenes. Efficient preparation of JONES, J. B. (1986), Enzymes in organic synthesis,
terpene and prostanoid synthons, J. Am. Chem. Tetrahedron 42,3351-3403.
SOC.110,4735-4741. JONES, J. B. (1993), Probing the specificity of synthet-
HUDLICKY, T., LUNA,H., PRICE,J. D., RULIN,F. ically useful enzymes, Aldrichimica Acta 26,
(1989), An enantiodivergent approach to D- and 105-1 12.
L-erythrose via microbial oxidation of chloroben- JONES, J. B., LIN,Y. Y. (1972), Evaluation of some of
zene, TetrahedronLett. 30,40534054. the factors involved in the selective hydrolysis of
7 References 397
aromatic ester protecting groups by a-chymo- (1981), Ph3P-(PyS),-CH3CN as an excellent

trypsin, Can. J. Chem. 50,2053-2058. condensing system for p-lactam formation
JONES,J. B., FINCH,M. A. W., JAKOVIC,I. J. (1982), En- from p-amino acids, J. Am. Chem. SOC. 103,
zymes in organic synthesis.26. Synthesis of enan- 2406-2408.
tiomerically pure grandisol from an enzyme-gen- KONDO,S., SHIBAHARA, S., TAKAHASHI, S., MAEDA,
erated chiral synthon, Can. J. Chem. 60, K., UMEZAWA, H., OHNO,M. (1 971), Negamycin,a
2007-201 1. novel hydrazide antibiotic, J. Am. Chem. SOC.93,
KAN,K., MIYAMA, A., HAMAGUCHI, S., OHASHI,T., 6305-6306.
WATANABE, K. (1985a), Synthesis of (S)-@block- KOSMOL, H., KIESLICH, K., VOSSING, R., KOCH,H.-J.,
er from (S)-5-hydroxymethyl-3-tert-butyl-2-oxaz- PETZOLD,K., GIBIAN,H. (1967), Mikrobiologi-
olidinone or (S)-5-hydroxymethyl-3-isopropyl-2- sche stereospezifische Reduktion von 3-Meth-
oxazolidinone,Agric. Biol.Chem. 49,207- 210. oxy-8.14-seco-l.3.5(10).9-ostratraen-14.17-dion,
KAN,K., MIYAMA, A., HAMAGUCHI, S., OHASHI,T., Liebigs Ann. Chem. 701,198-205.
WATANABE, K. (1985b), Stereochemical inversion KOYAMA, T., SAITO,A., OGURA,K., SETO,S. (1980),
of (R)-5-hydroxymethyl-3-tert-butyl-2-oxazolidi- Substrate specificity to farnesyl pyrophosphate
none or (R)-5-hydroxymethyl-3-isopropyl-2-ox- synthetase, application to asymmetric synthesis,J.
azolidinone to the corresponding (S)-isomer,Ag- Am. Chem. SOC.102,36163618.
ric. Biol. Chem. 49,1669-1674. KOYAMA, T., OGURA,K., BAKER,E C., JAMIESON, G.
KARADY,S., AMATO,J. S., REAMER,R. A., WEIN- C., SCHOOLERY, D. A. (1987), Synthesis and abso-
STOCK, L. M. (1981), Stereospecific conversion of lute configuration of 4-methyl juvenile hormone
penicillin to thienamicin, J. Am. Chem. SOC. 103, 1(4-MeJH 1) by a biogenetic approach: A combi-
6765-6767. nation of enzymatic synthesis and biotransforma-
KASEL,W., HULTIN,P. G., JONES,J. B. (1985), Prepar- tion, J. Am. Chem. SOC.109,2853-2854.
ations of chiral hydroxy ester synthons via stereo- KRAIDMAN, G., MUKHERTEE, B. B., HILL,J. D. (1969),
selective porcine pancreatic lipase-catalyzed hy- Cyclic vicinal glycols as microbial transformation
drolyses of meso-diesters, J. Chem. SOC.,Chem. products of some monocyclic terpene hydrocar-
Commun., 1563-1564. bons, Bacteriol. Proc. 63.
KATO,K., KAWAHARA, K.,TAKAHASHI,T., IGARASI, S. KRASNOBAJEW, V. (1984), Microbial transformations
(1980), Enzymatic synthesis of amoxicillin by the of terpenoids, in: Biotechnology 1st Edn., Vol. 6a.
cell bound a-amino acid ester hydrolase of Xan- Biotrunsformations (REHM,H.-J., REED,G., Eds.).
thomonas citri, Agric. Biol. Chem. 44,821-825. Weinheim: Verlag Chernie.
KATSUKI, T., MARTIN,V. S. (1996). Catalytic asym- KULLMAN, W. (1981), Protease-mediated peptide
metric epoxidation of allylic alcohols, Org. React. bond formation, J. Biol. Chem. 256,1301-1304.
48,l-130. KULLMAN, W. (1982), Enzymatic synthesis of dynor-
KATSUKI, T., SHARPLESS, K. B. (1980), The first prac- phin (la), J. Org. Chem. 47,5300-5303.
tical method for asymmetric epoxidation, J. Am. KUPCHAN,S. M., KOMODO,Y., BRANFMAN, A. R.,
Chem. SOC.102,5974-5976. SNEDEN,A. T., COURT,W. A. et al. (1977), The
KHORANA, H. G. (1976),Total synthesis of the struc- maytansinoids. Isolation, structural elucidation
tural gene for the precursor of a tyrosine suppres- and chemical interrelation of novel ansa macro-
sor transfer RNA from Escherichia coli, J. Biol. lides, J. Org. Chem. 42,2349-2357.
Chem. 251,565-586. KUROZUMI, S., TORA,T., OSHIMOTO, S. (1973), Prep-
KIESLICH,K. (1976), Microbial transformations of aration of 2-(4-hydroxy-l-oxocyclopent-2-ene)-
non-steroid cyclic compounds. Stuttgart: Thieme. heptanoic acid, an important prostaglandin syn-
KITAZUME, T., ISHIKOWA, N. (1984), Introduction of thon, TetrahedronLett. 49,49594960.
center of chirality into fluorocompounds by mi- LADNER,W. E., WHITESIDES, G. M. (1984), Lipase-
crobial transformation of 2,2,2-trifluoroethanol, catalyzed hydrolysis as a route to esters of chiral
Chem. Lett., 1815-1818. epoxy alcohols,J.Am. Chem. SOC.106,7250-7251.
KLIBANOV,A. M., BERMAN, Z.,ALBERTI,B. N. (1981), LADNER, W. E., WHITESIDES, G. M. (1985), Enzymat-
Preparative hydroxylation of aromatic com- ic synthesis of deoxy ATP using RNA as starting
pounds catalyzed by peroxidase, J. Am. Chem. materia1,J. Org. Chem. 50,1076-1079.
SOC.103,6263-6264. LAGERLOF, E., NATHORST-WESTFELOT, L., EKSTROM,
KOBAYASHI, M., KOYAMA,T., OGURA,K., SETO,S., B., SJOBERG, B. (1976), Production of 6-aminope-
RITER, E J., BRUGGERMANN-ROTGANS, I. E. M. nicillanic acid with immobilized Escherichia coli,
(1980), Bioorganic synthesis and absolute config- Methods Enzymol. 44,759-768.
uration of faranal, J. Am. Chem. SOC. 102, LAUMEN,K., SCHNEIDER, M. (1985), Enantioselec-
6602-6604. tive hydrolysis of cis-1,2-diacetoxycycloalkanedi-
KOBAYASHI, S., IIMORI,T., IZAWA,T., Omo, M. methanols: Enzymatic preparations of chiral
building blocks from prochiral meso substrates,
Tetrahedron Lett. 26,2073-2076. enantiomers of threo-2-amino-3-methyl-hexanoic

LEUENBERGER, H. G., BOGUTH,W., BARNER, R., acid by enzymatic resolution and their conversion
SCHMID, M., ZELL,R. (1979), Large-scale reduc- to optically active forms of threo-4-methylhep-
tion of oxoisophorone in the synthesis of caroten- tan-3-01, a pheromone component of the smaller
oids, Helv. Chem. Acta 62,455465. European elm bark beetle, Tetrahedron 36,2209-
LEY,S. V., STERNFELD, F. (1989), Microbial oxidation 2213.
in synthesis: Preparation of (+)- and (-)-pinit01 MORI,K.,TANIDA,K. (1981), Synthesis of three ster-
from benzene, Tetrahedron 45,3463-3476. eoisomeric forms of 2,8-dimethyl-1.7-dioxaspi-
LIN, C. H., ALEXANDER, D. L., CHICHESTER, C. G., ro(5S)undecane, the main component of the ce-
GORMAN, R. R., JOHNSON, R. A. (1982), 10-nor- phalic secretion of Andrena wilkella,Heterocycles
9,ll-secoprostaglandins.Synthesis, structure and 15,1171-1179.
biology of endoperoxide analogs, J. Am. Chem. MORISAWA, H., UTAGAWA, T., MUOSHI,T., YOSHINA-
SOC. 104,1621-1628. GA,F., YAMAZAKI, A., MITSUGI,K. (1980),A new
LIPMANN, F. (1973), Nonribosomal polypeptide syn- method for the synthesis of some g-P-~-arabino-
thesis on polyenzyme templates, Acc. Chem. Res. furanosylpurines by a combination of chemical
6,361-367. and enzymatic reactions, Tetrahedron Lett. 21,
MACLEOD, R., PROSSER, H.,FIKENTSCHER,L.,LANYI, 479482.
J., MOSHER,H. S. (1964),Asymmetric reductions. MOROE,T., HATTORI,S., KOMATSU, A., YAMAGUCHI,
XII. Stereoselective ketone reductions by fer- Y. (1970), Chem. Abstr. 73,33900d.
menting yeast, Biochemistry 3,838-846. MOSBACH,K., OHLSON, S., LARSSON, P. D. (1978),
MARPLES, B. A., ROGER-EVANS, M. (1989), Enantiose- Steroid transfer by activated living immobilized
lective lipase-catalyzed hydrolysis of esters of e p Arthrobacter simplex cells,Biotechnol. Bioeng. 20,
oxy secondary alcohols:An alternative to Sharp- 1267-1284.
less oxidation, Tetrahedron Lett. 30,261- 264. NAEMURA, K., KATOH,T.,CHIKAMATSU, H., NAKAZA-
MEDINA,J. C., KYLER,K. S. (1988), Enzymatic cy- KI, M. (1984), The preparation and chirotopical
clization of hydroxylated surrogate squalenoids properties of cage-shaped pentacyclic hydrocar-
with bakers’ yeast, J. Am. Chem. SOC.110, bons, Chem. Lett., 1371-1374.
4818-4821. NAEMURA, K., FuJII,T., CHIKAMATSU, H. (1986), Se-
MEDINA,J. C., GUAJARDO, R., KYLER,K. S. (1989), lective and stereospecific horse liver alcohol de-
Vinyl group rearrangement in the enzymatic cy- hydrogenase-catalyzed reduction of cage-shaped
clization of squalenoids: Synthesis of 30-oxyster- meso-diketones. An efficient access to optically
ols,J.Am. Chem. SOC.111,2310-2311. active D,-trishomocubane derivatives, Chem.
MEYERS, A. I., AMOS,R. A. (1980), Studies directed Lett., 923-926.
toward the total synthesis of streptogramin anti- NAKAZAKI, M., CHIKAMATSU, H., FuJII,T., SASAKI,Y.,
biotics. Enantiospecific approach to the nine- Ao,Y. (1983), Stereochemistry of horse liver alco-
membered macrocycle of grisoviridin, J. Am. hol dehydrogenase-mediated oxidoreduction of
Chem. SOC. 102,870472. 2-brendanone type cage-shaped tricyclic ketones
MEYERS, A. I., HUDSPETH, J. P. (1981), Enantioselec- and the related stereoisomeric alcohols, J. Org.
tive synthesis of C,-C,, fragment (north east Chem. 48,43374345.
zone) of maytanisoids with four chiral centers NEWTON,R. F., ROBERTS, S. M. (1980), Steric con-
(4S,5S,6R,7S), Tetrahedron Lett. 22,3925-3928. trolled prostaglandin synthesis involving bicyclic
MOHR,P.,WAESPE-SARCEVIC, N., TAMM,c . , CAW- and tricyclic intermediates, Tetrahedron 36,2163-
RONSKA, K., GAWRONSKI, J. K. (1983),A Study of 2196.
stereoselective hydrolysis of symmetrical diesters NEWTON,R. F., ROBERTS, S. M. (1982), Prostaglandin
with pig liver esterase, Helv. Chim. Acta. 66, and thromboxanes: An introductory text. Lon-
2501-251 1. don: Butterworths.
MORI,K. (1989), Synthesis of optically active phero- O’CONNELL, E. L., ROSE,I. A. (1973), Affinity label-
mones, Tetrahedron 45,3233-3298. ing of phosphoglucose isomerase by 1,2-anhydro-
MORI,K.,EBATA,T.(1986a),Synthesis of (2S,3R,l’R)- hexitol-6-phosphates, J. Biol. Chem. 248,
stegobinone, the pheromone of the drugstore 2225-2231.
beetle with stereocontrol at C-2 and C-2’, Tetra- OKANO,K., IZAWA, T., OHNO,M. (1983), A general
hedron 42,4413-4420. approach of trans-carbapenem antibiotics. Enan-
MORI,K., EBATA,T. (1986b), Synthesis of all of the tioselective synthesis of key intermediates for
four possible stereoisomers of 5-hydroxy-4-meth- (+)-PS-5, (+)-PS-6 and (+)-thienamycin, Tetra-
yl-3-heptanone (sitophilure). The aggregation hedron Lett. 24,217-220.
pheromone of the rice weevil and the maize wee- OYAMA, K., NISHIMURA, S., N O N A K A ,KIHARA,~.,
~.,
vil, Tetrahedron 42,4421-4426. HASHIMOTO, T. (1981), Synthesis of an aspartame
MORI,K., IWASAWA, H. (1980), Preparation of both precursor by immobilized thermolysin in an or-
7 References 399
ganic solvent, J. Org. Chem.46,5241-5242. lase (RAMA),J. Am. Chem. SOC.112,967&9671.

PATEL,S. S., CONLON, H. D., WALT,D. R. (1986), En- SCHULTZ, M., WALDMANN, H., VOGT,W., KUNZ,H.
zyme-catalyzed synthesis of L-acetylcarnitineand (1990), Stereospecific C-C bond formation with
citric acid using acetyl coenzyme A recycling, J. rabbit muscle aldolase - a chemicoenzymaticsyn-
Org. Chem.51,2842-2844. +
thesis of ( )-exo-brevicomin, Tetrahedron Lett.
PHILLIPS, G.T., MATCHAM, G. W. J., BERTOLA, M. A., 31,867-868.
MARX,A. F., KOGER,H. S. (1986), Eur. Patent SEEBACH, D., HERRADON, B. (1987), Diastereoselec-
Appl. EP 205,21517. tive elaboration of the carbon skeleton of P-hy-
PORTER, N. A., BYERS, J. D.,HOLDEN, K. M., MENZEL, droxy esters from yeast reductions, Tetrahedron
D. B. (1979),Synthesis of prostaglandin H2,J.Am. Lett. 28,3791-3794.
Chem. SOC.101,43194322. SEEBACH, D., SUTTER, R. H., WEBER,R. H., ZUGER,
QUISTAD, G. B., CERF,D.C., SCHOOLEY, D. A., STAAL, M. F. (1985) Ethyl (S)-3-hydroxybutanoate, Urg.
G. B. (1981), Fluoromenalonate acts as an inhibi- Synth. 63,l-7.
tor of insect juvenile hormone biosynthesis, Na- SERVI,S. (1990),Bakers’ yeast as a reagent in organ-
ture 289,176-177. ic synthesis, Synthesis, 1-25.
REHM,H.-J., REED,G. (Eds.) (1984), Biotechnology SEURLING, B., SEEBACH, D. (1977), Synthese von vier
1st. Edn., Vol. 6a Biotransformations (KIESLICH, chiralen, elektrophilen C,- und C,-Synthesebau-
K., Ed.). Weinheim:Verlag Chemie. steinen aus Hydroxycarbonsauren, Helv. Chim.
REES,L., VALENTE, E., SUCKLING, C. J., WOOD, H. C. Acta 60,1175-1181.
S. (1986),Asymmetric reduction of dihydrofolate SIH,C. J., SALOMAN, R. G., PRICE,P., SOOD,R., PER-
using dihydrofolate reductases and chiral boron- LUZZOTTI, G. (1972), Total synthesis of prosta-
containing compounds, Tetrahedron 42,117-136. glandins 111. 11-Deoxyprostaglandins, Tetrahe-
ROBERTS, S. M. (1985), Enzymes in organic synthesis, dron Lett. 24,2435-2437.
in: CIBA Foundation Symposium III, pp. 31-39. SUGAI,T., MORI,K. (1984), Preparation of (R)-ibu-
London: Pitman. profen and related carbocyclic acids using micro-
ROSAZZA, J. P. (1982), Microbial Transformations of bial oxidation of an aromatic hydrocarbon by
Bioactive Compounds, Vol. 1. Boca Raton, FL: Rhodococcus sp. BPM 1613, Agric. Biol. Chem.
CRC Press. 48,2501-2504.
ROUDEN, J., HUDLICKY, T. (1993), Total synthesis of SUGIYAMA, K.,TRAGER, W. F. (1986),Prochiral selec-
( + )-kifunensine, a potent glycosidase inhibitor, tivity and intramolecular isotope effects in the cy-
J. Chem. Soc., Perkin Trans.I, 1095-1097. tochrome P-450 catalyzed w-hydroxylationof cu-
SABBIONI, G., SHEA,M. L., JONES, J. B. (1984), Prepara- mene, Biochemistry 25,7336-7343.
tions of bicyclic chiral lactone synthons via stereo- TABENKIN, B., LEMAHIEN, R. A., BERGER,J., KIER-
specific pig liver esterase-catalyzed hydrolyses of STEAD, R. w. (1969), Microbiological hydroxyla-
meso-diestersRing-sized induced reversal of sterec- tion of cinerone to cinerolone, Appl. Microbiol.
specificityJ Chem.Soc., Chem. Commun.,236-238. 17,714-717.
SABINA, R. L., HOLMES, E. W., BECKER, M. A. (1984), TAKAMATSU, S., UMEMURA, I., TOSA,T., SATO,T.,
The enzymatic synthesis of 5-amino-4-imidazole- YAMAMOTO, K., CHIBATA, C. (1982), Production
carbocamide riboside triphosphate (ZTP), Sci- of L-alanine from ammonium fumarate using two
ence 223,1193-1195. types of immobilized microbial cells, Eur. J. Appl.
SALTZMANN, T. N., RATCLIFFE, R., CHRISTENSEN, B. Microbiol. Biotechnol. 15,142-152.
G., BOUFFARD,F. A. (1980), A stereocontrolled TENGO,J., AGREN,L., BAUR,B., ISAKSSON, R., LIUE-
synthesis of (+)-thienamycin, J. Am. Chem. SOC. FORS,T. et al. (1990), Andrena wilkella male bees
102,61614163. discriminate enantiomers of cephalic secretion
SAWADA, S., KULPRECHA, N., NILUBOL, N., YOSHIDA, components, J. Chem. Ecol. 16,429441.
S., KINOSHITA, S., TAGUCHI, H. (1982), Microbial TERASHIMA, S.,TAMOTO, K. (1982), An efficient syn-
production of ursodeoxycholic acid from lithio- thesis of optically pure anthracycline intermedi-
cholic acid by Fusarium equiseti M41, Appl. En- ates by the novel use of microbial reduction, Tet-
viron. Microbiol. 44,1249-1252. rahedron Lett. 23,3715-3718.
SCHIENMANN, F., ROBERTS,S. M. (1982), Recent Syn- TSCHAEW, D. M., FUENTES, L. M., LYNCH, J. E., LAS-
thetic Routes to Prostaglandins and Thrombox- WELL,W. L., VOLANTE, R. P., SHINKAI, I. (1988),
anes. London: Academic Press. An efficient synthesis of 4-benzoyloxyazetidi-
SCHINDLER, J., SCHMID, R. D. (1982), Fragrance or none: An important carbapenem nucleus, Tetra-
aroma chemicals - microbial synthesis and enzy- hedron Lett. 29,2779-2782.
matic transformation - a review, Proc. Biochem. TURNER, N. J., WHITESIDES, G. M. (1989), A com-
2, October 2-8. bined chemical-enzymaticsynthesis of 3-deoxy-6
SCHMID, W., WHITESIDES, G. M. (1990), A new ap- arabino-heptulosonic acid 7-phosphate, J. Am.
proach to cyclitols based on rabbit muscle aldo- Chem. SOC.111,624627.
VAN OSSELAER, T. A., LEMIERE,G. L., LEPOIVRE, J. (1984), Bifunctional chiral synthons via biochern-
A., ALDERWEIRELOT, F. C. (1978), Enzymatic in ical methods. 3. Optical purity enhancement in
vitro reduction of ketones, Bull. SOC.Chim. Belg. enzymic asymmetric catalysis, J. Am. Chem. SOC.
87,153-154. 106,3695-3697.
VON KRAMER, A., WANDER,H. (1982),C45-und Cs0- WONG,C.-H., WHITESIDES, G. M. (1994), Enzymes in
Carotinoide: Synthese von (R)- und (S)-Lavan- Synthetic Organic Chemistry,Tetrahedron Organ-
dulol, Helv. Chim.Acta. 65,293-301. ic Chemistry Series Vol. 12. Trowbridge: Pergam-
VELLUZ, L. (1965), Recent advances in the total syn- on.
thesis of steroids, Angew. Chem. (Int. Edn. Engl.) WONG,C. H., MAZENOID, F. P.,WHITESIDES, G. M.
4,181-200. (1983), Chemical and enzymatic syntheses of 6-
WANG,Y.-F.,SIH,C. J. (1984),Bifunctional chiral syn- deoxyhexoses. Conversion to 2,5-dimethyl-4-hy-
thons via biochemical methods 4. Chiral precur- droxy-2,3-dihydrofuran-3-one (furaneol) and an-
sors to (+)-biotin and (-)-A-factor, Tetrahedron alogs,J. Org. Chem.48,3493-3497.
Lett. 25,4999-5002. YAMAUCHI, T., CHOI,S. Y., OKADA,H., YOHDA,M.,
WANG,N.Y.,Hsu, C.T., SIH,C. J. (1981),Totalsynthe- KUMAGAI, H. et al. (1992),Properties of aspartate
sis of (+)-compactin (ML-236B), J. Am. Chem. racemase, a pyridoxal5 ‘-phosphate-independent
SOC.103,653M539. amino acid racernase, J. Biol. Chem. 267,
WANG,Y.-F., IZAWA,T., KOBAYASHI, S., OHNO,M. 18361-18 365.
(1982),Stereocontrolled synthesis of ( + )-negam- YEE, C., BLITHE,T. A., MCNABB,T. J., WALTS,A. E.
ycin from an acyclic homoallyamine by 1,3-asym- (1992), Biocatalytic resolution of tertiary a-sub-
metric induction, J. Am. Chem. SOC. 104, stituted carbocyclic acid esters: Efficient prepara-
646545466. tion of a quaternary asymmetric carbon center, J.
WANG,Y.-F., CHEN,C . 4 , GIRDAUKAS, G., SIH,C. J. Org. Chem.57,3525-3527.
The Future of Biotransformations
11 Catalytic Antibodies
GEORGEMICHAEL
BLACKBURN
ARNAUDGARCON
Sheffield, UK
1 Introduction 404
1.1 Antibody Structure and Function 404
1.2 The Search of a New Class of Biocatalyst 404
1.3 Early Examples for Catalytic Antibodies 406
1.4 Methods for Generating Catalytic Antibodies 407
2 Approaches to Hapten Design 410
2.1 Transition State Analogs 410
2.2 Bait and Switch 412
2.3 Entropic Trapping 415
2.4 Substrate Desolvation 419
2.5 Supplementation of Chemical Functionality 420
3 Spontaneous Features of Antibody Catalysis 421
3.1 Spontaneous Covalent Catalysis 421
3.2 Spontaneous Metal Ion Catalysis 422
4 How Good are Catalytic Antibodies? 423
5 Changing the Regio- and Stereochemistry of Reactions 426
5.1 Diels-Alder Cycloadditions 426
5.2 Disfavored Regio- and Stereoselectivity 427
5.3 Carbocation Cyclizations 430
6 Difficult Processes 431
6.1 Resolution of Diastereoisomers 432
6.2 Cleavage of Acetals and Glycosides 432
6.3 Phosphate Ester Cleavage 435
6.4 h i d e Hydrolysis 438
7 Reactive Immunization 439
8 Potential Medical Applications 441
8.1 Detoxification 441
8.2 Prodrug Activation 442
8.3 Abzyme Screening via Cell Growth 445
9 Industrial Future of Abzymes 446
10 Conclusions 446
11 Glossary 447
12 Appendix 451
12.1 Catalog to Antibody Catalyzed Processes 451
12.2 Key to Bibliography 479
13 References 481
404 11 Catalytic Antibodies
1 Introduction into similar structural domains, essentially a

bilayer of antiparallel P-pleated sheets. This
gives the structure of an IgG immunoglobulin
This review seeks to deal with most of the molecule whose core is formed from twelve,
important developments in the field of catalyt- similar structural domains: eight from the two
ic antibodies since the initial successes were heavy chains and four from the two light
announced over a dozen years ago (POLLACK chains (Fig. 1) (BURTON,1990). Notwithstand-
et al., 1986;TRAMONTANO et al., 1986).The de- ing this apparent homogeneity, the N-terminal
velopment of catalytic antibodies has required regions of antibody light and heavy chains
contributions from a number of scientific dis- vary greatly in the variety and number of their
ciplines, which traditionally have not worked constituent amino acids and thereby provide
in concert. Thus, while this chapter describes binding regions of great diversity called hyper-
catalytic antibodies, their reactions, and their variable regions. The variety of proteins so
mechanisms from a biotransformations view- generated approaches lolo in higher mam-
point, it will also provide a review that de- mals.
mands only a basic biochemical knowledge of The essential property of the immune
antibody structure, function, and production. system is its ability to respond to single or mul-
Sufficient details of these matters have been tiple foreign molecular species (antigens)
supplied to meet the needs of expert and non- through rapid diversification of the sequences
expert readers alike. In Sect. 11, there is a glos- of these hypervariable regions by processes in-
sary of most of the immunological terms used volving mutation, gene splicing, and RNA
in this review, in language familiar to chemists. splicing. This initially provides a vast number
While this survey is not fully comprehensive, it of different antibodies which subsequently are
seeks to focus on the most significant parts of selected and amplified in favor of those struc-
a subject which, in a little over a decade, has tures with the strongest affinity for one partic-
achieved much more than most critics expect- ular antigen.
ed at the outset. A moderately complete sur-
vey of the literature is presented in the form of
an appendix (Sect. 12),which lists over 100 ex- 1.2 The Search for a New Class of
amples of reactions catalyzed by antibodies, Biocatalyst
the haptens employed, and their kinetic pa-
rameters. Fifty years ago, LINUSPAULINGclearly set
out his theory that enzymes achieve catalysis
because of their complementarity to the tran-
1.1 Antibody Structure and sition state for the reaction being catalyzed
Function (PAULING,1948). With hindsight, this concept
could be seen as a logical extension of the new
One of the most important biological de- transition state theory that had been recently
fense mechanisms for higher organisms is the developed to explain chemical catalysis
immune response. It relies on the rapid gener- (EVANSand POLANYI,1935; EYRING, 1935).
ation of structurally novel proteins that can The basic proposition was that the rate of a re-
identify and bind tightly to foreign substances action is related to the difference in Gibbs free
that would otherwise be damaging to the par- energy (AGO)between the ground state of re-
ent organism. These proteins are called immu- actant(s) and the transition state for that reac-
noglobulins and constitute a protein super- tion. For catalysis to be manifest, either the en-
family.In their simplest form they are made up ergy of the transition state has to be lowered
of four polypeptide chains: one pair of identi- (transition state stabilization) or the energy of
cal short chains and one pair of identical long the substrate has to be elevated (substrate de-
chains, interconnected by disulfide bridges. stabilization). PAULING applied this concept to
The two light and two identical heavy chains enzyme catalysis by stating that an enzyme
contain repeated homologous sequences of preferentially binds to and thereby stabilizes
about 110 amino acids which fold individually the transition state for a reaction relative to
1 Introduction 405
Fig. 1. Scheme to show the structure of the peptide components of an IgG immunoglobulin:
the two light (L) and two heavy (H) polypeptide chains; the disulfide bridges (-S-S-)
connecting them; four variable regions of the light (V,) and heavy (V,) chains; and the eight
“constant” regions of the light (C,) and heavy (CH1,CHz,CH3) chains (shaded rectangle).
The hypervariable regions that achieve antigen recognition and binding are located within
six polypeptide loops, three in the V, and three in the V, sections (shaded circle, top left).
These can be excised by protease cleavage to give a fragment antibody, Fab (shaded
lobe, top right).
the ground state of substrate(s) (Fig. 2). This neered by manipulation of the immune system
has become a classical theory in enzymology (JENCKS, 1969).
and is widely used to explain the way in which “One way to do this (i.e., synthesize an en-
such biocatalysts are able to enhance specific zyme) is to prepare an antibody to a haptenic
processes with rate accelerations of up to lo’’ group which resembles the transition state of
over background (ALBERYand KNOWLES, a given reaction”.’
1976,1977;ALBERY, 1993 for a review). The practical achievement of this goal was
PAULINGapparently did not bring ideas held up for 18 years, primarily because of the
about antibodies into his concept of enzyme great difficulty in isolation and purification of
catalysis, although there is a tantalizing photo- single-species proteins from the immune rep-
graph in a volume of PAULING’S lectures ca. ertoire. During that time, many attempts to
1948which shows on a single blackboard a car- demonstrate catalysis by inhomogeneous (i.e.,
toon of an energy profile diagram for the low- polyclonal) mixtures of antibodies were made
ering of a transition state energy profile and al- and failed (e.g., RASOand STOLLAR,1975;
so reference to an immunoglobulin (PAULING,
1947).And so it fell to BILLJENCKSin his mag-
isterial work 1969 on catalysis to bring togeth- In making this statement, JENCKS was apparently
er the opportunity for synthesis of an enzyme not aware of PAULING’S idea (JENCKS,personal com-
by the use of antibodies that had been engi- munication).
11 Catalytic Antibodies
- progress ofreaction - -
Fig. 2. Catalysis is achieved by lowering the free energy of activation for a process, i.e., the catalyst must bind
more strongly to the transition state (TST) of the reaction than to either reactants or products. Thus:
AAG: s - A A G ~and ~ ~ AAGcak..
:~
SUMMERS, 1983).The problem was resolved in The Hammond postulate predicts that if a
1976 by KOHLERand MILSTEIN’S development high energy intermediate occurs along a reac-
of hybridoma technology, which has made it tion pathway, it will resemble the transition
possible both to screen rapidly the “complete” state nearest to it in energy (HAMMOND, 1955).
immune repertoire and to produce relatively Conversely, if the transition state is flanked by
large amounts of one specific monoclonal anti- two such intermediates, the one of higher ener-
body species in vitro (KOHLERand MILSTEIN, gy will provide a closer approximation to the
1975; KOHLERet al., 1976). transition state structure.This assumption pro-
While transition states have been discussed vides a strong basis for the use of mimics of un-
in terms of their free energies, there have been stable reaction intermediates as transition
relatively few attempts to describe their struc- state analogs (BARTLETTand LAMDEN,1986;
ture at atomic resolution for most catalyzed ALBERG et al., 1992).
reactions. Transition states are high energy
species, often involving incompletely formed
bonds, and this makes their specification very 1.3 Early Examples of Catalytic
difficult. In some cases these transient species Antibodies
have been studied using laser femtochemistry
(ZEWAILand BERNSTEIN, 1988;ZEWAIL, 1997), In 1986, RICHARDLERNERand PETER
and predictions of some of their geometries SCHULTZ independently reported antibody ca-
have been made using molecular orbital calcu- talysis of the hydrolysis of aryl esters and of
lations (HOUK et al., 1995). Intermediates carbonates respectively (POLLACK et al., 1986;
along the reaction coordinate are also often of TRAMONTANO et al., 1986). Such reactions are
very short lifetime, though some of their struc- well-known to involve the formation and
tures have been studied under stabilising con- breakdown of an unstable tetrahedral inter-
ditions while their existence and general na- mediate (2), and so this can be deemed $0 be
ture can often be established using spectro- closely related to the transition state (TS+) of
scopic techniques or trapping experiments the reaction (Fig. 3).
(MARCH,1992a).
1 Introduction 401
Transition states of this tetrahedral nature 1.4 Methods for Generating

have now been effectively mimicked by a
range of stable analogs, including phosphonic Catalytic Antibodies
acids, phosphonate esters, a-difluoroketones,
and hydroxymethylene functional groups (JA- It is appropriate at this stage in the review to
COBS, 1991). LERNER'S group elicited antibod- consider the stages in production of a catalytic
ies to a tetrahedral anionic phosphonate hap- antibody and to put in focus the relative roles
ten2 (3) (AE32.9) while SCHULTZ'S group iso- of chemistry, biochemistry, immunology, and
lated a protein with high affinity for p-nitro- molecular biology. Nothing less than the full
phenyl cholyl phosphate (5) (Fig. 4, AE 3.2). integration of these cognate sciences is needed
for the fullest realization of the most difficult
objectives in the field of catalytic antibodies. In
broad terms, the top section of the flow dia-
gram for abzyme production (Fig. 5) involves
chemistry, the right hand side is immunology,
"0LX,
the bottom sector is biochemistry, and molecu-
lar biology completes the core of the scheme.
0 R'
Chemistry
At the outset, chemistry dominates the selec-
tion of the process to be investigated. The tar-
geted reaction should meet most if not all of
following criteria:
(1) have a slow but measurable spontane-

ous rate under ambient conditions;
(2) be well analyzed in mechanistic terms;
(3) be as simple as possible in number of
reaction steps;
(4) be easy to monitor;
2 Tetrahedral (5) lead to the design of a synthetically ac-
intermediate cessible transition state analog (TSA)
of adequate stability.
As we shall see later, many catalytic antibodies

achieve rate accelerations in the range lo3 to
lo6.It follows that for a very slow reaction, e.g.,
0- the alkaline hydrolysis of a phosphate diester
Products
with k,, ca. lo-'' M-' s-',direct observation
Fig. 3. The hydrolysis of an aryl ester (1) (X = CHz) of the reaction is going to be experimentally
or a carbonate (1) (X = 0)proceeds through a tetra- problematic. Given that concentrations of cat-
hedral intermediate (2) which is a close model of the alytic antibodies employed are usually in the
transition state for the reaction. It differs substanti-
ally in geometry and charge from both reactants and
1-10 pM range, it has been far more realistic to
products. target the hydrolysis of an aliphatic ester, with
kOHca. 0.1 M-' s-' under ambient conditions.
The need for a good understanding of the
mechanism of the reaction is well illustrated
It might be helpful to the reader to indicate that
the pyridine-2-6-dicarboxylatecomponent of (3) by the case of amide hydrolysis. Many early
was designed for a further purpose, neither used nor enterprises sought to employ TSAs that were
needed for the activity described in the present based on a stable anionic tetrahedral interrne-
scheme. diate, as had been successful for ester hydroly-
A E =Appendix Entry sis. Such approaches identified catalytic anti-
Abzyme Conditions Km4 kcat4 Ki 3

Identity
6D4 X pH 8; 25 "C 1.9 @0.027
I s-l 0.16 fl
5 6
Abzyme Conditions Km 6 kcat6 Ki 5

Identity
MOPC167 pH7; 30°C 208 fl 0.007 s-l 5 p.M
Fig. 4. LERNER'S group used phosphonate (3) as the hapten to raise an antibody which was capable of hy-
drolyzing the ester (4). SCHULTZfound that naturally occurring antibodies using phosphate (5) as their anti-
gen could hydrolyze the correspondingp-nitrophenyl choline carbonate (6).(Parts of haptens (3) and ( 5 ) re-
quired for antibody recognition have been emphasized in bold).
a
of Target
Organic Synthesis
SCREEN
for binding
I
ANTIBODIES
Fig. 5. Stages in the production of a catalytic antibody.

1 Introduction 409
bodies capable of ester hydrolysis but not of a second one for ELISA screening purposes.
amide cleavage! There is good evidence that The carrier proteins selected for this purpose
for aliphatic amides, breakdown of the tetra- are bovine serum albumin (BSA, RMM
hedral intermediate is the rate determining 67,000), keyhole limpet hemocyanin (KLH,
step. This step is catalyzed by protonation of RMM 4 . lo6), and chicken ovalbumin (RMM
the nitrogen leaving group and hence this fea- 32,000).All of these are basic proteins of high
ture must be part of the TSA design. immunogenicity and with multiple surface ly-
The importance of minimizing the number sine residues that are widely used as sites for
of covalent steps in the process to be catalyzed covalent attachment of hapten. Successful
is rather obvious. Single- and two-step process- antibody production can take some three
es dominate the abzyme scene. However, there months and should deliver from 20 to 200
is substantial evidence that some acyl transfer monoclonal antibody lines for screening, pref-
reactions involve covalent antibody intermedi- erably of IgG isotype.
ates and so must proceed by up to four cova- Screening in early work sought to identify
lent steps. Nonetheless, such antibodies were high affinity of the antibody for the TSA, using
not elicited by intentional design but rather a process known as ELISA. This search can
discovered as a consequence of efficient now be performed more quantitatively by
screening for reactivity. BIAcore analysis, based on surface plasmon
Direct monitoring of the catalyzed reaction resonance methodology (LOFAS and JOHNS-
has most usually been carried out in real time SON,1990). A subsequent development is the
by light absorption of fluorescent emission catELISA assay (TAWFIKet al., 1993) which
analysis and some initial progress has been searches for product formation and hence the
made with light emission detection. The low identification of abzymes that can generate
quantities of abzymes usually available at the product.
screening stage put a premium on the sensitiv- Methods of this nature are adequate for
ity of such methods. However, some work has screening sets of hybridomas but not for selec-
been carried out of necessity using indirect tion from much larger libraries of antibodies.
analysis, e.g., by HPLC or NMR. So, most recently, selection methods employ-
Finally, this area of research might well have ing suicide substrates (Sect. 6.2) (JANDAet al.,
supported a Journal of UnsuccessfulAbzymes. 1997) or DNA amplification methodology
It is common experience in the field that some (FENNIRIet al., 1995) have been brought into
three out of four enterprises fail, and for no the repertoire of techniques for the direct
obvious reason. It is therefore imperative that identification of antibodies that can turnover
chemical synthesis of a TSA should not be the their substrate. However, the time-consuming
rate determining step of an abzyme project. screening of hybridomas remains the mainstay
The average performance target is to achieve of abzyme identification.
hapten synthesis within a year: one or two ex-
amples have employed TSAs that could be Biochemistry
found in a chemical catalog, the most syntheti- A family of 100 hybridoma antibodies can typ-
cally-demanding cases have perforce em- ically provide 20 tight binders and these need
ployed multi-step routes of considerable so- to be assayed for catalysis. At this stage in the
phistication (e.g.,AE 13.2).Lastly, the TSA has production of an abzyme, the benefit of a sen-
to survive in vivo for at least two days to elicit sitive, direct screen for product formation
the necessary antigenic response. comes into its own. Following identification of
a successful catalyst, the antibody-producing
Immunology cell line is usually recloned to ensure purity
The interface of chemistry and immunology and stabilization of the clone, then protein is
requires conjugation of multiple copies of the produced in larger amount (ca. 10 mg) and
TSA to a carrier protein for production of used for determination of the kinetics and
antibodies by standard monoclonal technolo- mechanism of the catalyzed process by classi-
gy (KOHLERand MILSTEIN,1976). One such cal biochemistry. Digestion of such protein
conjugate is used for mouse immunization and with trypsin or papain provides fragment anti-
410 I1 Catalytic Antibodies
bodies (Fabs), that contain only the attenuated

upper limbs of the intact IgG (Fig. 1). It is
2 Approaches to Hapten
these components that have been crystallized,
in many cases with the substrate analog, prod-
Design
uct, or TSA bound in the combining site, and One can now recognize a variety of strate-
their structures determined by X-ray diffrac- gies in addition to the earliest ones deployed
tion. for hapten design. Some of these were present-
ed originally as discrete solutions of the prob-
Molecular Biology lem of abzyme generation, but it is now recog-
Only a few abzymes have reached the stage nized that they need not be mutually exclusive
where mutagenesis is being employed in order either in design or in application. Indeed, more
to improve their performance (MILLERet al., recent work often brings two or more of them
1997). Likewise, HILVERT is the first to have together interactively. They can be classified
reached the stage of redesign of the hapten to broadly into five categories for the purposes of
attempt the production of antibodies with en- analysis of their principal design elements. The
hanced performance (KAST et al., 1996). So, sequence of presentation of these here is in
the circle of production has now been com- part related to the chronology of their appear-
pleted for at least one example, and chemistry ance on the abzyme scene.
can start again with a revised synthetic target.
(1) Transition state analogs.
(2) Bait and switch.
(3) Entropy traps.
(4) Desolvation.
( 5 ) Supplementation of chemical function-
ality.
2.1 Transition State Analogs

As has clearly been shown by the majority
of all published work on catalytic antibodies,
the original guided methodology, i.e., the de-
sign of stable transition state analogs (TSAs)
for use as haptens to induce the generation of
catalytic antibodies, has served as the bedrock
of abzyme research. Most work has been di-
rected at hydrolytic reactions of acyl species,
perhaps because of the broad knowledge of
the nature of reaction mechanisms for such re-
actions and the wide experience of deploying
phosphoryl species as stable mimics of un-
stable tetrahedral intermediates. More than 80
examples of hydrolytic antibodies have been
reported, including the 47 examples of acyl
group transfer to water (entries under 1-5 of
the Appendix).
Most such acyl transfer reactions involve
stepwise addition of the nucleophile followed
by expulsion of the leaving group with a tran-
sient, high energy, tetrahedral intermediate
separating these processes. The fastest of such

reactions generally involve good leaving
groups and the addition of the nucleophile is
the rate determining step. This broad conclu- Phosphate Phosphorothioate
sion from much detailed kinetic analysis has diester diester
been endorsed by computation for the hydrol-
ysis of methyl acetate (TERAISHIet al., 1994).
This places the energy for product formation
from an anionic tetrahedral intermediate some
7.6 kcal mol-l lower than for its reversion to Phosphonate Phosphonamidate
reactants. So, for the generation of antibodies monoester
for the hydrolysis of aryl esters, alkyl esters,
carbonates, and activated anilides, the design
of hapten has focused on facilitating nucleo-
philic attack, and with considerable success.
The tetrahedral intermediates used for this
purpose initially deployed phosphorus (V) Phosphinic acid Sulfonamide
systems, relying on the strong polarization of
the P=O bond (arguably more accurately
represented as P+-0-). The range has includ-
ed many of the possible species containing an
ionized P-OH group (Fig. 6). One particularly
good feature of such systems is that the Sulfone Ketone hydrate
P+-O- bond is intermediate in length
(1.521 A) between the C-0- bond calculated Fig. 6. Transition state analogs for acyl cleavage re-
' for an anionic tetrahedral intermediate action via tetrahedral transitions states.
(0.2-0.3 A shorter) and for the C . . - Obreak-
ing bond in the transition state (some 0.6 A
longer) (TERAISHIet al., 1994). Other tetrahe- lyzed by FUJII(FUJIIet al., 1995) have shown
dral systems used have included sulfonamides that the protonated in catalytic anti-
(SHEN,1995) and sulfones (BENEDE'ITIet al., bodies 6D9,4B5,8Dll, and 9C10 (AE 1.8) is
1996), secondary alcohols (SHOKATet al., capable of forming a hydrogen bond to the
1990), and a-fluoroketone hydrates ( K ~ A z u - oxyanion in the transition state for ester hy-
ME et al., 1994). drolysis.
It is clear that phosphorus-based transition In similar vein, KNOSSOWhas identified
states have had the greatest success, as shown HisH35located proximate to the oxyanion of
by the many entries under 1-5 of the Appen- p-nitrophenyl methanephosphonate in the
dix. This may be a direct result of their anionic crystalline binary complex of antibody
or partial anionic character, a feature not gen- CNJ206 and TSA, a system designed to hydro-
erally available for the other species illustrated lyzep-nitrophenyl acetate (c.f. AE 2.7) (CHAR-
in Fig. 6, though a-difluorosulfonamides might BONNIER et al., 1995).A third example is seen
reasonably also share this feature as a result of in SCHULTZ'Sstructure of antibody 4867,
their enhanced acidity. which hydrolyzes methyl p-nitrophenyl car-
Not surprisingly, most of the catalytic anti- bonate (AE 3.lc).The haptenpnitrophenyl4-
body binding sites examined in structural de- carboxybutane-phosphonate is proximate to
tail have been found to contain a basic residue ArgL96 and also forms hydrogen bonds to
that provides a coulombic interaction with TyrH33,and T ~ (Fig. T 7)~(PAITEN
~ ~ et
these TSAs, for which the prototype is the nat- al., 1996).
ural antibody McPC603 to phosphoryl choline, Clearly, the oxyanion hole is now as signifi-
where the phosphate anion is stabilized by cant a feature of the binding site of such acyl
coulombic interaction with ArgH5*(PADLAN et transfer abzymes as it is already for esterases
al., 1985). In particular, X-ray structures ana- and peptidases - and not without good reason.
2.2 Bait and Switch

Charge-charge complementarity is an im-
portant feature involved in the specific and
tight binding of antibodies to their respective
antigens. It is the amino acid sequence and
conformation of the hypervariable (or comple-
mentarity determining regions, CDRs) in the
antibody combining site which determine the
interactions between antigen and antibody.
This has been exploited in a strategy dubbed
“bait and switch” for the induction of antibody
..
catalysts which perform p-elimination reac-
TyrL94 H‘ tions (SHOKATet al., 1 9 8 9 ; T ~ et o~al.,~1995),
Fig. 7. Binding site details for antibody 48G7 com- acyl-transfer processes (JANDAet al., 1990b,
plexed with hapten p-nitrophenyl 4-carboxybuta- 1991b;SUGAet al., 1994a;Lr and JANDA, 1995),
nephosphonate (PAITENet al., 1996). NB Amino cis-trans alkene isomerizations (JACKSON and
acid residues in antibodies are identified by their SCHULTZ,1991), and dehydration reactions
presence in the light (L) or heavy (H) chains with a (UNOand SCHULTZ, 1992).
number denoting their sequence position from the The bait and switch methodology deploys a
N-terminus of the chain. hapten to act as a “bait”.This bait is a modified
substrate that incorporates ionic functions in-
tended to represent the coulombic distribution
expected in the transition state. It is thereby
designed to induce complementary, oppositely
KNOSSOW has analyzed the structures of three charged residues in the combining site of anti-
esterase-like catalytic antibodies, each elicited bodies produced by the response of the im-
in response to the same phosphonate TSA mune system to this hapten. The catalytic abil-
hapten (CHARBONNIER et al., 1997). Catalysis ity of these antibodies is then sought by a sub-
for all three is accounted for by transition state sequent “switch” to the real substrate and
stabilization and in each case there is an oxy- screening for product formation, as described
anion hole involving a tyrosine residue. This above.
strongly suggests that evolution of immuno- The nature of the combining site of an anti-
globulins for binding to a single TSA hapten body responding to charged haptens was first
followed by selection from a large hybridoma elucidated by GROSSBERGand PRESSMAN
repertoire by screening for catalysis leads to (GROSSBERG and PRESSMAN, 1960),who used a
antibodies with structural convergence. Fur- cationic hapten containing a p-azophenyltri-
thermore, the juxtaposition of X-ray structures methylammonium ion to make antibodies with
of the unliganded esterase mAb D2.3 and its a combining site carboxyl group, essential for
complexes with a substrate analog and with substrate binding (as shown by diazoacet-
one of the products provides a complete de- amide treatment).
scription of the reaction pathway. D2.3 acts at The first example of “bait and switch” for
high pH by attack of hydroxide on the sub- catalytic antibodies was provided by SHOKAT
strate with preferential stabilization of the (SHOKATet al., 1989), whose antibody 43D4-
oxyanion anionic tetrahedral intermediate, in- 3D12 raised to hapten (7) was able to catalyze
volving one tyrosine and one arginine residue. the p-elimination of (8) to give the trans-
Water readily diffuses to the reaction center enone (9) with a rate acceleration of 8.8.104
through a canal that is buried in the protein above background (Fig. 8;AE 8.2). Subsequent
structure (GIGANTet al., 1997). Such a clear analysis has identified a carboxylate residue,
picture of catalysis now opens the way for site- G ~ as the
u catalytic
~ ~ function
~ induced by the
directed mutagenesis to improve the perform- cationic charge in (7) (Fig. 6) (SHOKATet al.,
ance of this antibody. 1994).
12
Abzyme Identity Conditions
43D4-3D12 pH 6; 37 “C
182 pM 0.003 s-’ 0.29 pM
Fig. 8. Using the “bait and switch” principle, hapten

(7)elicited an antibody, 43D4-3D12, which catalyzed
the p-elimination of (8) to a trans-enone (9). The
carboxyl function in (7)is necessary for its attach-
R = succinimidyl
ment to the carrier protein. 14
Fig. 9. The original hapten (10) demonstrated the

utility of the “bait and switch” strategy in the gener-
A similar “bait and switch” approach has ation of antibodies to hydrolyze the ester substrate
been exploited for acyl-transfer reactions (11).Three haptens (U), (W), (14) were designed to
(JANDA et al., 1990b,1991b).The design of hap- examine further the effectiveness of point charges in
ten (10) incorporates both a transition state amino acid induction. Both charged haptens (U),
mimic and the cationic pyridinium moiety, de- (13) produced antibodies that catalyzed the hydroly-
signed to induce the presence of a potential sis of (11) whereas the neutral hapten (14)generat-
general acidbase or nucleophilic amino acid ed antibodies which bound the substrate unproduct-
ively.
residue in the combining site, able to assist in
catalysis of the hydrolysis of substrate (11)
(Fig. 9, AE 2.6).
Some 30% of all of the monoclonal antibod- combining site residue, while the quaternary
ies obtained using hapten (10) were catalytic, ammonium species (13) combines both tetra-
and so the work was expanded to survey three hedral mimicry and positive charge in the
other antigens based on the original TSA de- same locus. Finally, the hydroxyl group in (14)
sign (JANDA et al., 1991b).The carboxylate an- was designed to explore the effects of a neutral
ion in (12) was designed to induce a cationic antigen.
Three important conclusions arose from this ONH3

work. I
(1) A charged functionality is crucial for
catalysis.
(2) Catalytic antibodies are produced from OZN H
targeting different regions of the bind- 15
ing site with positive and negative hap-
tens (although more were generated in @NMe3
the case of the cationic hapten used 1
originally).
(3) The combination of charge plus mimic-
ry of the transition state is required to
induce hydrolytic esterases. O2N H
16
Esterolytic antibodies have also been pro- ONMe3
duced by SUGAusing an alternative “bait and 1
switch” strategy (AE 2.1) (SUGAet al., 1994a).
A 1,2-aminoalcohol function was designed for
generating not only esterases but also amidas-
es. In order to elicit an anionic combining site
for covalent catalysis, three haptens were syn-
thesized, one contained a protonated amine HO
(15) and two featured trimethylammonium
cations (16), (17) (Fig. 10). The outcome was
interpreted as suggesting that haptens contain-
ing a trimethylammonium group were too
sterically demanding, so that the induced an-
ionic amino acid residues in the antibody bind-
ing pocket were too distant to provide nucleo- 18
philic attack at the carbonyl carbon of sub-
strate (18). An alternative explanation may be
that coulombic interactions lacking any hydro-
gen bonding capability will not be sufficiently
short-range for the purpose intended.
The use of secondary hydroxyl groups in the
haptens (15) and (16) was designed to mimic 19
the tetrahedral geometry of the transition
state (as in JANDA’S work), while the third hap- R = position of linker
ten (17) replaced the neutral OH with an an- Fig. 10.Three haptens (W), (16), (17) containing 1,2-
ionic phosphate group, designed to elicit a cat- aminoalcohol functionality were investigated as al-
ionic combining site residue to stabilize the ternatives for esterase and amidase induction. Half
transition state oxyanion. However, this func- of the antibodies raised against hapten (15) were
tion in (17) may have proved too large to in- shown to catalyze the hydrolysis of ester (18),there-
duce a catalytic residue close enough to the de- by establishing the necessity for a compact haptenic
veloping oxyanion, since weaker catalysis was structure. Hapten (19)along with (16) was employed
observed relative to haptens (15) and (16) in a heterologous immunization program to elicit
(kcatlkUncat -
=2.4 . lo3, 3.3. lo3, and 1.lo3 for both a general and acid base function in the anti-
body binding site.
(15), (16), and (17), respectively) (Fig. 10).
In order to achieve catalysis employing both
acid and basic functions, an alternative zwitter-
ionic hapten was proposed in which the anion-
ic phosphoryl core is incorporated alongside

the cationic trimethylammonium moiety (cf.
17) (SUGAet al., 1994b).The difficulty in syn-
thesizing such a target hapten can be over-
come by stimulating the immune system first
with the cationic and then with the anionic
point charges using the two structurally relat-
ed haptens (16) and (19), respectively. Such a
sequential strategy has been dubbed “heterol-
ogous immunization” (Fig. 10) and this results
of this strategy were compared with those
from the individual use of haptens (16) and
(19) in a “homologous immunization” routine.
Of 48 clones produced as a result of the ho-
mologous protocols, 7 were found to be cata-
lytic, giving rate enhancements up to 3-103.
By contrast, 19 of the 50 clones obtained using
the heterologous strategy displayed catalysis,
the best being up to two orders of magnitude
better.
A final example of the bait and switch strat-
egy (THORNet al., 1995) focuses on the base-
promoted decomposition of substituted benzi-
soxazole (20) to give cyanophenol(21) (Fig 11,
AE 8.4). A cationic hapten (22) was used to
mimic the transition state geometry of all
reacting bonds. It was anticipated that if the H
benzimidazole hapten (22) induced the pres- I
ence of a carboxylate in the binding site, it
would be ideally positioned to make a hydro-
gen bond to the N-3 proton of the substrate.
The resultant abzymes would thus have gener-
al base capability for abstracting the H-3 in the
substrate.
HO,C 2 l4 22
Two monoclonals, 34E4 and 35F10, were Fig. 11. The use of a cationic hapten (22) mimics the
found to catalyze the reaction with a rate ac- transition state of the base-promoted decomposition
celeration greater than lo8, while the presence of substituted benzisoxazole (20) to cyanophenol
of a carboxylate-containing binding site resi- (21)and also acts as a “bait” to induce the presence
due was confirmed by pH-rate profiles and co- of an anion in the combining site that may act as a
general base. ’
valent modification by a carbodiimide, which
reduced catalysis by 84%.
The bait and switch tactic clearly illustrates
. that antibodies are capable of a coulombic re- 2.3 Entropic Trapping
sponse that is potentially orthogonal to the use
of transition state analogs in engendering ca- Rotational Entropy
talysis. By variations in the hapten employed, An important component of enzyme catalysis
it is possible to fashion antibody combining is the control of translational and rotational
sites that contain individual residues to deliver entropy in the transition state (PAGE and
intricate mechanisms of catalysis. JENCKS, 1971).This is well exemplified for uni-
molecular processes by the enzyme chorismate
mutase, which catalyzes the rearrangement of
chorismic acid (23) into prephenic acid (24)
(Fig. 12). This reaction proceeds through a cy- tional control and enthalpic lowering. Sup-
clic transition state having a pseudo-diaxial porting this, HILLIERhas carried out a hybrid
conformation (25) (ADDADIet al., 1983).With quantum mechanical/molecular mechanics
this analysis, BARTLETTdesigned and syn- calculation on the B. subtilis complex with sub-
thesized a transition state analog (26) which strate (23). He concluded that interactions
proved to be a powerful inhibitor for the en- between protein and substrate are maximal
zyme (BARTLETTand JOHNSON, 1985). X-ray close to the transition state (25) and lead to a
structures of mutases from Escherichia coli lowering of the energy barrier greater than is
(LEE,et al., 1995), Bacillus subtilis (CHOOK et needed to produce the observed rate accelera-
al., 1993, 1994), and Saccharomyces cerevisiae tion (DAVIDSON and HILLIER,1994).
(XUEand LIPSCOMB, 1995) complexed to (26) SCHULTZ employed TSA (26) as a hapten to
show completely different protein architec- generate antibodies to catalyze this same iso-
tures although the bacterial enzymes have sim- merization reaction (23)-+(24) (Fig. 12)
ilar values of k,,,/k,,,,, (3. lo6) and of Ki for (JACKSON et al., 1988). His kinetic analysis of
(26). It appears that these enzymes exert their one purified antibody revealed that it increas-
catalysis through a combination of conforma- es the entropy of activation of the reaction by
12 cal mol-' K-l (Tab. 1, Antibody 11F1-
2E11,AE 13.2), and gives a rate enhancement
of lo4. He suggested that this TSA induces a
complementary combining site in the abzyme
that constrains the reactants into the correct
conformation for the [3,3]-sigmatropic reac-
tion and designated this strategy as an "entrop-
ic trap".
- HILVERT'S group used the same hapten (26)
OH OH
with a different spacer to generate an antibody
24 Prephenate
catalyst which has very different thermody-
23 Chorismate
namic parameters. It has a high entropy of ac-
0 tivation but an enthalpy lower than that of the
o'cd
pcoo
wild type enzyme (Tab. 1, Antibody 1F7, AE
9: 13.2) (HILVERTet al., 1988; HILVERTand
+coo NARED,1988). WILSONhas determined an X-
ray crystal structure for the Fab' fragment of
this antibody in a binary complex with its TSA
(HAYNES, et al., 1994) which shows that amino
OH OR acid residues in the active site of the antibody
25 Transition state 26 Transition state analog catalyst faithfully complement the compo-
nents of the conformationally ordered transi-
Fig. 12. Chorismate mutase. tion state analog (Fig. 13) while a trapped wa-
Tab. 1. Kinetic and Thermodynamic Parameters for the Spontaneous, Enzyme Catalyzed and Antibody
Catalyzed Conversion of Chorismic Acid (23) into Prephenic Acid (24)
Catalyst Relative AGz AH: AS z K , 23 k,,, 23 Ki 26
Rate [kcal mol-'1 [kcal mol-'1 [cal mol-' K-'1
Spontaneous" 1 24.2 20.5 - 12.9

Chorismate mutaseb 3. lo6 15.9 15.9 0 45pM 1.35s-' 75nM
Antibody 1F7" 250 21.3 15.0 -22 49 pM 0.023 min-' 600 nM
11F1-2Elld 10,OOO 18.7 18.3 - 1.2 260 pM 0.27 min-' 9 pM
a At 25 "C; E. coli enzyme at 25 "C; pH 7.5,14 "C; pH 7.0,lO "C.

a \ b
NH
H---
4
Fig. 13. Schematic diagrams of X-ray crystal structures show the hydrogen bonding (dashed lines) and elec-
trostatic interactions between the transition state analog (26) (in grey) with relevant side chains of a antibody
1F7 (HAYNES et al., 1994) and b the active site of the E. coli enzyme (LEEet al., 1995).
ter molecule is probably responsible for the highly ordered transition state, showing large
adverse entropy of activation. Thus it appears activation entropies in the range of -30 to
that antibodies have emulated enzymes in -40 cal mol-l K-' (SAUER,1966).
finding contrasting solutions to the same cata- While it is one of the most important and
lytic problem. versatile transformations available to organic
Further examples of catalytic antibodies chemists, there is no unequivocal example of a
that are presumed to control rotational entro- biological counterpart. However, two cell free
py are AZ-28, that catalyzes an oxy-Cope fractions from Alternaria solani have been
[3.3]-sigmatropic rearrangement (AE 13.1) purified (KATAYAMA et al., 1998) which are ca-
(BRAISTED and SCHULTZ, 1994; ULRICHet al., pable of converting prosolanapyrone I1 to sol-
1996) and 2E4 which catalyzes a peptide bond anapyrones A and D (OIKAWAet al., 1999).
isomerization (AE 13.3) (GIBBS,et al., 1992b; This reaction can be rationalized as an oxida-
LIOTTA,et al., 1995). Perhaps the area for the tion followed by an intramolecular Diels-Al-
greatest opportunity for abzymes to achieve der reaction (OIKAWA et al., 1998,1997).In ad-
control of rotational entropy is in the area of dition there are many natural products, such as
himgravine (BALDWIN
cationic cyclization reactions (LI, et al., 1997). et al., 1995) and the
The achievements of the LERNERgroup in this manzamines (BALDWIN et al., 1998) which are
area (AE 15.1-15.4) will be discussed later in plausibly formed biosynthetically by intra-
this article (Sect. 5.3). molecular Diels-Alder reactions (ICHIHARA
and OIKAWA, 1998),albeit no enzyme has been
Translational Entropy implicated in these latter processes so far.
The classic example of a reaction that de- Hence, attempts to generate antibodies which
mands control of translational entropy is sure- could catalyze this reaction were seen as an
ly the Diels-Alder cycloaddition. It is acceler- important target.
ated by high pressure and by solutions 8M in The major task in producing a "Diels-Alder-
LiCl (BLOKZIJL and ENGBERTS, 1994; CIOBA- ase" antibody lies in the choice of a suitable
NU and MATSUMOTO, 1997; DELL, 1997) and haptenic structure because the transition state
proceeds through an entropically disfavored, for the reaction resembles product more close-
ly than reactants (Fig. 14). The reaction prod-

uct itself is an inappropriate hapten because it
is likely to result in severe product inhibition
of the catalyst, thereby preventing turnover.
Tetrachlorothiophene dioxide (TCTD) (27)
reacts with N-ethylmaleimide (28) to give an
unstable, tricyclic intermediate (29) that ex-
I*
trudes SO, spontaneously to give a dihy- 27 1 2 8
drophthalimide as the bicyclic adduct (30)
(RAASCH, 1980).This led to the design of hap-
ten as a bridged dichlorotricycloazadecenede-
rivative (31) which closely mimics the high en-
ergy intermediate (29),while being sufficiently
different from the product (30) to avoid the
possibility of inhibition by end-product (HIL-
VERT, et al., 1989).
Several antibodies raised to the hapten (31)
accelerated the Diels-Alder cycloaddition
between (27) and (28) (Fig. 14).The most effi- 29
0
cient of these, 1E9, performs multiple turn-
overs showing that product inhibition has been
largely avoided. Comparison of k,,, with the
second order rate constant for the uncatalyzed
reaction (k,,,,,=0.04 M-' min-', 25°C) gives
an effective molarity, EM: of 110 M (AE 17.1)
(HILVERT et al., 1989).This value is several or-
ders of magnitude larger than any attainable
concentration of substrates in aqueous solu-
tion, therefore the antibody binding site con-
fers a significant entropic advantage over the
bimolecular Diels-Alder reaction.
A number of further examples of Diels-Al-
der catalytic antibodies have been described
(AE 17.2-17.5) and they must necessarily ben-
efit from the same entropic advantage over ClVCl
spontaneous reactions, albeit without H I L -
VERT'S clever approach to avoiding product
inhibition. Their success in achieving control of
regio- and stereochemistry will be discussed
later (Sect. 5.1).
Of greater long-term significance is the con-
trol of translational entropy for antibody cata- 31
lyzed synthetic purposes. BENKOVIC'S descrip-
tion of an antibody ligase capable of joining an Fig. 14. The Diels-Alder cycloaddition of TCTD
activated amino acid (e.g., 32) to a second ami- (27) and N-ethylphthalimide (28) proceeds through
no acid to give a dipeptide and to a dipeptide an unstable intermediate (29) which extrudes SO2
spontaneously to give the dihydrophthalimide ad-
duct (30). Hapten (31) was designed as a stable mi-
mic of (29) that would be sufficiently different from
The EM is equivalent to the concentration of sub- product (30) to avoid product inhibition of the anti-
strate that would be needed in the uncatalyzed reac- body catalyst.
tion to achieve the same rate as achieved by the an-
tibody ternary complex (KIRBY,1980).
(e.g., 33) to give a tripeptide with only low 2.4 Substrate Desolvation
product inhibition is particularly significant
(Fig. 15,AE 18.4) (SMITHRUD et al., 1997).Anti- A classic example of rate acceleration by
body 16G3 can achieve 92% conversion of desolvation is the Kemp decarboxylation of 6-
substrates for tripeptide formation and 70% nitro-3-carboxybenzisoxazole(36).The chan-
for tetrapeptide synthesis within an assay time ge from water to a less polar environment can
of 20 min. A concentration of 20 pM antibody effect a 107-fold rate acceleration which has
can produce a 1.8 mM solution of a dipeptide been ascribed to a combination of substrate
in 2 h. The very good regiocontrol of the cata- destabilization by loss of hydrogen bonding to
lyzed process is shown by the 80: 1 ratio for solvent and transition state stabilization in a
formation of the programmed peptide (34) dipolar aprotic solvent (KEMPet al., 1975).
compared to the unprogrammed product (35) Both HILVERT and KIRBYhave sought to gen-
whereas the uncatalyzed reaction gives a 1:1 erate abzymes for this process (AE 9.1) (LE-
ratio. WIS et al., 1991;SERGEEVA et al., 1996) HILVERT
generated several antibodies using TSA (37)
and the best, 25E10, gave a rate acceleration of
23.2. lo3 for decarboxylation of (36),compar-
able to rate accelerations found in other mixed
solvent systems but much less than for hexa-
P h j + 32 methylphosphoric triamide (lo8, Fig. 16). In
, (3-Indolyl)
particular, it is of some concern that the K , for
this antibody is as high as 25 mM, which re-
I
! H flects the tenuous relationship between the
hapten design and the substrate/transition
state structure. Unfortunately, apparently bet-
CP 33 ter designed TSAs, e.g. (38)(SERGEEVA et al.,
1996), fared worse in outcome, possibly
through the absence of a countercation in the
16G3 binding site. This may offer an opportunity for
protein engineering to induce the presence of
an N,N,N-trimethyl-lysine residue in the active
site to provide a non-hydrogen bonding salt
pair.
Selenoxide syn-eliminations are another
type of reaction favored by less polar solvents
(REICH,1979).The planar 5-membered, pericy-
clic transition state for syn-elimination of (40)
was mimicked by the racemic proline-based
, (3-Indolyl)
cis-hapten (39) to give 28 monoclonal antibod-
ies (AE 8.5) (ZHOUet al., 1997). Abzyme SZ-
cis-42F7 converted substrate (40) exclusively
into trans-anethole (41) with an enhancement
ratio (ER) of 62 (R=Me, X =NOz) and with a
low K, of 33 pM. Abzyme SZ-cis-39C11 gave
a good acceleration, k,,, 0.036 min-', k,,,/K,
\
Ph 2,400 M-' min-' (substrate 40, R = H = X )
comparable to the rate in 1,2-dichloroethane
35 solution. Unexpectedly, the catalytic benefit
Fig. 15. Antibody 16G3 catalyzed peptide bond for- appears to be mainly enthalpic for both the
mation predominantly yields the peptide (34) antibody and for the solvent switch, as shown
(34:35, 80: l), whereas the uncatalyzed reaction by the data in Tab. 2.
gives a 1:1ratio of the two peptides.
2.5 Supplementation of Chemical

Functionality
Several antibodies have been modified to

incorporate natural or synthetic groups to aid
catalysis (POLLACK et al., 1988). POLLACK and
SCHULTZ reported the first example of a semi-
synthetic abzyme by the introduction of an
imidazole residue into the catalytic site
through selective modification of the thiol-
J0,O 37 containing antibody MOPC315 (POLLACK and
SCHULTZ, 1989). This yielded a chemical mu-
H tant capable of hydrolyzing coumarin ester
(48) with k,,, 0.052 min-l at pH 7.0,24 "C. In-
corporation of the nucleophilic group alone
was previously shown to accelerate hydrolysis
of the ester by a factor of lo4 over controls
(POLLACK et al., 1988).
The process of modification is shown in Fig.
17. Lys-52 (42) is first derivatized with 4-thio-
butanal and then an imidazole is bonded
through a disulfide bridge into the active site
(47). This can now act as a general basehucle-
ophile in the hydrolysis of (48), as was estab-
lished first by the pH-rate profile and then by
complete deactivation of the antibody by di-
/
ethyl pyrocarbonate (an imidazole-specific in-
Me0 39 activating reagent).
The first success in sequence-specific pep-
tide cleavage by an antibody was claimed by
IVERSON(IVERSONand LERNER,1989) using
hapten (49) which contains an inert Co(II1)-
(trien) complexed to the secondary amino acid
of a tetrapeptide (Fig. 18). This approach
aimed towards the elucidation of monoclonal
antibodies with a binding site that could simul-
taneously accommodate a substrate molecule
and a kinetically labile complex such as
Zn(II)(trien) or Fe(III)(trien), designed to
provide catalysis. Much early work by BUCK-
INGHAM and SARGESON had shown that such
cobalt complexes are catalytic for amide hy-
drolysis via polarization of the carbonyl group,
through nucleophilic attack of metal-bound
hydroxide, or by a combination of both pro-
cesses (SUT~ON and BUCKINGHAM, 1987; HEN-
DRY and SARGESON, 1990 ).
Peptidolytic monoclonal antibody 287F11
Fig. 16.TSAs (37),(38) for Kemp decarboxylation of was selected for further analysis. At pH 6.5,
6-nitro-3-carboxybenisoxazole(36) and for selen- cleavage of substrate (50) was observed with a
oxide elimination (39).
variety of metal complexes. The Zn(II)(trien)
3 SpontaneousFeatures of Antibody Catalysis 421
Tab. 2. Parameters for the syn-Eliminationof Selenoxide.(39)(R =X = H) in Water, DCM, and Catalyzed by
Antibody SZ-cis-39C11
Catalyst AG; AH: AS kcatlKm kcat ( k o d ER

[kcal mol-'1 [cal mol-' K-'1 [M-' min-'1 [min-l]
Water 26.3f0.15 26.3 f 0.15 + 0.014 f 0.47 1.6 E-5b
SZ-cis-39C11 22.2f1.2 19.7f1.2 -7.8f4.1 2,400 3.5 E-2 2,200
(DCM) 21.8f0.5 20.3f0.5 -4.8f1.7 4.4E-2 2,750
a 25 "C; here and elsewhere exponents are expressed as, e.g., E-5 ... .lo-'.
complex was the most efficient with 400 turn- tures that were not evidently design features
overs per antibody combining site and a turn- of the system at the outset. Such discoveries
over number of 6.1Op4s-' (Fig. 18).While this are clearly a strength rather than a weakness
approach is undoubtedly ingenious, there are of the abzyme field, and two of these out-turns
some doubts about its actual performance.The are described below.
site of cleavage of the substrate is not, as would
be expected from the design of the hapten,
between the N-terminal phenylalanine and 3.1 Spontaneoh Covalent
glycine, but rather it is between glycine and the Catalysis
internal phenylalanine.
In an equivalent approach, MAHYhas gen- The nucleophilic activity of serine in the hy-
erated a peroxidase-like catalytic antibody drolysis of esters and amides by many enzymes
which binds an iron(II1) ortho-carboxy substi- is one of the classic features of covalent cataly-
tuted tetraarylporphyrin, achieving oxidation sis by enzymes. So it was perhaps inevitable
rate up to 540 min-l with ABTS as a cosub- that an antibody capable of catalyzing the hy-
strate (DE LAUZONet al., 1999). drolysis of a phenyl ester should emerge hav-
A major achievement in augmenting the ing the same property. SCANLAN has provided
chemical potential of antibodies has been in just that example with evidence from kinetic
the area of redox processes. Many examples and X-ray structural analysis to establish that
now exist of stereoselective reductions, partic- the hydrolysis of phenyl (R)-N-formylnorleu-
ularly recruiting sodium cyanoborohydride cine (51)proceeds via an acyl antibody inter-
(AE under 22). A growing number of oxida- mediate with abzyme 17E8 (AE 2.3) (ZHOUet
tion reactions can now be catalyzed by ab- al., 1994; Fig. 19). The antibody reaction has a
zymes, with augmentation from oxidants such bell-shaped profile corresponding to ionizable
as hydrogen peroxide and sodium periodate groups of pK, 10.0 and 9.1. Based on X-ray
(AE under 21). analysis, they appear to be respectively LysH9'
and probably TyrHIO1.This system is deemed to
activate SerH99as part of a catalytic diad with
(52). In addition to the kinetic and
structural evidence for this claim, a trapping
3 Spontaneous Features of experiment with hydroxylamine generated a
mixture of amino acid and amino hydroxamic
Antibody Catalysis acid products from substrate (51)in the pres-
ence of antibody.
Despite the attention given to the pro- In a similar vein, antibody NPN43C9 ap-
grammed relationship of hapten design and pears to employ a catalytic histidine, as
consequent antibody catalytic activity, there a nucleophilic catalyst in the hydrolysis of a p -
are now many examples where the detailed ex- nitrophenyl phenylacetate ester (AE 2.8)
amination of catalysis reveals mechanistic fea- (GIBBS et al., 1992a;CHEN,et al., 1993).
H3N@ 3.2 Spontaneous Metal Ion
(yJLys52:2
I Catalysis
JANDAand LERNER tried to show that a met-

al ion or coordination complex need not be in-
cluded within the hapten used for the induc-
f(CHz)FHO tion of abzymes in order that they could (1)
(1) O Z N a bind a metallo-complex and thereby (2) pro-
N-S vide a suitable environment for catalysis (WA-
(2) NaCNBH, H 43
DE et al., 1993). The pyridine ester (54) was
screened as a substrate for 23 antibodies raised
( 3 ) Dithiothreitol against the hapten (53) (Fig. 20). Antibody
84A3 showed catalytic activity in the hydroly-
sis of (54) only in the presence of zinc,-with-a
rate enhancement of 12,860 over the spontan-
eous rate and 1,230 over that seen in the pres-
ence of zinc alone. Other metals, such as Cd" ,
Co2 ,Ni2 ,were inactive.The affinity of 84A3
+ +
for the substrate was high (3.5 pM) whereas

the affinity for zinc in the presence of substrate
was much lower (840 pM).This is far weaker
than any affinity of real potential for the re-
cruitment of metal ion activity into the catalyt-
ic antibody repertoire (plasma [Zn"] is
17.2 pM). However, we can anticipate that ap-
plication of site-directed mutagenesis and
computer assisted design will be targeted on
d%
this problem with real expectation of success.
CL,,
LERNER'S group has shown that the catalytic
performance of antibody 38C2 in catalyzing an
N aldol reaction is improved in the presence of
H one equivalent of Pd(l1) (FINNet al., 1998).
47
-
38C2 binds Pd specifically (Kd 1pM) and an
allosteric effect is observed. This study sug-
gests that the metal does not bind into the cat-
qn
alytic site, but induces a conformational
change promoting a closer binding to the sub-
strate.
Fig. 17. A semi-synthetic abzyme. Selective derivatization of lysine-52 in

the heavy chain of MOPC315 (42) gives an imine which is reduced to an
amino disulfide with sodium cyanoborohydride. Reduction to the thiol
and a series of disulfide exchanges gives an imidazole derivatized abzyme
capable of improved hydrolysis of the coumarin ester (48) (k,,, -0.052
min - ').
Fig. 18. A metal complex 49 used as hapten to raise antibodies capable of incorporating metal cofactors to
facilitate the cleavage of 50 at the position indicated.
In view of the great general importance of

metalloproteinases, it seems inevitable that
further work will be directed at this key area
either by designed or opportunistic incorpora-
tion of metal ions into the catalytic apparatus
of abzymes.
SerHg9 ti+ 6 HisH3’
4 How Good are Catalytic

Antibodies?
52 In the first years of abzyme research, acyl
group transfer reactions have appeared in a
Fig. 19. The hydrolysis of (R)-N-formylnorleucine majority of examples. Many of these end-
(51) proceeds via an acyl antibody intermediate with eavors have been based on mimicry of a high
abzyme 17E8 (52). (ZHOUet al., 1994). energy,tetrahedral intermediate that lies along
such reaction pathways (Sect. 2.1) and which,
though not truly a “transition state analog”,
provides a realistic target for production of a
stable TSA. Many of these haptens were based
on four coordinate phosphoryl centers.
In 1991, JACOBSanalyzed 18 examples of
antibody catalysis of acyl transfer reactions as
a test of the P~ULING concept, i.e., delivering
catalysis by TS + stabilization. The range of ex-
amples included the hydrolysis of both aryl
and alkyl esters as well as aryl carbonates. In
some cases more than one reaction was cata-
lyzed by the same antibody, in others the same
reaction was catalyzed by different antibodies
(JACOBS, 1991).
Fig. 20. The pyridine ester (54) was screened as a Much earlier, WOLFENDEN and THOMPSON
substrate for 23 antibodies raised against the hapten (WESTERICK and WOLFENDEN, 1972; THOMP-
(53). SON, 1973), established a criterion for enzyme
inhibitors working as TSAs. They proposed
that such activity should be reflected by a line-
ar relationship between the inhibition con- However, even the highest kcatlkuncat value of
stant for the enzyme Ki and its inverse second lo6 in this series (TRAMONTANO et al., 1988)
order rate constant, K,lk,,,, for pairs of inhib- barely compares with enhancement ratios seen
itors and substrates that differ in structure on- for weaker enzyme catalysts (LIENHARD,
ly at the TSAhbstrate locus. That has been 1973).
well validated, inter alia, for phosphonate in- The fact that many values of K J K i fall be-
hibitors of thermolysin (BARTLETT and MAR- low the curve (Fig. 22) suggested that interac-
LOWE, 1983) and pepsin (BARTLETT and GIAN- tions between the antibody and the substrate
GIORDANO, 1996). In order to apply such a cri- are largely passive in terms of potential cata-
terion to a range of catalytic antibodies, JA- lytic benefit. This conclusion exposes a limita-
COBS assumed firstly that the spontaneous+hy- tion in the design of haptens, if solely based on
drolysis reaction proceeds via the same TS+ as the transition state concept. It is well known
that for the antibody mediated reaction and that enzymes utilize a wide range of devices to
secondly that all corrective factors due to me- achieve catalysis as well as dynamic interac-
dium effects are constant. By treating the hy- tions to guide substrate towards the transition
drolyses reactions as a pseudo-first-order pro- state, which is then selectively stabilized. How-
cess, one can derive a simple relationship with ever, as has been illustrated above, the original
approximations of KTs and Ks to provide a concept of transition state stabilization has
mathematical statement in terms of Ki, K,, been augmented by a range of further ap-
k,,,, and k,,,,, (Fig. 21) (WOLFENDEN, 1969; proaches in the generation of catalytic anti-
JENCKS, 1975; BENKOVIC et al., 1988; JACOBS, bodies and with considerable success.
1991).
A log-log plot using Ki, K,, kat, and k,,,,
data from the 18separate cases of antibody ca-
talysis exhibited a linear correlation over four It may also be worth mentioning here that many
orders of magnitude and with a gradient of early estimates of Kdfor the affinity of the antibody
0.86 (Fig. 22)5. Considering the assumptions to their TSA were upper limits, being based on inhi-
made, this value is sufficiently close to unity to bition kinetics using concentrations of antibody that
suggest that the antibodies do stabilize the were significantly higher than the true K, being de-
transition state for their respective reactions. termined.
Fig. 21. A thermodynamiccycle linked to transition state theory gives an equation relating the enhancement
ratio for a biocatalyzed process to the ratio of equilibrium constants for the complex between the biocatalyst
and (i) substrate and (ii) the transition state for the reaction.These two values can be estimated as K , and Ki
for the TSA, respectively.
Fig. 22. JACOBS’correlation be-

tween the enhancement ratio 0
(k,,tlk,,,,t) and the relative affi-
nity for the TSA with respect to
the substrate (K,IKi) (JACOBS, I I I 1
1 2 3 4 5 6 7
1991).The slope is an unweight-
ed linear regression analysis. log ( k t 1kuncat)
6, Reaction Catalyzed
-1 v 1
Ester Hydrolysis
1r
P Ether Cleavage
4 Claisen
Decarboxylation
3.1 .“I
Elimination
Miscellaneous
0
Ester Synthesis
1
0 Amide Synthesis
DieldAlder
y = 0.462~+ 1.801 r = 0.597
-1 0 1 2 3 4 5 6 7 8
Fig. 23. The Stewart-Benkovic plot of rate enhancement vs relative binding of substrate and
TSA for 60 abzyme catalyzed reactions (STEWARTand BENKOVIC, 1995).The theoretical unit
slope (----)diverges from the calculated linear regression slope (-) for these data (its equati-
on is shown).
426 I 1 Catalytic Antibodies
with a correlation coefficient for the linear fit si-face re-face

of only 0.6 and with a slope of 0.46 very differ-
ent from the “theoretical slope” of unity. Per-
haps of greatest significance are the many pos-
itive deviations from the general pattern.
These appear to show that antibody catalysis R‘
can achieve more than is predicted from catal-
ysis through transition state stabilization
alone.
5 Changing the Regio-
ri
and Stereochemistry of R’
Reactions
The control of kinetic vs thermodynamic em approach
product formation can often be achieved by
suitable modificaton of reaction conditions. A
far more difficult task is to enhance the forma-
tion of a disfavored minor product to the detri-
ment of a favored major product, especially
when the transition states for the two process- R’ R1
es share most features in common. This goal
has been met by antibodies with considerable si-face re-face
success,both for reaction pathways differing in Fig. 24. Enantio- and diastereoselectivity of the
regioselectivity and also for ones differing in Diels-Alder reaction for ortho-approach.
stereoselectivity. In both situations, control of
entropy in the transition state must hold the
key.
and N,N-dimethylacrylamide (54) (Fig. 25)
(GOUVERNEUR et al., 1993).
5.1 Diels-Alder Cycloadditions They had shown experimentally that the un-
catalyzed reaction gave only two stereoiso-
In the Diels-Alder reaction between an un- mers: the ortho-endo (cis) (57) and the ortho-
symmetrical diene and dienophile up to eight ex0 (trans) (58) adducts in an 85 :15 mixture.
stereoisomers can be formed (MARCH,1992b). This experimental observation was under-
It is known that the regioselectivity of the pinned by ab initio transition state modeling
Diels-Alder reaction can be biased so that for the reaction of N-butadienylcarbamic acid
only the four ortho adducts are produced (Fig. (59) with acrylamide (a), which showed that
24) through increasing the electron-withdraw- the relative activation energies of the orrho-
ing character of the substituent on the dieno- endo and ortho-ex0 transition states were of
phile (DANISHEFSKY and HERSHENSON, 1979). considerably lower energy than the meta-endo
However, stereochemical control of the Diels- and meta-exo transition structures (not illus-
Alder reaction to yield the disfavored exo- trated) (Tab. 3). The design of hapten was cru-
products in enantiomerically pure form has cial for the generation of catalytic antibodies
proved to be very difficult. GOUVERNEUR and to deliver full regio- and diastereoselectivity.
co-workers were interested in controlling the Transition state analogs were therefore de-
outcome of the reaction between diene (55) vised to incorporate features compatible with
5 Changing the Regio- and Stereochemistry of Reactions 427
either the disfavored endo (63) or favored ex0

(65) transition states (Fig. 26) (AE 17.5).
4
HILVERT developed a new strategy to mini-
mize product binding to the abzyme (HILVERT
et al., 1989). Based on the knowledge that the
OYNH transition state for Diels-Alder processes is
0 very product-like, he designed haptens (64)
and (66) to mimic a high energy, boat confor-
mation for each product, thereby ensuring
avoidance of product inhibition.
’IIyo of the monoclonal antibodies pro-
duced, 7D4 and 22C8, proved to be completely
COzNa 55 stereoselective, catalyzing the endo and the
ex0 Diels-Alder reactions, with a k,,, of
3.44. and 3.17. min-’, respectively
at 25°C. That the turnover numbers are low
was attributed in part to limitations in transi-
tion state representation: modeling studies had
shown that the transition states for both the
ex0 and endo processes were asynchronous
whereas both TSAs (64) and (66) were based
on synchronous transition states (GOUVER-
NEUR et al., 1993).
In a further experiment, compounds (67)
and (68) were perceived as freely rotating hap-
O Y N H OYNH tens for application as TSAs for the same
Diels-Alder addition (Fig. 27). As expected,
each proved capable of inducing both endo-
and exo-adduct forming abzymes. It can be
noted that (67) produced more “exo-catalysts”
(6 out of 7) whereas (68)favored the produc-
tion of “endo-catalysts” (7 out of 8) though it is
C02Na f57 COzNa f58 difficult to draw any conclusion from this ob-
servation (AE 17.5) (YLI-KAUHALUOMA et al.,
1995;HEINE et al., 1998).
5.2 Disfavored Regio- and

Stereoselectivity
O Y NH
OH 59 Reversal of Kinetic Control in a Ring Closure
Reaction
Fig. 25. The Diels-Alder cycloaddition between the When several different outcomes are possible
diene (55) and the dienophile (56)yields two diaste-
reoisomers (57) and (58). Attenuated substrate ana-
in a reaction, the final product distribution re-
logs (59) and (60) were used in molecular orbital cal- flects the relative free energies of each transi-
culations of this reaction. tion state when the reaction is under kinetic
control (SCHULTZ and LERNER, 1993).
BALDWIN’S rules predict that for acid catalyzed
ring closure of the hydroxyepoxide (70) the
tetrahydrofuran product (69) arising from 5-
exo-tet attack will be preferred (Fig. 28)
(BALDWIN, 1976). By raising antibodies to the
Tab. 3. Calculated Activation Energies of the Transition Structures Relative to Reactants for the Reaction of
N-(1-Butadieny1)-carbamicAcid (59) with Acrylamide (60)
~ ~
Transition State Geometry Calculated Activation Energy [kcal mol-’1
RHF/3-21G 6-31G. 13-21G
ortho-endo 27.3 40.80

ortho-ex0 28.84 42.70
meta-endo 29.82 42.88
meta-exo 30.95 43.94
r
endo-Transitionstate endo-Hapten
(=+L R2
R’
63 64
1
61 62
em-Transition state exo-Hapten
1 H XR2
R2 = CONMe2 65
65 66
Fig. 26. Haptens (64)and (66)were designed as analogs of the favored endo-(63)or disfavored exo-(65)tran-
sition states, respectively.
.C0NMe2 charged hapten (72), JANDA and co-workers

generated an abzyme which accelerated 6-ex0
H attack of the racemic epoxide to yield exclu-
sively the disfavored tetrahydropyran product
(71) and in an enantiomerically pure form
(AE 14.1) (JANDA et al., 1993).
This work reveals that an antibody can se-
67 R = (CHz),COzH lectively deliver a single regio- and stereo-
chemically defined product for a reaction in
68 R = 4-carboxyphenyl
which multiple, alternative transition states are
Fig. 27. An alternative strategy for eliciting Diels- accessible and can also selectively lower the
Alderase antibodies has employed the freely rotat- energy of the higher of two alternative transi-
ing ferrocenes (67) and (68)as TSAs. tion states (NAand HOUK, 1996).
5 Changing the Regio- and Stereochirnistry of Reactions 429
I
73
I
Spontaneous I Disfavored
anti-Elimination
syn-Elimination
I
Fig. 29. The elimination of HF from the P-fluoroke-

tone (73) is catalyzed by antibody 1D4, elicited to
hapten (76), to form the disfavored (Z)-a$-unsatu-
rated ketone (75). This contrasts the spontaneous
process in which an anti-elimination reaction yields
Fig. 28. The monoclonal antibody 26D9, generated the (E)-a,P-unsaturated ketone (74). The syn-
to the N-oxide hapten (72), catalyzed the 6-exo-tet eclipsed conformation of (76) is shaded.
ring closure of (70) regioselectively to yield the dis-
favored tetrahydropyran product (71). This is a for-
mal violation of BALDWIN'S rules which predict a
spontaneous 5-exo-tet process to generate tetrahy-
drofuran derivative (69).
(75) (Fig. 29). Preliminary estimations of the
energy difference between the favored and
disfavored processes are close to 5 kcal mol-l
(CRAVA'IT et al., 1994), though this value is ex-
Syn-Elimination of p-Fluoroketones ceeded in the antibody catalyzed rerouting of
The base-catalyzed p-elimination of HF from carbamate hydrolysis from ElcB to BA,2
the ketone (73) normally gives the thermody- (Sect. 8.2, AE 4.3) (WENTWORTH et al., 1997).
namically more stable (E)-alkene (74) via a Antibody 1D4, raised to hapten (76) and used
staggered conformation in the transition state in 15% DMSO at pH 9.0, gave exclusively the
(Fig. 29). Hapten (76) was designed to enforce (Z)-alkene (75) with K , 212 pM and k,,,
the syn-coplanar conformation of the phenyl 2.95.1Op3 min-l. Under the same conditions,
and benzoyl functions in the transition state kobsis 2.48-1OP4 min-l for formation of (74)
and so catalyze the disfavored syn-elimination and immeasurably slow for the (undetectable)
of (73) to give the (Z)-a,@-unsaturatedketone formation of (75) (AE 8.1).
5.3 Carbocation Cyclizations Moving closer to a cationic transition state

mimic, HASSERODT and co-workers used the
The cationic cyclization of polyenes giving amidinium ion (80) as a TSA for cyclization of
multi-ring carbocyclic compounds with many the arenesulfonate ester (81) (Hasserodt et al.,
sterically defined centers is one of the more re- 1996). One antibody raised to this hapten,
markable examples of regioselective and ster- HA1-17G8, catalyzed the conversion of sub-
eoselective enzyme control which has provid- strate (81) into a mixture of the 1,6-dimethyl-
ed a major challenge for biomimetic chemistry cyclohexene (82) and 2-methylene-1-methyl-
(JOHNSON, 1968). This system provides an ex- cyclohexane (83) (Fig. 31) (AE 15.3). By con-
cellent opportunity for the application of re- trast, the uncatalyzed cyclization of (81)
gio- and stereocontrol by catalytic antibodies. formed a mixture of 1,2-dimethyl-cyclohexa-
LI and co-workers have discussed the use of nols and a little 1,2-dimethylcyclohexene.Evi-
catalytic antibodies to control the reactivity of dently, the antibody both excludes water from
carbocations (LI et al., 1997).At an entry level, the transition state and also controls the loss of
antibody 4C6 was raised to hapten (77) and a proton following cyclization.
used to convert acyclic olefinic sulfonate ester
(78) into cyclic alcohol (79) (98%) with very P N ’
little cyclohexene (2%) produced (Fig. 30, AE
15.1) (Lr, et al., 1994).
H
77
78
17G8
aa
4C6
(98 % yield)
Me,PhSi b 79
Fig. 30. The N-oxide hapten (77) was used to elicit
mAb 4C6 which catalyzed the cyclization of the
82 83
Fig. 31. Antibody HA1-17G8 raised against TSA
(80) catalyzed the cyclization of (81)to give (82) and
allylsilane (78) to form the cyclohexanol(79). (83).
While cyclopentanes have also been pro-
duced by antibody catalyzed cyclization (AE
15.2) (LI et al., 1996), much the most striking 0
example of cationic cyclization by antibodies is
the formation of the decalins (85), (a),
I
and
(87) (Fig. 32). The trans-decalin epoxide (88)
(tllZ100 h at 37°C) was employed as a mixture
of two enantiomeric pairs of diastereoisomers
as a TSA to raise antibodies, among which was
HA5-19A4
produced HA5-19A4 as the best catalyst for pH 7.0
cyclization of substrate (84) (AE 15.4) (HAS- (biphasic)
SERODT et al., 1997).
Sufficient substrate (84) was transformed to
give 10 mg of mixed products. The olefinic
fraction (70%) was predominantly a mixture
of the three decalins (85), (%), and (87) (2:3 :1
ratio) and formed along with a mixture of cy-
clohexanol diastereoisomers (30%). More-
over, the decalins were formed with enantio-
meric excesses of 53,53, and 80%, respectively.
It is significant that the (Z)-isomer of (84) is
not a substrate for this antibody.
The ionization of the arenesulfonate is the
first step catalyzed by the antibody which gen-
erates a carbocation as part of a process that
shows an ER of 2,300 with K , 320 pM.The re-
sulting cation can then either cyclize to decal-
ins in a concerted process (as in transition state
89) or in two stepwise cyclizations.The forma-
tion of significant amounts of cyclohexanols
seems to favor the latter of possibilities. Most
interestingly,inhibition studies suggest that the
isomer of the haptenic mixture that elicited
this antibody has structure (88), therefore, lo-
cating the leaving group in an axial position.
CO,H
This is contrary to the STORK-ESCHENMOSER
concept of equatorial leaving group and
presents a challenge for future examination
(STORKand BURGSTAHLER, 1955; ESCHEN- 88
MOSER et al., 1955). I
It is an exciting prospect that catalysts of this
nature may lead to artificial enzymes capable
of processing natural and unnatural polyiso-
prenoids to generate various useful terpenes.
Fig. 32. Formation of isomeric decalins (85)-(87) by

cyclization of a terpenoid alcohol catalyzed by anti-
body HAS-19A4 raised to hapten (88). The transi-
6 Difficult Processes tion state (89) has the leaving group in the equatori-
al position, as favored by the STORK-ESCHENMOSER
As scientists studying catalytic antibodies hypothesis.
have gained more confidence in the power of
abzymes,their attention has turned from reac- completely (Tab. 4). In a similar vein, KITA-
tions having moderate to good feasibility to ZUME also resolved the enantiomers of 1,lJ-
more demanding ones. Their work has on the trifluorodecan-2-01 with 98.5% ee (AE 1.11)
one hand tackled more adventurous stereo- (KITAZUME et al., 1991a).
chemical problems and on the other hand they
are seeking to catalyze reactions whose spon-
taneous rates are very slow indeed. Examples 6.2 Cleavage of Acetals and
of both of these areas are discussed in this sec- Glycosides
tion.
The synthesis, modification, and degrada-
tion of carbohydrates by antibody catalyzed
6.1 Resolution of Diastereoisomers transformations are subjects of active investi-
gation. Preliminary studies have reported anti-
Antibodies generally show very good selec- body hydrolysis of model glycoside substrates
tivity into the recognition of their antigens and (Yu et al., 1994) while the regio- and stereose-
discriminate against regio- or stereoisomers of lective deprotection of acylated carbohydrates
them. This results from a combination of the has been achieved using catalytic antibodies
inherent .chirality of proteins and the refined
response of the immune system (PLAYFAIR,
1992).In extension, this character suggests that
a catalytic antibody should be capable of simi-
lar discrimination in its choice of substrate and
the transition state it can stabilize, as deter-
mined by the hapten used for its induction. As
already shown above, the murine immune
system can respond to a single member of a
1
mixture of stereoisomers used for immuniza-
tion (Sect. 5.3). Such discrimination has been I 90-93
exemplified in antibody catalyzed enantiose-
lective ester hydrolysis (JANDA et al., 1989; PhCHZCOzH
POLLACKet al., 1989; SCHULTZ,1989) and
transesterification reactions (WIRSCHINGet
al., 1991;JACOBSEN et al., 1992).
One study has made use of abzyme stereo-
selectivity to resolve the four stereoisomers
(R,R',S,S', R,S', and S , R ' ) of 4-benzyloxy-3-
fluoro-3-methylbutan-2-01 (94)-(97) through
the antibody mediated hydrolysis of a diaster-
eoisomeric mixture of their phenacetyl esters
(90)-(93) (KITAZUME et al., 1991b).Antibodies
were raised separately to each of four phos-
phonate diastereoisomers (98)-(lOl), corre-
sponding to the four possible transition states
for the hydrolysis of the four diastereoisomer-
ic esters (Fig. 33) (AE 1.12). Each antibody op-
erated on a mixture of equal parts of the four ' F
diastereoisomers as substrate to give each al- 98-101
cohol in ca. 23% yield, with > 97% eelde, and Fig. 33. Four stereoisomeric alcohols (94)-(!W) were
leaving the three other stereoisomers un- separated by selective hydrolysis of their respective
changed. Following successive incubation with phenacetyl esters using four antibody catalysts, each
the four antibodies in turn, the mixture of dia- raised in response to a discrete stereoisomeric phos-
stereoisomers could effectively be separated phonate hapten (98)-(101).
Tab. 4. Kinetic Parameters for those Antibodies Raised against Phosphonates (98)-(101) which Effect the
Resolution of the Fluorinated Alcohols (94)-(97). The Configuration of the Diastereoisomerically Pure Pro-
duct from Each Antibody Catalyzed Process was Shown to Correspond to that of the Antibody-Inducing
Hapten
Product Alcohol Hapten Configuration k,,," [min-'1 K, [pM] Product ee/de [%I
(98) 2R, 3R (+) 0.88 390 99.0
(99) 2s, 3s ( - ) 0.91 400 98.5
2R,3S (+) 0.94 410 98.5
(101)
('O0) 2S, 3R (-) 0.86 380 98.0
a At 25 "C.
with moderate rate enhancements. Antibodies (105)by antibody AA71.17 raised to transition
raised to the TSA (102) were screened for state analog (104)(Fig. 35) (AE 7.2) (Yu, et al.,
their hydrolytic properties of the diester (103). 1994). Antibody AA71.17 has a useful K , of
One antibody, 17El1, used in a 20% concen- 320 pM but is rather slow in turnover, k,,,
tration with respect to (102),effected hydroly- 0.015 min-l. By contrast, two other haptens
sis exclusively at C-4. This process was fast
enough to make spontaneous acyl migration
from C-3 to C-4 of no significance: i.e., no
C3-OH product was detected. [This migration
mToM
reaction is generally fast compared to chemi-
cal deacylation (Fig. 34. AE 1.7) (IWABUCHI et
al., 1994)l. In this context, the use of an anti-
body to cleave a trityl ether by an SN1process AcHN
may have further applications (AE 7.1) (IVER-
SON et al., 1990).Also, the objective of utilizing
abzymes in the regioselective removal of a ( 102
specified protecting group has been extended SH
to show that an antibody esterase can have
broad substrate tolerance (AE 1.18) (LI et al.,
1995b).
The research towards the demanding glyco- Ac""yJJ&Fq \
sylic bond cleavage is progressing well, albeit
slowly.As a first step, REYMOND has described
an antibody capable of catalyzing the acetal
hydrolysis of a phenoxytetrahydropyran, al- AcHN
though it is slow, with k,,, 7 . 8 ~ 1 0 -s-l
~ at 103
24"C, and has a modest ER of 70 (AE 7.4B)
(REYMOND et al., 1991). Abzyme Identity Conditions
A classic approach to the problem has been
to raise antibodies against TSAs related by de- 17Ell pH 8.2; 20 "C
sign to well-known inhibitors of glycosidases. Km103 k,,,l03 Kilo2
Piperidino and pyrrolidino cations have high
affinity for pyranosidases and furanosidases 6.6 pM 0.182 min-' 0.026 pM
(WINCHESTER and FLEET,1992; WINCHESTER
et al., 1993) and can also be envisaged as com- Fig. 34. Antibody 17Ell raised against the TSA
ponents of a "bait and switch" approach to (102) was screened for its ability to hydrolyze diester
antibody production. Thus, SCHULTZhas de- (102) and, used in a 20% concentration with respect
scribed the hydrolysis of the 3-indolyl acetal to (102), effected hydrolysis exclusively at C-4.
Br,
HO
HO 108
CO2H 104
BrQ I
I
105
AA71.17
pH 5.5
:HO
:&H
I
HO
Br.
110
NO2
111
Fig. 36. Antibody 4f4f raised to (108) catalyzes the

hydrolysis of (109) (Yu et al., 1998).
106 107
Fig. 35. Antibody AA71.17 raised against hapten

sp2 character at the anomeric position. Some
(104) catalyzes the hydrolysis of the aryl acetal(lO5)
(Yu et al., 1994). 100 clones were isolated in response to immu-
nization with (112) and used to generate a
cDNA library for display on the surface of
based on a guanidino and a dihydropyran in- phage (AE 7.3) (JANDAet al., 1997). Rather
hibitor did not elicit any antibodies showing than proceed to the normal screening for turn-
glycosidase activity. over, JANDA then created a suicide substrate
Further studies led the same team to gener- system to trap the catalytic species.
ate glycosidase antibodies by in vitro immuni- HALAZYhad earlier shown that phenols
zation. They raised antibodies to the chair-like with ortho- or para-difluoromethyl substitu-
transition state analog (108) derived from 1- ents spontaneously eliminate HF to form qui-
deoxynojirimycin, a classic glycosidase inhibi- nonemethides that are powerful electrophiles
tor. They isolated antibody 4f4f which shows and that this activity can be used to trap glyco-
k,,, 2.8. lop3min-' and K , 22 pM,respective- sidases (HALAZYet al., 1992). So, glycosylic
ly, for the hydrolysis of substrate (109) (Yu et bond cleavage in (1W) results in formation of
al., 1998) (Fig. 36). the quinonemethide (114) that covalently
JANDA has described the production of a ga- traps the antibody catalyst. By suitable engi-
Iactopyranosidase antibody in response to neering a bacteriophage system, JANDA was
hapten (112)(Fig. 37).This was designed to ac- able to screen a large library of Fab fragment
commodate several features of the transition antibodies and select for catalysis. Fab 1B cata-
state for glycoside hydrolysis: notably a flat- lyzed the hydrolysis of p-nitrophenyl P-galac-
tened half-chair conformation and substantial topyranoside with k,,, 0.007 min-' and K,,,
HO Phosphate Monoesters
The achievement of this reaction is particular-
k N He N IH ly important in light of the fact that phosphoryl
s* CO-linker
transfers involving tyrosine, serine, or threo-
HO OH nine play crucial roles in signal transduction
pathways that control many aspects of cellular
112 physiology. The production of an abzyme
would provide a crucial tool for the investiga-
tion and manipulation of such processes.
SCHULTZ'Sgroup employed an a-hydroxy-
phosphonate hapten (115) and subsequently
isolated 20 cell lines of which 5 catalyzed the
YH hydrolysis of the model substrate p-nitrophen-
CO-linker 01 phosphate (116)above background (Fig. 38)
113
I
NH ::p&
, \ 0
co-linker 114
a>."
Fig. 37. Fragment antibody FablB is selected by sui-
115
cide selection with substrate ( I D ) from a library of H,N
antibodies generated to hapten (lU).The suicide in- 0
termediate is the o-quinonemethide (114).
116
OZN
530 pM, corresponding to a rate enhancement

of 7 - lo4.Moreover, this activity was inhibited
o+ /
0
'4 38E1
by hapten (112) with Ki 15 pM. By contrast,
the best catalytic antibody, 1F4, generated Ho/p' o0
from hapten (112) by classical hybridoma
screening showed k,,, min-l and K,
330 pM, a rate enhancement of only 100.
Clearly, this work offers an exciting method D O H 117
OZN
for screening for antibodies that can lead to
suicide product trapping and also appears to Abzyme Identity Conditions
offer a general approach to antibodies with
glycosidase activity. 38E1 pH 9.0
Km116 k,,,"116 Kills

6.3 Phosphate Ester Cleavage
155 pM 0.0012 min-' 34 pM
The mechanisms of phosphate ester cleav- "At30"C
age vary significantly between monoesters,
diesters, and triesters (THATCHER and KLU- Fig. 38. Antibody 38E1, generated from a a-hy-
GER, 1989). Each of these is a target for anti- droxyphosphonate hapten (115), catalyzed the hy-
body catalyzed hydrolysis and progress has drolysis of p-nitrophenyl phosphate (116) to p-nitro-
been reported for all three cases. phenol (117).
(SCANLANet al., 1991). Antibody 38E1 was ten is designed to induce an anionic amino ac-
characterized in more detail and kinetic para- id in the abzyme binding site, either to act as a
meters were afforded by LINEWEAVER-BURKEgeneral base to activate a nucleophilic water
analysis. This antibody exhibited 11 turnovers molecule, or as a nucleophile operating direct-
per binding site with no change in V,, and ly at the phosphorus center. More details are
thus acted as a true catalyst. Moreover, exam- awaited from this work.
ination of substrate specificity showed that ca- The classic case of assisted hydrolysis of
talysis was entirely selective for para-substitut- phosphate diesters is neighboring group par-
ed species (AE 6.6). ticipation by a vicinal hydroxyl group, specifi-
cally the phosphate ester of a 1,2-diol, which
Phosphodiester Cleavage provides a rate acceleration greatly in excess
The phosphodiester bond being one of the of lo6 (WESTHEIMER, 1968). While vanadate
most stable chemical linkages in nature, its complexes of 1,Zdiols have been explored as
cleavage is an obvious and challenging target pentacoordinate species for inhibiting en-
for antibody catalysis. In an attempt to model a zymes, they are toxic and too labile for use in
metal-independent mechanism, a nucleotide murine immunization (CRANS,et al., 1991).
analog (118) featuring an 0-phosphorylated JANDA has solved this problem by using of
hydroxylamine moiety was chosen by SAKU- pentacoordinate oxorhenium chelates (WEI-
RAI and co-workers (SAKURAI et al., 1996) NER et al., 1997).By employing hapten (119) as
(Fig. 39). separate diastereoisomers, 50 monoclonal
This hapten design aims to mimic the geo- antibodies were generated and screened for
metry and spatial constraints in the phosphate their ability to hydrolyze uridine 3 '-(p-nitro-
linkage, to retain the stereoelectronic configu- phenyl phosphate) (l20a) (Fig. 40) (AE 6.4).
ration of the phosphorus atom, and to act as a The most active of the three antibodies show-
simple model of a dinucleotide. For that pur- ing catalysis, 2G12, had k,,, 1.53.10-3 s-' at
pose, the retention of the phosphate backbone 25 "C and K , 240 pM giving k,,,lk,,,,, 312. A
seeks to facilitate the formation of an oxyan- more favorable expression for protein cata-
ion hole in which the electrophilicity of the lysts working at substrate concentrations be-
phosphorus center is increased in the bound low K , is k,,,/(K;k,,,,,) (RADZICKAand
substrate, while the positive charge on the hap- WOLFENDEN, 1995), which is 1.3-106M-' and
compares favorably to the value for RNase A
of 10'' M-' for the same substrate. The TSA
antL(119) proved to be a powerful inhibitor
for 2G12 with Ki estimated at 400 nM.
Evidently, this is a system with scope alike
for improvement in design and for broader ap-
plication. It is clearly one of the most success-
ful examples of antibody catalysis of a difficult
reaction.
More recently, the same team has used a bait
d o and switch strategy in order to improve this
P"
/ \ 0 system. A nucleophilic residue activating the
? O 2'-hydroxyl is induced by a cationic trimethyl-
ammonium group, while the 3 '-hydroxyl is
substituted by ap-nitrophenyl phosphoester in
a substrate-like shape (l2Ob). Two antibodies
were isolated of which MA7T.F-1 was found
to obey classic Michaelis-Menten kinetics with
11s the values k,,, =0.44 min-' and K , = 104 pM.
This antibody is 5 times more efficient than
Fig. 39. Hapten for generating catalytic antibodies the one studied before (WENTWORTH et al.,
for phosphodiester cleavage (SAKURAI et al., 1996). 1998).
0 Phosphotriester Hydrolysis
Catalysis of this reaction was first exhibited by
antibodies raised by ROSENBLUM and co-work-
linker, r ,NH ers (ROSENBLUM et al., 1995). More recently,
LAVEYand JANDAhave explored the genera-
tion of abzymes able to catalyze the break-
down of poisonous agrochemicals (LAVEYand
JANDA, 1996a).25 Monoclonal antibodies were
raised against the N-oxide hapten (121) of
which two were found to be catalytic.The hap-
119
ten was designed to generate antibodies for
the hydrolysis of triester (122) using the "bait
.o and switch" strategy: cationic charge on the ni-
trogen atom targeted to induce anionic amino
acids to act as general base catalysts; partial
negative charge on oxygen to favor the selec-
tion of antibody residues capable of stabilizing
negative charge in the transition state (Fig. 41).
. . Antibody 15C5 was able to catalyze the hy-
4-
: %
OR 120 drolysis of the phosphate triester (122) with a
aR=OH value of k,,, =2.65. min-' at 25 "C. Later,
a second antibody from the same immuniza-
o , . -~ o ~ p ~ o ~ tion program was found to hydrolyze the ace-
b R =0
NMel
tylcholinesterase inhibitor Paraoxon (123)
Fig. 40. Hapten anti-(119) was used to generate 25 with k,,,=1.95.10-3 min-l at 25°C (AE 6.2)
mAbs from which 2G12 proved to catalyze the hy- (LAVEY and JANDA,1996b). Antibody 3H5
drolysis of the phosphate diester (l20a). (l20b) was showed Michaelis-Menten kinetics and was
later used as a hapten in a bait and switch strategy to strongly inhibited by the hapten (121). It ex-
obtain antibodies hydrolyzing (l20a). hibited a linear dependence of the rate of hy-
drolysis on hydroxide ion suggesting that 3H5
effects catalysis by transition state stabilization
rather than by general acidhase catalysis.
121 122 123
Abzyme Substrate Conditions Km lo3.k,,," K, 121

Identity
~ ~~
15C5 122 pH 8.1 87 pM 2.7 min-' -

3H5 123 pH 9.15 5.05 mM 2.0min-' 0.98 pM
a Measured at pH 8.25 and 25 "C
Fig. 41.The N-oxide (121) was used as hapten to raise mAbs to catalyze the hydrolysis of both triesters (122)
and (123).
Phosphate ester hydrolysis is one of the amide with stereospecificity for the (R)-sub-
most demanding of reactions for catalyst engi- strate (l2Sa) (rendered visible by the attach-
neering. The progress made so far with catalyt- ment of a dansyl fluorophore to support
ic antibodies is extremely promising and ap- HPLC analysis of the course of the reaction)
pears to be competitive with studies using met- (AE 5.1) (MARTINet al., 1994).At pH 9.0 and
al complexes if only because they can deliver 37 "C, mAb 13Dll showed K , 432 pM and k,,,
turnover while metal complexes have for the 1.65.10-'s-*, corresponding to a half-life of
most part to solve the problem of tight product 42 d.This activity was fully inhibited by hapten
binding. (124) with Ki 14 pM. Unexpectedly, the dansyl
group proved to be an essential component of
the substrate. Even more surprisingly,the anti-
6.4 Amide Hydrolysis body did not catalyze the hydrolysis of the cor-
responding methyl ester (l25b).
While ester, carbonate, carbamate, and ani- More recently, JANDA and co-workers have
lide hydrolyses have been effectively catalyzed produced catalytic antibodies for hydrolysis of
by antibodies, the difficult tasks of catalyzing a similar primary amide (GAO et al., 1998).
the hydrolysis of an aliphatic amide or a urea They raised antibodies to the trigonal boronic
remain largely unsolved. Much of this problem acid hapten (126)in order to catalyze the hy-
comes from the fact that breakdown of a TI* drolysis of the primary amide (l27a) and
is the rate determining step, as established by methyl ester (l27b)(Fig. 43). Using antibodies
much kinetic analysis and, more recently, by obtained by standard hybridoma techniques,
computation. TERArsHI has computed that they built a combinatorial library and selecting
C-N bond cleavage for the TI- for hydrolysis with a boronic acid probe and phage display,
of N-methylacetamide (or aminolysis of acetic they were able to isolate Fab-BL25 catalyzing
acid) lies some 18 kcal mol-' above that for the hydrolysis of the L-enantiomer of (l27a).
C-O(H) bond cleavage (TERAISHI et al., 1994). This Fab fragment showed Michaelis-Menten
Clearly, protonation of nitrogen is an essential kinetics ( K , 150 pM and k,,, 0.003 min-')
step in the breakdown process of such inter- with a half-life for the substrate of 3.9 h, more
mediates and for anilides that is hardly a prac- than two orders of magnitude better than for
tical proposition under ambient conditions.To 13Dll. It is interesting to note that no catalyt-
date only three investigations of this problem ic antibodies were obtained by the standard
have shown any success. immunization route.
A group at IGEN raised antibodies to the Whereas most amide substrates for catalytic
dialkylphosphinic acid (124) (Fig. 42). These antibodies have been activated by the use of
were screened for their ability to hydrolyze aromatic amines (AE 5.3, 5.4, 5.5), BLACK-
four alkyl esters and four primary amides at BURN and co-workers chose to explore hydrol-
pH 5.0,7.0, and 9.0. Just one out of 68 antibod- ysis of an aliphatic amide activated through
ies, 13Dl1, hydrolyzed the C-terminal carbox- halogenation in the acyl moiety. Chloram-
aX=NH,
bX=OMe
Fig. 42. One out of 68 antibodies raised to the dialkylphosphinic acid hapten (W),hydrolyzed the carboxa-
rnide (l25a), but not the ester (l25b).
7 Reactive Immunization 439
OH
AcHN
127
aX=NH2
bX=OMe
Fig. 43. Antibodies raised to the trigonal boronic acid hapten (126)catalyzed the hydrolysis of
the L-enantiomer of the primary amide (l27a).
phenicol(128) was selected as substrate on ac- 1.3-13.3.10-5 min-’ and K , of 77-370 pM for
count of its dichloroacetamide function and the substrate and 14-136 pM for the three co-
the tetrahedral intermediate for hydrolysis factors.
was mimicked by the neutral sulfonamide By contrast, the reverse reaction, that of
(129) and the zwitterionic “stretched transition amide synthesis,has proved to be a good target
state analog” aminophosphinic acid (130) (Fig. for antibody catalysis and a range of different
44). Antibodies produced to each of these hap- enterprises have been successful (AE 18.1-
tens proved too weak to hydrolyze chloram- 18.4). It would appear here that little more is
phenicol (128) at a rate sufficiently above needed than a good leaving group and satisfac-
background (kOH1.3.10-3 M - l s - l ) for fur- tory design of a TSA based on an anionic tetra-
ther study. However, the switch to a more reac- hedral intermediate (BENKOVIC et al., 1988;
tive amide substrate, trifluoramphenicol (131) JANDA et al., 1988a; HIRSCHMANN et al. 1994;
( k , 6.10-’ s-’, k,, 6.3.10-* M-l s-l at JACOBSEN and SCHULTZ, 1994).
37 “C), enabled useful data to be obtained for
antibody 2B5. This showed Michaelis-Menten
kinetics with k,,, 2 . s-l and K , 640 pM at
pH 7.0,37”C.The use of kcatl(K,.k,,,,,) gave
an ER of 5,200.The relatively high K , may be 7 Reactive Immunization
a consequence of switching the dichloroacet-
amide moiety in the hapten for the trifluoro- An alternative approach for the induction of
acetamide group in the substrate and so could catalysis in antibody binding sites is a strategy
be improved by appropriate modification to named “reactive immunization” (WIRSCHING
the hapten. The low rate of turnover achieved et al., 1995).This system uses haptens of inter-
clearly indicates the difficult task ahead for mediate chemical stability as antigens. After
antibody cleavage of a peptide based on tetra- the first stimulation of the mouse B cells to
hedral intermediate mimicry alone (SHEN, generate antibodies, one of the products of in
1995;DATTA et al., 1996). vivo chemical transformation of the original
A new strategy to achieve cleavage of an hapten is then designed to act as a second im-
amide bond has used an external cofactor (ER- munogen to stimulate further maturation of
SOY et al., 1998).Antibodies were raised to an antibodies that will be better able to catalyze
arylphosphonate diester. In this case the aryl- the desired reaction. The system seems well-
propylamide is attacked by any of three nucle- designed to achieve the benefits of a neutral
ophile cofactors catalyzing a N+O acyl trans- and a charged hapten within the same family
fer. This generates an ester with a high sponta- of monoclonal antibodies.
neous rate of cleavage. In this way, aryl amide An organophosphate diester (132),was cho-
hydrolysis was achieved with k,,, of sen as the primary reactive immunogen. Fol-
REACTIVE IMMUNOGEN
Ar = 4-(methylsulfonyl)phenyl
a R = represents position of linker to

which carrier protein is attached
0 b R = H in free hapten
128
Chloramphenicol
1
132
Spacer-CONH &C
;HC12 // ‘ spontaneous
in vivo
129
OH OH
H 133
Spacer-CONH CHCI, STABLE IMMUNOGEN TSA -

130
134
SUBSTRATE
0
131
Fig. 45. Antibodies raised simultaneously against the
Trifluoramphenicol
reactive (132) and stable immunogen (133) shown
above were capable of efficient “turnover” of the re-
Fig. 44. Antibodies produced to each of haptens lated aryl ester substrate (134) (Ab 49H4:
(129), (130) proved too weak to hydrolyze chlor- K,,,=300pM;kc,,=31 min-’ at 22°C).
amphenicol (128)at a rate sufficiently above back-
ground. However, the more reactive substrate, tri-
fluoramphenicol(l31) enabled useful data to be ob-
tained for antibody 2B5 (SHEN,1995;DATTAet al., finity for the monoaryl TSA. This further pro-
1996). motes the induction of amino acids capable of
acting as nucleophiles or general acidbase cat-
alysts in the active site. In practice, reactive im-
lowing spontaneous hydrolysis in vivo, it be- munization with (l32a)generated 19 monoclo-
comes a stable monoester transition state ana- nal antibodies, 11of which were able to hydro-
log (133),which in turn gives a new challenge lyze substrate (132b).The most efficient ab-
to the immune system (Fig. 45) (AE 2.14). zyme, SP049H4, was analyzed kinetically us-
Cross-reactivity has been demonstrated as being radioactive substrates. It was established
ing an advantage in this process since heter- that 49H4 had undergone reactive immuniz-
ologous immunization with both diary1 ester ation, since it was able to hydrolyze the aryl
(132) and the corresponding monoaryl ester carboxylate aryl (134) very effectively with
gave cross-reacting serum with enhanced af- K , =300 pM; k,,, = 31 min-’.
mT
A similar approach has been used by LER-

NER and BARBAS to induce catalytic antibodies R 135
mimicking Type I aldolases. The reaction
HZN-Lys-Ab
it
scheme is shown below: the aim here was to in-
duce an enamine moiety which can achieve ca-
talysis through lowering the entropy for bi-
molecular reaction between ketone substrate
and aldol acceptor. Compound (135) is a 1,3-
diketone which acts as a trap for the “critical
lysine”, forming the vinylogous amide (138),
which can be monitored by spectrophotome-
try at 318 nm (Fig. 46) (AE 16.2) (LERNER and
BARBAS,1996). Screening for this catalytic
intermediate by incubation with hapten facili-
tated the detection of two monoclonal anti-
bodies with k,,, 2.28.10-’ M-’ min-’. Fur-
thermore, k,,,/(K;k,,,,,) is close to lo9,mak-
ing these antibodies nearly efficient as the nat-
urally occurring fructose 1,6-bisphosphate
aldolase. Studies on the stoichiometry of the
reaction by titration of antibody with acetylac-
etone indicated two binding sites to be in-
volved in the reaction.
The stereochemical control shown by these
antibodies was remarkable, and so it has been
suggested that it might be possible to program
an antibody to accept any aldol donor and ac-
ceptor. In the event, the antibodies generated
Lys . Ab Lys- Ab
in this program accepted a broad range of sub-
strates including acetone, fluoroacetone, 2-bu-
tanone, 3-pentanone, and dihydroxyacetone. H
Finally, the process of reactive immuniza-
tion leads to the concept of using mechanism- H 138 139
based inhibitors as haptens, actively promoting
the desired mechanism by contrast to their R = p-(HO2C(CHz)&ONH)C,H,-CHzCH,-
conventional use as irreversible enzyme inhib-
itors. Fig. 46.The mechanism by which an essential Lys re-
sidue in the antibody combining site is trapped using
the 1,3-diketone (135)to form the covalently linked
vinylogous amide (138).
8 Potential Medical
hydrolysis of the benzoyl ester of cocaine
Applications (140)yielding the ecgonine methyl ester (141)
and benzoic acid, products which retain none
8.1 Detoxification of the stimulant or reinforcing properties of
the parent drugs. The transition state analog
The idea that abzymes might be used thera- used in this experiment was the stable phos-
peutically to degrade harmful chemicals in phonate monoester (142) which led to a range
man potentially offers a new route to treat- of antibodies of which 3B9 and 15A10 were
ment for victims of drug overdose. LANDRY’S the most effective (Fig. 47) (AE 1.3) LANDRY
group has generated antibodies to catalyze the et al., 1993).
CONH-linker
II
0 PhC02H
140 141 142
Abzyme Identity Conditions Km kc,," K , 142
3B9 pH 7.7 490 pM 0.11 min-' < 2 pM

15A10 pH 8.0 220 pM 2.3 min-' -
a Temperature not defined
Fig. 47.Hapten (142)was used to raise an antibody 3B9 capable of the hydrolysis of cocaine (140)to the al-
cohol (141)thereby effecting cocaine detoxification.
In a more recent study, the same group ex- lectivity could have implications in targeted
amined the efficiency of antibody 15A10 in vi- therapies.
vo (METSet al., 1998).They studied the effect Antibody mediated prodrug activation was
of mAb 15A10 on seizure and lethality in a rat first illustrated by FUJIIwho raised antibodies
model of overdose and its effect on cocaine in- against phosphonate (144) to hydrolyze a pro-
duced reinforcement in a rat model of addic- drug of chloramphenicol(l45). Antibody 6D9
tion. They showed how this mAb while effec- was shown to operate on substrate (145) to re-
tively increasing the degradation rate of the lease the antibiotic (128)with an ER of 1.8.103
drug, protects against its lethal effect and (AE 1.8) (Fig. 48) (MIYASHITA et al., 1993).
blocks its reinforcing effects. The authors sug- Furthermore, FUJIIshowed unequivocally that
gest the use of a humanized mAb to transpose antibody catalyzed prodrug activation is viable
this system to humans. by demonstrating inhibition of the growth of
B. subtilis by means of the ester (145) only
when antibody mAb 6D9 was present in the
8.2 Prodrug Activation cell culture medium. No product inhibition
was observed by chloramphenicol at 10 mM
Many therapeutic agents are administered supporting the multiple turnover effect seen in
in a chemically modified form to improve fea- the growth inhibition assay.
tures such as their solubility characteristics, CAMPBELL and co-workers also succeeded
ease of administration, and bioavailability with this type of strategy by producing anti-
(BOWMAN and RAND,1988). Such a "prodrug" body 49.AG.659.12 against a phosphonate
must be designed to break down in vivo releas- TSA (147), designed to promote release of the
ing the active drug, sometimes at a particular anti-cancer drug, 5-fluorodeoxyuridine from a
stage of metabolism or in a particular organ. D-Valyl ester prodrug (148) (Fig. 49, AE 1.10,
The limitation that this imposes on the choice CAMPBELL, et al., 1994).This catalyst was able
of masking function could be overcome by the to bring about inhibition of the growth of E.
use of an antibody catalyst for activating the coli by the release of the cytotoxic agent,
prodrug which could, in principle, be concen- 5-fluorodeoxyuridine in vitro.
trated at a specified locus in the body. Such se-
FJ.
mNHCom3
OH 147
n 0
n
i
1 6D9
Abzyme Identity
OH
Conditions
148
49.AG.659.12 pH 8.0 37 "C
Km148 k,,,148 Ki 147

218 pM 0.03 min-' 0.27 pM
Fig. 49.Prodrug (148)is an acylated derivative of the

anticancer drug 5-fluorodeoxyuridine. Antibody
49.AG.659.12, raised against phosphonate (147)was
found to activate the prodrug (148)in vitro, thereby
128 inhibiting the growth of E. coli. Kinetic parameters
Chloramphenicol are listed.
Abzyme Identity Conditions

~ ~~
6D9 pH 8.0 30°C
Km145 k,,, 145 K,144

64 pM 0.133 min-' 0.06 pM
Much the most developed example of pro-
Fig. 48. The monoclonal, 6D9, raised against phos- drug activation comes from our own laborato-
phonate (144)catalyzed the hydrolysis of one possi- ry. The cytotoxicity of nitrogen mustards is de-
ble regio-isomer (145)of a phenacetyl ester prodrug pendent on substitution on the nitrogen atom:
derived from chloramphenicol(l28). electron-withdrawing substituents deactivate
and electron-releasing substituents activate a
bifunctional mustard. Thus, antibody catalyzed
cleavage of a carbamate ester of a phenolic
mustard can enhance its cytotoxicity to estab-
lish the carbamate as a viable prodrug for can-
cer chemotherapy (BLAKEY, 1992; BLAKEYet
al., 1995). So the target for prodrug activation
is defined as an aryl carbamate whose nitrogen body hydrolysis via the BA,2 pathway coupled
substituent is either an aryl (149a) or alkyl to the proved ability of antibodies to stabilize
(149b) moiety (Fig. 50). tetrahedral transition states led to the formu-
Aryl carbamates are known to cleave by an lation of TSAs (152a) and (152b). Siting the
ElcB process with a high dependency on the linker in the locus of the nitrogen mustard was
pK, of the leaving phenol ( p - =2.5). By con- designed (1) to minimize potential alkylation
trast, aryl N-methylcarbamates are hydrolyzed of the antibody by the mustard function and
by a BA,2 process with a much lower depen- (2) to support mechanistic investigations by
dency on leaving group ( po=0.8) (WILLIAMS variation of the p-substituent of the aryl carba-
and DOUGLAS,1972a, b). Given the electron- mate with little or no change in K,, both fea-
releasing nature of the nitrogen mustard func- tures that were realized in the outcome. Both
tion (aca. -0.5), the kinetic advantage of anti- of these TSAs generated large numbers of hy-
bridomas including many catalysts capable of
carbamate hydrolysis.
A mechanistic analysis of antibody DF8-D5
showed it to cleave p-nitrophenyl carbamate
(153) with k,,, 0.3 s-', K , 120 yM, and kc,,/
k,,,,, 300 at 14°C (AE 4.3) (WENTWORTH et
C 1 d 149 al., 1997).This is some tenfold more active than
a R' = 3.5-dicarboxyphenyl a carbamatase antibody generated by SCHULTZ
b R 1 = 2-glutwl to a p-nitrophenyl phosphonate TSA but with
a similar E R (AE 4.1) (VANVRANKEN et al.,
1994). Most significantly, variations in the
p-substituent in substrates for DF8-5 hydroly-
sis identified a Hammett p" value6 of 0.526 to
establish the BA,2 nature of the reaction. For
150 the p-methoxyphenyl carbamate substrate
(." = -0.3) the apparent E R is 1.2.10". Given
that there is a 10' difference in rate for the
ElcB and BA,2 processes for the p-nitrophen-
c1 yl carbamate (153), the data show that anti-
151 body DF8-D5 has promoted the disfavored
BA,2 process relative to the spontaneous ElcB
cleavage by some 13 kcal mol-'. Lastly, it is
H noteworthy that DF8-D5 was raised against
the phosphonamidate ethyl ester (149a) as
hapten, which raises the possibility that it may
be an unexpected product of reactive immuni-
zation (Sect. 7).
The medical potential of such carbamatases
depends on their ability to deliver sufficient
cytotoxic agent to kill cells. Antibody EA11-
D7, raised against TSA (152b) proved able to
hydrolyze the prodrug (149b) with K, 201 yM
and k,,, 1.88 min-' at 37°C (AE 4.2) (WENT-
WORTH et al., 1996). Ex vivo studies with this
Fig. 50. Carbamate prodrugs (149a, b) are targets for abzyme and human colonic carcinoma (LoVo)
abzyme cleavage to release a mustard (150)of en-
hanced cytotoxicity. ElcB hydrolysis of aryl carba-
cells led to a marked reduction in cell viability
mates involves the anion (151). TSAs (152a) and relative to controls. This cytotoxic activity was
(152b) were used to generate antibodies to catalyze
a BA,2 mechanism for hydrolysis whose kinetic be-
havior was evaluated with ester (153). A p lu- plot would have an even flatter slope.
reproduced exactly by the Fab derived from 0 0

EA11-D7 and was fully inhibited by a stoichio-
metric amount of the TSA (152b).Using EA11-
D7 at 0.64 pM,some 70% of cells were killed
in a 1h incubation with prodrug (149b) and the
antibody transformed a net 4.18 pM of prodrug Ribose-5-P
H 154
delivering more than 2. IC,, of the cytotoxic
155
agent (150).This performance is, however, well j Antibody
behind that of the bacterial carboxypeptidase ODCase
CPG2 used by Zeneca in their ADEPT system t
(BAGSHAWE, 1990; BLAKEYet al., 1995), being
lo3 slower than the enzyme and 4.104 inferior
in selectivity ratio. Nonetheless, it is the first
abzyme system to show genuine medical po-
tential and should stimulate further work in
this area. I
H 156 Ribose-5-P
a
UMP 157
8.3 Abzyme Screening via Cell
Growth
BENKOVIC proposed a new method of select-
ing Fabs from the whole immunological reper- DNA Biosynthesis
toire in order to facilitate a metabolic process
(SMILEYand BENKOVIC, 1994). A cDNA li-
brary for antibodies was raised against hapten
(159) and then expressed in an E. coli strain
devoid of any native orotic acid decarboxylase t 0
activity (Fig. 51).The bacteria were then estab-
lished in a pyrimidine-free environment where
only those bacteria grew which expressed an 0
antibody able to provide pyrimidines essential
O I
for DNA synthesis, and hence bacterial R
growth. Six colonies expressing an active Fab
fragment were found viable in a screen of 158 159
16,000 transformants (AE 9.2). The remark-
able feature of this system is that OCDase, Fig. 51. Pathways for uridylate biosynthesis.PRTase:
which catalyzes the decarboxylation of oroti- phosphoribosyl transferase; ODCase: OMP decar-
dylic acid to UMP (Fig. 51), is thought to be at boxylase; OMP: orotidine 5 ‘-phosphate; UMP: uri-
the top end of performance by any enzyme in dine 5 ‘-phosphate. Mutants lacking enzymes
accelerating this decarboxylation by some lo*’ PRTase or ODCase can complete a route to UMP
provided by an antibody orotate decarboxylase in
(RADZICKA and WOLFENDEN, 1995). conjunction with the naturally occurring uracil
Such an example illustrates the ability of ab- PRTase. Decarboxylation of orotic acid (154) is
zymes to implant cell viability in the face of a thought to proceed through the transition state
damaged or deleted gene for a crucial meta- (158), for which the hapten (159) was developed
bolic process. The medical opportunities for (SMILEY and BENKOVIC, 1994).
applications of such catalysis are clear.
There is sufficient encouragement in these
examples to show that out of all the prospects
for the future development of catalytic anti- unusual substrates may be of greater impor-
bodies, those in the field of medical applica- tance than sheer velocity of turnover of sub-
tions, where selectivity in transformation of strate, may well rank highest.
9 Industrial Future of tion, JANDA has described an automated meth-

od of transposing antibody catalyzed transfor-
Abzymes mations of organic molecules onto the multi-
gram scale by employment of a biphasic sys-
In view of the widespread interest in bioca- tem. The viability of this system was demon-
talysis, it is not surprising that in little over a strated by an epoxide ring-closing antibody,
dozen years after catalytic antibodies were 26D9, to transform 2.2 g of substrate, corre-
first reported, a vast literature has developed sponding to a turnover of 127 molecules per
documenting them.The field of research work- catalytic site in each batch process. This proves
ers is international, with groups from four con- that the catalytic antibody does not experience
tinents showing activity in the area. The poten- inhibition by product (AE 14.1) (SHEVLIN et
tial of “designer enzymes” is already becoming al., 1994). It would appear that an improve-
a reality in relation to both the chemical indus- ment in abzyme performance of little more
try and the pharmaceutical field. than two orders of magnitude is needed before
Over 70 different chemical reactions, rang- catalytic antibodies can be efficiently put to
ing from hydrolyses to carbon-carbon bond work in bioreactors and participate in kilo-
forming reactions, have been catalyzed by ab- gram scale production.
zymes and their application to general synthet- Lastly, two technical features of antibody
ic organic chemistry seems promising. Typical production may be valuable for the future pro-
Michaelis constants (K,) lie in the range duction of cheaper abzymes of commercial va-
10 pM to 1mM and binding selectivity for the lue. First, the use of polyclonal catalysts,prima-
TSA over the substrate is in the range 10- to rily from sheep, has had a tough early passage
105-fold.It therefore appears that antibodies but now appears to be established for a wide
have fulfilled most expectations that they range to transformations (GALLACHER et al.,
would be capable of substrate discrimination 1990,1992; STEPHENS and IVERSON, 1993;Tu-
comparable to that of enzymes but over a wid- BUL et al., 1994;BASMADJIAN et al., 1995;WAL-
er range of substrate types than foreseen, and LACE and IVERSON, 1996).While these catalysts
especially effective when programmed to a may not lend themselves to detailed examina-
designated substrate. The range of reactions tion by physical organic chemistry, they
that may be catalyzed by antibodies appears to should be able to deliver catalysts at a much
be limited only by a sufficient knowledge of lower cost. Secondly, as science becomes more
the transition state for any given reaction com- environmentally friendly and animal experi-
bined with synthetic accessibility to a stable mentation is more tightly regulated, approach-
TSA or to a suitable “suicide” substrate. es to screening antibodies with in vitro libra-
On the other hand, antibodies are generally ries may become a more important component
able to accelerate reactions by at most lo7 of this domain of investigation. THOMAShas
times the rate of the uncatalyzed process. It made a beginning with in vitro immunization
has to be said that scientists at large are look- and shown that useful catalysis can be identi-
ing for a major step forward in abzymes prop- fied (STAHLet al., 1995).While there are some
erties to achieve rate accelerations up to lo9 limitations in this system, notably the relative-
that would establish abzymes as a feature of ly low substrate affinity of antibodies genera-
synthetically useful biotransformations. At the ted in this way, it is capable of refinement and
same time, it is essential to demonstrate that may become a useful component of future ab-
product inhibition is not an obstacle to the zyme selection systems.
scaled-up use of abzymes.
In relation to syntheses able to deliver usab-
le amounts of product, LERNER has shown that
stereoselective reactions can be performed on
a gram scale, as in the enantioselective hydro- 10 Conclusions
lysis of a 2-benzylpropenyl methyl ether to the
corresponding (S)-2-benzylpropanol of high On an evolutionary time scale, abzyme re-
ee (AE 7.4A) (REYMOND et al., 1994). In addi- search is just reaching adolescence (THOMAS,
11 Glossary 447
1996), yet already over 80 different antibody have shown that non-specific binding proteins
catalyzed chemical reactions have been listed such as BSA may display catalysis approach-
during its first decade of life. The details un- ing the level of abzymes, albeit without any
covered concerning the mechanisms of ab- substrate selectivity (HOLLFELDERet al.,
zyme catalyzed reactions have been richer 1996). All of this serves to emphasize the fact
than expected. A wide diversity of purposely that protein recognition of discrete high ener-
designed catalysts has been explored, with the gy reaction intermediates need not translate
potential impact on the field of medicine and into efficient protein catalysis. However, the
fine chemicals production being implicated. improvements in hapten design and antibody
However, the immaturity of antibody catalysis generation strategies described above are be-
has been exposed by its poor efficiency,which ing used to highlight more intricate catalytic
in spite of intense research efforts to improve features. Charged and nucleophilic active site
all aspects of abzyme generation, continues to residues, substrate distortion (DATTAet al.,
hinder wide-scale acknowledgement of its con- 1996; YLI-KAUHALUOMA et al., 1996), desolva-
tribution to biocatalysis, particularly from tion, and proximity effects have all been now
under the shadow of powerful enzymes. identified as components of antibody mediat-
There now exists sufficient literature about ed catalysis. Using structural information
catalytic antibodies not only in terms of their available for an ever increasing number of cat-
kinetic behavior (Appendix, Sect. 12) but also alytic antibodies, manipulation of the antibody
through structural information derived from combining site is now attainable using proce-
X-ray crystallographic data (GOLINELLI-PIM-dures such as chemical modification (POLLACK
PANEAU et al., 1994;HAYNES et al., 1994; ZHOU and SCHULTZ, 1989; SCHULTZ, 1989) and site-
et al., 1994) and 3-D modeling of protein se- directed mutagenesis (JACKSON et al., 1991;
quences (ROBERTS et al., 1994), that it has be- STEWART et al., 1994;KASTet al., 1996) to pin-
come possible to speculate on a more general point or to improve the action of abzymes.The
basis concerning the scope, limitations, and re- semi-rational design of antibody catalysts us-
alistic future of the field (STEWARD and BEN- ing a combination of such techniques is also
KOVIC,1995; KIRBY,1996). In terms of transi- supporting the systematic dissection of these
tion state stabilization, catalytic antibodies primitive protein catalytic systems so as to
have been shown to recognize features of the provide valuable information concerning the
putative transition state structure encoded by origin and significanceof catalytic mechanisms
their haptens with affinity constants in the employed in enzymes.
nanomolar region whereas it has been estimat- If the ultimate worth of antibody catalysts is
ed that enzymes can achieve transition state to be more than academic, then the key must
complementarity with association constants of be found in their programmability. Here, the
the order of M to deliver rate accelera- capabilities of abzymes such as their promo-
tions of up to lo1’ (RADZICKA and WOLFEN- tion of disfavored processes and selectivity for
DEN,1995).The whole subject of binding ener- substrates and transformations for which there
gy and catalysis has been authoritatively and are no known enzymes may offer prospects
critically reviewed by MADERand BARTLETT, more significant than the further pursuit of
with especial focus on the relationship performance levels comparable to those of en-
between transition state analogs and catalytic zymes.
antibodies (MADERand BARTLETT,1997). En-
zymes have evolved to interact with every spe-
cies along the reaction pathways that they ca-
talyze whereas our manipulation of the im-
mune system is still relatively simplistic, using 11 Glossary
a single hapten to stimulate a full, often multi-
step, reaction sequence of catalysis. Abzyme: An alternative name for a catalytic
The serendipity that may be involved in the antibody (derived from Antibody-enzyme).
isolation of an efficient antibody catalyst is Affinity labeling: A method for identifying
now well appreciated while recent studies amino acid residues located in the binding
site(s) of a peptide. The protein is treated with ly refers to the product obtained from the
a ligand which binds to the binding site and covalent coupling of a protein (e.g., a carrier
reacts with proximal amino acid residues to protein) with either a hapten, a label such as
form a covalent derivative. Upon hydrolysis of fluorescein, or an enzyme.
the protein, individual amino acids or short Conjugation: The process of covalently bond-
peptide fragments linked to the ligand are sep- ing (multiple) copies of a hapten to a carrier
arated and identified. protein, usually by means of a linkerkpacer to
Antibodies: Proteins of the immunoglobulin distance the hapten from the surface of the
superfamily, carrying antigen binding sites that carrier protein by a chain of about six atoms.
bind non-covalently to the corresponding epi- ELISA (Enzyme Linked Immunosorbent As-
tope. They are produced by B lymphocytes and say), An immunoassay in which antibody or
are secreted from plasma cells in response to antigen is detected. To detect antibody, antigen
antigen stimulation. is first adsorbed onto the surface of microtiter
Antigen: A molecule, usually peptide, protein, plates, after which the test sample is applied.
or polysaccharide, that elicits an immune re- Any unbound (non-antigen specific) material
sponse when introduced into the tissues of an is washed away, and remaining antibody-anti-
animal. gen complexes are detected by an antiimmu-
B cells: (Also known as B lymphocytes). De- noglobulin conjugated to an enzyme.When the
rived from the bone marrow, these cells are substrate for this enzyme is applied, a colored
mediators of humoral immunity in response to product is formed which can be measured
antigen, where they differentiate into antibody spectrophotometrically. The intensity of the
forming plasma cells and B memory cells. colored product is proportional to the concen-
Bait and switch A strategy whereby the tration of antibody bound.
charge-charge complementarity between anti- Enhancement ratio, ER: Quantified as kc,,/
body and hapten is exploited. By immunizing k,,,,,, is used to express the catalytic power of
with haptens containing charges directed at a biocatalyst. It is a comparison between the
key points of the reaction transition state, catalyzed reaction occurring at its optimal rate
complementary charged residues are induced and the background rate.
in the active site which are then used in cataly- Entropic trap: A strategy aimed at improving
sis of the substrate. the efficiency of catalytic antibodies, via the in-
B S A Bovine Serum Albumin. Extracted from corporation of a molecular constraint in the
cattle serum and used as a carrier protein. transition state analog that gives the hapten a
Carrier protein: Macromolecule to which a higher-energy conformation than the reaction
hapten is conjugated, thereby enabling the product.
hapten to stimulate the immune response. Epitope: The region of an antigen to which
catELISA Similar to an ELISA, except that antibody binds specifically.This is also known
the assay detects catalysis as opposed to sim- as the antigenic determinant.
ple binding between hapten and antibody. The Fab The fragment obtained by papain hydrol-
substrate for a reaction is bound to the surface ysis of immunoglobulins. The fragment has a
of the microtiter plate, and putative catalytic molecular weight of -45 kDa and consists of
antibodies are applied. Any product molecules one light chain linked to the N-terminal half of
formed are then detected by the addition of its corresponding heavy chain. A Fab contains
anti-product antibodies, usually in the form of one antigen binding site (as opposed to biva-
a polyclonal mixture raised in rabbits. The EL- lent antibodies), and can combine with antigen
ISA is then completed in the usual way, with as a univalent antibody.
an anti-rabbit “second antibody” conjugated Fab’: The fragment obtained by pepsin diges-
to an enzyme, and the formation of colored tion of immunoglobulins, followed by reduc-
product upon addition of the substrate for this tion of the interchain disulfide bond between
enzyme. The intensity of this color is then in- the two heavy chains at the hinge region. The
dicative of the amount of product formed, and resulting fragment is similar to a Fab fragment
thus catalytic antibodies are selected directly. in that it can bind with antigen univalently, but
Conjugate: In immunological terms this usual- it has the extra hinge region of the heavy chain.
I 1 Glossary 449
Hapten: Substance that can interact with anti- substrate and biocatalyst; the smaller the val-
body but cannot elicit an immune response un- ue, the tighter the binding in the complex
less it is conjugated to a carrier protein before (FERSHT, 1985).
its introduction into the tissues of an animal. Library: A collection of antibodies, usually Fab
Haptens are mostly small molecules of less or scFv fragments, in the range of lo6 to 10’’
than 1 kDa. For the generation of a catalytic and displayed on the surface of bacteriophage
antibody, a TSA is attached to a spacer mole- whose DNA gene contains a DNA sequence
cule to give a hapten of which multiple copies capable of expression as the antibody protein.
can be linked to a carrier protein. Thus, identification of a single member of the
Hybridoma: Cell produced by the fusion of library by selection can be used to generate
antibody producing plasma cells with myelo- multiple copies of the phage and sizeable
makarcinoma cells. The resultant hybrids have amounts of the antibody protein.
then the capacity to produce antibody (as de- Monoclonal antibody,m A b Describes an anti-
termined by the properties of the plasma body derived from a single clone of cells or a
cells), and can be grown in continuous culture clonally obtained cell line. Its common use de-
indefinitely due to the immortality of the mye- notes an antibody secreted by a hybridoma
loma fusion partner. This technique enabled cell line. Monoclonal antibodies are used very
the first continuous supply of monoclonal anti- widely in the study of antigens, and as diagnos-
bodies to be produced. tics.
IgG The major immunoglobulin in human ser- Polyclonal antibodies: Antibodies derived
um. There are four subclasses of IgG: IgG1, from a mixture of cells, hence containing vari-
IgG2, IgG3, and IgG4, yet this number varies ous populations of antibodies with different
in different species. All are able to cross the amino acid sequences. Are of limited use in
placenta, and the first three subclasses fix com- that they will not all bind to the same epitopes
plement by the classical pathway. The molecu- following immunization with a haptenlcarrier
lar weight of human IgG is 150 kDa and the protein conjugate. They are also difficult to
normal serum concentration in man is 16 mg purify and characterize, yet have been used
mL-l. with success in the catELISA system.
Immunoglobulin: Member of a family of pro- Positive clones: A phrase usually used to de-
teins containing heavy and light chains joined scribe those hybridoma clones which bind rea-
together by interchain disulfide bonds. The sonably well to their respective hapten in an
members are divided into classes and subclass- enzyme linked immunosorbent assay, thereby
es, with most mammals having five classes eliminating non-specific antibodies raised to
(IgM, IgG, IgA, IgD, and IgE). different epitopes of the haptenkarrier conju-
k,,,:The rate constant for the formation of gate.
product from a particular substrate. k,,, is ob- Residues: General term for the unit of a poly-
tained by dividing the Michaelis-Menten pa- mer, that is, the portion of a sugar, amino acid
rameter, V,,,, by the total enzyme concentra- or nucleotide that is added as part of the poly-
tion. It is also called the “maximum turnover mer chain during polymerization.
number”, because it represents the maximum Site-directedmutagenesis:A change in the nu-
number of substrate molecules converted per cleotide sequence of DNA at particular nucle-
active site per unit time (FERSHT, 1985). otide residues and/or complete codons. This is
k,,,/K,: See specificity constant. usually done in order to change the corre-
KLH Keyhole limpet haemocyanin, used for sponding amino acid residue in the protein en-
its excellent antigenic properties. It is used as a coded by the nucleotide sequence so as to in-
carrier protein in order to bestow immuno- troduce or remove functionality from the pro-
genicity to small haptens. tein.
K,: Is the Michaelis-Menten constant, which is Single Chain Antibody (scFv): Comprises a V,
defined as the substrate concentration at linked to a VHchain via a polypeptide linker. It
which the biocatalyst is working at half its is thus a univalent functioning antibody con-
maximum rate (V,,,). In practice, K , gives a taining both of the variable regions of the par-
measure of the binding affinity between the ent antibody.
Somatic hypermutation: Mutations occurring a pseudo-second-order rate constant which, in

in the variable region genes of the light and theory, would be the actual rate constant if for-
heavy chains during the formation of memory mation of the enzyme-substrate complex was
B cells. Those B cells whose affinity is increa- the rate determining step (FERSHT, 1985).
sed by such mutations are positively selected TSA Transition state analog; frequently a sta-
by interaction with antigen, and this leads to an ble analog of an unstable, high energy, reaction
increase in the average affinity of the antibod- intermediate that is close to related energy
ies produced. barriers in a multi-step reaction.
Specificity constant: Is defined as kcatlKm.It is
12 Appendix 451
12 Appendix
12.1 Catalog of Antibody Catalyzed Processes
A. HYDROLYTIC AND DISSOCIATIVE PROCESSES
1. Aliphatic Ester Hydrolysis
Reaction I Conditions Hapten / Comments IKi Km kcat Entrj

/mid AE
- -
1.1
1.4 E+3 5.0 E+O
1.2
r;*No2 7G12
1.3 E+1 7.0 E-2 3.7 E+:
,:, 5.4 E+O 3.3 E-2 1.7 E+:
0 OH 3G2
R' = (CH&CO&I
T
SA
7G12: K, 1.9 E-2 KM
3G2: Ki 4.7 E-2 PM
1.3
1.9 E+2 1.1 E-1 5.4 E+:

Cocaine 0 15A10 2.2 E+2 2.3 E+O 2.3 E+i
I
R, = (CHzhNHCO(CH,hCO,H,
389,pH 7.7 R, = Me, R, = H
15A10. pH 8.0
polyclonal TSA
3B9: Ki < 2.OEi4 pM
Polyclonal N N N
R, =Me, R, =Me, R, = NH-DT
R , = Me, R, =DT,Q = H
R, = DT. R,=Me, & = H
--- -
-
1.4
EtOH 0
1 F 8 . 0 , 30°C
0
2.9 E+Z 2.0 E+ N
N, (CHd5COzH TSA
HO
H Kl 4.0 E+O pM
N, (CHz)&GH
EtO
H
- - -
Y0 O Q Y 0
1.5
1.8 E+2 7.0 E-: g.8 E+l
TSA
Kl 7.0 E+O pM
AcOH
" " ' O - O y
-
0 1.6
3.9 E+2 1.O E-: ).O E+2

pH 9.0,
25°C BnC02H 42% 6s COzH
TSA
I Ki 4.3 E+O pM - -
1.7
AcH
5.6E+O 1.8 E-I !.7 E+3
1 17E11,pH8.2,2OoC
F, AcHN
yHN
OMe
<
SH 90
AcH TSA
it Kj 2.6 E-2 pM
Hu
- ___ __ -
12 Appendix 453
-
I
0 LoNHcocF3 FGOCHN 1.8
02 .4 E+l 1.3 E-1 .8 E+:

I
6D9 I pH 8.0.30"C
02
TSA
K,6.0 E-2 pM
- -
1.9
I
OCsHii
F F
.1 E+2 6.7 E-1 1.1 E+:
IgG pH 7.0,25"C
R C 0 2 H HOCsHll
F F
- -
.10
OH
.2 E+2 3.0 E-2 1.7 E+:
49.AG.659.12 pH 8.0,37°C
OH
~
.ll
..3 E+2 8.9 E-1 N
B 8.9 E+2 8.6 E-1 N
Enantiomers immunized separately
TSA
-
-
.12
2R, 3R 1.9 E+2 8.8 E-1
2s, 3 s 1.0 E+2 9.1 E-1
1.1 E+2 9.4 E-1

1.8 E+2 8.6 E-1
.13
2D,0, pH
1 4°C Kinetic resolution

30°C Kinetics
H o J = o ~ N o z
80 % 88
.3 E+3 2.0 E+C 1.4 E+
NO2
A d O D 40%
-
.14
2H6 1.0 E+3 4.6 E+C s.3 E+
2H6-I L.2 E+3 4.0 E+C 1.2 Ec
2H6 Rester to Ralcohol
2H6-I R-ester to R-alcohol 21H3 s.9 E+2 9.0 E-2 1.6 E+:
pH9.0 21H3 Sesterto Salcohol
21°C 21~ 3 - ISester to Salcohd !.O E+2 6.0 E-2 1.1 E+:
I = immobilized antibody 21H3-1
TSA
2H6: Ki 2.0 E+O FM
21H3: Ki 1.9 E-1 pM
.15
2H12E4
I pH 8 0,24OC LO2 .5 E+l 1.9 E-2 2.7 E+
TSA
K , 2.4 E+O pM
12 Appendix 455
-
0 A 2.8 E+2 7.4 E+O 2.6 E+5 1 . 1 6
B 3.3 E+l 3.4 E+O 7.2 E+3
On ' HOzC/'# 0
A R = 4-Nitrobenzyl 'OH
B R = 4-Nitrophenyl TSA
-
1.17
1.0 E+2 3.0 E-2 3.0 E+l
&o@% 0
in vitro Chemical Selection
-
p
no-
1.18
3-examples shown below
3.4 E+3 6.2 E-2 2.9 E+4

02
2.8 E+3 1.1 E-2 8.8 E+3
A R = ally1
B R = ethyl
C R = mnitrobenzyl I pH 9.0, 23°C
:i:Iasic)
TSA
1.5 E+3 4.7 E-1 1.4 E+6
0 2
ROH Ki (substrate A) 1.2 E+1 PM
1.19
OTYPIC CATALYSTS
I Antibodieselicited against mAbE-2, 6.0 E+2 4.9 E+3 4.2 E+8
an anti- acetylcholinesteraseantibody
AcOH HS-5
--
2. Aryl Ester Hydrolysis
-- - -
2.1
0 2D o m N L HC O z H
H5H2-42
HO
1 pH 7.0, 25%
N L C O z H
l.4 E+2 1.3 E+l 6.8 E+4
OnN 42.2E+1 pM
Heterologous Immunization
___ - -
__ - -
2.2
1.1 E+2 2.4 E+O 9.7 E+3

TSA
K , 3.4 E+3 pM
---
2.3
pH 8.; 2.6 E+2 1 .O E+2 1.3 E+4
17E8 1 pH 8.7and 9.5

H3
0 BU
TSA
pH 9.: nr
little
variance
with pH
2.2 E+2 2.2 E+4
Ki 5.0 E-1 pM
---
&oxYNoz 4.0 E+2 1.4 E+2 3.5 E+6

2.4
Me0
+OH
C3
1 pH 8.5
DNo2
TSA
Kd 2.4 E-2 @vl
Mrn HO
-
2.5
QoA - 3.6 E+l 5.4 E-1 6.9 E+1

1.6 E+2 1.9 E+l 1.7 E+4
A 20G9, pH 8.8,25°C 5.7 E+2 3.9 E+O N
Bi 20G9. pH 8.5,35"C
-
Bii 20G9 (reverse micelles) Wo 23
TSA
A, Ki 2.2 E-3 FM
Bi, Ki 3.9 E-2 pM
12 Appendix 457
-
.1 E+3 5.0 E-3 1 .O E+6

(VP)
.5 E+O 2.7 E+O 1.2 E+3
X = CH 30C6, pH 7.2, 37°C

x =N 84A3, pH 7.0, 25°C
X= CH 27A6, pH 8.3, 37°C
m)P 27A6 .4 E+2 2.0 E-3 N

(VP)
NH
H o d O
-
27A6: Ki 6.0 E+OpM
Bait and Switch (BS)
-
ozyy+p?@
I
C0zH
KD2-260 .9 E+O 2.5 E+O 3.1 E+3

KD2-260:Ki ( 3 0 0 ~ 1 E-1
. 2 @I
KD2-260, pH 6.0,ZO"C
7K16.2, pH 7.5,3O0C
COzH
""Q
%
2
0
AcOH 7K16.2 .7 E+3 7.2 E-1 2.3 E+3

OH 7K16.2: Ki 1.4 E+2 @I
TSA
o z ~ > p , O o NF"43C9 8.3 E+l 1.5 E+3 2.7 E+4
Hb
(estimate
based on
pH rate
profile)
NPN43C9, pH 9.3,25"C
Fab-1D, pH 7.2 ' Fab-1D . I E+2 2.5 E-1 N
O Y NH
(CHdCQH
TSA
~ 1.0 E+O pM
NPN43C9: Kd ( P 7)
.9 E+O 1.6 E+O 9.6 E+i
6D4
I pH 8.0, 25%
JNmoH
Fa HoQNA H
6D4: Ki 1.6 E-1 pM
TSA
~ --
--
1.5 E+3 1.2 E+3
SOD8
I pH 8.O,2S0C
50D8:K,5.0 E-2 pM
AN+
H 0 TSA
3.5 E+2 7.1 E-1 !.4 E+3
flom
H 0 2 e O
H6-32: Ki 3.6 E+2 fl

02
H
1 3.7 E+2 1.O E+O

H6-32,pH 7.8, 25°C
H5-38, pH 7.0, 25°C H5-38 t.3 E+3
o2 / OH /
H7-59,pH 7.0, 25°C NH
H02&O
H O n NJco2H
H5-38: Ki 5.0 E+Ofl
H
0 NMe3
0 2 H7-59 1.1 E+3 4.9 E-1 1.6 E+3
Qb
HO2
H7-59: Ki 2.3 E+2 @I

-
1.7 E+2 2.0 E-1 !.O E+3

37G2 1 pH8.0,25'C
OH ' NHCO(CH2)sCOd
-eNHAc
-
dNHAC
I actone Formation o+ ,OH
24811 7.6 E+l 5.0 E-1 .7 E+2

PhO pH 7.0
25°C %HO2
O
PhOH
0
TSA, Kj 2.5 E-1 pM -- -
12 Appendix 459
--
!.14
1
S02Me
H I 1.0 E+2 3.1 E+1 5.7 E+3
49H4 pH 8.0,22"C
i02Me
in viw Ki 1.2 E+1 pM
H S02Me
SOnMe R
Reactive Immunization (RI)
!.15
Semisvnthetl'c Antibodies
Nucleophilic thiol groups 1.2 E+O 8.7 E-1 5.0 E+4
were introduced into a
2,4-dinitrophenylligand
specific antibody binding site
by chemical modification
Ki (DNP-Gly) 2.5 E-1 pM
3. Carbonate Hydrolysis
02ao~o/ 3.3 E+3 3.1 E-1 9.3 E+2

3.1
I A 7K16.2. DH 7.5. 30°C

% O H02 A
6.6 E+2 1.4 E+O 8.1 E+2

4.3 E+2 4.0 E+l 2.3 E+4
"'"Q C02 MeOH

6.8 E+2 2 . 3 E+l 1.3 E+4
OH
3.2
2.1 E+2 4.0 E-1 7.7 E+2

MOPC167 pH 7.O,3O0C
TSA
Ki 5.0 E+O pM
-
----
3.1
3.3 E+3 3.1 E-1 9.3 E+;
A 7K16.2, pH 7.5,30°C
B lg, pH 8.5, 30°C 6.6 E+2 1.4 E+C 8.1 Et:
C 48G7-4A1, pH 8.1, 30°C
[soluble ( S ) , immobilized O)] 4.3 E+2 4.0 E+1 2.3 E+4
6.8 E+2 2.3 E+l 1.3 E+4
- ___ -
3.2
2.1 E+2 4.0 E- 1 7.7 E+2

TSA
Ki 5.0 E+O pM
OH HO-
-
Sheep no. 27C 3.3 E+O 1.7 E+Z 1.5 E+4 3.3
(based
on 1%
active
protein)
(Sheep no. 270), pH 8.0, 25°C
NCAT2-f 2.8E+2 7.2 E+l 5.5 E+3
(IVCAT2-6), PH 8.O,3O0C Shcep no. 270,R =OH
IVCAT2-6, R = NH(CH,),CH,
TSA
Sheep no. 2 7 0 Kj 9.0 E-3 pM
NCAT2-6: Ki 2.0 E+2 pM --
3.4
g.9 E+l 2.1 E-1 4.3 E+3

bPP) bPP) bPP)
12 Appendix 461
4. Carbamate Ester Hydrolysis
--
4.1
5.5 E+O 1.5 E+O 2.6 E+:
OH coz
-
4.2
2.0 E+2 1.9 E+O N
TSA
K,i 2.0 E+8 M
--
1.3
Y = NO,, Br. F, OMe CozH

1.2 E+2 1.8 E+l 3.0 E+:
l
a""
DFB-05
cozH
pH 6.5, 14%
T C O ' "
8.0 E+l
4.1 E+l
5.8 E+l
5.0 E+O 1.0 Ew
7.2 E+O 1.0 E+r
1.9 E+O 1.2 E+t
Y
COzH TSA
---
5. Amide Hydrolysis
-
5.1
4.3 E+2 9.9 E-6 1.3 E+2

Ph(CHz)ny '
Gly-Phe-fl-AlaGlyOH
5.2
287F11 pH 6.5,37 'C

N 3.6 E-2 2 E+5
O
Ph(CH2)nyOH
1
HZN-Gly-Phe-B-Als-GlyoH
8 R = CONHCHzCOzH
0 Metal complex cofactor - ___ ~
ozQNmy(
5.3
*I
COzH
NPN43C9 pH 9.0.37 'C i.6 E+Z 8.0 E-2 !.5 E+.5
TSA
NHz HO Ki 1.0 E+l
5.4
1.6 E+l 4.5 E-4 r.5 E+2
TSA
5.5
i.4 E+O 3.6 E-1 1.1 E+?

(based on
1% active
TSA protein)
__ __ -
. .
nubod@
1
Gln16-#-Met'7 VIP 5.6
Human serum IgG fraction was 3.8 E-2 1.6 E+l N
Fab pH 8.5,38 "C found to hydrolyze vasoactive
intestinal polypeptide (VIP).
VIP (1-16) VIP (17-28) Unknown immunogen
- -
I
Tg 5.7
Polvclonal Human serum IgG fraction 3.9 E-2 3.9 E-3 N
Tg-Ab was found to hydrolyze
thyroglobulin (Tg).
Tg-fragments Unknown immunogen
5.8
I
Boc-EAR-MCA
Bence Jones proteins (BJPs)
(monoclonal antibody light .5 E+1 3.3 E-2 N
BJP-B6 chains) isolated from the urine of
multiple myeloma patients, were
BE-EAR MCA found to hydrolyze peptide
methylcoumarin amide
peptide-MCA substrates
- --
12 Appendix 463
6. Phosphate Ester Hydrolysis

-- --
6.1
1.8 E+l 1.9 E- 3.6 E+:
I
3.6 E+1 1.0 E- 9.8 E+:
TX1-4C6 pH 8.5,3OoC 0
Electrostatic TS Stabilization
h (fluorescence quench) 6.7 E-l pM
~ __
1. N-Acvl Serinol Triester Hvdrolvsis
6.2
( ~ ~ N 0 2 1 3H5
5 C 1.7
5 E+l 2.7 E-: 1.3 E+:
F.1 E+3 2.0 E-: 3.5 E+:
0
2. Paraoxon Hvdrolvsis
Electrostatic TS Stabilizationand
""'o-? 3H5 OH
BS
~ 9.8 E-1 pM
0.';- OEt 0
.'
;- OEt
OEt OEt
3H5: K, ( p 9.3)
6.3
1.3 E+2 1.0 E+I j.5 E+?
5.4
2.4E+2 3.2 E-; 1.1 E+2
TSA
Ki <4.0 E-1 pM
__
Fab fragment froman IgG 1.3 E+l 1.4 E+1 N

purified from human sera Human serum IgG fraction (Fab)
pH 1.5, 30°C was found to hydrolyze DNA.
Unknown immunogen
__
R
H T OOHH
..6 E+2 1.2 E-3 8.0 E+3
Ki 3.4 E+l FM
- -
7. Miscellaneous Hydrolyses
--- -
3 7c4 3.1 E+I 1.0 E-1 2.7 E+ 7.1
polyclonal 3.1 E+l 2.0 E-2 1.3 Et
(based or
12 %
\ active
37C4,pH 6.0 protein)
polyclonal, pH 7.2
OM*
TSA
37c4: Kd 2.5 E-2
- - __ -
7.2
3.2 E+2 1.5 E-2 N
TSA/ BS
Ki 3.5 E+l FM - -
7.3
FablB HO
HO i.3 E+2 7.0 E-3 7.0 E+
HO
in vitro Chemical Selection

K; 1.5 E+l uM
12 Appendix 465
-- - -
7.4
A 3.4 E+Z 5.7 E-3 1.5 E+:

B 1 .O E+Z 4.7 E-3 1.0 E+1
C 5.0E+l 1.2 E-2 5.0 E+i
R D p D 2.3 E+2 1 .O E-2 1.3 E+i
1409 OH E 2.5 E+l 1.5 E-3 1.4 E+1
&Lo.
0
R = CH2NHCO(CH2)&0&I
OH H
-1ization in Water BS
A:Kd 1.0 E-2 pM
12 %, >99 % ee
D Ketal Hvdrolvsis
Ar
pH 5.6,24%
i14D9
HOf
87 % ee
8. Eliminations
Disfavored s m Fl i r n i w 8.1
0 2.1 E+2 3.0 E-3 N
P h 5 F A
pH 9.0 P h y
37%
BS and Entropic Trap
466 11 CatalyticAntibodies
__
43D4-3D21 1.8 E+2 1.9 E-1 8.8 E+ B.2
20A2F6 1.1 E+3 3.5 E-4 1.2 E+
0 2
pE& OH 0
20A2F6
20A2F6: Kl 1.6 E+l pM
0 2 0 2
- -
2 3 - C o ~ eElimination
8.3
I
!.4 E+2 2.4 E-5 9.1 E+
21B12.1
pH 7.2, 37%
TSA
Ki 2.0 E-1 pM - -
H
F2 Elimination 8.4
.2 E+2 1.0 E+l 2.1 E+

C02H
BS
-
Selenoxide Elimination
3.5
mSfD
I
Me0 NO2 .5 E+O 1.8 E-1 1.6 E+
C02H 0 Br
I
SZ-28F8 pH 8.0, 25°C
TSA
Ki 8.2 E-2 pM
Me0 NO2
--- -
9. Decarboxylations
1 21D8, pH 8.0,20°C
SOsH 21D8 1.7 E+2 1.7 E+1 1.9 E+4
25E10, pH 8.0, 20°C
I
25E10 2.6 E+2 2.3 E+l 2.3 E+4
Medium Effect
21D8: Kl 6.8 E-3 pM
02mcN OH
25E10 K;2.4 E-3 uM
12 Appendix
-
9.2
2.1 E-4 1 .O E+8
-
9.3
1.6 E-1 1.5 E+4
-
9.4
2.8 E-2 1.9 E+5
-
10. Cycloreversions
Retro Diels-Alder Re-

10.1
1.3 E+2 7.3 E-2 2.3 E+2
Heterologous Immunization
(with hydroxylated form)
HNO &(pH 9.0) 9.0 E-1 P M
~
10.2
A 6.5 E+O 1.2 E+O 2.2 E+2
B 2.8 E+2 4.1 E-1 3.8 E+2
A 300 nm
RI RI Rq
A 15F1-381, R, =OH, R2 = H, R = Me cis, syn

B UD4C3.5, R, = NHCH2C02Me,R, = H R = H trans, syn
15F1-B1: Ki < 1.0 E+O pM

m 4 c 3 . 5 : Kd (fluorescence quench)
-
11. Retro-Henry and Retro-Aldol Reactions
11.1
kcatlKm kimid
Hz 1.3 E+2 M-*min-' 2.5 E-4
(kcat and K m not M-1
TSA measured separate1 min-1
Ki (app) 2.6 E+O pM
-
.1.2
AcH Jy+ kcat/KmM-lmin-'

bPP)
1.1 E-1
N
2.2 E-2
AcHN
(4R. 55) (>95 % de)
(4R, 5R) (43% de)
d H A 7.8 E-2
2.2 E-1
N
AcHN
(45. 5s) (>95 % de)
(45, 5R) (65 % de)
3. INTRAMOLECULAR PROCESSES
12. Isomerizations
-
Reaction / Conditions Hapten 1 Comments / K i Entry
&@dvl-Drolvl cistrans .isom- . . -

AE
""a
12.1
NHz 0
2.7 E+
R CO(CHz)&OOH
VTT1E3
02
pH 8.0,4"C TSA, Kj 1.0 E+1 pM
. .
somenzabm
12.2
P N O z DY110-4
pH7.5 2.2 E+2 4.8 E+O 1.5 E+
CO&I
0 2 ' 25°C
BS, Ki 6.7 E+O pM
12 Appendix 469
&
__
12.3
0 '
9D5H12
\ 1.6 E+2 2.3 E+O 8.3 E+2
8
TSA
K, 1.3 E+2 pM
12.4
CO2H
4.2 E+2 2.6 E-3 2.9 E+3
\
TSA
Kd (BIAcore) 2.1 E-1 pkf
13. Rearrangements
.3.1
ph&coR
HO 2.6 E-2 5.3 E+
R = NH(CH&O(Cb)zNHz
TSA
Kj 3.0 E-2-1.6 E-1 pM
B .3.2
" " ~ c o P
+ q ( O H 1F7 1.9 E+1 2.3 E-2 2.5 E+
QJcd
OH
0 0
1F7: Ki 6.0 El
I
02@COp
lF7. pH 7.5,14"C
11F1-2E11, pH7.0. 10°C
0
H
1 lF1-2E11 !.6 E+2 2.7 E+O 1.0 E+
i
OH
0
llFl-2E11: Kj9.0E+OpM
~
3.3
1.9 E+2 7.2 E-3 7.0 E+

8.3 E-1 3.6 E+1 nr
COzH
TSA
2 B 4 Ki 1.0 E-1 @I
-
3.4
Ar Qo
=
6.7 E+2 1.3 E-5 1.0 E+I
HO- NH r‘
HO
TSA
X = Linker
62C7 1 pH5.8
9 - NO2
1.7 E+5 1.8 E+1 1.9 E+r

.3.5
I
Ab-DNP pH 7.4,23%
&CpNO2
NOz
\
-
12 Appendix 471
14. Epoxide Opening
--
.4.1
1 3.6 E+2 9.0 E-1

1
L 2.0 E+2 9.0 E-l
u
HO
Qo
TSA
-
15. Cationic Cyclization
15.1
1.3 E+; 2.0 E-2 N
1.5 E+1 2.0 E-2 N
TX1-4C6, pH 7.0, (biphasic)

TM1-87D7, pH 7.0, (biphasic)
0 6" TSA
TX1-4C6: Ki 1.0 E+O pM
TM1-87D7: Ki 1.4 E+O
.5.2
A i.8 E+1 1.3 E-2 N
B I .O E+Z 2.1 E-2 N
1.1 E+1 1.0 E-2 N
TSA
A: Ki 1.0 E+O pM
Me
B: Ki 1.0 E+O pM
80% 63% 60%
from R = cis- Me from R = frans- Me from R = H C: Ki 1.0 E+O pM
-
15.3
1
3.5 E+1 2.5 E-2 7.0 E+1
HA1-17G8
pH 7.0
ct a&Jl
(biphasic)
% O H
TSA
4: 1 H
IC50 1.2 EtO pM
-
15.4
HA5-19A4
3.2 E+2 2.1 E-2
m&m
pH 7.0
0 (biphasic)
TSA
Ki 1.4 E+O PM
2 : 3 : 1
-
C. BIMOLECULAR ASSOCIA'ITW AND SUBSTITUTION PROCESSES
16. Aldol Reactions
~~~ ~
-
Reaction I Conditions Hapten / Comments (Ki) Kln kcat Zntr
[pM] [min-'1 AE
A 3.6 E+2 1.4 E-4 16.1

4.7 E+2 4.9 E-4
70H6
pH 7.5
o&H - B
BS
-
6.2
1.7 E+l 6.7 E-3 2.9 E4

EOlH Retro-ddol 5.4 E+1 4.4 E-3 N
Reactive Immunization
12 Appendix 473
-
L6.3
1.8 E+3 1.8 E-4 1 .OE+2
bPP) @PP) bPP)
H2T&o ;~D~oor9.3,20~c 4.9 E+3 9.6 E-5 1.7 E+2

1-10 % vhr acetone (aPP) bPP) bPP)
HO- NH
17. Diels-Alder Cycloaddition
Dienophile 2.1 E+4 4.3 E+O ,. 1 E+2

([Diene] 0.61 mhf) bPP) @PP) @PP)
CI
TSA, Entropic Trap

-
Diene 1.1 E+3 .7.2
4.0 E+l 3.5 E-1
Dienophile 1.4 E+2
TSA,
Kj 1.3 E-1 PM
Diene N N N
.7.3
8.3 E+3 3.3 E+l L.8 E+1
I
OAC 0
H11 pH8.0,18"C
1.1 E+3 5.5 E-2 N
TSA
Dienophile 3.1 E+3 1.2 E+

O=FCAr 17.4
([rrm Diene] 5.0 mM) @PP) bPP)
309-1G7 pH 7.3
R = (CH2)5C02H Dienophile 3.9 E+3 2.6 E+

([cis Diene] 5.0 mM) (wp) @PP)
Ar = o-C.H.CONHPr TSA
__
9.6 E+2 7.5
3.4 E-3 4.8 E+
Dienophil 1.7 E+3
7.0 E+Z
3.2 E-3 1.8 E+
HO 7.5 E+3
I
7D4, pH 7.4.37"C
22C8, pH 7.4, 37%
4D5. pH 7.4, 37%
1 3 ~ 5pn
, 7.4,37oc
1.6 E+3
3.5 E-3 4.9 E+l
5.9 E+3
1365 (em) Dien 2.7 E+3

1.2 E-3 6.9 E+
Dienophil 1 .OE+4
CO2H COzH
--- -
18. Acyl Transfer Reactions
-
18.1
0" 1 HN Ester 2.2 E+3 2.3 E-2 1.1 E+I
mNHCocH3
NHz ;;YO, 23°C o% ([Amine]20 mM) bPP) (app) (app)
0".
COzH
TSA, IC50 1.0 E+1 pM

PhOH
18.2
4.9 E+3
6.6 E-2 1.6 E+1
24811 I pH7.0 1.2 E+3
12 Appendix 475
- --
Azide 1.5 E+1

5.9 E-2 1 .OE+4
B'Q,,, 1 965.1, pH 7.4

Amine 1.5 E+:
- ___ -
L O E+?
1.3 E+l 1.9 E+2
1.6 E+4
TSA
0
- --
'2
$7vJo Alcohol
Ester
1.7 E+i
1.6 E+i
1.4 E+l 5.5 E+4
NC
TSA
'N+Ph
H Kd 2.4 E-4 fl
- --
A Ester 3.0 E+?

2.1 E+1 N
d:'.~po
alcohol 1.3 E+?
A 21H3, pH 9.0 B Ester

B 21H3. pH 8.5,23"C 1.1 E+;
(96 % octane)
t alcohol 1.3 E+: 3.0 E+O nr
CHCHO TSA
21H3: Ki (app) 2.0E+O pM
--
Transamination 4.2 E-1 8.7

(loo PLP) bPP)
COzH
2
G 0
*
15A9, pH 7.5,25"C
Elimination 5.0 E+1
(loo ph4 PLP) bPP)
- -
19. Amination Reactions
20AF2F6 Ketoni 2.7 E+3 1.1 E+l 9.1

([NH2OH] 20 mM (aPP) bPP)
0 NH3
H - y J
0 43D4-3D12 Ketoni 9.4 E+2 6.7 E+O
([NHzOH] 20 mM bPP) @PP)
2OAF2F6, pH 7.3,25"C,syn :antiS:l
43D4-3D12, pH 6.5,25"C, syn :anti 1:9 ~L COzH
TSA - -
3.9 E+3 9.2

1.5 E+l
Antisera-ATE3 ~ ~ ~ c o z ' 1.6 E+2
Go L-Phe.
9.3
m H : A Amino acid 1.2 E+2
1.8 E+1 2.1 E-1
0
HO* mdoxd
7.1 E+2
17C5-11C2
pH 7.0, 25°C L-amino acid Kd 6.0 E-3 pM
D-tUllhlO acid: Kd 1.7 E-2
-- -
12 Appendix 477
20. Miscellaneous
--
Sulfonate 1.3 E+2 2.8 E-5
( [NaI] 0.15M) bPP) bPP)
Ph-
P - NHAC
I ' h ; s 00
c oa y y ~
I
'
1685 Nal, 37°C (biphasic) H o d o
Ph- Ai+ HO-+ R - NHAC

NaI 1.5 E+5 2.8 E-2
([Sulfonate] 0.75mM) bPP) @PP)
I
TSA
Kj ca. l.OE+l p.M
I
Tfl Enone
CN-
5.4 E+l
I.4 E+2
2.1 E-2 3.0 E-i
&p
564, NaCN pH 7.0,37"C
TSA
K, 1.1 E+l pM
HO-0 ' CN
-
1.9 E+l 5 . 2 E-4 2.6 E+:
5.0 E+1 8.4 E-5 1.7 E+:
Potphyrin + M2+
1 7G12-A10-61-A12
pH 8.0,26"C
Porphyrin-M2*
COzH COzH
-- -
Reaction I Conditions Hapten / Comments ( K j)
D" 0 2ppgO
1
02 Na'04
2884.2 pH 5.5, 23% Sulfide 4.3 E+l

8.2 E+O
fl?
COPH
NaIO4 2.5 E+2
/ 00 NalOJ TSA
02 &j 5.2 E-2 I
- -
11.1
R N
R enhance
Metal cofactor complex ment
1
YA,
20811, CH,CN Linke 1.3
T~r H202,pH 6.6 *
2.6 E+2
66 ?b ec
TSA bPP)
-4
1.4
7GlZ-AlO-Gl -A12
pH 8.0, 10°C
I
Fe(lll), H202, 2.4 E+4 4.0 E+2 2.4 E+l
OH rnesoporphyrin 0
COzH COM
Metal cofactor complex
22. Reductions
--
"QiB o i
!2.1
I
2.9 E+:
NaBH,CN A5 bPP)
(1 mM) pH 5.0,2ZoC
de > 99 %
12.2
N N
Safranine T [O]
1 rnAb, flavin. dithionite
Safranine T [R]
0
Cofactor complex
Kd 8.0 E-3
A;::
12 Appendix 479
i2.3
3.0 E+3
1.2 E+O 6.0 E+l
6.0 E-1
1
HO 0
66D2 pH5.8.25"C
\ \ \
HO
I
12.4
02
R=Et
R = Et 37839.3
R = isopropyl NaCNBH, 50 mM NaBH3CN kuncat
R=Bn pH 5.0,Z"C 1.1 E-3
min-1
DHR
0.15 mM NaBH3CN
M.1
0 TSA
R = Et. 99 % S Kd 3.3 E-2
12.2 Key to Bibliography TRAMONTANO et a]., 1988; 2.11 SUGAet a].,

1994a;2.12 JANDA et al., 1991a;2.13 NAPPER et
A Hydrolytic and Dissociative Processes al., 1987;2.14 WIRSCHING et al., 1995;2.15 POL-
LACK et al., 1988.
1. Aliphatic Ester Hydrolysis
1.1SHENet al., 1992; 1.2 TANAKAet a]., 1996; 3. Carbonate Hydrolysis
1.3 3B9 LANDRY et al., 1993,15A10 YANGet 3.1 A SHOKAT et al., 1990,B JACOBSet al., 1987,
al., 1996, polyclonal BASMADJIAN et a]., 1995; C SPITZNAGEL et al., 1993; 3.2 POLLACK et al.,
1.4 NAKATANI et al., 1993; 1.5 IKEDA et al., 1986; 3.3 "Sheep no. 270" GALLACHER et al.,
1991; 1.6 FUJIIet al., 1991; 1.7 IWABUCHI et al., 1991, IV-CAT 2-6 STAHLet al., 1995; 3.4 WAL-
1994; 1.8 MIYASHITA et a]., 1993;1.9 KITAZUME LACE and IVERSON, 1996.
et al., 1994;1.10 CAMPBELL et al., 1994;1.11KI-
TAZUME et al., 1991a; 1.12 KITAZUME et al., 4. Carbamate Ester Hydrolysis
1991b;1.13 IKEDAand ACHIWA, 1997;1.14 JAN- 4.1 VANVRANKEN et al., 1994;4.2 WENTWORTH
DA et al., 1989,1990a;1.15 POLLACK et al., 1989; et a]., 1996;4.3 WENTWORTH et al., 1997.
1.16 A TAWFIKet al., 1993, B TAWFIK et al.,
1997); 1.17 JANDA et a]., 1994; 1.18 LI et al., 5. Amide Hydrolysis
1995b;1.19 IZADYDARet al., 1993. 5.1 MARTIN et al., 1994; 5.2 IVERSONand LER-
NER, 1989; 5.3 JANDA et al., 1988b; 5.4 BENE-
2. Aryl Ester Hydrolysis D E T ~ Iet al., 1996;5.5 GALLACHER et al., 1992;
2.1 SUGAet a]., 1994b;2.2 TAWFIK et al., 1990; 5.6 PAULet al., 1989; 5.7 LI et al., 1995a; 5.8
2.3 pH 8.7 Guo et al., 1994,pH 9.5 ZHOUet a]., PAULet a]., 1995.
1994;2.4 KHALAFet a]., 1992;2.5 A MARTIN et
al., 1991,B DURFOR et al., 1988;2.6 30C6 JAN- 6. Phosphate Ester Hydrolysis
DA et al., 1990b, 84A3 WADEet al., 1993,21A6 6.1 ROSENBLUM et al., 1995; 6.2 15C5 LAVEY
JANDA et al., 1991b; 2.7 KD2-260 OHKUBO et and JANDA, 1996a, 3H5 LAVEYand JANDA,
al., 1993, 7K16.2 SHOKATet al., 1990; 2.8 1996b;6.3 BRIMFIELD et al., 1993; 6.4 WEINER
NPN43C9 GIBBSet al., 1992a,Fab-1D CHENet et al., 1997;6.5 SHUSTER et al., 1992, GOLOLO-
al., 1993; 2.9 TRAMONTANO et al., 1986; 2.10 BOV et al., 1995;6.6 SCANLAN et a]., 1991.
7. Miscellaneous Hydrolyses C Bimolecular Associative and Substitution

7.1 37C4 IVERSONet al., 1990, polyclonal STE- Reactions
PHENS and IVERSON,1993; 7.2 Yu et al., 1994;
7.3 JANDA et al., 1997; 7.4 A REYMOND et al., 16. Aldol Reactions
1992, 1993, 1994, B REYMOND et al., 1991, C 16.1 KOCH et al., 1995; 16.2 WAGNERet al.,
SHABATet al., 1995, D SINHAet al., 1993b, E 1995; 16.3 A REYMOND and CHEN,1995a, B
SINHAet al.. 1993a. REYMOND and CHEN,1995b.
8. Eliminations 17. Diels-Alder Cycloaddition

8.1 CRAVA'IT et al., 1994;8.2 43D4-3D21, SHO- 17.1 HILVERT et al., 1989; 17.2 BRAISTED and
KAT et al., 1989,20A2F6 UNO and SCHULTZ, SCHULTZ, 1990;17.3 SUCKLING et al., 1993; 17.4
1992; 8.3 YOONet al., 1996; 8.4 THORNet al., trans MEEKELet al., 1995, cis RESMINI et al.,
1995;8.5 ZHOUet al., 1997. 1996; 17.5 7D4 and 22C8 GOUVERNEUR et al.,
1993,4D5 and 13G5 YLI-KAUHALUOMA et al.,
9. Decarboxylations 1995.
9.1 21D8 LEWISet al., 1991,25E10TARASOW et
al., 1994; 9.2 SMILEY and BENKOVIC, 1994; 9.3 18. Acyl Transfer Reactions
BJORNESTEDT et al., 1996; 9.4 ASHLEYet al., 18.1 JANDA et al., 1988a; 18.2 BENKOVIC et al.,
1993. 1988; 18.3 JACOBSENand SCHULTZ, 1994; 18.4
HIRSCHMANN et al., 1994, SMITHRUD et al.,
10. Cycloreversions 1997; 18.5 JACOBSEN et al., 1992; 18.6 A WIR-
10.1 BAHRet al., 1996; 10.2 A COCHRAN
et al., SCHING et al., 1991, B ASHLEYand JANDA,
1988,B JACOBSENet al., 1995. 1992;18.7 GRAMATIKOVA and CHRISTEN, 1996.
11. Retro-Henry and Retro-Aldol Reactions 19. Amination Reactions

11.1 FLANAGAN et al., 1996; 11.2 REYMOND,19.1 UNOet al., 1994; 19.2 TUBULet al., 1994;
1995. 19.3 COCHRAN et al., 1991.
20. Miscellaneous
B Intramolecular Processes 20.1 LI et al., 1995d;20.2 COOKet al., 1995;20.3
COCHRAN and SCHULTZ, 1990a, for a second
12. Zsomerizations example see KAWAMURA-KONISHI et al., 1996.
12.1 YLI-KAUHALUOMA et al., 1996; 12.2
JACKSONand SCHULTZ, 1991; 12.3 KHETTAL et
al., 1994; 12.4 UNOet al., 1996. D Redox Reactions
13. Rearrangements 21. Oxidations

13.1 BRAISTED and SCHULTZ, 1994, ULRICH et 21.1 HSIEHet al., 1994;21.2 KEINANet al., 1990;
al., 1996; 13.2 1F7 HILVERT et al., 1988, HIL- 21.3 KOCH et al., 1994; 21.4 COCHRAN and
VERT and NARED,1988,llF1-2Ell JACKSON et SCHULTZ, 1990b.
al., 1988; 13.3 2B4 GIBBSet al., 1992b, RG2-
23C7 LIOTTAet al., 1993;13.4 CHENet al., 1994; 22. Reductions
13.5 WILLNER et al., 1994. 22.1 NAKAYAMA and SCHULTZ, 1992;22.2 SHO-
KAT et al., 1988;22.3 JANJICand TRAMONTANO,
14. Epoxide Opening 1989;22.4 HSIEHet al., 1993.
14.1 1.JANDA et al., 1993, SHEVLIN
et al., 1994,
2. JANDA et al.. 1995.
15. Cationic Cyclization

15.1 TX1-4C6 LI et al., 1994,TMI 87D7 LI et
al., 199%; 15.2 LI et al., 1996; 15.3 HASSERODT
et al., 1996; 15.4 HASSERODT et al., 1997.
13 References 481
13 References BARTLEIT,P. A., MARLOWE, C. K. (1983), Phosphon-

amidates as transition state analogue inhibitors of
thermolysin, Biochemistry 22,461-624.
ADDADI, L., JAFFI, E. K., KNOWLES, J. R. (1983), Se- BASMADJIAN, G. l?, SINGH,S., SASTRODJOJO, B.,
condary tritium isotope effects as probes of the SMITH,B. T.,AvoR, K. S. et al. (1995), Generation
enzymic and nonenzymic conversion of choris- of polyclonal catalytic antibodies against cocaine
mate to prephenate, Biochemistry 22,4494-4501. using transition state analogs of cocaine conjuga-
ALBERG,D. G., LAUHON, C. T., NYFELER, R., FASS- ted to diptheria toxoid, Chem. Pharm. Bull. 43,
LER, A., BARTLETT, P. A. (1992), Inhibition of 1902-191 1.
EPSP synthase by analogues of the tetrahedral BENEDETTI, F., BERTI,F.,COLOMBATTI,A., EBERT,C.,
intermediate and of EPSP,J.Am. Chem. SOC. 114, LINDA,P., TONIZZO,F. (1996), anti-Sulfonamide
3535- 3546. antibodies catalyse the hydrolysis of a heterocyc-
ALBERY, W. J. (1993),Transition state theory revisit- lic amide, Chem. Commun. 1417-1418.
ed, Adv. Phys. Org. Chem. 28,139-170. BENKOVIC, S. J., NAPPER,A.D.,LERNER, R. A. (1988),
ALBERY,J., KNOWLES, J. R. (1976), Evolution of Catalysis of a stereospecific bimolecular amide
enzyme function and development of catalytic synthesis by an antibody, Proc. Natl. Acad. Sci.
efficiency,Biochemistry 15,5631-5640. USA 85,5355-5358.
ALBERY, J., KNOWLES, J. R. (1977), Efficiency and BJ~RNESTEDT, R., ZHONG,G., LERNER,R. A., BAR-
evolution of enzyme catalysis,Angew. Chem. (Znt. BAS 111, C. F. (1996), Copying nature’s mechanism
Edn. Engl.) 16,285-293. for the decarboxylation of p-keto acids into cata-
ASHLEY, J. A., JANDA,K. D. (1992), Antibody cataly- lytic antibodies by reactive immunization, J. Am.
sis in low water content media, J. Org. Chem. 57, Chem. SOC.118,11720-11724.
6691-6693. BLAKEY, D. C. (1992), Drug targeting with monoclo-
ASHLEY, J. A., Lo, C.-H. L., MCELHANEY, G. P., WIR- nal antibodies - a review, Acta Oncologica, 31,
SCHING, P., JANDA,K. D. (1993), A catalytic anti- 91-97.
body model for PLP-dependent decarboxylases, BLAKEY, D. C., BURKE,P. J., DAVIES, D. H., DOWELL,
J. Am. Chem. SOC.115,2515-2516. R. I., MELTON, R. G. et al. (1995),Antibody-direc-
BAGSHAWE, K. D. (199O), Antibody-directed enzy- ted enzyme prodrug therapy (ADEPT) for treat-
me/prodrug therapy (ADEPT), Biochem. SOC. ment of major solid tumour disease, Biochem.
Trans.18,750-752. SOC. Trans.23,1047-1050.
BAHR,N., GULLER,R., REYMOND, J.-L., LERNER,R. BLOKZIJL, W., ENGBERTS, J. B. F. N. (1994), Enforced
A. (1996),A nitroxyl synthase catalytic antibody, hydrophobic interactions and hydrogen-bonding
J.Am. Chem. SOC. 118,3550-3555. in the acceleration of Diels-Alder reactions in
BALDWIN, J. E. (1976), Approach vector analysis: A water, ACS Symp. Series 568,303-317.
stereochemical approach to reactivity, J. Chem. BOWMAN, W. C., RAND,M. J. (1988), Textbook of
SOC.Chem. Commun. 738-741. Pharmacology. Oxford: Blackwell Scientific Pu-
BALDWIN, J. E., CHESWORTH, R., PARKER,J. S., Rus- blications.
SELL,A. T. (1995), Studies towards a postulated BRAISTED, A. C., SCHULTZ, P. G. (1990), An Antibo-
biomimetic Diels-Alder reaction for the synthe- dy-Catalyzed bimolecular Diels-Alder reaction,
sis of himgravine, Tetrahedron Lett. 36, 9551- J. Am. Chem. SOC.112,743Ck7431.
9554. BRAISTED,A.C., SCHULTZ, l? G. (1994),An antibody-
BALDWIN, J. E., CLARIDGE, T. D. W., CULSHAW, A. J., catalyzed oxy-Cope rearrangement, J. Am. Chem.
HEUPEL,F. A,, LEE,V.et al. (1998),Investigations SOC.116,2211-2212.
into the manzamine alkaloid biosynthesis hypo- BRIMFIELD, A. A., LENZ,D. E., MAXWELL,D. M.,
thesis, Angew. Chem. (Znt. Edn. Engl.) 37,2661- BROOMFIELD, C. A. (1993), Catalytic antibodies
2663. hydrolysing organophosphorus esters, Chemico-
BARTLETT, P. A., GIANGIORDANO, M. A. (1996), Biological Znteractions - England 87,95-102.
Transition-state analogy of phosphonic acid pep- BURTON,D. R. (1990), Antibody: The flexible ad-
tide inhibitors of pepsin, J. Org. Chem. 61,3433- aptor molecule, Trends Biochem. Sci. 15,64-69.
3438. CAMPBELL, D. A., GONG,B., KOCHERSPERGER, L. M.,
BARTLETT, P. A., JOHNSON, C. R. (1985),An inhibitor YONKOVICH, S., GALLOP,M. A., SCHULTZ, P. G.
of chorismate mutase resembling the transition- (1994), Antibody-catalyzed prodrug activation, J.
state conformation, J. Am. Chem. SOC.107,7792- Am. Chem. SOC.116,2165-2166.
7793. CHARBONNIER, J.-B., CARPENTER,E., GIGANT,B.,
BARTLETT, P. A,, LAMDEN, L. A. (1986), Inhibition of GOLINELLI-PIMPANEAU, B., ESHHAR,Z. et al.
chymotrypsin by phosphonate and phosphonami- (1995), Crystal structure of the complex of a cata-
date peptide analogs, Bioorg. Chem. 14,356-377. lytic antibody Fab fragment with a transition-sta-
te analog - structural similarities in esterase-like 6013-6014.

catalytic antibodies, Proc. Natl. Acad. Sci. USA DANISHEFSKY, S., HERSHENSON, F. M. (1979), Regio-
92,11721-11726. specific synthesis of isogabaculine,J. Org. Chem.
CHARBONNIER, J.-P., GOLINELLI-PIMPANEAU, B., GI- 44,1180-1181.
GANT, B., TAWFIK,D. s., CHAP,R. et al. (1997), DAITA, A., PARTRIDGE, L. J., BLACKBURN, G. M.
Structural convergence in the active sites of a fa- (1996), European network on antibody catalysis
mily of catalytic antibodies, Science 275, 1140- 1993-1995. Brussels, Luxembourg, CSC-EC-EA-
1142. EC, 36.
CHEN,Y.-C. J., DANON,T., SASTRY, L., MUBARAKI, M., DAVIDSON, M. M., HILLIER, I. H. (1994), Claisen rear-
JANDA, K. D., LERNER,R. A. (1993), Catalytic an- rangement of chorismic acid and related analo-
tibodies from combinatonal libraries, J. Am. gues: An ab initio molecular orbital study, J.
Chem. SOC.115,357-358. Chem. SOC.Perkin Trans. II, 1415-1417.
CHEN,Y., REYMOND, J.-L., LERNER, R. A. (1994), An DE LAUZON, S., DESFOSSES, B., MANSUY, D., MAHY,J.-
antibody-catalyzed 1,2-rearrangement of carb- P. (1999), Studies of the reactivity of artificial per-
on-carbon bonds, Angew. Chem. (Znt.Edn. Engl.) oxidase-like hemoproteins based on antibodies
33,1607-1609. elicited against a specifically designed ortho-car-
CHOOK,Y. M., KE, H. M., LIPSCOMB, W. N. (1993), boxy substituted tetraarylporphyrin, FEBS Lett.
Crystal sturctures of the monofunctional choris- 443,229-234.
mate mutase from Bacillus subtilis and its com- DELL,C. P. (1997), Cycloadditions in synthesis, Con-
plex with a transition state analog, Proc. Natl. temp. Org. Synth. 487-117.
Acad. Sci. USA 90, 8600-8603. DURFOR,C. N., BOLIN,R. J., SUGASAWARA, R. J.,
CHOOK,~. M., GRAY,J. V., KE, H. M. L., LIPSCOMB, W. MASSEY, R. J., JACOBS, J. W., SCHULTZ, P. G. (1988),
N. (1994), The monofunctional chorismate muta- Antibody catalysis in reverse micelles, J. Am.
se from Bacillus subtilis - structure determination Chem. SOC.110,8713-8714.
of chorismate mutase and its complexes with a ERSOY,O., FLECK,R., SINSKEY, A., MASUMUNE, S.
transition-state analog and prephenate and impli- (1998), Antibody catalyzed cleavage of an amide
cations for the mechanism of enzymatic reaction, bond using an external nucleophilic cofactor, J.
J. Mol. Biol. 240,476500. Am. Chem. SOC.120,817-818.
CIOBANU, M., MATSUMOTO, K. (1997), Recent advan- ESCHENMOSER,A., RUZICKA, L., JEGER,O.,ARIGONI,
ces in organic synthesis under high pressure, Lie- D. (1955), Eine stereochemische Interpretation
bigs Ann. Chem.4,623-635. der biogenetischen Isoprenregel bei den Triterpe-
COCHRAN, A. G., SCHULTZ, P. G. (1990a), Antibody- nen, Helvet. Chim.Acta 38,189&1904.
catalysed porphyrin metallation, Science, 249, EVANS,M. G., POLANYI,M. (1935), Some applica-
781- 783. tions of the transition state method to the calcula-
COCHRAN, A. G., SCHULTZ, P. G. (1990b), Peroxidase tion of reaction velocities, especially in solution,
activity of an antibody-heme complex, J. Am. Trans. Faraday SOC.31,875-894.
Chem. SOC.112,9414-9415. EYRING,H. (1935), The activated complex and the
COCHRAN, A. G., SUGASAWARA, R., SCHULTZ, P. G. absolute rate of chemical reactions, Chem. Rev.
(1988), Photosensitized cleavage of a thymine di- 17,65-77.
mer by an antibody,J. Am. Chem. SOC.110,7888- FENNIRI, H., JANDA, K. D., LERNER, R. A. (1995), En-
7890. coded reaction cassette for the highly sensitive
COCHRAN,A. G., PHAM,T., SUGASAWARA, R., detection of the making and breaking of chemical
SCHULTZ, P. G. (1991), Antibody-catalyzed bi- bonds, Proc. Natl. Acad. Sci. USA 92,2278-2282.
molecular imine formation, J. Am. Chem. SOC. FERSHT,A. F. (1985), Enzyme Structure and Mecha-
113,667M672. nism,pp. 98-154. New York: Freeman.
COOK,C. E.,ALLEN,D. A., MILLER, D. B., WHISNANT, FINN, M. G., LERNER, R. A., BARBAS Ill, C. F. (1998),
C. C. (1995), Antibody-Catalyzed Michael reac- Cofactor-induced refinement of catalytic anti-
tion of cyanide with an cy,&msaturated ketone, J. body activity: A metal-specific allosteric effect, J.
Am. Chem. SOC.117,7269-7270. Am. Chem. SOC.120,2963-2964.
CRANS,D. C., FELTY,R. A., MILLER,M. M. (1991), FLANAGAN, M. E., JACOBSEN, J. R., SWEET,E.,
Cyclic vanadium(V) alkoxide: An analogue of the SCHULTZ, P. G. (19%), Antibody-catalyzed retro-
ribonuclease inhibitors, J. Am. Chem. SOC. 113, aldol reaction,J. Am. Chem. SOC. 118,607843079.
265-269. FUJII,I., LERNER,R.A., JANDA, K. D. (1991), Enan-
CRAVAIT,B. F., ASHLEY, J. A., JANDA, K. D., BOGER, tiofacial protonation by catalytic antibodies, J.
D. L., LERNER,R. A. (1994), Crossing extreme Am. Chem. SOC.113,852843529.
mechanistic barriers by antibody catalysis: Syn FUJII,I., TANAKA, F., MIYASHITA, H., TANIMURA, R.,
elimination to a cis olefin, J. Am. Chem. SOC.116, KINOSHITA, K. (1995), Correlation between anti-
13 References 483
gen-combining-site structures and functions wit- the combining site of antibody against a hapten
hin a panel of catalytic antibodies generated bearing a positive charge, J. Am. Chem. SOC. 82,
against a single transition state analog, J. Am. 5478-5482.
Chem. SOC.117,6199-6209. GUO,J., HUANG, W., SCANLAN, T. S. (1994), Kinetic
GALLACHER, G., JACKSON, C. S., TOPHAM, C. M., SE- and mechanistic characterization of an efficient
ARCEY, M.,TuRNER,B. C. et al. (1990), Polyclonal- hydrolytic antibody: Evidence for the formation
antibody-catalysed hydrolysis of an aryl nitro- of an acyl intermediate, J. Am. Chem. SOC.116,
phenyl carbonate, Biochem. SOC.Trans. 18, 600- 6062-6069.
601. HALAZY, S., BERGES,V., ERHARD, A., DANZIN, C.
GALLACHER, G., JACKSON, C. S., SEARCEY, M., BAD- (1992), Difluoromethylphenyl glycosides as suici-
MAN,G. T., GOEL,R. et al. (1991), A polyclonal de substrates for glycosidases,Bioorg. Chem. 18,
antibody preparation with Michaelian catalytic 330-335.
properties, Biochem. J. 279,8714381. HAMMOND, G. S. (1955),A correlation of reaction ra-
GALLACHER, G., SEARCEY,M., JACKSON,C. S., tes,J. Am. Chem. SOC.77,334-338.
BROCKLEHURST, K. (1992), Polyclonal antibody- HASSERODT, J., JANDA, K. D., LERNER, R. A. (1996),
catalysed amide hydrolysis, Biochem. J . 284, Antibody catalyzed terpenoid cyclization,J. Am.
675-680. Chem. SOC.118,11654-11655.
GAO,C., LAVEY,B. J., Lo, C. H. L., DATTA, A., WENT- HASSERODT, J., JANDA, K. D., LERNER, R. A. (1997),
WORTH JR., P., JANDA, K. D. (1998), Direct selec- Formation of bridge-methylated decalins by anti-
tion for catalysis from combinatorial antibody li- body-catalyzed tandem cationic cyclization, J.
braries using a boronic acid probe: primary amide Am. Chem. SOC.119,5993-5998.
bond hydrolysis, J. Am. Chem. SOC. 120,2211- HAYNES, M. R., STURA, E. A., HILVERT, D., WILSON, I.
2217. A. (1994), Routes to catalysis: Structure of a cata-
GIBBS,R. A., BENKOVIC, P.A., JANDA, K. D., LERNER, lytic antibody and comparison with its natural
R. A., BENKOVIC, S. J. (1992a), Substituent effects counterpart, Science 263,646-652.
on an antibody catalyzed hydrolysis of phenyl HEINE,A., STURA,E. A., YLI-KAUHALUOMA, J. T.,
GAO,C. C., DENG,Q. L. et al. (1998),An antibod
esters: Further evidence for an acyl-antibody in-
termediate,J. Am. Chem. SOC.114,3528-3534. eno-Diels-Alderase inhibitor complex at 1.95 ‘l
GIBBS, R.A.,TAYLoR,S., BENKOVIC, S. J. (1992b),An- resolution, Science 279, No. 5358,1934-1940.
tibody-catalysed rearrangement of the peptide HENDRY, I?, SARGESON, A. M. (1990), Metal-ion pro-
bond, Science 258,803-805. moted reactions of phosphate derivatives, Progr.
GIGANT,B., CHARBONNIER, J.-B., ESHHAR,Z., Inorg. Chem.38,201-258.
GREEN, B. S., KNOSSOW, M. (1997), X-ray structu- HILVERT,D., NARED,K. D. (1988), Stereospecific
res of a hydrolytic antibody and of complexes elu- Claisen rearrangement catalyzed by an antibody,
cidate catalytic pathway from substrate binding J. Am. Chem. SOC.110,5593-5594.
and transition state stabilization through water HILVERT, D., CARPENTER, S. H., NARED, K. D.,AuDI-
attack and product release, Proc. Natl. Acad. Sci. TOR, M.-T. M. (1988), Catalysis of concerted reac-
USA 94,7857-7861. tions by antibodies: The Claisen rearrangement,
GOLINELLI-PIMPANEAU, B., GIGANT, B., BIZEBARD,T., Proc. Natl. Acad. Sci. USA 85,4953-4955.
NAVAZA, J., SALUDJIAN, P. et al. (1994), Crystal HILVERT, D., HILL,K. W., NARED,K. D., AUDITOR,
structure of a catalytic antibody with esterase- M.-T. M. (1989), Antibody catalysis of a
like activity,Structure 2,175-183. Diels-Alder reaction, J. Am. Chem. SOC. 111,
GOLOLOBOV, G. V., CHERNOVA, E. A., SCHOUROV, D. 9261-9262.
V., SMIRNOV, I.V., KUDELINA, I. A., GABIBOV,A. G. HIRSCHMANN, R., SMITH111, A. B., TAYLOR, C. M.,
(1995), Cleavage of supercoiled plasmid DNA by BENKOVIC, P. A., TAYLOR, S. D. et al. (1994), Pep-
autoantibody Fab fragment: Application of the tide synthesis catalyzed by an antibody contai-
flow linear dichroism technique, Proc. Natl. Acad. ning a binding site for variable amino acids,Scien-
Sci. USA 92,254-257. ce 265,236237.
GOUVERNEUR, V. E., HOUK,K. N., DE PASCUAL-TE-HOLLFELDER, F., KIRBY,A. J., TAWFIK,D. S. (1996),
RESA,B., BENO,B., JANDA, K. D., LERNER, R. A. “Off-the-shelf” proteins that rival tailor-made
(1993), Control of the en0 and endo pathways of antibodies as catalysts,Nature 353, M 3 .
the Diels-Alder reaction by antibody catalysis, HOUK,K. N., GONZALES, J., LI, Y. (1995), Pencyclic
Science 262,204-208. reaction transition states: passions and punctilios,
GRAMATIKOVA, S. I., CHRISTEN, P. (1996), Pyridoxal 1935-1995, Acc. Chem. Res. 28,81-90.
5 ‘-phosphate-dependent catalytic antibody, J. HSIEH,L. C., YONKOVICH, S., KOCHERSPERGER, L.,
Biol. Chem.271,30583-30586. SCHULTZ, P. G. (1993), Controlling chemical reac-
GROSSBERG, A. L., B PRESSMAN, D. (1960), Nature of tivity with antibodies, Science 260,337-339.
HSIEH,L. C., STEPHANS, J. C., SCHULTZ, P. G. (1994), photocleavage,J. Am. Chem. SOC.117,5453-5461.
An efficient antibody-catalyzed oxygenation re- JANDA,K. D., LERNER,R. A., TRAMONTANO, A.
action, J. Am. Chem. SOC.116,2167-2168. (1988a),Antibody catalysis of bimolecular amide
ICHIHARA, A., OIKAWA, H. (1998), Diels-Alder type formation, J. Am. Chem. SOC.110,48354337.
natural products - Structures and biosynthesis, JANDA, K. D., SCHLOEDER, D., BENKOVIC, S. J., LER-
Curr. Org. Chem. 2,365-394. NER, R. A. (1988b), Induction of an antibody that
IKEDA,K., ACHIWA, K. (1997), Antibody-mediated catalyzes the hydrolysis of an amide bond, Scien-
regio- and enantioselective resolution of a glyce- ce 241,1188-1191.
rol derivative, Bioorg. Med. Chem. Lett. 7, 225- JANDA, K. D., BENKOVIC, S. J., LERNER, R. A. (1989),
228. Catalytic antibodies with lipase activity and R or
IKEDA, S.,WEINHOUSE, M. I., JANDA, K. D., LERNER, S substrate selectivity,Science 244,437-440.
R. A. (1991),Asymmetric induction via a catalytic JANDA, K. D., ASHLEY, J. A., JONES,T. M., MCLEOD, D.
antibody,J. Am. Chem. SOC.113,7763-7764. A., SCHLOEDER, D. M.,WEINHOUSE, M. I. (1990a),
IVERSON, B. L., LERNER, R. A. (1989), Sequence-spe- Immobilized catalytic antibodies in aqueous and
cific peptide cleavage catalyzed by an antibody, organic solvents, J. Am. Chem. SOC. 112,
Science 243,1184-1189. 8886-8888.
IVERSON, B. L., CAMERON, K. E., JAHANGIRI, G. K., JANDA, K. D., WEINHOUSE, M. I., SCHLOEDER, D. M.,
PASTERNAK, D. S. (1990), Selective cleavage of tri- LERNER, R. A., BENKOVIC, S. J. (1990b), Bait and
tyl protecting groups catalyzed by an antibody, J. switch strategy for obtaining catalytic antibodies
Am. Chem. SOC.112,532Q-5323. with acyl-transfer capabilities,J. Am. Chem. SOC.
IWABUCHI,~., MIYASHITA, H.,TANIMURA, R., KINOS- 112,1274-1275.
HITA, K., KIKUCHI, M., F ~ J I 1.
I , (1994), Regio- and JANDA,K. D., BENKOVIC, S. J., MCLEOD,D. A.,
stereoselective deprotection of acylated carbo- SCHLOEDER, D. M., LERNER, R. A. (1991a), Sub-
hydrates via catalytic antibodies, J. Am. Chem. strate attenuation: An approach to improve anti-
SOC.116,771-772. body catalysis, Tetrahedron47,2503-2506.
IZADYAR, L., FRIBOULET, A., REMY,M. H., ROSETO, JANDA, K. D., WEINHOUSE, M. I., DANON,T., PACELLI,
A., THOMAS, D. (1993),Monoclonal anti-idiotypic K. A., SCHLOEDER, D. M. (1991b), Antibody bait
antibodies as functional internal images of enzy- and switch catalysis:A survey of antigens capable
me active sites: Production of catalytic antibody of inducing abzymes with acyl-transfer pro-
with a cholinesterase activity, Proc. Natl. Acad. perties, J. Am. Chem. SOC.113,5427-5434.
Sci. USA 90,8876-8880. JANDA, K. D., SHEVLIN, C. G., LERNER, R. A. (1993),
JACKSON, D. Y., SCHULTZ, P. G. (1991), An antibody- Antibody catalysis of a disfavored chemical
catalyzed cis-trans isomerization reaction, J. Am. transformation, Science 259,490-493.
Chem. SOC.ll3,2319-2321. JANDA, K. D., Lo, C.-H. L., Lr, T., BARBAS 111, C. F.,
JACKSON, D. Y., JACOBS,J. W., SUGASAWARA, R., WIRSCHING, P., LERNER, R. A. (1994), Direct se-
REICH,S. H., BARTLE-IT,P. A., SCHULTZ, P. G. lection for a catalytic mechanism from combina-
(1988),An antibody-catalyzed Claisen rearrange- tonal antibody libraries, Proc. Natl. Acad. Sci.
ment, J.Am. Chem. SOC.110,48414842. USA 91,2532-2536.
JACKSON, D. Y., PRUDENT, J. R., BALDWIN, E. P., JANDA, K. D., SHEVLIN, C. G., LERNER, R. A. (1995),
SCHULTZ, P. G. (1991), A mutagenesis study of a Oxepane synthesis along a disfavored pathway:
catalytic antibody, Proc. Natl. Acad. Sci. USA 88, The rerouting of a chemical reaction using a cata-
5M2. lytic antibody,J. Am. Chem. SOC.117,2659-2660.
JACOBS, J. W. (1991), New perspectives on catalytic JANDA,K. D., Lo, L.-C., Lo, C.-H. L., SIM, M.-M.,
antibodies, Bio. Technology 9,258-262. WANG,R. et al. (1997), Chemical selection for ca-
JACOBS, J., SCHULTZ, P. G., SUGASAWARA, R., POWELL, talysis in combinatonal antibody libraries, Scien-
M. (1987), Catalytic antibodies,J. Am. Chem. SOC. ce 275,945-948.
109,2174-2176. JANJIC,N.,%AMONTANO, A. (1989), Antibody-cat-
JACOBSEN, J. R., SCHULTZ, P. G. (1994), Antibody ca- alyzed redox reaction, J. Am. Chem. SOC. 111,
talysis of peptide bond formation, Proc. Natl. 9109-9110.
Acad. Sci. USA 91,5888-5892. JENCKS, W. P.(1969), Mechanisms for catalysis and
JACOBSEN, J. R., PRUDENT, J. R., KOCHERSPERGER, L., carbonyl and acyl-group reactions, in: Catalysis in
YONKOVICH, S., SCHULTZ, P. G. (1992),An efficient Chemistry and Enzymology, pp. 3-6 and 523-537.
antibody-catalyzed aminoacylation reaction, New York: McGraw Hill.
Science 256,365-367. JENCKS, W. P. (1975), Binding energy, specificity and
JACOBSEN, J. R., COCHRAN, A. G., STEPHANS, J. C., enzyme catalysis: the circe effect, Adv. Enzymol.
KING,D. S., SCHULTZ, P. G. (1995). Mechanistic Relat. Areas Mol. Biol. 43.219-410.
studies of antibody-catalyzed pyrimidine dimer JOHNSON, W. S. (1968), Non-enzymic biogenetic-like
I3 References 485
olefinic cyclisations,Acc. Chem. Res. 1,143. tibody catalysis of multistep reactions: An aldol
KAST, I?, ASIF-ULLAH, M., JIANG, N., HILVERT, D. addition followed by a disfavored elimination, J.
(1996), Exploring the active site of chorismate Am. Chem. SOC.117,9383-9387.
mutase by combinatorial mutagenesis and selec- KOHLER,G., MILSTEIN, C. (1975), Continuous cultu-
tion: The importance of electrostatic catalysis, res of fused cells secreting antibody of predefined
Proc. Natl. Acad. Sci. USA 93,5043-5048. specificity,Nature 256,495497.
KATAYAMA,K., KOBAYASHI, T., OIKAWA, H., HOMA, KOHLER,G., MILSTEIN, C. (1976), Derivation of spe-
M., ICHIHARA, A. (1998), Enzymatic activity and cific antibody-producing tissue culture and tu-
partial purification of solanapyrone synthase: mour lines by cell fusion, Eur. J. Immunol. 6,
first enzyme catalysing Diels-Alder reaction, 511-519.
Biochim. Biophys. Acta 1384,387-395. KOHLER, G.,HOWE,S. C.,MILSTEIN, C. (1976),Fusion
KAWAMURA-KONISHI, Y., HOSOMI, N., NEYA,S., Su- between immunoglobulin-secreting and non-
GANO, s.,FUNASAKI, N., SUZUKI,H. (1996),Kinetic secreting myeloma cell lines, Eur. J. Immunol. 6,
characterization of antibody-catalyzed insertion 292-295.
of a metal ion into porphyrin, J. Biochem. 119, LANDRY, D. W., ZHAO,K., YANG,G. X.-Q., GLICK-
857-862. MAN, M., GEORGIADIS, M. (1993), Antibody-cata-
KEINAN,E., SINHA,S. C., SINHA-BAGCHI,A., BENORY, lyzed degradation of cocaine, Science 259,
E., GHOZI, M. C. et al. (1990), Towards antibody- 1899-1901.
mediated metallo-porphyrin chemistry, Pure LAVEY,B. J., JANDA, K. D. (1996a), Antibody cataly-
Appl. Chem.62,2013-2019. zed hydrolysis of a phosphotriester, Bioorg. Med.
KEMP,D. S., Cox, D. D., PAUL,K. G. (1975),The phy- Chem. Lett. 6,1523-1524.
sical organic chemistry of benzisoxazoles. IV. The LAVEY, B. J., JANDA,K. D. (1996b), Catalytic antibody
origins and catalytic nature of the solvent rate ac- mediated hydrolysis of Paraoxon, J. Org. Chem.
celeration for the decarboxylation of 3-carboxy- 61,7633-7636.
benzisoxazoles,J.Am. Chem. SOC.97,7312-7318. LEE,A. Y., STEWART, J. D., CLARDY, J., GANEM,B.
KHALAF,A. I., PROCTOR,G. R., SUCKLING, C. J.,BEN- (1995), New insight into the catalytic mechanism
CE, L. H., IRVINE, J. I., STIMSON, W. H. (1992), Re- of chorismate mutases from structural studies,
markably efficient hydrolysis of a 4-nitrophenyl Chem. Biol. 2,195-203.
ester by a catalytic antibody raised to an ammoni- LERNER,R. A., BAREIAS 111, C. F. (1996), Using the
um hapten, J. Chem. SOC.Perkin Trans. I, 1475- process of reactive immunisation to induce cata-
1481. lytic antibodies with complex mechanisms: Aldo-
K H E ~ A B.,
L , DE LAUZON, S., DESFOSSES, B., USHIDA, lases,Acta Chim. Scand. 50,672-678.
S., MARQUET, A. (1994), A catalytic antibody iso- LEWIS,C., KRAMER, T., ROBINSON, S., HILVERT,D.
merizing a As-3-ketosteroid,C. R. Acad. Sci. Paris, (1991), Medium effects in antibody-catalyzed re-
Life Sciences 317,381-385. actions,Science 253,1019-1022.
KIRBY,A. J. (1980), Effective molarities for intra- Lr,T.,JANDA,K. D. (1995), Synthesisof a bifunctional
molecular reactions, Adv. Phys. Org. Chem. 17, hapten designed to mimic both transition state
183-278. and to induce “Bait and Switch”catalysis, Bioorg.
KIRBY, A. J. (1996),The potential of catalyic antibo- Med. Chem. Lett. 5,2001-2004.
dies, Acta Chim. Scand. 50,203-210. LI, T., JANDA, K. D., ASHLEY, J. A., LERNER,R. A.
KITAZUME,T., LIN,J. T.,YAMAMOTO,T.,YAMAZAKI,T. (1994), Antibody-catalyzed cationic cyclization,
(1991a), Antibody-catalyzed double stereoselec- Science 264,1289-1293.
tion in fluorinated materials, J. Am. Chem. SOC. Lr, L., PAUL,S., TYUTYULKOVA, S., KAZATCHKINE,
113,8573-8575. M. D., KAVERI,S. (1995a), Catalytic activity of
KITAZUME, T., LIN,J. T., TAKEDA, M., YAMAZAKI, T. anti-thyroglobulin antibodies, J. Immunol. 3328-
(1991b), Stereoselective synthesis of fluorinated 3332.
materials by an antibody, J. Am. Chem. SOC.113, Lr,T.,HILTON, S., JANDA, K. D. (1995b),The potential
2123-2126. application of catalytic antibodies to protecting
KITAZUME, T., TSUKAMOTO, T., YOSHIMURA, K. group removal: Catalytic antibodies with broad
(1994), A catalytic antibody elicited by a hapten substrate tolerance, J. Am. Chem. SOC. 117,
of tetrahedral carbon-type, J. Chem. SOC. Chem. 2123-2127.
Commun.1355-1356. LI,T., HILTON, S., JANDA, K. D. (1995c), Remarkable
KOCH,A.,REYMOND, J.-L.,LERNER,R.A. (1994),An- ability of different antibody catalysts to control
tibody-catalyzed activation of unfunctionalized and diversify the product outcome of cationic cy-
olefins for highly enantioselective asymmetric clization reactions, J. Am. Chem. SOC.117,3308-
epoxidation, J. Am. Chem. SOC.116,803-804. 3309.
KOCH,T., REYMOND, J.-L.,LERNER, R. A. (1995),An- LI, T., JANDA,K. D., HILTON,S., LERNER,R. A.
(1995d), Antibody catalyzed nucleophilic substi- using a chain-shuffling approach, Bioorg. Med.
tution reaction at a primary carbon that appear to Chem.5,581-590.
proceed by an ionisation mechanism, J. Am. MIYASHITA, H., KARAKI,Y., KIKUCHI,M., FUJII,I.
Chem. SOC.117,2367-2368. (1993), Prodrug activation via catalytic anti-
LI, T., JANDA,K. D., LERNER,R. A. (1996), Cationic bodies, Proc. Natl. Acad. Sci. USA 90,5337-5340.
cyclopropanation by antibody catalysis, Nature NA,J., HOUK,K. N. (1996),Predicting antibody cata-
379,326-327. lyst selectivity from optinum binding of catalytic
LI,T., LERNER, R. A., JANDA, K. D. (1997),Antibody- groups to a hapten, J. Am. Chem. SOC.118,9204-
catalyzed cationic reactions: Rerouting of chemi- 9205.
cal transformations via antibody catalysis, Acc. NAKATANI, T., HIRATAKE, J., SHINZAKI, A., UMESHI-
Chem. Res. 30,115-121. TA, R., SUZUKI, T. et al. (1993),A mode of inhibi-
LIENHARD, G. E. (1973), Enzymatic catalysis and tion of an esterolytic antibody, Tetrahedron Lett.
transition-state theory, Science 180,149-154. 34,49454948.
LIOTTA,L. J., BENKOVIC, P.A., MILLER, G. P., BENKO- NAKAYAMA, G. R., SCHULTZ, P.G. (1992), Stereospe-
VIC,S. J. (1993), A catalytic antibody for imide cific antibody-catalyzed reduction of an a-keto
hydrolysis featuring a bifunctional transition-sta- amide,J. Am. Chem. SOC.114,780-781.
te mimic,J. Am. Chem. SOC.115,350-351. NAPPER,A. D., BENKOVIC, S. J., TRAMONTANO, A.,
LIOTTA,L. J., GIBBS,R. A.,TAYLOR, S. D., BENKOVIC, LERNER, R. A. (1987),A stereospecific cyclisation
l? A., BENKOVIC, S. J. (1995), Antibody-catalyzed catalysed by an antibody,Science 237,1041-1043.
rearrangement of a peptide bond: mechanistic OHKUBO, K., URATA,~., SERI,K., ISHIDA, H., SAGA-
and kinetic investigations,J. Am. Chem. SOC.117, WA,T.et al. (1993),The catalytic activities of IgG
4729-4741. and IgM monoclonal antibodies for the hydroly-
LOFAS,S., JOHNSON,B. (1990),A novel hydrogel ma- sis of p-nitrophenyl acetate, Chem. Lett. 6,1075-
trix on gold surfaces in surface plasmon resonan- 1078.
ce sensors for fast and efficient covalent immobi- OIKAWA, H., YAGI,K., WATANABE, K., HONMA, M.,
lisation of ligands,J. Chem. SOC.Chem. Commun. ICHIHARA, A. (1997), Biosynthesis of macropho-
15261528. mic acid: plausible involvement of intramolecular
MADER, M. M., BARTLETT, P. A. (1997),Binding ener- Diels-Alder reaction, J. Chem. Soc., Chem. Com-
gy and catalysis: the implications for transition mun.97-98.
state analogs and catalytic antibodies, Chem. Rev. OIKAWA, H., KOBAYASHLT., KATAYAMA, K., SUZUKI,
97,1281-1301. Y., ICHIHARA,A. (1998), Total synthesis of
MARCH, J. (1992a), Determination of the presence of ( - )-solanapyrone via enzymatic Diels-Alder re-
an intermediate, in: Advanced Organic Chemis- action of prosolanapyrone, J. Org. Chem. 63,
try: Reactions Mechanisms and Structure, pp. 874843756.
217-219. New York: John Wiley & Sons. OIKAWA, H., SUZUKI, Y., KATAYAMA, K., NAYA,A.,
MARCH,J. (1992b), Addition to carbon-carbon mul- SAKANO, C., ICHIHARA,A. (1999), Involvement of
tiple bonds, in: Advanced Organic Chemistry:Re- the Diels-Alder reaction in the biosynthesis of
actions Mechanisms and Structure, pp. 839-852. secondary natural products: the late stages of the
New York: John Wiley & Sons. biosynthesis of the phytotoxins, solanapyrones,J.
MARTIN, M. T., NAPPER,A. D., SCHULTZ, P. G., REES, Chem. Soc., Perkin Trans. I, 1225-1232.
A. R. (1991),Mechanistic studies of a tyrosine-de- PADLAN, E. A., COHEN,G. H., DAVIES, D. R. (1985),
pendent catalytic antibody, Biochemistry 30, On the specificity of antibody 3-antigen interac-
9757-9761. tions - phosphocholine binding to MCPC603 and
MARTIN,M. T., ANGELES, T. S., SUGASAWARA, R., the correlation of 3-dimensional structure and se-
AMAN,N. I., NAPPER,A. D. et al. (1994), Anti- quence data, Annales de l’lnstitut Pasteur - Im-
body-catalyzed hydrolysis of an unsubstituted munology C136,211.
amide, J. Am. Chem. SOC.116,6508-6512. PAGE,M. I., JENCKS, W. P. (1971), Entropic contribu-
MEEKEL,A.A.P., RESMINI, M., PANDIT, U. K. (1995), tions to rate accelerations in enzymic and intra-
First example of an antibody-catalyzed hetero- molecular reactions and the chelate effect, Proc.
Diels-Alder reaction, J. Chem. SOC. Chem. Com- Natl. Acad. Sci. USA 68,1678-1683.
mun. 571-572. PAITEN, P. A., GRAY,N. S., YANG,P. L., MARKS,C. B.,
METS,B., WINGER, G., CABRERA, C., SEO, S., JAMDAR, WEDEMAYER, G. J. et al. (1996),The immunologi-
S. et al. (1998), A catalytic antibody against co- cal evolution of catalysis, Science 271,1086-1091.
caine prevents cocaine’s reinforcing and toxic ef- PAUL,S.,VOLLE,D. J., BEACH,C. M., JOHNSON, D. R.,
fects in rats, Proc. Natl. Acad. Sci. USA 95,10176. POWELL, M. J., MASSEY, R. J. (1989), Catalytic hy-
MILLER,G. P., POSNER, B. A., BENKOVIC, S. J. (1997), drolysis of vasoactive intestinal peptide by hu-
Expanding the 43C9 class of catalytic antibodies man autoantibody, Science 244,1158-1162.
13 References 487
PAUL,S., LI, L., KALAGA,R., WILKINS-STEVENS, P., Highly enantioselective protonation catalyzed by
STEVENS, F. J., SOLOMON, A. (1995), Natural cata- an antibody,J.Am. Chem. SOC.114,2257-2258.
lytic antibodies: Peptide hydrolyzing activities of REYMOND, J.-L., JAHANGIRI,G. K., STOUDT, C., LER-
Bence Jones proteins and VL fragment, J. Biol. NER, R. A. (1993), Antibody catalyzed hydrolysis
Chem.270,15257-15261. of enol ethers, J. Am. Chem. SOC.115,3909-3917.
PAULING, L. (1947), Chemical achievement and hope REYMOND, J.-L.,REBER,J.-L.,LERNER, R. A. (1994),
for the future, Silliman Lecture, Yale University Enantioselective, multigram-scale synthesis with
Press. a catalytic antibody, Angew. Chem. (Int. Edn.
PAULING, L. (1948), Nature of forces between large Engl.) 33,475477.
molecules of biological interest, Nature 161, ROBERTS, V. A., STEWART, J., BENKOVIC, S. J., GET-
707-709. ZOFF, E. D. (1994), Catalytic antibody model and
PLAYFAIR, J. H. L. (1992), Immunology at a Glance. mutagenesis implicate arginine in transition-state
Oxford Blackwell Scientific. stabilization,J. Mol. Biol. 235,1098-1116.
POLLACK, S. J., SCHULTZ, P. G. (1989), A semisynthe- ROSENBLUM, J. S., Lo, L.-C.,LI,T.,JANDA, K. D., LER-
tic catalytic antibody, J. Am. Chem. SOC. 111, NER, R. A. (1995), Antibody-catalyzed phosphate
1929-1931. triester hydrolysis, Angew. Chem. (Int. Edn.
POLLACK, S. J., JACOBS,J. W., SCHULTZ, P. G. (1986), Engl.) 34,2275-2271.
Selective chemical catalysis by an antibody,Scien- SAKURAI, M., WIRSCHING, P., JANDA, K. D. (1996),
ce 234,1570-1573. Synthesis of a nucleoside hapten with a
POLLACK, S. J., NAKAYAMA, G. R., SCHULTZ, P. G. [P(O)-0-N] linkage to elicit catalytic antibodies
(1988), Introduction of nucleophiles and spec- with phosphodiesterase activity, Bioorg. Med.
troscopic probes into antibody combining sites, Chem. Lett. 6,1055-1060.
Science 242,1038-1040. SAUER,J. (1966), Diels-Alder reactions: new prepa-
POLLACK, S. J., HSIUN,P., SCHULTZ, P. G. (1989), Ste- rative aspects, Angew. Chem. (Znt. Edn. Engl.) 5,
reospecific hydrolysis of alkyl esters by anti- 211-220.
bodies, J.Am. Chem. SOC.111,5961-5962. SCANLAN,T. S., PRUDENT, J. R., SCHULTZ, P. G. (1991),
RAASCH, M. S. (1980), Annelations with tetrachloro- Antibody-catalyzed hydrolysis of phosphate
thiophene 1,l-dioxide,J. Org. Chem. 45,856-867. monoesters, J.Am. Chem. SOC.113,9397-9398.
RADZICKA, A., WOLFENDEN, R. (1995), A proficient SCHULTZ, P. G. (1989), Catalytic antibodies, Acc.
enzyme, Science 267,90-93. Chem. Res. 22,287-294.
RASO,V., STOLLAR, B. D. (1975),The antibody-enzy- SCHULTZ, P. G., LERNER, R. A. (1993),Antibody cata-
me analogy. Characterisation of antibodies to lysis of difficult chemical transformations, Acc.
phosphopyridoxyltyrosine derivatives, Biochem- Chem. Res. 26,391-395.
istry 14,584-591. SERGEEVA, M. V., YOMTOVA,V., PARKINSON, A.,
REICH,H. J. (1979), Functional group manipulation OVERGAAUW, M., POMP,R. et al. (1996), Hapten
using organoselenium reagents, Acc. Chem. Res. design for antibody-catalyzed decarboxylation
l2,22-30. and ring-opening of benzisoxazoles, Isr. J. Chem.
RESMINI, M., MEEKEL,A. A. P., PANDIT,U. K. (1996), 36,177-183.
Catalytic antibodies: Regio- and enantioselectivi- SHABAT, D., ITZHAKY, H., REYMOND, J.-L.,KEINAN, E.
ty in a hetero Diels-Alder reaction, Pure Appl. (1999, Antibody catalysis of a reaction otherwise
Chem.68,2025-2028. disfavoured in water, Nature 374,143-146.
REYMOND, J.-L. (1995), (S)-Selective retroaldol re- SHEN,J.-Q. (1995), Catalytic antibodies for the hy-
action and the (R)-selective p-elimination with drolysis of chloramphenicol, Thesis, Sheffield
an aldolase catalytic antibody,Angew. Chem. (Znt. University.
Edn. Engl.) 34,2285-2287. SHEN,R., PRIEBE, C., PATEL,C., RUBO,L., SU,T. et al.
REYMOND, J.-L.,C H E N ,(1995a),
~. Catalytic,enantio- (1992), An approach for the generation of sec-
selective aldol reaction using antibodies against a ondary structure specific abzymes, Tetrahedron
quaternary ammonium ion with a primary amine Len. 33,3417-3420.
cofactor, Tetrahedron Lett. 36,2575- 2578. SHEVLIN, C . G., HILTON, S., JANDA, K. D. (1994), Au-
REYMOND, J.-L.,C H E N ,(1995b),
~. Catalytic,enantio- tomation of antibody catalysis: A practical me-
selective aldol reaction with an artificial aldolase thodology for the use of catalytic antibodies in or-
assembled from a primary amine and an antibo- ganic synthesis, Bioorg. Med. Chem. Lett. 4,297-
dy, J. Org. Chem.60,6970-6979. 302.
REYMOND, J.-L.,JANDA, K. D., LERNER, R. A. (1991), SHOKAT,K. M., LEUMANN, C. J., SUGASAWARA, R.,
Antibody catalysis of glycosidic bond hydrolysis, SCHULTZ, P. G. (1988), An antibody-mediated re-
Angew. Chem. (Int. Edn. Engl.) 30,1711-1713. dox reaction, Angew. Chem. (Znt. Edn. Engl.) 27,
REYMOND, J., JANDA, K. D., LERNER,R. A. (1992), 1172-1 175.
SHOKAT, K. M., LEUMANN, C. J., SUGASAWARA, R., SUGA,H., EESOY,O., TSUMURAYA, T., LEE, J., SINS-
SCHULTZ, P. G. (1989), A new strategy for the ge- KEY,A.J., MASAMUNE, S. (1994a), Esterolytic anti-
neration of catalytic antibodies, Nature 338, bodies induced to haptens with a 1,2-amino alco-
269-271. hol functionality,J.Am. Chem. SOC.116,487-494.
SHOKAT, K. M., KO, M. K., SCANLAN, T. S., KOCHER- SUGA,H., ERSOY, O.,WILLIAMS, S. F.,TSUMURAYA,T.,
SPERGER, L.,YONKOVICH, S. et al. (1990),Catalytic MARGOLIES,, M. N. et al. (1994b), Catalytic anti-
antibodies: A new class of transition-state analo- bodies generated via heterologous immunization,
gues used to elicit hydrolytic antibodies, Angew. J.Am. Chem. SOC.116,6025-6026.
Chem. (Znt. Edn. Engl.) 29,12961303. SUMMERS, R. (1983), Catalytic principles of enzyme
SHOKAT,K., UNO,T., SCHULTZ, P. G. (1994), Me- chemistry, Thesis, Harvard University.
chanistic studies of an antibody-catalyzed elimi- SUTTON,P. A., BUCKINGHAM, D. A. (1987), Cobalt
nation reaction,J. Am. Chem. SOC.116,2261-2270. (111)-promoted hydrolysis of amino acid esters
SHUSTER,A. M., GOLOLOBOV, G.V., KVASHUK, 0.A., and peptides and the synthesis of small peptides,
BOGOMOLOVA,A. E., SMIRNOV, I.V., GABIBOV,A. Acc. Chem. Res. 20,357-364.
G. (1992), DNA hydrolysing antibodies, Science TANAKA, E, KINOSHITA, K., TANIMURA, R., FUJII,I.
256,665-667. (1996), Relaxing substrate specificity in antibody-
SINHA,S. C., KEINAN,E., REYMOND, J.-L. (1993a), catalyzed reactions: Enantioselective hydrolysis
Antibody-catalyzed enantioselective epoxide hy- of N-Cbz-amino acid esters, J. Am. Chem. Soc.
drolysis,J.Am. Chem. SOC.115,4893-4894. 118,2332-2339.
SINHA,S. C., KEINAN,E., REYMOND, J.-L. (1993b), TARASOW,T. M., LEWIS,C., HILVERT, D. (1994),Inves-
Antibody-catalyzed reversal of chemoselectivity, tigation of medium effects in a family of decarb-
Proc. Natl. Acad. Sci. USA 90,11910-11913. oxylase antibodies, J. Am. Chem. SOC.116,7959-
SMILEY, J. A., BENKOVIC, S. J. (1994), Selection of ca- 7963.
talytic antibodies for a biosynthetic reaction from TAWFIK,D. S., ZEMEL,R. R., ARAD-YELLIN, R.,
a combinatorial cDNA library by complementa- GREEN, B. S., ESHHAR, Z. (1990),A simple method
tion of an auxotrophic Escherichia coli: Anti- of selecting catalytic monoclonal antibodies that
bodies for orotate decarboxylation, Proc. Natl. exhibit turnover and specificity,Biochemistry 29,
Acad. Sci. USA 91,8319-8323. 9916-9921.
SMITHRUD, D. B., BENKOVIC, P. A., BENKOVIC, S. J., TAWFTK, D. S., GREEN,B. S., CHAP,R., SELA,M.,
TAYLOR, C. M.,YAGER, K. M. et al. (1997),Investi- ESHHAR, Z. (1993), catELISA: A facile route to
gations of an antibody ligase, J. Am. Chem. SOC. catalytic antibodies,Proc. Natl. Acad. Sci. USA 90,
119,278-282. 373-377.
SPITZNAGEL, T. M., JACOBS, J. W., CLARK, D. S. (1993), TAWFIK,D. S., LINDNER, A. B., CHAP,R., ESHHAR, Z.,
Random and site-specific immobilisation of cata- GREEN,B. S. (1997), Efficient and selective p-
lytic antibodies, Enzyme Microb. Technol. 15, nitrophenyl-ester-hydrolyzingantibodies elicited
916-921. by a p-nitrobenzyl hapten, Eur. J. Biochem. 244,
STAHL,M., GOLDIE,B., BOURNE, S. €'.,THOMAS,N. R. 619-626.
(1995), Catalytic antibodies generated by in vitro TERAISHI,K., SAITO,M., FUJII, NAKAMURA, H.
immunization,J.Am. Chem. SOC.117,51665165. (1994), Design of the hapten for the induction of
STEPHENS, D. B., IVERSON, B. L. (1993), Catalytic antibodies catalysing aldol reaction, I. Mol.
polyclonal antibodies, Biochem. Biophys. Res. Graphics 12,282-285,
Commun. 192,1439-1444. THATCHER, G. R. J., KLUGER, R. (1989), Mechanism
STEWART, J. D., BENKOVIC, S. J. (1995),Transition-sta- and catalysis of nucleophilic substitution in phos-
te stabilization as a measure of the efficiency of phate esters, Adv. Phys. Org. Chem.25,99-265.
antibody catalysis, Nature 375,388-391. THOMAS, N. R. (1996), Catalytic antibodies - reach-
STEWART, J. D., ROBERTS, V. A., THOMAS, N. R., GET- ing adolescence?, Natural Product Reports 13,
ZOFF, E. D., BENKOVIC, S. J. (1994), Site-directed 479-512.
mutagenesis of a catalytic antibody: An arginine THOMPSON, R. C. (1973),Use of peptide aldehydes to
and a histidine residue play key roles, Biochem- generate transition-state analogs of elastase, Bio-
istry 33,1994-2003. chemistry l2,47-51.
STORK, G., BURGSTAHLER, W. A. (1955), Stereochem- THORN,S. N., DANIELS, R. G., AUDITOR,M.-T. M.,
istry of polyene cycliation, J. Am. Chem. SOC.77, HILVERT,D. (1995), Large rate accelerations in
5068-5077. antibody catalysis by strategic use of haptenic
SUCKLING, C. J.,TEDFORD, C., BENCE, L. M., IRVINE, J. charge, Nature 373,228-230.
I., STIMSON, W. H. (1993), An antibody with dual TRAMONTANO, A., JANDA,K. D., LERNER,R. A.
catalytic activity, J. Chem. SOC. Perkin Trans. I , (1986), Catalytic antibodies, Science 234, 1566-
1925-1929. 1570.
13 References 489
TRAMONTANO, A., AMMANN, A. A., LERNER,R. A. as inhibitors of papain, J. Biol. Chem. 247,8195-
(1988),Antibody catalysis approaching the activi- 8197.
ty of enzymes, JAm. Chem. SOC.110,2282-2286. WESTHEIMER, F. H. (1968),Pseudorotation in the hy-
TUBUL,A., BRUN,P., MICHEL,R., GHARIB,B., DE drolysis of phosphate esters, Acc. Chem. Res. 1,
REGGI,M. (1994), Polyclonal antibody-catalyzed 70-78.
aldimine formation, Tetrahedron Lett. 35, 5865- WILLIAMS, A., DOUGLAS, K. T. (1972a), ElcB mech-
5868. anisms. Part 11. Base hydrolysis of substituted
ULRICH,H. D., DRIGGERS, E. M. G., SCHULTZ, P. G. phenyl phosphoramidates, J. Chem. SOC.Perkin
(1996),Antibody catalysis of pericyclic reactions, Trans. II, 1455-1459.
Acta Chim. Scand. 50,328-332. WILLIAMS, A., DOUGLAS, K. T. (1972b), ElcB mech-
UNO,T., SCHULTZ, P. G. (1992), An antibody-cat- anisms. Part 111. Effect of ionisation of the amido-
alyzed dehydration reaction, J. Am. Chem. SOC. NH on the reaction of hydroxide ion with methyl
114,6573-6574. 3- and 4-benzamidobenzoates,J. Chem. SOC.Per-
UNO,T., GONG,B., SCHULTZ, P. G. (1994), Stereosel- kin Trans.II,2112-2115.
ective antibody-catalyzed oxime formation, J. WILLNER, I., BLONDER, R., DAGAN,A. (1994), Re-
Am. Chem. SOC.116,1145-1146. versible optical-recording by a dinitrophenol an-
UNO,T., Ku, J., PRUDENT, J. R., HUANG, A., SCHULTZ, tibody-catalyzed ring-opening of 6,8-dinitrospiro-
P. G. (1996), An antibody-catalyzed isomerizia- pyran,J. Am. Chem. SOC.116,3121-3122.
tion reaction, J.Am. Chem. SOC.118,3811-3817. WINCHESTER, B., FLEET,G. W. (1992), Amino-sugar
VANVRANKEN, D. L., PANOMITROS, D., SCHULTZ, P. G. glycosidase inhibitors - versatile tools for glyco-
(1994), Catalysis of carbamate hydrolysis by an biologists, Glycobiology 2,199-210.
antibody, Tetrahedron Lett. 35,3873-3876. WINCHESTER, B., ALDAHER, S., CARPENTER,N. C.,
WADE,W. S., ASHLEY, J. A., JAHANGIRI, G. T., McEL- DIBELLO, I. C., CHOI,S. S. et al. (1993), The struc-
HANEY, G., JANDA, K. D., LERNER, R. A. (1993),A tural basis of the inhibition of human alpha-man-
highly specific metal-activated catalytic antibody, nosidases by azafuranose analogs of mannose,
J. Am. Chem. SOC.115,4906-4907. Biochemical J. 290,742-749.
WAGNER, J., LERNER, R. A., BARBAS 111, C. F. (1995), WIRSCHING, P.,ASHLEY, J. A., BENKOVIC, S. J., JANDA,
Efficient aldolase catalytic antibodies that use the K. D., LERNER, R. A. (1991),An unexpectedly ef-
enamine mechanism of the natural enzyme, ficient catalytic antibody operating by ping-pong
Science 270,1797-1800. and induced fit mechanisms,Science 252,680485.
WALLACE, M. B., IVERSON, B. L. (1996),The influen- WIRSCHING, P., ASHLEY, J. A., Lo, C.-H. L., JANDA, K.
ce of hapten size and hydrophobicity on the cata- D., LERNER, R. A. (1995), Reactive immunization,
lytic activity of elicited polyclonal antibodies, J. Science 270,1775-1782.
Am. Chem. SOC. 118,251-252. WOLFENDEN, R. (1969), Transition state analogues
WEINER,D. P., WIEMANN, T., WOLFE,M. M., WENT- for enzyme catalysis,Nature 223,704-705.
WORTH JR., P., JANDA, K. D. (1997), A pentaco- XUE,Y. F., LIPSCOMB, W. N. (1995), Location of the
ordinate oxorhenium(V) metallochelate elicits active-site of allosteric chorismate mutase from
antibody catalysts for phosphodiester cleavage,J. Saccharomyces cervisiae, and comments on the
Am. Chem. SOC.119,408&4089. catalytic and regulatory mechanisms, Proc. Natl.
WENTWORTH JR., P., DATTA,A.,BLAKEY, D., BOYLE, Acad. Sci. USA 92,10595-10598.
T., PARTRIDGE, L. J., BLACKBURN, G. M. (1996),To- YANG,G., CHUN,J., ARAKAWA-URAMOTO, H., WANG,
wards antibody directed abzyme prodrug thera- X., GAWINOWICZ, M. A. et al. (1996),Anti-cocaine
py, ADAPT Carbamate prodrug activation by a catalytic antibodies: A synthetic approach to im-
catalytic antibody and its in vitro application to proved antibody diversity,J. Am. Chem. SOC.118,
human tumor cell-killing, Proc. Natl. Acad. Sci. 5881-5890.
USA 93,199-803. YLI-KAUHALUOMA, J. T., ASHLEY,J. A., Lo, C.-H.,
WENTWORTH JR., P., DATTA,A., SMITH,S., MAR- TUCKER, L., WOLFE,M. M., JANDA,K. D. (1995),
SHALL, A., PARTRIDGE, L. J., BLACKBURN, G. M. Anti-metallocene antibodies: A new approach to
(1997),Antibody catalysis of BAc2 aryl carbama- enantioselective catalysis of the Diels-Alder re-
te ester hydrolysis: A highly disfavored chemical action,J. Am. Chem. SOC.117,7041-7047.
process,J.Am. Chem. SOC.119,2315-2316. YLI-KAUHALUOMA, J. T., ASHLEY, J. A., Lo, C.-H. L.,
WENTWORTH JR.,P., L I U , ~WENTWORTH,
., D. A., FAN, COAKLEY, J., WIRSCHING, P., JANDA,K. D. (1996),
P., FOLEY,M. J., JANDA,K. D. (1998), A bait and Catalytic antibodies with peptidyl-prolyl cis-trans
switch hapten strategy generates catalytic anti- isomerase activity, J. Am. Chem. SOC.118, 5496-
bodies for phosphodiester hydrolysis, Proc. Natl. 5497.
Acad. Sci. USA 95,5971. YOON,S. S., OEI,Y., SWEET,E., SCHULTZ, P. G. (1996),
WESTERICK, J. O., WOLFENDEN, R. (1972),Aldehydes An antibody-catalyzed [2,3]-elimination reaction,
J. Am. Chern. SOC.118,11686-11687. ZEWAIL, A. H., BERNSTEIN, R. B. (1988), Special Re-

Yu, J., HSIEH,L. C., KOCHERSPERGER, L., YONKO- port - Real time laser femtochemistry - viewing
VICH,S., STEPHANS, J. C. et al. (1994), Progress to- the transition from reagents to products, Chem.
wards an antibody glycosidase, Angew. Chem. Eng. News 66,24-43.
(Int. Edn. Engl.) 33,339-341. ZHOU,G. W., Guo, J., HUANG, W., FLETTERICK, R. J.,
Yu, J., CHOI, S. Y., MOON,K.-D., CHUNG,H.-H., SCANLAN,T. S. (1994), Crystal structure of a cata-
YOUN,H. J. et al. (1998), A glycosidase antibody lytic antibody with a serine protease active site,
elicited against a chair-like transition state analog Science 265,1059-1064.
by in vitro immunization, Proc. Natl. Acad. Sci. ZHOU,2. S., JIANG,N., HILVERT, D. (1997), An anti-
USA 95,2880. body-catalyzed selenoxide elimination, J. Am.
ZEWAIL, A. H. (1997), Femtochemistry,Adv. Chem. Chem. Soc. 119,3623-3624.
Phys. 101,892 (and other articles in this issue).
12 Synthetic Enzymes -
Artificial Peptides in
Stereoselective Synthesis
PAULA. BENTLEY
New York, NY 10027,USA
1 Introduction 492
2 Cyclic Dipeptides 492
3 Poly-Leucine 499
3.1 Other Applications of Oligopeptides 505
4 Use of Linear Di-, Tri- and Tetrapeptides 508
5 Summary and Future Directions 513
6 References 513
492 12 Synthetic Enzymes -Artificial Peptides in Stereoselective Synthesis
1 Introduction -20 "Cwith two equivalents of hydrogen cya-

nide (Fig. 1 andTab. 1,Entry 5 ) (TANAKA et al.,
Low molecular weight peptides may have 1990).An important feature of this reaction is
functioned as the earliest natural catalysts that the catalyst must be present in the form of
prior to the evolution of their sophisticated a gel for enantioselectivity to be achieved.
enzyme relatives (EHLERand ORGEL,1976; Despite wide ranging studies, variation of
FERRIS et al., 1996;LEE et al., 1996).Now they the original ligand's structure (3) (Tab. 1) has
are being revitalized for use in the laboratory. achieved very limited success. Replacement of
Synthetic applications of polypeptides (EBRA- (S)-phenylalanine with (S)-leucine gives the
HIM and WILLS,1997), and polypeptides plus
opposite enantiomer of the cyanohydrin (ent-
other polymers (Pu, 1998) have been reviewed 2a) (Tab. 1, Entry 4). If the phenyl ring of
recently. phenylalanine is changed to naphthalene or
This chapter will review the applications of anthracene (Tab. 1,Entries 11and 12) enantio-
8"
synthetic peptides to stereoselective synthesis,
acquainting the reader with the history and
latest developments, as well as speculating on
the future directions of this intriguing area.
R' Rz 1
2 Cyclic Dipeptides
One of the greatest challenges for synthetic
chemists is to design small molecules which
have the catalytic selectivity of enzymes.How-
HCN, 3
ever the complex and ordered architecture of Toluene,
an enzyme active site, which is seemingly a -10 to -2OOC
prerequisite for selectivity is not easily mim-
icked by small acyclic molecules. Consequent-
ly chemists have resorted to cyclic structures
which are constrained to be highly ordered
8
and which p r i m a facie have properties which 3 cycle [CS)-Phe-@)-His]
can be predicted with some certainty. This was
INOUE'S premise for studying cyclic dipeptides
(diketopiperazines). After initial studies with
very limited success (OKUet al., 1979, 1982),
he was rewarded in 1981 when the dipeptide,
cycZo-[(S)-Phe-(S)-HisI1(3) in benzene cata-
lyzed the addition of hydrogen cyanide to R' R2 2
benzaldehyde (la) giving the (R)-cyanohydrin
(2a, mandelonitrile) in 90% ee at 40% conver-
sion (OKUand INOUE,1981).This reaction was
subsequently optimized to 97% ee in 97% B R' = H , R ~ =H 97% yield, 97% ee
yield by running the reaction in toluene at
b R ' = H, RZ= F'h-0 97% yield, 92% ee
For 18 of the 20 amino acids involved in DNA en-
coded peptide biosynthesis the Cahn-Ingold-Pre-
log designation (S) is equivalent to the Fischer- 88% yield, >98% ee
Rosanoff designation L, which is the predominant
naturally occurring enantiomer. The exceptions Fig. 1. Optimal substrate and conditions for cyclic di-
are glycine (achiral) and cysteine. peptide hydrocyanation.
Tab. 1.Cyclic Dipeptides Used in Stereoselective Hydrocyanation of Benzaldehyde and Derivative l b
Entry Catalyst R1 R* Product ee Y/C Time

["/.I ["/I [hl
(Reference)
1 4 cycfo-[Gly-(S)-His]
Rty
RZ *'.
H
0
H
4 cycb[X-(S)-His]
(R)-2a 3.3 70' 44(1)

2 4 cycfo-[(S)-Ala-(5')-His] Me H (R)-2b 26 21y 20(2)
(R)-2a 9.9 50' 47 (1)
3 4 cyclo-[(R)-Ala-(S)-His] H Me (R)-2a 7.5 90" 47(1)
4 4 cycfo-[(S)-Leu-(S)-His] 'Bu H (S)-2a 55 85y 5 (3)
5 4 cyclo-[(S)-Phe-(S)-His] Bn H (R)-2a 90 40' 0.5 (4)
s3 (R)-2a 10.1 90" 42 (1)
(R)-2a 71 75y 17(2)
(R)-2b 97 97" 8 (5)
5 cyclo-[X-(R)-His]
6 5 cyclo-[(R)-Phe-(R)-His] H Bn (S)-2a 93 95' S(5)

(S)-2b 88 93y 18.5 (2)
7 4 cyclo-[(S)-Phe-(R)-His] Bn H (S)-2b 11 75y 21 (2)
8 5 cycfo-[(S)-PhGly-(S)-His]Ph H 2b 0 3OY 20 (2)

9 4 cyclo-[(S)-Qr-(S)-His] H (R)-2b 21 6lY 24(2)
Q
A
10 4 cyclo-[(S)-MeOTyr-(S)- OMe H (R)-2b 28 74Y 42 (2)
His]
A
494 12 Synthetic Enzymes -Artificial Peptides in StereoselectiveSynthesis
Tab. 1. Continued
Entry Catalyst R' R2 Product ee YIC Time

Po1 [%I [h1
(Reference)
11 4 cyclo-[(S)-1-naphthy1Ala-(S)-His] (R)-2a 0 <lo' -(6)
R~=H
12
9
4 cyclo-[(S)-1-anthracenylAla-(S)-His] (R)-2a 0 <lo' -(6)
R1= R~=H
13 4 cyclo-[(S)-His-(S)-His] H (R)-2b 2 90Y 42 (2)

(R)-2a 2.5 50" 23 (1)
YN
14 4 cyclo-[(It)-His-(S)-His] Hf"\\ (S)-2b 10 5OY 21(2)
J4
15 4 cyclo-[(S)-3-thienyl- H 2a 0 <20' - (6)
Ala-(S)-His]
16 4 cycZo-[(S)-2- H (R)-2a 72 40' -(6)

thienylAla-(S)-His]
17 4 cycZo-[(S)-2-(5-Me- H 2a 0 <20' -(6)

thieny1)Ala-@)-His]
18 4 cyclo-[(S)-2-(5-Br- H 2a 0 <20" - (6)

thienyl)Ala-@)-His]
Tab. 1. Continued
Entry Catalyst R' R2 Product ee Y/C Time
%
$,
["/.I ["/I [hl
(Reference)
'9 6
H
.f H
R' 0
19 6 cyclo-[(S)-(N-Me)-Phe- Me H 2a 0 <lo' - (7)
(S)-His];R3= H
20 6 cycZo-[(S)-Phe-(S)-(N- H Me 2a 0 <lo' -(7)
Me)-His]; R3 = H
21 6 cycZo-[(S)-Phe-(S)-(2- H H (R)-2a 22 10' -(7)
Me)-His]; R3= Me
22 7 cyczo-[(S)-(p,p- Me Me (R)-2a 60 20" -(7)

diMe)-Phe-(S)-His]
23 7 cycZo-[(S)-(P-Ph)- Ph H (R)-2a 36 20' -(7)
Phe-(S)-His]
~~
24 4 cyclo-[(S)-(a-Me)-Phe- Bn Me (R)-2a 15 50' -(7)

(S)-His] (R)-2a 99 98' -(8)
25 4 cyclo-[(R)-(a-Me)-Phe- Me Bn (R)-2a 32 9OY - (8)

(S)-His]
26 8 (5R)-5-(4-imidazolylmethyl-3-N-phenyl-2,4- (S)-2a 37 90' l(9)

imidazolidinedione
Y, = yield; C, = conversion.References: 1OKUet al., 1982;2 JACKSON et al., 1988; 3 MORIet al., 1989;4 OKU
and INOUE, 1981;5 TANAKA et al., 1990; 6 NOEet al., 1996;7 NOEet al., 1997;8 HULST et al., 1997; 9 DANDA,
1991.
selectivity is completely lost, possibly due to phatic aldehydes (which mostly react rapidly)
the disruption of supramolecular assembly. is only low to moderate, and that of conjugated
Substitution of the amidic protons believed to aldehydes ( ~ 3 1 %ee) and ketones (<19% ee)
be involved in intermolecular hydrogen bond- is even lower.
ing (see Fig. 4) by a methyl group also leads to The addition of cyanide to imines (9) is the
a loss of any stereoselectivity (Tab. 1,Entries enantiodiscriminating step in the Strecker syn-
19 and 20). Incorporation of (S)-a-methyl- thesis of a-amino nitriles (lo), which are pre-
phenylalanine (Tab. 1, Entry 24) in place of cursors of a-amino acids (Fig. 3). Catalysis of
(S)-phenylalanine (Tab. 1,Entry 5) is the only this reaction by cyclo-[(S)-Phe-(S)-His] (3)
modification which retains high enantioselec- was unsuccessful, which was attributed to fail-
tivity. Replacement of the six membered ring, ure of the imidazole group to accelerate pro-
by a five membered ring (8), reduces enantio- ton transfer to the imine. Replacement of the
selectivity, however the nature of the enan- histidine residue in the cyclic dipeptide with
tiodiscrimination achieved [(S)-cyanohydrin (S)-a-amino-y-guanidinobutyricacid (which
( e n t 3 a ) , (R)-histidinyl residue] suggests that
the same mode of discrimination is operating
as in the six membered ring case (Tab. 1,En-
tries 6,7, and 26).
The expansion of substrate range (MAT-
THEWS et a]., 1988; KIM and JACKSON, 1994)
(Tab. 2) has led to a system of great practical
R' IR2 H 9
value (for a review see NORTH,1993) which

has been applied to the preparation of natural
products, drugs and their analogs (Fig. 2)
(BROWNet al., 1994). However several limita-
tions have been revealed. Aromatic aldehydes HCN, 10, MeOH
bearing electron donating substituents under-
I
or M H ,
go hydrocyanation with high enantioselectiv-
ity, but enantioselectivity is reduced if electron -75 to 25 OC H
withdrawing substituents are present. The
11 cyclo[@)-Phe-~-a-aminoy
enantioselectivity of hydrocyanation of ali- guauidinobutyric acid]
H
R2
Ar R H-N
s)(
Ar =p-oMe-C&,, R = PhCO; Tembamide
R' H 10
Ar =p-OMe-CsH4,R = (E) Ph-CH=CH-;Aegeline
Ar =rn-oPh-CsHd,R = bu; Salbutamol derivative R' = RZ = Aromatic; 82-98%yield, 10->99%ee
Ar =p-OH-C6H4,R = CbBz-m,p-OMe;Denopamine R' = Aliphatic, R2 = Aromatic; 88%yield, 75% ee
R' =Aromatic, 2 = Aliphatic, 71-8155 yield, 10-17%ee
Fig. 2. Natural products and drugs produced using
cyclic dipeptide catalyzed hydrocyanation as the key Fig. 3. Cyclic dipeptide catalyzed enantioselective
step (BROWN et al., 1994). Strecker reaction (IYER et al., 1996).
Tab. 2. Substrate Range and Enantioselectivity for Asymmetric Hydrocyanation of Aldehydes Catalyzed by
cyclo- [(S)-Phe-(S)-His)] (3)
Functionality (No. of Examples) 0-30% ee 3140% ee 61-90% ee 91-100% ee

~~ ~ ~
Aromatic aldehydes (43) 9% 28% 46% 16%

Aliphatic aldehydes (18) 50% 44% 5 yo -
has a more basic side chain group) yielded an As noted above, the dipeptide catalyst must
extremely efficient catalyst (11). The results be present as a gel in solution for enantioselec-
with a range of substrates show some interest- tive hydrocyanation to occur. In early experi-
ing parallels with hydrocyanation. Aromatic ments the gel tended to dissolve as the reac-
imines with electron donating substituents tion proceeded with erosion of the enantiose-
give a-amino nitriles with high enantiomeric lectivity. Switching from benzene to toluene
excesses, whereas those bearing electron with- largely solved this problem, and initial gel for-
drawing substituents, heteroaromatic and ali- mation is promoted by a range of prescriptions
phatic functionality give low enantiomeric ex- for pretreatment of the dipeptide to give
cesses. Unlike hydrocyanation the Strecker re- amorphous non-crystalline material. This is
action is conducted as a homogeneous reac- achieved by rapid crystallization of the dipep-
tion in methanol, moreover the cyclic dipeptide from methanol alone or by addition of
tide (11) gave the opposite enantiomer as the ether (TANAKAet al., 1990; DANDAet al.,
major product when compared with the equiv- 1991), spray drying (DONGand PETTY, 1985),
alent hydrocyanation process, suggesting the interaction with supercritical COz (SHVOet al.,
involvement of different mechanistic factors 1996), or lyophilization (KOGUTet al., 1998).
(IYERet al., 1996). IR observations indicate that during this acti-
Cyclic dipeptide hydrocyanation is one of vation process intermolecular hydrogen bonds
the few examples of reactions which exhibit (Fig. 4) are broken, while intramolecular hy-
autoinduction (BOLMet al., 1996). In the hydrogen bonds are formed (JACKSON et al.,
drocyanation of m-phenoxy-benzaldehyde 1992).However, the importance of intermolec-
(lb, Fig. 1) catalyzed by cyclo-[(R)-Phe-(R)- ular hydrogen bonding for good enantiodis-
His] (ent-3) a gradual increase in enantioselec- crimination is clearly underscored by the poor
tivity for formation of the (S)-cyanohydrin results which have been obtained when the cy-
(ent-2b) was observed as the reaction pro- clic dipeptide has been immobilized (KIMand
gressed. When a small amount of the enantio- JACKSON, 1992). The importance of hydrogen
pure product of this reaction, the (S)-cyanohy- bonding is also clear from the fact that metha-
drin (ent-2b),was included prior to addition of nol destroys chiral control in the reaction.
hydrogen cyanide, the optical purity of the The mechanism by which cyclic dipeptides
product remained at circa 96% ee throughout provide such high enantiodiscrimination has
the course of the reaction. The presence of an
initial trace of (R)-cyanohydrin (2b) gave a
slightly lower enantioselectivity, but a similar
rate of increase in enantioselectivity for for-
mation of the (S)-cyanohydrin (ent-2b), over
the duration of the reaction when compared
with no pre-addition (DANDAet al., 1991; cf.
KOGUTet al., 1998).Moreover, pre-addition of
achiral 2-cyano-propan-2-01 (acetone cyano-
hydrin) increases the enantioselectivity of fur-
fural hydrocyanation from 53 to 73% ee. Pre-
addition of (S)-1-phenyl-1-ethanol causes a
similar enhancement of enantioselectivity
(72% ee), but the (R)-enantiomer had only a
modest effect (58% ee), which was identical to R' = Bn, R2= Irnidazole(syn)
that of methanol (58% ee) (KOGUTet al., R' = Imidazole, F?= Bn (anti)
1998). These phenomena are broadly consis-
tent with a catalyst in which hydrogen bonding
plays a major role and, as might be expected, = Hydrogen bonding
an excess of the alcohol causes a drop in enan- Fig. 4. Intermolecular hydrogen bonding of cyclic di-
tioselectivity, attributable to the disruption of peptides used for enantioselective hydrocyanation
hydrogen bonds. ( S w oet al., 1996;KOGUTet al., 1998).
been the subject of considerable investigation.

If it is assumed that catalysis involves aug-
mented direct addition of cyanide to the alde-
hyde (1, Fig. 1) by cyclo-[(S)-Phe-(S)-His] (3),
then the (R)-cyanohydrins (e.g., 2) must be
formed by addition of cyanide to the Si-face of
the carbonyl group. Localization of the hydro-
gen cyanide most plausibly occurs by coordi-
nation to the basic imidazole ring of histidine.
The only issues remaining are then the posi-
@pl{
14
tion of the aldehyde and the means by which it
is orientated and/or activated to undergo nu- ---- = Hydrogen bonding
cleophilic attack.
One proposal is that the transition state re-
sembles (14) (Fig. 5), where the imidazole ring
is rotationally restricted by hydrogen bonding
to the carbonyl group of histidine (KIM and
JACKSON, 1994), while the aldehydic oxygen is
hydrogen bonded to the amide group of histi-
dine (TANAKA et al., 1990). .rr-Stacking may No
also exist between ligand and substrate, the 1: 15
overall effect being to create a U-shape mole- H
cule. Cyanide becomes associated with the
imidazole ring by ionic interaction. An alterna-
NC- H,
tive arrangement is supported by NMR data
and has the aldehydic oxygen hydrogen bond-
ed to the phenylalanine amide group (15)
(HULSTet al., 1997). NMR and molecular
modeling studies suggest that the pre-transi-
tion state model (16) does not adopt a U-shape
and that HCN forms a covalent bond to imida-
zole (CALLANT et al., 1992).
Interestingly cyclo-[(S)-Leu-(S)-His] (17)
gives the ent-cyanohydrin (ent-2) when com-
pared to the product from cyclo-[(S)-Phe-(S)-
His] (3) (HOGGet al., 1994). Cyclo-[(S)-Leu-
(S)-His] (17) adopts a conformation in solu-
tion in which the imidazole ring is folded over
the diketopiperazine ring, whereas the pre-
dominant conformer for cyclo-[(S)-Phe-(S)-
His] (3, Fig. 6) has the phenyl ring folded over
the diketopiperazine ring (HOGGet al., 1994).
This may account for the difference in the sub- 17 cyclo-[(s)-Leu-(.S)-His]
strate profile of the two catalysts. Cyclo-[(S)- Fig. 5. Imidazolekyanide salt mechanism for cyclic
Leu-(S)-His] (17) performs consistently better dipeptide hydrocyanation and possible conformati-
for aliphatic aldehydes compared to aromatic on of the cyclic dipeptides (TANAKA
et al., 1990; KIM
aldehydes (MORI et al., 1989), whereas the and JACKSON, 1994).
converse is true for cyclo-[(S)-Phe-(S)-His]
(3)* gen catalyzes the oxidation of benzaldehyde to
A radically different mechanism was pro- benzoic acid. In the absence of catalyst this re-
posed based on the observation that cyclo- action proceeds via an aldehyde hydrate,
[(S)-Phe-(S)-His] (3) in the presence of dioxy- whereas the catalyst can accelerate this reac-
3 Poly-Leucine 499
drogen on N-3 of the imidazole ring and the

amidic carbonyl group of the histidine residue.
This of course could play a major role in en-
hancing the nucleophilicity of N-1 as required
for the aminol mechanism. Whether this in-
volves full proton transfer to give the enolic
form of the amide (Fig. 6) or a protonated
amide or some other pathway is conjecture at
3
present.
Moreover hydrocyanation has second order
kinetics with respect to the cyclic dipeptide
suggesting two molecules of cyclic dipeptide
are involved in the rate determining step. It is
plausible that the aldehyde is bound to one
imidazole group and the hydrogen cyanide to
another imidazole group with the catalytic
event occurring in the void between two mole-
cules of dipeptide (SHVOet al., 1996). If this is
the case, and catalysis involves multiple di-
1
peptide units, it will be ironic, because the in-
ital premise for using cyclic dipeptides was that
18 their structural rigidity would mimic the hy-
drogen bonding arrays of long acyclic poly-
peptides. Have the catalysts evolved (by selec-
tion for enantioselectivity) towards structures
which resemble acyclic polypeptides?
3 Poly-Leucine
2a
N
H
0--H'
3 The first breakthrough in the use of synthet-
ic peptides in stereoselective synthesis was
Fig. 6.Amino1 mechanism for cyclic peptide cataly-
zed hydrocyanation.
achieved by JULIA(JULIAet al., 1980; COLON-
NA et al., 1987). Using poly-L-alanine to cata-
lyze the epoxidation of chalcone (19) under
triphasic conditions (polypeptide/organic sol-
vent/aqueous phase) the (2R,3S)-epoxide (20)
was obtained in up to 93% ee (Fig. 7). By using
tion by attack of benzaldehyde (la) by the poly-D-alanine the ent epoxide (21) was pre-
imidazole moiety to give an aminol intermedi- pared with comparable enantioselectivity. In
ate (18).This could also serve as a substrate for collaboration with COLONNA the reaction was
nucleophilic displacement by cyanide to give found to be applicable to a fair range of a,p-
the cyanohydrin (2a) (HOGGet al., 1993) (Fig. unsaturated ketones (Tab. 3), gave optimal re-
6). The conformation of cyclo-[(S)-Phe-(S)- sults in toluene and carbon tetrachloride and
His] (3) has been determined in considerable while the rate of the reaction was dependent
detail by solution state NMR (HOGG and on the substrate :catalyst ratio, the enantio-
NORTH,1993), molecular modeling (NORTH, meric excess obtained was largely unaffected.
1992), and solid state NMR studies (APPERLEY These latter two features indicate enzyme-like
et al., 1995). These studies indicate that a catalysis and a low background uncatalyzed
strong hydrogen bond exists between the hy- epoxidation rate (JULIA et al., 1982). The
Triphasic reaction, 1-3 days so-called “poly-alanine” used in this work was
prepared by polymerization of the N-carboxy-
anhydride of L-alanine initiated by n-butyl-
amine, thus the polymer bears a C-terminal N-
Ph butyl amide group. However the catalytic ac-
2o t Toluene,NaOH, t 21 tivity is unaffected by the nature of this group

and even if the C-terminus is used as a site for
immobilization to polystyrene, enantioselec-
tive catalytic activity is retained (BANFIet al.,
1984). Poly-L-alanine oligomers with an aver-
age of 5,7,10 and 30 residues were tested as
catalysts, with only 10- and 30-mers making vi-
able peptides for epoxidation, although the 30-
mer was considered marginally optimal (JULIA
et al., 1980,1982). More than 15 oligopeptides
were prepared and assayed for enantioselec-
tive epoxidation of chalcone (18), but the only
examples with practical levels of enantioselec-
tion were poly-leucine and poly-isoleucine
(COLONNA et al., 1983).
The major disadvantage of triphasic reac-
tions is that the reactions are mostly slow (1-
3 d) which results in partial degradation of the
poly-alanine and partial loss of activity (JULIA
et al., 1982,1983; COLONNA et al., 1983,1984).
Despite the slow rate of the reaction it was ex-
Ph Ph ploited successfully in the synthesis of flavo-
20 21 noids (cf. 29, Fig. 8) (BEZUIDENHOUDT et al.,
1987; AUGUSTYN et al., 1990; VANRENSBURG
Biphasic reaction, 5-30 min et al., 1996), although superior results were
subsequently achieved with biphasic condi-
Fig. 7. Biphasic and triphasic poly-leucine stereosel-
ective epoxidation.
tions (NELet al., 1998).
The next developments in the use of poly-
peptides as epoxidation catalysts came about
as a consequence of a large scale synthesis of
Tab. 3.The Epoxidation of “Chalcone-vpe” Substrates (19and l9a-d) Using Poly-L-AlanineUnder Tripha-
sic Conditions (JULIA et al., 1980,1982,1983; COLONNA
et al., 1983,1984)
Rl- RZ
Toluene, HzOz.
aq NaOH
Poly-L-alanine, triphasic conditions R’
4
..\’ =
0
Rz
19 and19a-d 20 and 20a-d

Entry Substrate R’ RZ Time ee Yield
[hl [% 1 1% 1
~~ ~
1 19 Ph Ph 37 93 75
2 19a ‘Pr Ph 42 50 68
3 19b Ph ‘Pr 52 60 49
4 19c Ph ‘BU 49 100 24
5 19d Ph Naphthyl 44 80 77
22 SK&F 104353 23 Diltiazem 24 Clausenamide
Ftl
H
HO H
Fhm HO
i H
0
25 (+)-Goniopypyrone 26 (+)-Goniofufurone 27 (+)-Goniotriol
AcO 0
28 TaxolTMISidechain] 29 Dihydroflavonols
Fig. 8. Natural products and drugs prepared using poly-leucine catalyzed epoxidation
SK&F 104353 (22, Fig. 8). A selection of com- ITSUNOprepared immobilized poly-alanine
mercial homo-polypeptides were investigated and poly-leucine by initiating polymerization
and poly-L-leucine was found to give the most of the N-carboxyanhydrides with aminometh-
consistent results. The catalyst was prepared yl groups on the surface of cross-linked micro-
by placing the N-carboxyanhydride of L-leu- porous polystyrene. This provided a more ro-
cine into trays to a depth of 6-8 cm in a cham- bust catalyst, affording a higher degree of recy-
ber at 70-75% relative humidity. Polymeriza- clability (12 cycles) and reproducibility (ITSU-
tion was initiated by water from the air. Pre- NO et al., 1990). Surprisingly, even peptides
swelling the peptide for 6 h under the reaction with as few as four residues had substantial
conditions prior to the addition of the sub- enantioselective catalytic activity (83% ee),
strate and the use of hexane as solvent led to whereas the corresponding non-immobilized
higher enantioselectivity in shorter times, with peptides gave only poor enantiomeric excesses
the additional bonus that the recovered cata- and yields.
lyst retained full activity over 6 cycles (BAURES In the last few years, the Roberts group at
et al., 1990;FLISAK et al., 1993). Exeter and latterly Liverpool has further ex-
panded the scope of poly-leucine catalyzed perborate/sodium hydroxide (KROUTIL et al.,

epoxidation (for a review see LASTERRA- 1996a; SAVIZKY et al., 1998). These methods
SANCHEZ and ROBERTS, 1997). Initially the tri- have some advantages, but the reaction times
phasic conditions were extended to an in- are still prolonged (>24 h). The discovery of
creased range of (E)-@unsaturated ketones biphasic conditions, in which the urea-hydro-
(Tab. 4) (LASTERRA-SANCHEZ and ROBERTS, gen peroxide complex (UHP) (HEANEY, 1993)
1995; LASTERRA-SANCHEZ et al., 1996; KROU- is used with 1,8-diazobicyclo[5.4.0]undec-7-
TIL et al., 1996a,b) and subsequently to (Z)-diene (DBU) (YADAVand KAPOOR,1995) as the
substituted, digeminally substituted, and tri- base in THF led to a dramatic decrease in reac-
substituted a,P-unsaturated ketones (Tab. 5 ) tion time (5-30 min; BENTLEYet al., 1997a).
(RAYand ROBERTS, 1999;BENTLEY, 1999). The biphasic conditions were successfully ap-
Phase transfer reagents were added to in- plied in the synthesis of diltiazem (23)(ADGER
crease the rate of the reaction, without loss of et al., 1997), clausenamide (24)(CAPPIet al.,
enantioselectivity, suggesting the phase trans- 1998), (+)-goniopypyrone (25),(+)-goniofu-
fer properties of poly-leucine were not implic- furone (26), and (+)-goniotriol (27)(CHEN
it in its enantioselectivity. These conditions and ROBERTS, 1999), TaxolTMside chain (28)
were used in the epoxidation of phenyl-P-sty- (ADGERet al., 1997), and dihydroflavonols
ryl sulfone, but only achieved 21% ee. This dis- (29)(NELet al., 1998) (Fig. 8).
appointing result can be rationalized by in- The standard THF/DBU/UHP biphasic re-
creased steric hindrance of the sulfone oxy- action protocol has been significantly im-
gens or weaker hydrogen bonds possible proved in terms of enantioselectivity, with lim-
through the sulfone oxygens (compared with ited loss of reaction rate. This has been
the ketone) to the amide of the peptide back- achieved by dilution of the reagents and in-
bone. The substrate would be less tightly creasing the amount of poly-leucine relative to
bound into the chiral environment enhancing the substrate, while changing the solvent to
the role of the background reaction.This could iso-propyl acetate (Tab. 5). These conditions
indicate key hydrogen bonding of the sub- were used to expand the substrate range to en-
strate to poly-leucine via the ketone in enones compass trisubstituted and digeminally substi-
(BENTLEY,1999). Alternative oxidation sys- tuted enones (32)(BENTLEY and ROBERTS, un-
tems to hydrogen peroxidelsodium hydroxide published data). Substrate (32) offered an
were found including sodium percarbonate interesting contrast to prior results (e.g., 30f);
(LASTERRA-SANCHEZ et al., 1996) and sodium these “tethered chalcones” (30 and 32) could
Tab. 4. The Epoxidation of Structurally Varied Substrates (19e-j) Using Poly-L-Leucine Under Triphasic
2
Conditions (LASTERRA-SANCHEZ and ROBERTS, 1995; LASTERRA-SANCHEZ et al., 1996; KROUTILet al.,
1996a,b)
R I 4A
19e-j
R2
Toluene, H202, aq NaOH
Poly-L-leucine, triphasic conditions * R‘
...\‘ 5
20e-j
R2
Entry Substrate R1 RZ Time ee Yield

[hl 1%1 [”/.I
1 19e Cyclopropyl Ph 18 77 85
2 1% Ph-C C Ph 96 90 57
3 19g Ph (SCH2)2C=CH 115 > 94 51
4 19h PhCO Ph - 76 76
5 19i PhCH = CH 2-Naphthyl 72 > 96 78
6 19j Ph PhCH = CH - > 98 -
3 Poly-Leucine 503
Tab. 5. The Epoxidation of Digeminal and Trisubstituted Alkenes (Ma-h, 32) Catalyzed by Immobilized Po-
ly-L-Leucine Under Biphasic Conditions. Protocol: Substrate (3Oa-h,32) (0.24 mmol), 'PrOAc (1.6 mL), ac-
tivated immobilized PLL (200 mg), urea-hydrogen peroxide complex (UHP, 11 mg) and 1,8-diazobicy-
Q&
clo[5.4.0]undec-7-ene (DBU, 30 mg). UHP and DBU were added every 12 h until reaction was complete
(BENTLEY, 1999)
0
R R
n
Ma-h 'PrOAc, UHP, DBU 31a-h

*
Immobilized poly-L-leucine,biphasic conditions
0
Ph Ph
32 33
Substrate R n Time ee Yield

[hl ["/.I 1% I
30a Ph 2 90 84.5 76
30b p-Br-C,H, 2 72 82.5 81
30c p-NO,-C,H, 2 78 96.5 85
30d Me 2 60 92.0 66
30e 'BU 2 192 83.0 63
30f Ph 1 48 88.0 72
3% Ph 3 168 59.0 74
30h" H 2 7 94.0 64
32 - - 72 0.0 67
a Reagent additions made after 0.5,1,3and 6 h
give an indication as to the orientation that leucine and triphosgene (DALYand POCHE,
the (E)-disubstituted a$-unsaturated ketone 1988). There is a strong correlation between
adopts so as to be processed by poly-leucine. the purity of NCA as assessed by melting point
Although initial studies found the range of (should be within 2 "C of literature values;
bases to be of utility with UHP very limited, LeuNCA: 76-78 "C) and the quality of poly-
further work demonstrated potassium carbo- leucine as a catalyst. Good quality NCA is ob-
nate to provide comparable enantioselectivity tained by controlling the temperature of the
to DBU, ultimately leading to sodium per- reaction and limiting the exposure of NCA to
carbonate's (BENTLEY,1999) replacement of moisture at all stages of the process. An extra
UHP and DBU. Development of these condi- step of stirring poly-leucine in aqueous NaOH
tions has provided distinct improvements and toluene followed by washing with selected
(RAYand ROBERTS, 1999;Allen et al., 1999) in solvents is required to provide superior mate-
the reaction rate of this economically signifi- rial (35) for biphasic epoxidation reactions,
cant alternative biphasic reaction. when compared to unactivated poly-leucine
Poly-leucine is prepared from leucine N-car- (ALLENet al., 1998; BENTLEY et al., 1998; Nu-
boxyanhydride (NCA) (34) (Fig. 9) (KRICHEL- GENT,unpublished data).
DORF,1987), which in turn is prepared from
The means by which poly-leucine achieves

its impressive chiral discrimination has recent-
ly begun to be addressed by the preparation of
polypeptides of precisely defined lengths, con-
taining both D- and L-residues attached via a
spacer to a polystyrene resin. The homo-deca-
peptide of L-leucine (Pl, Fig. 10) catalyzes the
epoxidation of chalcone to give the expected
H'
O F c &
epoxide (20) with a moderate enantiomeric
excess, whereas the 5 ~ / diastereoisomer
5 ~
-f 30
(P2) gives essentially racemic epoxide (20).
The 20-mer homologs (P3-P8) behave differ-
ently.The 7 ~ / 1 (P4),
3 ~ and 5 ~ / 1 (P5)
5 ~ diaster-
eoisomers give predominantly the enantio-
meric epoxide (21), apparently under control
by the D-leucine residues in the N-terminal re-
gion (BENTLEY et al., 1998). It is clear from the
1 ~ / 5 ~ / diastereoisomer
14~ (P6) giving pre-
dominantly the epoxide (21),under control by
HN
J the D-leucine residues, 2L/SD/13L (P7) giving
virtually racemic epoxide and good selectivity
for the epoxide (20) being restored with the
3 ~ / 5 ~ /diastereoisomer
12~ (P8) that the termi-
nal trimer is the most important determinant
of enantioselectivity (BENTLEY,unpublished
data). Moreover, the terminal amino group
can be replaced by N,N-dimethylamino-
(BENTLEY et al., 1998) or other substituents (-
JULIAet al., 1982) without a substantial effect
on enantioselectivity. Cleavage of the peptide
from the polymer does not change the stereo-
control of the N-terminal region, eliminating
its comparatively less hindered environment
as an explanation for these observation.
The C-terminal region also plays a signifi-
cant role in determining enantioselectivity, po-
tentially providing the correct scaffold allow-
ing the N-terminal region to be presented in an
effective orientation. An immobilized 18-mer
of L-leucine is a highly enantioselective epoxi-
a 4 M aq NaOH, toluene dation catalyst (Fig. 11,Pl), whereas the corre-
approx. 20 h sponding tert-leucine analog (P4) is non-enan-
b H20, 1:1, 1.4 (H20:Acetone), tioselective. As might be anticipated, polypep-
acetone, EtOAc, EtZO tides with 9 terf-leucine or a mixture of D,L-leU-
cine residues in the C-terminal region (P2 and
P5) and 9 L-leucine residues at the N-terminus
are also selective catalysts, but interestingly
the 9 ' ~ / catalyst
9~ (P3) is also fairly enantiose-
lective (BENTLEY et al., 1997b).
In summary, the length of poly-leucine must
be at least 10 residues for good enantioselec-
tivity, with only 18-20 residues providing opti-
3 Poly-Leucine 505
rious positions in poly-leucine Yo ee 66 5 91 80 45 67 11 89

using D- and L-leucine (shown Major
20 20 20 21 21 21 21 20
as D and L, respectively). Epoxide
No.of
residues
0
Fig. 11. The determination of the role of amino

acids in various regions of poly-leucine, using
L-leucine, racemic leucine, and L-leucine 18
[shown as L,(D,L), and 2,respectively]. %ee >90 81 64 3 0
mum stereoselectivity and a higher rate NAP and CHIRAPHOS). Poly-D-alaninegave

(FLOOD, unpublished data). Shorter polypep- the (S)-lactone (ent-37),but in only 8% enan-
tides are more enantioselective if immobilized. tiomeric excess.It has been speculated that the
Three to five residues at the N-terminus are reaction goes via the complex (38), although
the most important determinant of enantiose- no explanation was proffered for invoking the
lectivity, but this can be modified profoundly unusual protonated amide (ALPERand HA-
by five to fifteen C-terminal residues, although MEL,1990).
the stereochemistry of these residues does not
seem to be important. The terminal amino
group does not play a key role in determining
enantioselectivity. 3.1 Other Applications of
Other examples of reactions for which poly- Oligopept ides
peptides can be used as enantioselective cata-
lysts are rather sparse but they do give impor- Stereoselective electrochemical reduction
tant directions for expansion of poly-leucine and oxidation reactions have been carried out
technology. It has been shown that palladium using electrodes coated with a range of homo-
binds to the peptide backbone (FRANCIS et al., polypeptides. Citraconic acid (39) (ABEet al.,
1996). Poly-L-leucine has been used in an 1983;NONAKA et al., 1983; ABE and NONAKA,
enantioselective palladium catalyzed carbony- 1983) and 4-methylcoumarin (41) (ABEet al.,
lation to give the (&)-lactone (37) (Fig. 12) and 1983) were reduced on poly-L-valine coated
gave better chiral induction than a range of graphite electrodes with moderate success
chiral alcohols (e.g., menthol, 1,l-bi-2-naph- (Fig. 13). Amazingly, the authors reported that
thol, and diethyl tartrate) and phosphines (BI- both poly-D- and poly-L-valine coated elec-
I
OH
39
A 41
0 2 , PdCl2, CUCl2.
PLL, HCl, THF,
18h,1t
Graphite electrode coated
with poly-L-valine,
Na&P04, ethanol, pH 6
37 49%yield, 61%ee
40 25% ee 42 43% ee
Fig. 13. Stereoselective reduction with poly-L-valine.
Tab. 6. Electrochemical Enantioselective Oxidation

of Sulfides to Sulfoxides with Poly-L-Valine Coated
Electrodes (KOMORIand NONAKA,1983,1984)
Pt electrode coated
..
4
with poly-pyrrole
and poly-L-valine
'%. ,o
PhNS'R * Ph+RJ
"Bu4BF4, aq MeCN
Fig. 12. Stereoselective carbonylation with poly-L-
leucine. 43a-f 44a-f
Entry Substrate R ee Yield

trodes reduced citraconic acid (and also mesa- [%I [Yo]
conic acid) to (S)-methylsuccinic acid (40)
(25% and 5% ee, respectively). This seemingly 1 43a Me 1 -
impossible result was probably due to differ- 2 43b "Bu 18 -
ent degrees of polymerization of each of the 3 43c 'B u 44 69

polypeptide samples, since although they had 4 43d 'Pr 77 56
opposite optical rotations these were not iden- 5 43e 'BU 93 45
6 43f 'C,H,, 54 -
tical in magnitude. More fruitful studies in-
volved the oxidation of phenyl sulfides (43) to
the corresponding sulfoxides (44).Partially re-
usable platinum electrodes were prepared by good enantioselectivity was observed (43e)
covalently coating with poly-pyrrole and then (Tab. 6) (KOMORIand NONAKA, 1983,1984).
dipping in a solution of poly-L-valine. Al- The selective epoxidation of the terminal al-
though the enantioselectivity of the electrodes kene bond of the hexaene squalene, is one of
diminished with each cycle of use, the activity the "landmark" achievements of organic syn-
could be almost wholly restored by redipping thesis.The result was rationalized as due to the
in the solution of poly-L-valine. In some cases polyene chain forming a coiled conformation
3 Poly-Leucine 507
in polar media which minimizes contact of the

non-polar chain with the solvent and shields
the internal alkene bonds from reaction with
the epoxidation reagent (VAN TAMELEN,
1968).This idea was extended by preparing ho-
mochiral peptide derivatives of (E,E)-farnesic
acid with the anticipation that the peptide
chain would induce a helical conformation
which would render epoxidation both regio-
and enantioselective.
Initial studies using hexa-L-phenylalanyl
methylester farnesate (45a; Fig. 14) gave poor
results, possibly because the material had low
solubility and aggregation to give p-pleated
sheet structures occurred. Insertion of a-ami-
no-iso-butyric acid (Aib) residues into the
peptide chain increased solubility and conse-
quently improved the results obtained. The
best results were achieved with the N-terminal
farnesoyl derivative of the nonapeptide; [L-
Phe-L-Phe-Aib],OBz (45b). Bromohydroxyla-
tion followed by base treatment gave the (R)-
epoxide (46b) but with only 25% chiral in-
duction, whereas epoxidation with m-chloro- 0 0
peroxybenzoic acid gave the (S)-enantiomer
0
(ent-46b) (12% ee) plus bis-epoxide.The enan-
tiocomplementary results with bromohydrox-
Ph NH2
ylationhase and peracid are consistent with
approach to the less hindered face of an alkene
bond in a right-handed a-helix (BUDTet al., 48 Pps NH2
49 cps
1986).
I
H2, 1200 psi, 47
,R
N
..
H 4-9% ee
H - N y0 H - H y 0
45a,b
a NBS, g1yme:water (5:1), 0 O C ;
b K2CO3, MeOH, 0 "C 50 51
Fig. 15. Stereoselective hydrogenation using a rhodi-

um polypeptide complex (Ac-Ala-Aib-Ala-Pps-
Ala-Ala-Aib-Cps-Ala-Ala-Aib-Ala
47).
R H
Hydrogenation reactions have been carried
46
out using rhodium and a derivatized oligomer
of alanine (47) (Fig. 15) with incorporation of
a R = (L-Phe)6-OMe
Aib to enhance secondary structure. Although
b R = (L-Phe-L-Phe-Aib)3-OBz;25% ee initially poor enantiomeric excess was ob-
Fig. 14. Regio- and enantioselective epoxidation of tained (GILBERTSON et al., 1996),an intriguing
farnesamide N-oligopeptides (BUDTet al., 1986). combinatorial strategy was adopted from this
approach (GILBERTSON and WANG,1996). A

63-member library was created, its generic fea-
tures were Ac-Ala-Aib-Ala-1-2-3-4-5-Ala-
Aib-Ala-NH,. The peptides either had two Pps
(cf. 48),two Cps (cf. 49) or one of each. In some
cases these residues were at positions 1 and 5 ,
in others they were adjacent to each other.The
remaining positions were taken with combina-
tions of Ala, Aib, Phe, Val, His, and Ile with the
52
objective of placing the latter four residues in
proximity to the metal. When the catalysts a Nap-(S)-Val-(S)-Phe
were used in the hydrogenation of (50) at 400 b Nap-(R)-Val-(S)-Phe
psi the highest enantioselectivity (51,18% ee), c Nap-(R)-Val-(R)-Phe
was achieved with Cps-Ala-Ala-Aib-Cps. A
general trend found was that the better cata-
lysts had Ala at positions 2 and 3 with another
amino acid at 4. It shows some of the potential
for accurate rational modification of single
amino acids in an oligomer so as to design
oligopeptides utilizing variation in side chains
in the assembly of a chiral scaffold.
A noteworthy failure is an attempted ster-
eoselective epoxidation of unfunctionalized
olefins using a metalloporphyrin strapped with
a peptide (Ac-Ala-Cys-Glu-Gln-Leu-Leu-Lys-
Glu-Leu-Leu-Gln-Lys-Cys-Ala-NH,) through 53 Nap-(5’)-Val-(S)-Trp
the cysteine sulfur atoms (GEIERand SASAKI, Fig. 16. Dipeptide ligands for titanium alkoxide cata-
1997).Despite no enantiodiscrimination being lyzed enantioselective hydrocyanation of aldehydes
observed, the study demonstrates a thorough (MORI et al., 1991; ABEet al., 1992; NITTAet al.,
rationalization of the design process (GEIER 1992).
and SASAKI, 1999; GEIERet al., 1999).
An elegant development of this methodolo-

gy is the titanium(1V)-catalyzed addition of
trimethylsilyl cyanide (TMSCN) to meso-
4 Use of Linear Di-,Tri- epoxides using a combinatorially optimized li-
gand (interesting examples in the series: ligand
and Tetrapeptides 56 I-IV and i-iv) for each substrate type
(57a-c and 59) (Tab. 8, Entries 1,2;7,s) (COLE
INOUE’Sconsiderable contribution to this et al., 1996; SHIMIZU et al., 1997).
whole field has also embraced linear dipep- The appendage of glycine as R3has provid-
tides attached to a Schiff base (52,53)(Fig. 16), ed increases of enantioselectivities of up to
which in the presence of titanium(IV), cata- 20% ee compared to R3= OMe with different
lyze enantioselective hydrocyanation (Tab. 7). ligands, for three substrates (Tab. 8, Entries 3,
Good enantioselectivity has been obtained 4; 10, 11; 12, 13). Interestingly it appears the
with a diverse range of aldehydes (54a-o) chirality of specific amino acids do not entirely
(MORIet al., 1991;ABEet al., 1992),with lower determine which product is the major enan-
temperatures providing higher enantiodis- tiomer in the reaction; the functionality of the
crimination. While Ile, Leu, Ala, and phenyl side chain is at least partially responsible (Tab.
glycine have also been studied as part of the 8, Entries 4,5,and 6 ) (SHIMIZU et al., 1997).
catalyst, Val, Phe, and Trp appear to provide Extension of this work has produced an
the best results (NI?TAet al., 1992). even more successful enantioselective addi-
4 Use of Linear Di-,
Tri- and Tetrapeptides 509
Tab. 7. Enantioselective Hydrocyanation of Aldehydes Using Titanium Dipeptide Complex Catalysts
1
R H
Ligands 52 or 53, toluene, HCN, Ti(OEt), or Ti(dPr),
*
HxOH
R CN
H04* H
Rx CN
54a-o (R)-55a-o (S)-55a-o
54a l a 54b 54c OPh 54d 54e 54f
54g 54h 54i 54j 54k
541 54m 54n 540

Entry Ligand Substrate Temp Time Product ee Conv.
[“CI PI [Yo1 [Yo 1
1 52a 54a - 40 4 (R)-55a, 86 85

2 52b 54a - 20 4 (S)-55a, 38 84
3 52c 54a - 40 7 (S)-55a, 84 86
4 53 54a - 40 3 (R)-55a, 88 88
5 53 54b - 40 7.5 (R)-55b, 90 88
6 53 54c -40 7.5 (R)-55c, 86 74
7 52c 54d -40, - 20 11,12 (S)-55d, 86 85
8 52a 54e -40 1.5 (R)-55e,54 99
9 52a 54f -40 1.5 (R)-55f, 74 99
10 52a 54g -40 18 (R)-55g, 81 82
11 52a 54h - 60 119 (R)-55h, 89 83
12 52a 54i - 20 22 (R)-55i, 85 85
13 52a 54j - 60 71 55j, 70 74
14 52a 54k - 60 20 55k, 37 22
15 52a 541 - 60 46 551,72 90
16 52a 54m - 60 143 55m,60 28
17 52a 54n - 60 143 55n,60 78
18 52a 540 - 40 69 550,68 57
5 10 12 Synthetic Enzymes -Artificial Peptides in Stereoselective Synthesis
Tab. 8. Titanium Dipeptide Complex Catalyzed Enantioselective meso-Epoxide Ring Opening with Trime-
thylsilyl Cyanide (COLEet al., 1996;SHIMIZU
et al., 1997)
Nq.*osiM+
58
Ti(O'Pr),, toluene, 4 'C, TMSCN
-- NyOsiMe,
"Pr "Pr Ti(O'Pr),, toluene, 4 "C,TMSCN "Pr "Pr

59 60
Entry Ligand 56 Substrate Product 58 or 60

R' R2 R3 n ee [YO] Yield [%]
1 I 11
... OMe 57a 1 64 56
2 I1 111 OEt 57a 1 75 57
3 I1 11 OMe 57a 1 63
4 I1 11 GlY 57a 1 83 72
5 I1 i GlY 57a 1 10
6 I1 iv GlY 57a 1 ent-SSa,58 -
7 I 11 OMe 5% 2 86 65
8 I1
...
111 OEt 5% 2 70 65
...
9 I1 111 GlY 57c 3 52
10 111 11 OMe 57c 3 69 -
11 111 11 GlY 57c 3 84 79
12 IV 11 OMe 59 - 58 -
13 IV 11 GlY 59 78 69
(< 39% after 48 h), but gradual addition of iso- amino acid without racemization. A similar
propanol provided the product in higher yield type of catalyst and approach can be seen with
and improved enantioselectivity with some another stereoselective Strecker reaction (SIG-
substrates. It is thought that the alcohol causes MAN and JACOBSEN, 1998) and epoxidation
slow in situ release of hydrogen cyanide from (FRANCIS and JACOBSEN,1999).
the TMSCN (KRUEGER et al., 1999).The use of Recently MILLERand coworkers have de-
the diphenylmethyl protecting group enables veloped tetrapeptide catalysts for the acyla-
the nitrile group and the amino protecting tion of alcohols incorporating a 3-( l-imidazo-
group to be cleaved simultaneously with 6 N ly1)-L-alanineresidue (64a shown as an N-acet-
hydrochloric acid to give the corresponding ylated intermediate; Fig. 17). The challenge in
4 Use of Linear Di-, Tri- and Tetrapeptides 511
Tab. 9. Titanium Dipeptide Complex Catalyzed Enantioselective Addition of Cyanide to Imines (Strecker
Reaction)
Ti(O’Pr), (0.10 equiv.), toluene, H

TMSCN (2 equiv.), PIOH
62a-g (1.5 equiv.) added over 20 h, 4 OC 63a-g
62,63 e f
a R3 = R4 = H
b R 3 = C 1 , R4 = H
c R3 = Br, R4 = H
d R 3 = H, R4 = OMe
Entry Ligand 61 Substrate Product 63a-g

R1 R* ee [YO] Yield [Yo]
1 OMe H 62a 97 82
2 c1 c1 62b 93 85
3 C1 c1 62c 94 93
4 c1 c1 62d 94 99
5 OMe H 62e 93 80
6 OMe H 62f 90 87
7 Br Br 62g 85 97
creating an “active site” with a short peptide is tance of hydrogen bonding was further dem-
to induce it to fold back upon itself, rather than onstrated by a solvent optimization study. The
form an extended structure. This is achieved in highest enantioselectivity was achieved in
this case by the combination of proline and Aib non-polar, non-Lewis base solvents, whereas
(Aib is a seemingly popular choice for synthet- protic solvents resulted in totally non-selective
ic peptides) to give a p-turn. The a-methylben- acylation. The role of the imidazole group in
zamide group was incorporated to provide 7r- the catalyst (64a) was demonstrated by replac-
stacking with the acylimidazolium ion. The cating it with a phenyl group (i.e., a phenylalanine
alyst (64a) showed good enantioselectivity in residue), to give an analog (64b) which did not
the acylation of a range of alcohols (e.g., 65) act as an acylation catalyst (MILLERet al.,
bearing an adjacent amide group, which pre- 1998).
sumably orientates the alcohol in the hydro- Further investigations studied the replace-
gen bonding array of the catalyst. The impor- ment of the C-terminal a-methylbenzamide
aR=
Z N
Q \
2-
d
BocHN 0
(X--H-N 0
\ ..,,,,, bR=Ph
- R 64 HObNHAc A C Q ~ N H A C
+
Ac20, toluene, CHCl,, 0 "C
rac-65 (2R73R)-65 (2S.38-66 84% ee

Fig. 17.Tripeptide benzamide catalyzed enantioselective acylation (MILLERet al., 1998).
group with phenylalanine, valine, or glycine to tion, but the enantioselectivity is also modulat-
give the tetrapeptide (67) (Tab. 10) and reed mainly by histidine, but to some extent by
placement of the L-proline residue by a D-pro- the C-terminal residue. For the L-proline based
line residue (68) (Tab. 11). catalyst (67), D-amino acids at the C-terminus
The diastereomeric catalysts (67) and (68) increase enantioselectivity, while the converse
give enantiocomplementary products with the is true for the D-proline based catalyst (68).
latter being more enantioselective in all cases. Evidently, the u-relationship is advantageous
Evidently the chirality of the proline residue for selective catalysis over the I-form. NMR
dictates which enantiomer undergoes acyla- and IR data were used to determine that the
Tab. 10. L-Proline Containing Tetrapeptide Catalysts for the Acylation of Alcohols (COPELAND
el al., 1998)
1
=
/
T N
N d
67 2-5 mol%
aR} OMe
R'
Ac20, toluene, CHCl,, 25 "C
rac-65 (2R,3R)-65 (2S.38-66

Entry Catalyst 67 S (2R,3R)-65 (2S,3S)-66 Conv.
R1 ee [%J ee [YO] ["/I
1 L-Phe 3.0 44 34 56
2 D-Phe 5.7 89 36 71
3 L-Val 3.4 54 35 61
4 D-Val 4.3 65 39 63
5 GlY 3.5 50 38 57
5 Summary and Future Directions 513
Tab. 11. D-Proline Containing Tetrapeptide Catalysts for the Acylation of Alcohols (COPELAND
et al., 1998)
HJ--(NHAc
V
68 2-5 mol% OMe
A q O , toluene, CHC13, 25 “C
i R1
*
rac -65 (2S.38-65 (2R,3R)-66

~
Entry Catalyst 68 S (2S,3S)-65 (2R,3R)-66 Conv.

R’ ee [Yo] ee [%I [Yo1
1 L-Phe 28 98 73 58
2 D-Phe 14 89 66 57
3 L-Val 21 99 63 61
4 D-Val 9.2 88 55 62
5 GlY 14 97 57 63
L-proline based catalyst (67) gives a type I1 ing of reagents and substrates (BURGERand
p-turn with one hydrogen bond and the D-pro- STILL,1995; FRANCIS et al., 1996; SEVERINet
line based catalyst (68) gives a type 11’ p-turn al., 1998).The chemistry for preparation of the
with two hydrogen bonds. This probably gives ligand (peptide) is very well understood with
a more rigid structure, which is the origin of facility for solid phase synthesis and good
the greater enantioselectivity of the latter cat- comprehension of their structure. Such com-
alyst (COPELAND et al., 1998). patibility offers the exciting possibility of mul-
tidomain peptides facilitating multiple stereo-
selective reactions tailored to specific require-
ments. Further exploitation of the versatility of
synthetic peptides as catalysts in stereoselec-
tive synthesis is inevitable.
Since the preparation of this chapter there
have been interesting studies using combina-
torial variation of peptides to optimize serine-
While successful examples of peptides being protease mimics (DE MUYNCK et al., 2000) and
used in stereoselective synthesis are currently in the search to find means of controlling cy-
limited in number, the few positive examples clizations of epoxy-alcohols to provide the en-
demonstrate a significant capacity for their vi- ergetically disfavored product (CHIOSIS, 2000).
able application. The trend towards combina- In addition to this, diphenylglycine has dis-
torially designed ligands, which allow adapta- played an interesting capacity for the enantio-
tion for individual substrates, increases the po- selective inclusion of sulfixides (AKAZOME et
tential importance. To this end peptides al., 2000).
uniquely offer a cheap, simple, enantiopure
(with both enantiomers available), diverse
range of subunits (amino acids) with the po-
tential for metal binding and hydrogen bond-
6 References synthesis of substituted phenyl glycidic esters,

Tetrahedron Lett. 31,6501-6504.
BENTLEY, P. A. (1999), The use of poly-leucine in
ABE,S., NONAKA,T. (1983), Electroorganic reactions stereoselective synthesis, Thesis, University of
on organic electrodes. Part 5. Durable chiral Liverpool.
graphite electrodes modified chemically with po- BENTLEY, P. A., BERGERON, S., CAPPI,M. W., HIBBS,
ly(L-valine) and poly(N-acryloyl-~-valinemethyl D. E. et al. (1997a), Asymmetric epoxidation of
ester), Chem. Lett., 1541-1542. enones employing polymeric a-amino acids in
ABE,S., NONAKA, T., FUCHIGAMI, T. (1983), Electro- non-aqueous media, J. Chem. SOC.,Chem. Com-
organic reactions on organic electrodes. 1. Asym- mun., 739-740.
metric reduction of prochiral activated olefins on BENTLEY,P. A., KROUTIL,W., LITTLECHILD, J. A.,
poly-L-valine-coated graphite, J. Am. Chem. SOC. ROBERTS, S. M. (1997b), Preparation of polyami-
105,3630-3632. no acid catalysts for use in Julia asymmetric epox-
ABE,H., NIITA,H., MORI,A., INOUE,S. (1992), A fa- idation, Chirality 9,198-202.
cile synthesis of optically active y-cyanoallylic al- BENTLEY, P. A., CAPPI,M. W., FLOOD,R. W., ROBERTS,
cohols using asymmetric hydrocyanation of a#- S. M., SMITH,J. A. (1998), Towards a mechanistic
alkenyl aldehydes followed by stereospecific [3.3] insight into the Julia-Colonna asymmetric epoxi-
sigmatropic chirality transfer of the cyanohydrin dation of a$-unsaturated ketones using discrete
acetates, Chem Lett.,2443-2446. lenghts of poly-leucine, Tetrahedron Lett. 39,
ADGER,B. M., BARKLEY, J. V., BERGERON, S., CAPPI, 9297-9300.
M. W., FLOWERDEW, B. E. et al. (1997), Improved BEZUIDENHOUDT, B. C. B., SWANEPOEL, A., Aucus-
procedure for JuliCColonna asymmetric epoxi- TYN,J. A. N., FERREIRA, D. (1987),The first enan-
dation of a#-unsaturated ketones: total synthesis tioselective synthesis of poly-oxygenated a-hy-
of diltiazem andTaxolTMside-chain, J. Chem. SOC., droxydihydro-chalcones, Tetrahedron Lett. 28,
Perkin Trans. 1,3501-3507. 48574860.
AKAZOME,M., UENO,Y., OOISO,H., OGURA,K. BOLM,C., BIENEWALD, F., SEGER,A. (1996), Asym-
(2000), Enantioselective inclusion of methyl metric autocatalysis with amplification of chiral-
phenyl sulfoxides and benzyl methyl sulfoxides ity, Angew. Chem. (Int. Edn. Engl.) 35,1657-1659.
by (R)-phenylglycyl-(R)-phenylglycyl and the BROWN, R. F. C., DONOHUE, A. C., JACKSON, W. R.,
crystal structures of the inclusion cavities, J. Org. MCCARTHY,T. D. (1994), Synthetic applications of
Chem. 65,68-76. optically active cyanohydrins. Enantioselective
ALLEN,J. V., ROBERTS,S. M., WILLIAMSON, N. M. syntheses of the hydroxyamides Tembamide and
(1998), Polyamino acids as man-made catalysts, Aegeline, the cardiac drug Denopamine, and
Adv. Biochem. Eng. Biotechnol. 63,126-143. some analogs of the bronchodilator Salbutamol,
ALLEN,J. V., DRAUZ,K.-H., FLOOD,R. W., ROBERTS, Tetrahedron 50,13739-13752.
S. M., SKIDMORE, J. (1999), Polyamino acid cata- BUDT,K.-H., VATELE, J.-M., KISHI,Y. (1986), Termi-
lyzed asymmetric epoxidation: sodium percarbo- nal epoxidation of farnesate attached to helical
nate as a source of base and oxidant, Tetrahedron peptides, J. Am. Chem. SOC.108,608CL-6082.
Lett. 40,5417- 5420. BURGER,M. T., STILL,W. C. (1995), Synthetic iono-
ALPER,H., HAMEL,N. (1990), Poly-L-leucine as an phores. Encoded combinatorial libraries of cy-
added chiral ligand for the palladium catalyzed clen-based receptors for Cu2+ and Co”, J. Org.
carbonylation of allylic alcohols, J. Chem. SOC., Chem. 60,7382-7383.
Chem. Commun.,135-136. CALLANT, D., COUSSENS, B., MATEN,T. V. D., DE
APPERLEY, D., NORTH,M., STOKOE, R. B. (1995),The VRIES,J. G., DE VRIES,K. (1992), NMR measure-
catalytically active conformation of cyclo-[(S)- ments and semi-empirical calculations in a first
His-(S)-Phe] as determined by solid state NMR, approach to elucidate the mechanism of enantio-
Tetrahedron:Asymmetry 6,1869-1872. selective cyanohydrin formation catalyzed by cy-
AUGUSTYN, J. A. N., BEZUIDENHOUDT, B. C. B., FER- clo-(S)-Phe-(S)-His, Tetrahedron: Asymmetry 3,
REIRA,D. (1990), Enantioselective synthesis of 401414.
flavonoids. Part 1. Poly-oxygenated chalcone CAPPI,M. W., CHEN,W. P., FLOOD,R. W., LIAO,Y. W.,
epoxides, Tetrahedron 46,2651-2660. ROBERTS, S. M. et al. (1998), New procedures for
BANFI,S., COLONNA, S., MOLINARI,H., JULIA, S., the Julia-Colonna asymmetric epoxidation: syn-
GUIXER,J. (1984), Asymmetric epoxidation of thesis of (+)-Clausenamide,J. Chem. SOC.,Chem.
electron-poor olefins. 5. Influence on stereoselec- Commun.,1159-1160.
tivity of the structure of poly-a-aminoacids used CHEN,W.-€?,ROBERTS, S. M. (1999), JuliCColonna
as catalysts, Tetrahedron40,5207-5211. asymmetric epoxidation of fury1 styryl ketone as a
BAURES, P.W., EGGLESTON, D. S., FLISAK, J. R., GOM- route to intermediates to naturally occurring styryl
BATZ,K. et al. (1990), An efficient asymmetric lactones,J. Chem. Soc., Perkin Trans. 1,103-105.
6 References 515
CHIOSIS, G. (2000), Study into the cyclization of an surfaces,Nature 381,5941.
epoxy-alcohol to the energetically disfavored FLISAK, J. R., GOMBATZ, K. J., HOLMES, M. M., JAR-
product by peptides from non-biased combinator- MAS, A. A., LANTOS, I. et al. (1993), A practical,
ial libaries, Tetrahedron Lett. 41,801-806. enantioselective synthesis of SK&F 104353, J.
COLE,B. M., SHIMIZU, K. D., KRUEGER, C. A., HAR- Org. Chem. 58,6247-6254.
R I ~ J., P. A,, SNAPPER, M. L., HOVEYDA, A. H. FRANCIS, M. B., JACOBSEN, E. N. (1999), Discovery of
(1996), Discovery of chiral catalysts through li- novel catalysts for alkene epoxidation from met-
gand diversity: Ti-catalyzed enantioselective ad- al-binding combinatorial libraries, Angew. Chem.
dition of TMSCN to meso-epoxides, Angew. (Int. Edn. Engl.) 38,937-941.
Chem. (Int. Edn. Engl.) 35,1668-1671. FRANCIS, M. B., FINNEY, N. S., JACOBSEN, E. N. (1996),
COLONNA, S., MOLINARI, H., BANFI,S., JULIA,S., MA- Combinatorial approach to the discovery of nov-
SANA, J., ALVAREZ, A. (1983), Synthetic enzymes el coordination complexes,J.Am. Chem. SOC.118,
4. Highly enantioselective epoxidation by means 8983-8984.
of polyaminoacids in a triphasic system: influence GEIER,G. R. I., SASAKI,T. (1997),The design, synthe-
of structural variations within the catalyst, Tetru- sis and characterization of a porphyrin-peptide
hedron 39,1635-1641. conjugate, Tetrahedron Lett. 38,3821-3824.
COLONNA, s., JULIA,s., MOLINARI, H., BANFI,s. GEIER,G. R. I., SASAKI,T. (1999), Catalytic Oxida-
(1984), Catalytic asymmetric epoxidation by tion of alkene with a surface-bound metallopor-
means of polyaminoacids in a triphase system, phyrin-peptide conjugate, Tetrahedron 55, 1859-
Heterocycles 21,548. 1870.
COLONNA, S., MANFREDI, A., SPADONI, M. (1987), GEIER,G. R. I., LYBRAND, T. P., SASAKI,T. (1999), On
Asymmetric syntheses catalyzed by natural and the absence of stereoselectivity in the catalytic
synthetic peptides, in: Organic Synthesis: Modern oxidation of alkenes with a surface-bound metal-
Trends for Organic Synthesis (CHIZHOV, O., Ed.), loporphyrin-peptide conjugate, Tetrahedron 55,
pp. 275-284. Oxford: Blackwell. 1871-1880.
COPELAND, G. T., JARVO, E. R., MILLER,S. J. (1998), GILBERTSON, S. R., WANG,X. (1996),The combinato-
Minimal acylase-like peptides. Conformational rial synthesis of chiral phosphine ligands, Tetrahe-
control of absolute stereospecificity, J. Org. dron Lett. 37,64754478.
Chem. 63,67846785. GILBERTSON, S. R., WANG,X., HOGE,G. S., KLUG,C.
DALY, W. H., POCHE,D. (1988),The preparation of N- A., SCHAEFER,J. (1996), Synthesis of phosphine-
carboxyanhydrides of a-amino acids using bis(tri- rhodium complexes attached to a standard peptide
chloromethyl)carbonate, Tetrahedron Lett. 29, synthesis resin, Orgunometallics 15,4678-4680.
5859-5862. HEANEY, H. (1993), Oxidation reactions using mag-
DANDA,H. (1991), Asymmetric hydrocyanation of nesium monoperphtalate and urea hydrogen per-
benzaldehyde catalyzed by (SR)-5-(4-imidazolyl- oxide, Aldrichim. Acta 26,3545.
methyl)-2,4-imidazolidinedione, Bull. Chem. SOC. HOGG,D. J.,.'F NORTH,M. (1993), Mechanistic stud-
Jpn. 64,3743-3745. ies on the asymmetric addition of HCN to alde-
DANDA, H., NISHIKAWA,H.,OTAKA, K. (1991),Enan- hydes catalyzed by cyclo-[(S)-His-(S)-Phe],Tetru-
tioselective autoinduction in the asymmetric hy- hedron 49,1079-1090.
drocyanation of 3-phenoxybenzaldehyde cata- HOGG,D. J. P., NORTH, M., STOKOE, R. B.,TEASDALE,
lyzed by cyclo-[(R)-phenylalanyl-(R)-histidyl], J. W. G. (1993), The oxidation of benzaldehyde to
Org. Chem. 56,6740-6741. benzoic acid catalyzed by cyclo-[(S)-His-(S)-
DE MUYNCK, H., MADDER,A., FARCY, N., DE CLER- Phe], and its implications for the catalytic asym-
CQ, P. J., PEREZ-PAYAN, M. N. et al. (2000), Appli- metric addition of HCN to aldehydes, Tetruhe-
cation of combinatorial procedures in the search dron:Asymmetry 4,1553-1558.
for serine-protease-like activity with focus on the HOGG,D. J. P., NORTH,M., STOKOE, R. B. (1994), A
acyl transfer step, Angew. Chem. (Int. Edn.) 39, conformational comparison of cyclo-[(S)-His-
145-148. (S)-Leu] and cyclo-[(S)-His-(S)-Phe],catalysts
DONG,W., PETTY, W. (1985), US. Putent 102,4,554. for asymmetric addition, Tetrahedron 50, 7933-
EBRAHIM, S., WILLS,M. (1997), Synthetic applica- 7946.
tions of polymeric a-amino acids, Tetrahedron: HULST,R., BROXTERMAN, Q. B., KAMPHUIS, J., FOR-
Asymmetry 8,3163-3173. MAGGIO, F., CRISMA, M. et a]. (1997), Catalytic
EHLER,K. W., ORGEL,L. E. (1976), N,N'-carbonyl- enantioselective addition of hydrogen cyanide to
diimidazole induced peptide formation in aque- benzaldehyde and p-methoxybenzaldehyde using
ous solution, Biochim. Biophys. Acta 434, 233- cyclo-His-(a-Me)Phe as catalyst, Tetrahedron:
243. Asymmetry 8,1987-1999.
FERRIS, J. l?, HILL,A.R.,LUI,R., ORGEL,L. E. (1996), ITSUNO, S., SAKAKURA, M., ITO,K. (1990), Polymer-
Synthesis of long prebiotic oligomers on mineral supported poly(amino acids) as new asymmetric
516 12 Synthetic Enzymes-Artificial Peptides in Stereoselective Synthesis
epoxidation catalyst of a$-unsaturated ketones, DRELL, S. J., MAYON, l?, MORGAN, E et a]. (1996a),
J. Org. Chem. 55,60474049. Development of the Julia asymmetric epoxida-
IYER,M. S., GIGSTAD, K. M., NAMDEV, N. D., LIPTON, tion reaction. Part 2. Application of the oxidation
M. (1996), Asymmetric catalysis of the Strecker to alkyl enones, enediones and unsaturated keto
amino acid synthesis by a cyclic dipeptide, J. Am. esters, J. Chem. Soc., Perkin Trans. 1,2837-2844.
Chem.SOC.118,491W911. KROUTIL, W., MAYON, l?, LASTERRA-SANCHEZ, M. E.,
JACKSON, W. R., JAYATILAKE, G. S., MAITHEWS,B. R., MADDRELL, S. J., ROBERTS, S. M. et al. (1996b),
WILSHIRE, C. (1988), Evaluation of some cyclic di- Unexpected asymmetric epoxidation reactions
peptides as catalysts for the asymmetric hydro- catalyzed by polyleucine-based systems, J. Chem.
cyanation of aldehydes, Aust. J. Chem. 41, 203- Soc., Chem. Commun.,845-846.
213. KRUEGER, C. A., KUNTZ,K. W., DZIERBA,C. D.,
JACKSON, W. R., JACOBS,H. A., KIM, H. J. (1992), WIRSCHUM, W. G., GLEASON, J. D. et al. (1999),Ti-
Spectroscopic characterization of the active form catalyzed enantioselective addition of cyanide to
of the “Inoue” dipeptides (cyclo-[(S)-Phe-(S)- imines. A practical synthesis of optically pure a-
His-]),Aust. J. Chem. 45,2073-2076. amino acids, J.Am. Chem.SOC.121,4284-4285.
JULIA,S., MASANA, J., VEGA,J. C. (1980), Synthetic LASTERRA-SANCHEZ, M. E., ROBERTS, S. M. (1995),
enzymes - highly stereoselective epoxidation of Enantiocomplementary asymmetric epoxidation
chalcone in a triphasic toluene-water-poly[(S)- of selected enones using poly-L-leucine and poly-
alanine] system, Angew. Chem. (Int. Edn. Engl.) o-leucine, J. Chem. Soc., Perkin Trans. 1, 1467-
19,929-931. 1468.
JULIA,S., GUIXER, J., MASANA, J., ROCAS,J., COLON- LASTERRA-SANCHEZ, M. E., ROBERTS, S. M. (1997),
NA, S. et al. (1982), Synthetic enzymes. 2. Catalytic An important niche in synthetic organic chemis-
asymmetric epoxidation by means of polyamino- try for some biomimetic oxidation reactions cata-
acids in a triphase system, J. Chem. Soc., Perkin lyzed by polyamino acids, Curr. Org. Chem. 1,
Trans. 1,1317-1324. 187-196.
JULIA,S., MASANA, J., ROCAS,J., COLONNA, S., AN- LASTERRA-SANCHEZ, M. E., FELFER, U., MAYON, P.,
NUNZIATA, R., MOLINARI, H. (1983), Synthetic en- ROBERTS,S. M., THORNTON, S. R., TODD,C. J.
zymes. 3. Highly stereoselective epoxidation of (1996), Development of the Julia asymmetric
chalcones in a triphasic toluene-water-poly[(S)- epoxidation reaction. Part 1. Application of the
alanine] system, Anales De Quimica Serie C- oxidation to enones other than chalcones, J.
Quimica Organica Y Bioquimica 79,102-104. Chem.SOC.,Perkin Trans. 1,343-348.
KIM,H. J., JACKSON, W. R. (1992), Polymer attached LEE,D. H., GRANJA, J. R., MARTINEZ, J. A., SEVERIN,
cyclic dipeptidedes as catalysts for enantiosel- K., GHADIRI, M. R. (1996),A self-replicating pep-
ective cyanohydrin formation, Tetrahedron: tide, Nature 382,525-528.
Asymmetry3,1421-1430. MATTHEWS, B. R., JACKSON, W. R., JAYATILAKE, G. S.,
KIM,H. J., JACKSON, W. R. (1994), Substituent effects WILSHIRE, C., JACOBS, H. A. (1988), Asymmetric
on the enantioselective hydrocyanation of aryl hydrocyanation of a range of aromatic and ali-
aldehyde, Tetrahedr0n:Asymmetry5,1541-1548. phatic aldehydes, Aust. J. Chem. 41,1697-1709.
KOGUT,E. F.,THoEN,J. C., LIFTON, M. A. (1998), Ex- MILLER,S. J., COPELAND, G. T., PAPAIOANNOU, N.,
amination and enhancement of enantioselective HORSTMANN, T. E., RUEL,E. M. (1998), Kinetic
autoinduction in cyanohydrin formation by cyclo- resolution of alcohols catalyzed by tripeptides
[(R)-His-(R)-Phe], J. Org. Chem. 63,4604-4610. containing the N-alkylimidazole substructure, J.
KOMORI,T., NONAKA,T. (1983), Electroorganic reac- Am. Chem.SOC.120,1629-1630.
tions on organic electrodes. 3. Electrochemical MORI,A., IKEDA,~., KINOSHITA, K., INOUE, S. (1989).
asymmetric oxidation of phenyl cyclohexyl sul- Cyclo-((S)-leucyl-(S)-histidyl). A catalyst for
fide on poly(L-va1ine)-coated platinum elec- asymmetric addition of hydrogen cyanide to alde-
trodes, J. Am. Chem.SOC.105,5690-5691. hydes, Chem. Lett., 2119-2122.
KOMORI,T., NONAKA,T. (1984), Electroorganic reac- MORI,A., NITTA, H., KUDO,M., INOUE, S. (1991),
tions on organic electrodes. 6. Electrochemical Peptide-metal complex as an asymmetric cata-
asymmetric oxidation of unsymmetric sulfides to lyst. A catalytic enantioselective cyanohydrin syn-
the corresponding chiral sulfoxides on poly(ami- thesis, Tetrahedron Lett. 32,433311336.
no acids)-coated electrodes, J. Am. Chem. SOC. NEL,R. J. J., VANHEERDEN, P. S.,VANRENSBURG, H.,
106,2656-2659. FERREIRA, D. (1998), Enantioselective synthesis of
KRICHELDORF, H. R. (1987), a-Aminoacid-N-Car- flavonoids. Part 5. Poly-oxygenated P-hydroxydi-
boxyanhydridesand Related Heterocycles. Berlin: hydrochalcones, Tetrahedron Lett. 39,562>5626.
Springer-Verlag. NITTA,H., Yu, D., KUDO,M., MORI,A., INOUE,S.
KROUTIL,W., LASTERRA-SANCHEZ, M. E., MAD- (1992), Peptide-titanium complex as catalyst for
asymmetric addition of hydrogen cyanide to alde-
6 References 517
hyde, J.Am. Chem. SOC.114,7969-7975. use of sonochemistry in the asymmetric epoxida-

NOE,C. R., WEIGAND, A., PIRKER,S. (1996), Studies tion of substituted chalcones with sodium perbo-
on cyclic dipeptides, I: Aryl modifications of cy- rate tetrahydrate, Tetrahedron: Asymmetry 9,
clo-[Phe-His], Monatshefte fur Chemie 127, 3967-3969.
1081-1097. SEVERIN, K., BERGS,R.. BECK,W. (1998), Bioorga-
NOE, C. R., WEIGAND,A,, PIRKER,S., LIEPERT,P. nometallic chemistry-transition metal complexes
(1997), Studies on cyclic dipeptides, 11. Methylat- with a-amino acids and peptides, Angew. Chem.
ed modifications of cyclo-[Phe-His], Monatshefte (Int. Edn. Engl.) 37,1634-1654.
fur Chemie 128,301-316. SHIMIZU, K. D., COLE,B. M., KRUEGER, C.A., KUNTZ,
NONAKA, T., ABE,S., FUCHIGAMI, T. (1983), Electro- K. W., SNAPPER, M. L., HOVEYDA, A. H. (1997),
organic reactions on organic electrodes. Part 2. Search for chiral catalysts through ligand diver-
Electrochemical asymmetric reduction of citra- sity: substrate-specific catalysts and ligand screen-
conic and mesaconic acids on optically active po- ing on solid phase,Angew. Chem. (Int. Edn. Engl.)
ly(amino acid)-coated electrodes, Bull. Chem. 36,1704-1707.
SOC.Jpn. 56,2778-2783. SHVO,Y., GAL,M., BECKER,Y., ELGAVI,A. (1996),
NORTH,M. (1992),A conformational study on cyclo- Asymmetric hydrocyanation of aldehydes with
[(S)-phenylalanyl-(S)-histidyl] by molecular mo- cyclo-dipeptides: a new mechanistic approach,
deling and NMR techniques, Tetrahedron 48, Tetrahedr0n:Asymmetry 7,911-924.
5509-5522. SIGMAN, M. S., JACOBSEN, E. N. (1998), Schiff base
NORTH,M. (1993), Catalytic asymmetric cyanohy- catalysts for the asymmetric Strecker reaction
drin synthesis, Synlett,807320. identified and optimized form of parallel synthet-
OKU,J.-I., INOUE,S. (1981),Asymmetric cyanohydrin ic libraries, J. Am. Chem. SOC.120,4901-4902.
synthesis catalyzed by a synthetic cyclic dipep- TANAKA, K., MORI,A., INOUE,S. (1990), The cyclic
tide, J. Chem. SOC.,Chem. Commun., 229-230. dipeptide cyclo-[(S)-phenylalanyl-(S)-histidyl] as
OKU,J.-I., ITO,N., INOUE,S. (1979),Asymmetric cya- a catalyst for asymmetric addition of hydrogen
nohydrin synthesis catalyzed by synthetic dipep- cyanide to a1dehydes.J. Org. Chem. 55,181-185.
tides, 1,Makromol. Chem. 180,1089-1091. VANRENSBURG, H., VANHEERDEN, P. S., BEZUIDEN-
OKU,J.-I., ITO,N., INOUE,S. (1982),Asymmetric cya- HOUDT, B. c. B., FERREIRA, D. (1996), The first
nohydrin synthesis catalyzed by synthetic dipep- enantioselective synthesis of trans- and cis-dihy-
tides, 2, Makromol. Chem. 183,579-586. droflavonols, J. Chem. SOC., Chem. Commun.,
Pu, L. (1998), Recent developments in asymmetric 2747-2748.
catalysis using synthetic polymers with main VANTAMELEN, E. E. (1968), Bioorganic chemistry:
chain chirality, Tetrahedron: Asymmetry 9, 1457- Sterols and acyclic terpene epoxides, Acc. Chem.
1477. Res. 1,111-120.
RAY,P. C., ROBERTS, S. M. (1999), Overcoming dia- YADAV, V. K., KAPOOR,K. K. (1997), 1,8-Diazobicy-
stereoselection using poly amino acids as chiral clo[5.4.0]undec-7-ene: a remarkable base in the
epoxidation catalysts, Tetrahedron Lett. 40,1779- epoxidation of a#-unsaturated lactones and oth-
1782. er enones with anhydrous t-BuOOH, Tetrahedron
SAVIZKY, R. M., SUZUKI, N., BovE, J. L. (1998), The Lett. 51,85733584.
Index
A acylation, enantioselective -, tripeptide benzamide

AAAD see aromatic-L-amino-acid decarboxylase catalyzed - 510ff
AAD see acetoacetate decarboxylase - of alcohols, use of tetrapeptide catalysts 512f
A a D see aspartate a-decarboxylase acyloin condensation 393
abzymes see also catalytic antibodies - pyruvate decarboxylase mediated - 49
- industrial future of 446 - yeast catalyzed - 366
- screening via cell growth 445 adenosine triphosphate (ATP), and phosphodies-
- semi-synthetic - 420 ter formation 232
acetal, hydrolysis of, use of catalytic antibodies - structure of 222
432ff, 465 adenylate kinase, phosphorylation by 226
acetate kinase, phosphorylation by 224 Alcaligenes bronchisepticus, decarboxylation of a-
acetoacetate decarboxylase (AAD) 58ff aryl-m-methylmalonates 73
- Clostridium acetobutylicurn 5% alcohol dehydrogenase, horse liver 362f, 372f,
- decarboxylation of acetoacetate, mechanism 60 379f
acetoacetic acid, decarboxylation of, abiotic mech- - yeast, keto ester reduction 359ff
anism 59 - - ketone reduction 359
- - by acetoacetate decarboxylase 60 alcohols, acylation of, use of tetrapeptide cata-
acetoin 63f lysts 512f
a-acetolactate, biosynthesis of 64 - conversion to aldehydes, by Pichia pastoris 345
- decarboxylation of, by acetolactate decarbox- - flavor-active -, production of 345f
ylase 63 aldehyde-lyases 45, 89f
acetolactate decarboxylase 62ff aldehydes, asymmetric hydrocyanation of, cata-
- of Bacillus sp. 63f lyzed by cyclo-[(S)-Phe-(S)-His)] 496
acetolactate synthase 91 - enantioselective hydrocyanation of, use of titan-
acetone, production by Clostridium acetobutyli- ium dipeptide complex catalysts 508f
cum 61f - flavor-active -, production of 345f
acetyl phosphate, phosphorylation potential 231 aldol addition 7ff
aconitase 109ff aldol reaction 388f
cis-aconitate, decarboxylation of, by aconitate de- - use of catalytic antibodies 472f
carboxylase 65 aldolases 6ff
aconitate decarboxylase 64f - asymmetric carbonxarbon bond formation 365
- decarboxylation of cis-aconitate 65 - classification of 7
- of Aspergillus terreus 64f - dihydroxy-acetone phosphate-dependent - 7ff
acyl cleavage reaction, transition state analogs - glycine-dependent - 19f
411 - phosphoenolpyruvate-dependent - 15ff
acyl transfer reactions, tetrahedral intermediates - pyruvate-dependent - 15ff
410 - 2-deoxyribose 5-phosphate aldolase (DERA)
- use of catalytic antibodies 474ff 17ff
acylamide, production of 287f algae, marine -, production of iodomethane 190
acylases, production of non-natural amino acids - - source of halometabolites 178
285f alicyclic biotransformation products 367ff
- L-stereospecificity 356 aliphatic biotransformation products 353ff
520 Index
aliphatic ester, hydrolysis of, use of catalytic anti- - production stages 408
bodies 451ff - sequence-specific peptide cleavage by 420
alkaline phosphatase, phosphorylation by 226 - structure of 404ff
alkaloids, chlorinated - 185 - - antibody 48G7 411f
alkenes, epoxidation of, use of poly-L-leucine 503 antibody catalysis, hydrolysis of 421
- halogenation of 196f - spontaneous covalent - 421
alkyl mercury-lyase 143 - spontaneous features of 421ff
alkynes, halogenation of 197 - spontaneous metal ion 422f
amidases, production of non-natural amino acids - transition state stabilization 423f
285f 6-APA see 6-aminopenicillanic acid
- synthesis of pharmaceutical precursors, kilo- L-arginine, decarboxylation of, by arginine decar-
gram-scale routes 285 boxylase 80
amides, hydrolysis of, use of catalytic antibodies arginine decarboxylase 80
438f, 461f arginine kinase 224ff
amination, use of catalytic antibodies 476 - phosphorylation by 224ff
amines, large-scale resolution of 279f aristeromycin 230
- - involving a Pseudomonas lipase 279f - phosphorylation of 230f
amino acid production, engineering novel bio- aroma chemicals see also natural flavors
chemical pathways 324ff - natural -, carboxylic acids 344f
- L-lysine 321ff - - fermentative production of 333ff
- - flavor-active alcohols 345f
- L-phenylalanine 314ff
- - flavor-active aldehydes 345f
- L-threonine 321ff
- microbial pathways 313ff
- - flavor-active lactones 340ff
- - methyl ketones 347
amino acids, chlorinated - 185
- - phenolic compounds 346f
- natural -, production of 285
- - vanillin 334ff
- non-natural -, 285f
aromatic L-amino acid decarboxylase (AAAD),
D-amino acids, production of 326
deactivation of 84
S(L-a-aminoadipy1)-L-cystein-D-valine synthetase
- decarboxylation of tryptophan L-tryptophan 83
385
aromatic biotransformation products 390ff
~-2-aminobutyrate,novel biosynthetic pathway
aromatic compounds, chlorinated - 188
324f
- selective hydroxylation of 390
7-aminocephalosporanic acid, biocatalytic route Arthrobacter lipase 368f
280 aryl esters, hydrolysis of, tetrahedral interme-
1-amino-1-deoxy-D-sorbitol, oxidation of, by Glu- diate 406f, 455ff
conobacter oxydans 300ff - - use of catalytic antibodies 406f
- - protection groups 302
aspartame, manufacture of 125
- - pyridine formation from 6-amino-6-deoxy-~- - - commercial process 2861
sorbose 302 aspartame synthesis, enzymatic - 355
- - time course 304 aspartase 126ff
- - with Gluconobacter oxydans 304
- biotechnology of 128f
6-aminopenicillanic acid (6-APA), production of, - covalent modification 127
using penicillin G acylase 280 - of Bacillus sp. 126ff
aminosorbitol, regioselective oxidation of, with - of E. coli 126ff
Gluconobacter oxydans 295 L-aspartate, use of 128
ammonia lyases 47, 125 a-aspartate decarboxylase, mechanism of decar-
Amycolatopsis, vanillin production by 339f boxylation 75
angiotensin I1 356 aspartate a-decarboxylase (AaD) 72ff
angiotensin synthesis, use of thermolysin 355f - structure 72
antibiotics, chloroamphenicol 178 aspartate 4-decarboxylase 74ff
- chlorotetracycline 178 Aspergillus niger, stereospecific hydroxylation
- griseofulvin 178 373f
antibodies, affinity for transition state analog, Aspergillus terreus, aconitate decarboxylase 64f
screening of 409 ATP see adenosine triphosphate
- function of 404 azasugars, structure of 12
- galactopyranosidase 434 - synthesis of, use of rabbit muscle aldolase 10f
- glycosidase, generation by in vitro immuniza-
tion 434
Index 521
B - X-ray crystal structure of 195
Bacillus sp., acetolactate decarboxylase 63 butanol, production by Clostridium acetobutyli-
- aspartase 126ff cum 61f
bait and switch strategy, generation of catalytic
antibodies 412ff
bakers’ yeast 31f C
- acyloin condensation 23ff C4-dicarboxylic acids, manufacture of 108
- Diels-Alder reaction 30 CA see carbonic anhydrase
- esterase of 370 Caldariomyces fimago, haloperoxidase of 197
- Michael addition 31f - heme chloroperoxidase of 193
- pyruvate decarboxylase of 23ff caldariomycin, chlorination by a chloroperoxid-
- - synthesis of solerone 27 ases 181
- synthesis of lanosterol analogs 382 carbamatase, antibody 444f
- transaldolase 20 - medical potential 444f
- transketolase 20 carbamate ester, hydrolysis of, use of catalytic an-
- 2,3-oxidosqualene lanosterol cyclase 29f tibodies 461
basidiomycetes, production of halometabolites carbapenem antibiotic 350f
176 - synthesis of 353f
Beauveria bassiana, synthesis of (R)-2(4-hydroxy- carbazoles, chlorinated - 187
phen0xy)proprionic acid 282 carbocation cyclizations, use of catalytic antibod-
benzaldehyde, stereoselective hydrocyanation of, ies 43Of
use of cyclic dipeptides 493ff carbohydrate analogs, synthesis of 17f
benzaldehyde derivatives, stereoselective hydro- carbohydrate hydro-lyases 115ff
cyanation of 493 carbohydrate lyases 115ff
benzofurans, chlorinated - 187 carbohydrate synthesis, use of rabbit muscle
benzoylformate decarboxylase (BFD) 65ff aldolase 1Of
- of Pseudomonas putida 6% carbohydrates, kinetic glycosylation 246f
benzylformate decarboxylase (BFD), decarboxyla- - thermodynamic glycosylation 246f
tion of [p-(bromomethyl)benzoyl]formate, carbon-carbon bond formation reactions Sff,
mechanism 67 365ff, 382,388,393
Bertrand-Hudson rule 299ff carbon-carbon lyases 44f, 47ff
betapol, production of 289 carbon dioxide, hydration of, by carbonic anhy-
BFD see benzoylformate decarboxylase drase 100
biocatalysis, thermodynamic cycle 424 carbon-halide lyases 142f
biocatalysts, industrial use of 278ff carbon-nitrogen lyases 47, 125ff
biohalogenation, commerical application of 201f carbon-oxygen lyases 46,98ff
- enzymology of 192ff carbonates, hydrolysis of, tetrahedral interme-
- mechanistic aspects of 184ff diates 406f
biotin, enzymic synthesis of 384f - - use of catalytic antibodies 406f, 459f
biotransformation products, alicyclic - 367ff carbonic anhydrase (CA) 99f
- aliphatic - 353ff - hydration of carbon dioxide, mechanism 100
- aromatic - 390ff carboxykinases 84f
- heterocyclic - 384ff - listing of 85
- polycyclic - 376ff carboxylesterase NP, synthesis of (S)-naproxen
- - use of alcohol dehydrogenases 382f 281
p-blockers, synthesis of 385 carboxylic acids, fermentative production of 344f
Brevibacterium flavum, immobilized whole cells, - hydroxylation of, by Pseudomonas putida 363f
fumarase activity in 107ff - used in flavor compositions, sensoric description
brewers’ yeast, pyruvate decarboxylase of 25 of 344
bromine 184 carboxyl-lyases 44,47ff
- content of the earth 178 L-carnitine, biocatalytic route to 288f
bromoperoxidases, isolated enzymes 194 catalysis, free energy of activation 406
- producing cells 194 catalytic antibodies 403ff
- sequences from Streptomyces venezuelae 182 - - see also abzymes
- turnover number 179 - acyl-transfer reactions 412f, 474ff
- X-ray crystal structure of 195 - - hapten design 412f
brompoperoxidases, of Streptomyces aureofaciens - aldol reactions 472f
19.5 - amination reactions 476
522 Index
- p-elimination reactions, hapten design 412f - isomerizations 468f

- bimolecular associative and substitution proc- - Kemp decarboxylation 419f
esses 472ff - ketalization in water 46.5
- carbamatase 444f - medical applications 441ff
- carbocation cyclizations 430f - nucleophilic substitution 477
- cationic cyclization 471f - oxidations 477f
- - of polyenes 430f - peptide bond formation 418f
- changing regio- and stereochemistry of reac- - peroxidase-like - 421
tions 426ff - porphyrin metalation 477
- cleavage of, acetals 432ff - prodrug activation 442ff
- - carbamate prodrugs 444f - rearrangements 469f
- - glycosides 432ff - redox reactions 477ff
- - phosphate esters 435 - reductions 478f
- conjugate addition 477 - resolution of diastereoisomers 432f
- conversion chorismic acid into prephenic acid - retro-aldol reactions 468
416 - retro-Henrv reaction 468
- cycloreversions 467 - ring closure reaction, reversal of kinetic con-
- decarboxylations 466f trol 427ff
- detoxification by 441f - side chains, interactions with transition state
- “Diels-Alderase” 417ff analog 417
- Diels-Alder cycloadditions 418, 426ff, 473 - substrate desolvation 419f
- - regioselectivity 426f - supplementation of chemical functionality
- - stereoselectivity 426 42Off
- disfavored regio- and stereoselectivity 427ff - syn-elimination, of p-fluoroketones 429
- eliminations 465f - - of selenoxide 419ff
- epoxide opening 471 cationic cyclization, use of catalytic antibodies
- esterolytic -, hapten design 414 471f
- formation of isomeric decalins 431 CDP-ascarylose 118ff
- generation of, biochemistry 409f - biosynthesis of, by Yersinia pseudotuberculosis
- - chemistry 407ff 118
- - hapten for phosphodiester cleavage 436f C-glycosides, synthesis of, by rabbit muscle
- - immunonology 409 aldolase 13
- - methods for 407ff chalcone, epoxidation of, use of poly-L-alanine
- - molecular biology 410 499f
- - suicide substrate 434f chitooligosaccharides, synthesis by transglycosyla-
- hapten design 410ff tion 251
- - bait and switch 412ff chloroamphenicol 178ff
- - control of translational entropy 417ff chlorinated aromatics, from basidiomycetes 176
- - entropic trapping 415ff chlorine 184
- hydrolysis of, acetal 465 - content of the earth 178
- - aliphatic esters 451ff chloromethane, anthropogenic inputs 184
- - amides 438f, 461f - output of volcanoes 184
- - aryl esters 406f, 455ff chloroperoxidases, cloning from human eosino-
- - carbamate esters 461 phils 201
- - carbonates 406f, 459f - halide-dependent reactions 180
- - cocaine 441f - isolated enzymes 194
- - enol ether 465 - producing cells 194
- - epoxide 465 - sequenced from microbes 182
- - ether 464 - turnover number 179
- - glycoside 464 chlorotetracycline 178f
- - ketal 46.5 chorismate, common aromatic pathway 316
- - phosphate esters 463f chorismate mutase 415f
- - phosphotriesters 437 - deregulation of 317ff
- - trifluoramphenicol 439f - transition state 416
- hydrolytic and dissociative processes 451ff - transition state analog 416
- induction of catalysis, by reactive immuniza- chorismic acid, conversion into prephenic acid, ki-
tion 439ff netic parameters 416
- intramolecular processes 468ff - - thermodynamic parameters 416
Index 523
(+)-trans chrysanthemic acid, synthesis of, using - - mechanism 497ff
an esterase from Arthrobacter globiformis 283 - - optimal substrate 492
chymotrypsin 356 - - production of natural products and drugs
a-chymotrypsin, dihydrocinnamate ester hydroly- 496
sis 376f - hydroxyanation by, optimal conditions 492
- stereoselectivity of 354 - stereoselective hydrocyanation by, of benzalde-
cinnamaldehydes, biotransformation products of hyde 493ff
26f - - of benzaldehyde derivatives 493ff
citrate dehydratase 109 - use in stereoselective synthesis 492ff
citric acid cycle, lyases in 48 - used for enantioselective hydrocyanation, inter-
Citrobacter freundii, tyrosine-phenol lyase 95ff molecular hydrogen bonding 497
clausenamide, preparation of, using poly-leucine cyclitols, synthesis of 13
catalyzed epoxidation 501f P-cyclodextrin 142
Clostridium acetobutylicum, acetoacetate decar- cyclodextrin glycosyltransferases, bacterial - 267f
boxylase 59ff cyclopropanes, halogenation of 197
- production of, acetone 61f cycloreversions, use of catalytic antibodies 467
- - butanol 61f cytidine triphosphate (CTP), and phosphodiester
Clostridium beijerincki, isopropanol production formation 232
62
Clostridium tetanomorphum, Pmethylaspartase
129 D
clozylacon, synthesis of 108 DAGD see dialkylglycine decarboxylase
cocaine, hydrolysis of, use of catalytic antibodies DAHP synthase 315
441f - activity, deregulation of 317
cocoa butter equivalents, lipase catalyzed synthe- DDT, dehydrochlorination of 206
sis 289 - dehydrohalogenation of 205f
compactin, synthesis by yeast alcohol dehydrogen- y-decalactone, formation of 340ff
ase 360 - - Poxidation pathway of ricinoleic acid 342
conjugate addition, use of catalytic antibodies - - by Yarrowia lipolytica 341f
477 - sensoric description of 341
corynebacteria, biochemical pathway engineering decalins, formation of isomeric -, use of catalytic
in 321 antibodies 431
- biosynthetic pathway of, L-hornoserine 323 decarboxylation, of a-acetolactate 63
- - L-isoleucine 323 - of acetoacetic acid 59f
- - L-lysine 323 - of cis-aconitate 65
- - L-methionine 323 - of L-arginine 80
- - t-threonine 323 - of dimethylglycine 87
- overproduction of amino acids 322 - of fluoropyruvate 54, 56
Corynebacterium glutamicum, production of, glu- - of L-histidine 81
tamate 321ff - of L-lysine 80
- - lysine 321ff - of malonic acid 69
- - threonine 321ff - of malonyl-CoA 69
coryneform bacteria, production of phenylalanine - of a-methylornithine 79
314 - of L-ornithine 79
creatine kinase 224ff - of orotidine-5 '-phosphate 82
- phosphorylation by 224ff - of oxaloacetate 56
CTP see cytidine triphosphate - of phenylpyruvate 86
cumenes, hydroxylation of 39Of, 392 - of L-tyrosine 82
curcumin, as substrate for vanillin production 335 - pyruvate decarboxylase mediated - 49
- hydrolysis of 335 - - catalytic sequence 52
cyanohydrin formation, enzymatic - 366 - use of catalytic antibodies 466f
cyclic dipeptides, catalysis of Strecker reaction dehalogenases 181ff
496f - classification of 182ff
- enantiodiscrimination mechanism 497f - commerical application of 211f
- hydrocyanation by 492ff - dehalogenation via epoxide formation 183
- - amino1 mechanism 498f - dehydrohalogenation 183
- - autoinduction 497 - glutathione-dependent - 205
- - imidazolekyanide salt mechanism 498 - halidohydrolase-type 204f
524 Index
- haloalcohol 205 - use of catalytic antibodies 473f

- hydrolytic dehalogenation 183ff Diels-Alder reaction, enantio- and diastereoselec-
- - classification of 183f tivity of 426
- oxygenolytic dehalogenation 182f - - for ortho-approach 426
- reductive dehalogenation 182 - in biosynthesis 3Off
dehalogenations 202ff - intramolecular - 30f
- aliphatic - 203 - use of catalytic antibodies 426ff
- catalyzed by specific enzymes 181 “Diels-Alderase”, antibody 417
- dioxygenase-catalyzed - 208ff dihydroflavonols, preparation of, using poly-leu-
- hydrolytic - 183, 210, 204f cine catalyzed epoxidation 501f
- monooxygenase-catalyzed - 210 dihydrofolate reductase 387
- of chlorinated aromatic compounds 207 dihydroxyacetone phosphate (DHAP), structure
- oxidative - 203f, 208 of 8
- oxygenolytic - 183 - synthesis of 8ff
- reductive - 182, 203,207 dihydroxyacetone phosphate analogs, structure of
- via epoxide formation 183 8
dehydratases 98f a$-dihydroxy acid dehydratase (DHAD) l l l f
dehydroalanine residues in peptides, formation - of Salmonalla typhimurium 112
of 134 diltiazem, commercial synthesis of, lipase cata-
dehydrochlorination, of DDT 206 lyzed- 279
- of lindane 206 - preparation of, using poly-leucine catalyzed
dehydrohalogenation l83,205f, 211 epoxidation 501f
- of DDT 205f dimethylglycine, oxidative decarboxylation of, by
- of lindane 205f dialkylglycine decarboxylase 87
3-dehydroquinate dehydratase (DHQD) lllf dioxins, chlorinated - 188
1-deoxynojirimycin 296ff - degradation of 207
- a-glucosidase inhibitor 297 dioxygenase 208ff
- industrial synthesis of 295 dipeptide ligands, enantioselective hydrocyanation
- production of, by chemical synthesis 299 of aldehydes 508
- - by extraction from plants 298 disaccharides, synthesis of, by glycosylation 253f
- - by fermentation 298f - by immobilized glycosyltransferases 258
- - combined biotechnological-chemical synthe- y-dodecalactone, formation of, from oleic acid
sis 299ff 343
- sources of 297f L-DOPA, synthesis of 95
- structure of 296ff - - hybrid pathway 98
2-deoxyribose-5-phosphate aldolase 17ff L-DOPA decarboxylase see aromatic L-amino acid
- acetaldehyde condensations 18 decarboxylase (AAAD)
- from Escherichia coli 17 dopamine, multi-enzyme synthesis of 98
- synthesis of carbohydrate analogs 17f drugs, preparation of, using poly-leucine catalyzed
3-deoxy-~-arabino-heptulosonate 7-phosphate epoxidation 501f
synthase see DAHP synthase - production of, using cyclic dipeptide catalyzed
deoxysugar synthesis 23 hydrocyanation 496
DHAD see a$-dihydroxy acid dehydratase - synthesis of, enzymic hydroxylation in 392
DHAP see dihydroxyacetone phosphate
DHQD see 3-dehydroquinate dehydratase
diabetes mellitus, treatment of, by Miglitol 298 E
dialkylglycine decarboxylase (DAGD) 86f E. coli, aspartase 126ff
- decarboxylation catalyzed by 88 - fumarases l O l f f
- transamination catalyzed by 88 eliminations, use of catalytic antibodies 465f
diaminopimelate decarboxylase, decarboxylation enantiomerically pure pharmaceutical interme-
of L-arginine 80 diates, synthesis of 278ff
dichlorophenol, degradation of 207 - - amines 279f
3,6-dideoxyhexoses, naturally occurring - 120 - - chiral C3 building blocks 283
3,6-dideoxysugars 117ff - - diltiazem 279
Diels-Alder cycloadditions, control of translation- - - naproxen 281f
al entropy 417 - - pyrethroid precursors 282f
- of tetrachlorothiophene and N-ethylphthalim- - - 6-aminopenicillanic acid 280
ide 418 - - 7-aminocephaIosporanic acid 280f
Index 525
endoglycosidases 255 FDP aldolase see fructose-1,6-diphosphate
engineering of microbial pathways, for amino acid aldolase
production 303ff fermentative production, of natural aroma chemi-
enol ether, hydrolysis of, use of catalytic antibod- cals 333ff
ies 465 ferulic acid, as substrate for vanillin production
enolase 112f 338ff
entropic trapping, rotational entropy 415ff - fed-batch formation 338f
- translational entropy 417ff - production of 336ff
enzyme catalysis, concept of 404ff - - as intermediate for vanillin production 336ff
- entropic trapping, rotational entropy 415ff - - by Pseudomonas sp. 337
- transition state stabilization 423f - - from eugenol 337
- enzyme-catalyzed reactions, synthetic applica- flavor-active alcohols, production of 345
tions of 351ff flavor-active aldehydes, production of 345f
enzyme reactions, multiple - 366 flavor-active lactones, fermentative production of
enzyme specificity, exploiting combinations 382 340ff
enzymes see also synthetic enzymes - sensoric description 341
- and carbon-carbon bond formation 5
fluorine 184
- in carbohydrate chemistry 243ff
fluorine metabolism 199ff
ephedrine, industrial synthesis of 24 - enzymes of 199ff
- production using the Knoll process 53f
fluoroacetate, formation by Streptomyces cattleya
- synthesis of 393 199f
- plant and microbial metabolite 190
epoxidation, of “chalcone-type” substrates, using
poly-L-leucine 502 fluoroacetone, production by plant homogenates
190
- of digeminal and trisubstituted alkenes, use of
fluorocitrate, biosynthesis of, catalyzed by aconit-
poly-L-leucine 503
ase 110
- poly-leucine catalyzed - 501f
- citrate synthase 199
- - preparation of natural products and pro-
- formation by 199
drugs 501f
pfluoroketones, syn-elimination of, use of catalyt-
- regio and enantioselective, of farnesamide-N-ol-
ic antibodies 429
igopeptides 507 fluoropyruvate, decarboxylation of, by pyruvate
- stereoselective, biphasic - 499f decarboxylase 54, 56
- - triphasic - 499f
fluorothreonine, biosynthesis of 199f
epoxides, formation of, by degradation of vicinal folate and tetrahydrofolate, interconversion of
haloalcohols 206f 387
- hydrolysis of, use of catalytic antibodies 465
N-formyl-1-amino-1-deoxy-D-sorbitol, biotransfor-
- opening of, use of catalytic antibodies 471
mation of, at industrial scale 303f
Erwinia herbicola, tyrosine-phenol lyase 95ff - - with Gluconobacter oxydans cells 303f
erythromycin, enzymatic synthesis of 358 fructose-l,6-diphosphate(FDP) aldolase 7ff
Escherichia coli, deoxyribose-5-phosphate - - see also rabbit muscle aldolase
aldolase 17 - aldol condensation 14
- phenylalanine hyper-secreting phenotype 321 - resolution of racemic aldehydes 9
esterases, microbial - 357f fucosyltransferases 259
- synthesis of (+)-trans chrysanthemic acid 283 fuculose 1-phosphate aldolase, overexpression of
ether glycoside, hydrolysis of, use of catalytic anti- 14
bodies 464 fumarases lOOff
eugenol, degradation of, by Pseudornonas sp. - biotechnology of 106ff
337f - class I lOlff
- for ferulic acid production 337 - - structure 101
exoglycosidases 255 - class I1 103ff
- - of Therrnus therrnophilus 109
- enzymology 104
F - hydration of acetylene dicarboxylate 102
farnesamide N-oligopeptides, regio- and enantio- - in immobilized Brevibacteriurn fravurn cells
selective epoxidation of 507 107ff
farnesyl pyrophosphate synthetase, from pig liver - non-natural substrates 105f
365 - of E. coli lOlff
fatty acids, chlorinated - 186 - role in anaerobic metabolism 101
526 Index
- stereochemistry 104f glycosidases 245ff

- structures of 104 - availability of 246
- substrate specificity 102 - immobilization of 268f
furans, chlorinated - 187 - specificity for glycosyl donor 246
furanyl acrolein, yeast biotransformation of 387 - synthesis of small oligosaccharides 249
- use in consecutive glycosylation reactions 268
glycosides, cleavage of, use of catalytic antibodies
G 432ff
GAD see glutamate decarboxylase - synthesis of, multiglycosylated substrates 255
D-galaCtOnate dehydratase 119 glycosidic linkages, formation of 243ff
galactopyranosidase 434 - - use of organic solvents 254
galactosyltransferases 25% glycosphingolipids, biosynthetic pathways 262f
- from bovine colostrum 265f glycosyl donors, activated -, commonly used -
gangliosides 262f 247
Gluconobacter oxydans 305 - anomeric configuration 247
- biotransformation of N-formyl-1-amino-1 deoxy- - availability to glycosyltransferases 256f
D-sorbitol, at industrial scale 303f glycosylation see also transglycosylation
- cells, fermentative production at industrial - by reverse hydrolysis 253ff
scale 304ff - - aqueous systems 253f
- continuous fermentation of 306 - - use of organic solvents 254
- in the synthesis of vitamin C 297 - diastereoselective - 248f
- oxidation of 1-amino-1-deoxy-D-sorbitol 300ff - disaccharide formation, regioselectivity of 250
- - protection groups 302 - glycosides as acceptors 249
- - pyridine formation from 6-amino-6-deoxy-~- - of cell surfaces 264
sorbose 302 - of non-natural disaccharides 266
- regioselective oxidation of aminosorbitol 295ff - whole-cell systems 266f
- D-sorbitol dehydrogenases 306 glycosylation reactions, isolation of products 269f
glucose, exogonic oxidation of 222 glycosylic bond, cleavage of, use of catalytic anti-
glucose-6-phosphate, enzymatic synthesis of 228f bodies 433f
glucosidase, and glycosyltransferase, consecutive glycosyltransferase activity, assay of 269
glycosylation reactions 268 glycosyltransferases 256ff
a-glucosidase inhibitors 297f - acceptor-donor analogs 264ff
- deoxynojirimycin 297ff - availability of, enzymes 256
- Miglitol 298ff - - glycosyl donors 256f
- nojirimycin 297ff - expression in insect cells 268
glucurate dehydratase 119 - expression in yeast 268
glutamate decarboxylase (GAD) 76ff - heterologous expression of 266f
- mechanism of decarboxylation 77 - immobilization of 258, 268f
glutarate diesters, hydrolysis of, use of pig liver - in glycoconjugate synthesis 261ff
esterase 353f - in oligosaccharide synthesis 258ff
N-glycans, biosynthesis of 263f - use in consecutive glycosylation reactions 268
0-glycans, biosynthesis of 263 - using non-nucleotide donor substrates 267f
glyceraldehyde, specific phosphorylation of 230 +
( )-goniofufurone, preparation of, using poly-leu-
glycerol, specific phosphorylation of 230 cine catalyzed epoxidation 501f
glycerol kinase, phosphorylation by 224 +
( )-goniopypyrone, preparation of, using poly-
glycidol butyrate, resolution of, using porcine pan- leucine catalyzed preparation 501f
creatic lipase 283 +
( )-goniotriol, preparation of, using poly-leucine
glycoconjugates, synthesis of 251ff catalyzed preparation 501f
- - by glycosyltransferases 261ff griseofulvin 178f
glycolipids, synthesis of 262f griseoviridin, enzymatic synthesis of 361
- - solid-phase methods 264 guaiacol, formation from vanillic acid 346
glycopeptides, enzymatic synthesis, using transgly-
cosylation 252
- glycosylation sites, N-linkage 263 H
- - 0-linkage 263 halide methyltransferase 198f
- synthesis of 263f - biosynthesis of chloromethane 198f
glycoproteins, synthesis of 263f halides, physicochemical properties 189
glycosidase antibody 434 halidohydrolases, classification of 205
Index 527
haloalcohol dehalogenases, formation of epox- HDC see histidine decarboxylase
ides 205 heme haloperoxidases 193
haloaliphatics, priority pollutants 203 - mechanism 195
halocompound transforming enzymes, synthetic heterocycles, chlorinated - 187
importance 179ff heterocyclic biotransformation products 384ff
halocompounds 173ff hexane squalene 506
- anthropogenic sources 175f hexokinase, phosphorylation by 226
- biogenic origins 184ff histidase 132ff
- biosynthesis 173ff - catalytic activity 134
- biotransformation 173ff - deamination of labeled L-histidine, mechanism
- distribution 175 137
- function 175ff - deamination of L-histidine, mechanism 138
- of basidiomycetes 176 - inhibition of 135
- of marine algae 178 - mutants 135, 139
halogenation, enhancement of bioactive efficacy L-histidine, decarboxylation of, by histidine decar-
179 boxylase 81
haloorganics, recalcitrance of 177 histidine decarboxylase (HDC) 81f
haloperoxidases 181ff hog kidney acylase (HKA) 356f
- assay methods 180 - stereocontrolled synthesis of a penicillin 356f
- bacterial -, catalytic mechanism 182 L-homoserine, aspartate derived amino acids, in
- basic mechanism 192 corynebacteria 323
- classification of 193 horse liver alcohol dehydrogenase, reduction of
- enantioselectivity of 180f four- to nine-membered cyclic ketones 379f
- heme, mechanism of 193, 195 horse liver alcohol dehydrogenase (HLADH)
- immobilization of 202 362f
- isolated enzymes 194 - oxidation reactions 362f, 372f
- natural sources of 192f HSDH see hydroxysteroid dehydrogenases
- non-heme nonmetal -, mechanism 195 hydantoinase, production of non-natural amino
- of Caldariomyces fumago 197 acids 285f
- pH optima 180 hydrocyanation 493ff
- producing cells 194 - asymmetric -, of aldehydes 496
- reactions of 196ff - stereoselective -, of benzaldehyde 493ff
- regiospecific biotranformations 198 - - of benzaldehyde derivatives 493ff
- stereoselective biotransformations 198 - use of cyclic dipeptides, amino1 mechanism
- temperature optima 180 498f
- vanadium 193ff - - autoinduction 497
Hammond postulate 406 - - imidazolekyanide salt mechanism 498
haptens, boronic acid, generation of catalytic anti- - - mechanism 497ff
bodies 438f hydrogenation, stereoselective - 507
- charged, generation of catalytic antibodies hydrolyases 46, 98f
412ff hydroxylation, enzymic -, in drug synthesis 390,
- design -, strategies 410ff 392
- dialkylphosphinic acid, generation of catalytic hydroxymandelonitrile lyase 90
antibodies 438 hydroxynitrilase (NHL), synthesis of pyrethroid
- for generating catalytic antibodies, for phos- precursors 282
phodiester cleavage 436f (R)-2-(4-hydroxyphenoxy)propionic acid, synthesis
- generation of catalytic antibodies, bait and of, use of Beauveria bassiana 282
switch strategy 412ff hydroxysteroid dehydrogenases (HSDH), regio-
- - carrier proteins for 409 specific reduction of ketones 378f
- - design of 410ff 3-hydroxy-y-decalactone, formation of 341ff
- - Diels-Alder cycloaddition 417f
- - entropic trapping 415ff
- - tetrahedryl intermediates 410f I
- - transition state analogs 410ff IDPC see indolepyruvate decarboxylase
- heterologous immunization strategy 414f IgG immunoglobulin, structure of 404f
- reactive immunization 439ff imidazoleglycerol phosphate dehydratase 114
- zwitterionic -, generation of catalytic antibod- immobilization, of glycosidases 268f
ies 414f - of glycosyltransferases 258, 268f
528 Index
- of haloperoxidases 202 lipids, chlorinated - 186

immunization, heterologous - 414ff - production of structured - 289
indolepyruvate decarboxylase (IDPC) 87ff lipoxygenases 363ff
indoles, chlorinated - 186 lyases 41ff
- halogenation of 196 - acting on poly-D-galacturonates 123
insect cells, expression of glycosyltransferases 268 - acting on polysaccharides 122ff
intramolecular processes, use of catalytic antibod- - classes 44ff
ies 468ff - definition 43
iodine 190 - in the citric acid cycle 48
iodomethane, production by marine algae 190 - nomenclature 43
iodoperoxidases, isolated enzymes 194 - systematic names 6
- producing cells 194 L-lysine, aspartate derived amino acids, in coryne-
isocitrate lyase 90 bacteria 323
isoeugenol, as substrate for vanilline production - bacterial production of 321ff
335 - - pathway engineering 321ff
L-isoleucine, aspartate derived amino acids, in co- - decarboxylation of, by lysine decarboxylase 80
rynebacteria 323 lysine decarboxylase 79f
isomerases, carbon+arbon bond formation 6
isomerizations, use of catalytic antibodies 468f
isopropanol, production by Clostridium beijer- M
incki 62 malate, routes to 105
maleate hydratase, of Pseudomonas pseudoali-
genes 114
K Malomonas rubra, malonate decarboxylation
Kemp decarboxylation, of 6-nitro-3-carboxybenzi- mechanism 71
soxazole 419 - malonyl-CoA decarboxylase 69ff
ketal, hydrolysis of, use of catalytic antibodies malonate decarboxylation, by Klebsiella pneumon-
465 iae, reaction mechanism 71
ketalization, use of catalytic antibodies 465 - by Malonomonas rubra, reaction mechanisms
ketoses, synthesis from amino acid synthons 10 71
Klebsiella pneumoniae, malonate decarboxylation - synthesis of chiral - 106
mechanism 71 malonic acid, decarboxylation of, abiotic mecha-
- malonyl-CoA decarboxylase 69ff nism 69
Knoll process, for the manufacture of L-phenyl malonyl-CoA, decarboxylation of, by malonyl-
carbinol 53f CoA decarboxylase 69
malonyl-CoA decarboxylase, of Klebsiella pneu-
moniae 69ff
L - of Malomonas rubra 69ff
/?-lactam, enzymatic synthesis of 360f malonyl-CoA decarboxylase (MCD) 68ff
lactones, flavor active -, production of 340ff mandelonitrile lyase 90
lanosterol, structure of 28 mannosyltransferase 260f
lanosterol cyclase 382 L-methionine, aspartate derived amino acids, in
Leloir glycosyltransferases 267 corynebacteria 323
leukotriene analogs 380f methoxycarbonyl phosphate, phosphorylation po-
ligases, carbon-arbon bond formation 6 tential 231
lindane, dehydrochlorination of 206 methyl ketones, formation by Penicillium roque-
- dehydrohalogenation of 205f forti 347
linear dipeptides, use in stereoselective synthesis /?-methylaspartase 129ff
508ff - addition of amines to substituted fumarates
lipases 368ff, 385f 132
- commercial synthesis of diltiazem 279 - addition of ammonia to substituted fumarates
- of Mucor sp. 385f 131
- of Pseudomonas sp. 385 - bearing the Ser-Gly-Asp sequence 130
- synthesis of, cocoa butter equivalents 289 - inhibitors of 130
- - pharmaceutical precursors, at kilogram-scale - mechanism of action 133
routes 284 - of Clostridium tetanomorphurn 129
- - structured triglycerides 289 a-methylornithine, decarboxylation of, by orni-
lipid modification 289 thine decarboxylase 79
Index 529
mevinolin, synthesis by yeast alcohol dehydrogen- nucleophilic substitution, use of catalytic antibod-
ase 360 ies 477
Michael addition, by bakers’ yeast 31f nucleoside kinase, phosphorylation by 226
microbial enzymes, oxidation reactions 373f nucleoside triphosphates (NTP), as phosphate
microbial esterases 357f source 228ff
microbial pathways, for amino acid production nucleotide phosphate metabolism 222
313ff
microorganism oxidation 380f
- preparation of leukotriene analogs 380f 0
microorganism reduction, of polycyclic com- OAD see oxaloacetate decarboxylase
pounds 378ff OCD see oxalyl-CoA decarboxylase
Miglitol 296ff ODC see ornithine decarboxylase
- a-glucosidase inhibitor 298 oligopeptides, farnesamide N-oligopeptides, regio-
- structure of 296 and enantioselective epoxidation of 507
monensin, synthesis of 358f - rhodium polypeptide complex, stereoselective
monooxygenase, synthesis of (R)-2(4-hydroxy- hydrogenation by 507f
phenoxy)proprionic acid 282 oligosaccharides, complex, assembly of 250f
monosaccharide carboxylic acid dehydratases - in vitro enzymatic synthesis 245
115ff oligosaccharide synthesis, use of glycosidases 249
- listing of 116f - use of glycosyltransferases 258ff
- of Pseudomonas putida 115 OPD see orotidine-5 ‘-phosphate decarboxylase

monothiophosphate, stereospecific phosphoryla- organic solvents, use in formation of glycosidic
tion of 229f linkages 254
Mucor sp. lipases, synthesis of heterocyclic com- organofluorine compounds 184
pounds 385f - naturally occurring - 189
mutagenesis, development of phenyl alanine over- organohalogens, natural - 184ff
producing organisms 315ff - - listing of 185ff
organoiodine compounds, isolated from marine
organisms 19Of
N L-ornithine, decarboxylation of, by ornithine de-
carboxylase 79
(S)-naproxen, synthesis of 281f
ornithine decarboxylase (ODC) 78f
- - with carboxylesterase NP 281
- of Trypanosoma brucei 78
natural aroma chemicals see aroma chemicals
orotidine 5 ‘-phosphate, decarboxylation of, by
natural flavors see also aroma chemicals protidine 5 ‘-phosphate decarboxylase 82
- definition of 334 orotidine-5 ’-phosphate decarboxylase (OPD) 82
natural products, preparation of, using poly-leu- overexpression, of fructose-1-phosphate aldolase
cine catalyzed epoxidation 501f 14
- production of, using cyclic dipeptide catalyzed - of rhamnose-1-phosphate aldolase 14
hydrocyanation 496 - of tagatose-1,6-diphosphate aldolase 14
negamycin synthesis 353f overproduction of amino acids 315ff
- use of pig liver esterase 353f oxalate decarboxylase 55f
NeuAc aldolase see sialic acid aldolase oxaloaceate, decarboxylation of, by oxaloacetate
NHL see hydroxynitrilase decarboxylase 56ff
nicotinamide, production of 287f oxaloacetate decarboxylase (OAD) 55ff
nitrilases 287f - decarboxylation of oxaloacetate 57f
nitrile hydratases, production of, acrylamide 287f - - mechanism 57
- - nicotinamide 287f - of Pseudomonas putida 57f
nitriles, pathways of hydrolysis of 287 Oxalobacter formigenes, oxalyl-CoA decarboxyl-
nitrogen mustards, cytotoxicity 443 ase 67f
- prodrug activation 443f oxalyl-CoA decarboxylase (OCD), of Oxalobacter
nojirimycin 296ff formigenes 67f
- a-glucosidase inhibitor 297 oxidation reactions 386ff
- structure of 296 - enzymatic- 386
NTP see nucleoside triphosphates - - synthesis of heterocyclic compounds 386ff
nucleic acid derivatives, hydrolysis of 235f - use of catalytic antibodies 477f
nucleic acids, chlorinated - 187 oxidative degradation 391f
nucleocidin 190 - enzymic -, of aromatic compounds 391f
2,3-oxidosqualene cyclase 28ff - feedback inhibition of prephenate dehydratase
- from pig liver 28ff 319
0x0-acid-lyases 45, 90f phenylalanine ammonia-lyase (PAL) 137ff
oxynitrilases 282 - deamination of phenylalanine 139f
- inhibitors 140
- of Rhodotorula glutinis 139ff
P - substrates 140
PAL see phenylalanine ammonia-lyase - - pyridyl cinnamates 141
Parkinson’s disease, synthesis of L-DOPA 95 phenylpyruvate, decarboxylation of, by phenyl-
PCB see polychlorinated biphenyls pyruvate decarboxylase 86
PDC see pyruvate decarboxylase phenylpyruvate decarboxylase 85
pectate lyases 124f pheromones, cockroach aggregation, halo-
pectic substances, cleavage of 125 organic- 177
- structure 124 - component, synthesis by yeast alcohol dehydro-
pectin lyases 125 genase 360
penicillin, stereocontrolled synthesis, using kidney - enzymatic synthesis of 361f
acylase 356f - synthesis of 22
penicillin acylase, use in transacylations 386 phosphate, pK, values 222
penicillin G, hydrolysis by penicillin acylase 386f phosphate ester, hydrolysis of, use of catalytic an-
penicillin G acylase (PGA), production of 6-ami- tibodies 463f
nopenicillanic acid 280 phosphate ester hydrolysis, by nuclease 236
Penicillium digitatum, stereospecific modification - by phosphatase enzymes 236f
of terpenoids 374 phosphate monoester, cleavage of, use of catalytic
Penicillium roqueforti, blue veined cheese flavor antibodies 435f
compounds 347 phosphate sources, inorganic phosphate 228
pentachlorophenol, degradation under aerobic - nucleoside triphosphates 228ff
conditions 210 phosphodiester, cleavage of, use of catalytic anti-
- reductive dehalogenation of 207 bodies 436f
PEP-CL see phosphoenolpyruvate carboxylases phosphodiester formation, coupling with adeno-
peptide bonds, formation of, by catalytic antibod- sine triphosphate 232
ies 418f - coupling with cytidine triphosphate 232f
peptide cleavage, sequence specific -, by an anti- - coupling with uridine triphosphate 233
body 420ff phosphodiesterase, phosphorylation by 226
peptide formation, by thermolysin 355f phosphoenolpyruvate 229ff
peptides see also synthetic enzymes - enzymatic synthesis of 229
- chlorinated - 185 - phosphorylation potential 229
pesticides, halogenated -, distribution of 177 phosphoenolpyruvate carboxylases (PEP-CL) 84f
PGA see penicillin G acylase - listing of 85
pharmaceutical intermediates see enantiomerically phosphonates, inhibitors of phosphodiester cleav-
pure pharmaceutical intermediates age 236
pharmaceutical precursors, kilogram-scale routes phosphoramidate esters, hydrolysis by alkaline
to, involving amidases 285 phosphatase 237
- - involving lipases 284 phosphoryl transfer 222ff
- - involving proteases 284f - cofactor regeneration 228
phenolic compounds, formation of 346f - mechanism of 224
phenols, chlorinated - 188 - phosphate source 228
- halogenation of 196 phosphoryl transfer enzymes 223ff
phenylacetate catabolism, pathway 66 - classification of 223ff
phenylalanine, biosynthetic pathway, rate limiting - listing of 225
steps 320 phosphoryl transfer reactions 223ff
- overproducing organisms 315ff - enzyme classes 223ff
- regulation of biosynthesis 315 - two groups of 223
- secretion from the cell 320f phosphoryl transfer reagents, phosphorylation po-
D-phenylalanine, engineering biochemical path- tentials of 227
way, for whole cell biosynthesis 327 phosphorylation 221ff
- novel biosynthetic pathway 325ff - enzymes 223ff
L-phenylalanine, bacterial production of 314ff - enzymic synthesis of heterocyclic compounds
- biosynthetic pathways 314f 389
Index 531
phosphotriester, hydrolysis of, use of catalytic an- prostaglandin synthons, use of horse liver alcohol
tibodies 437 dehydrogenase 372f
Pichia pastoris, alcohol conversion to aldehydes prostaglandins, chlorinated - 186
345 proteases, synthesis of pharmaceutical precursors,
pig liver esterase (PLE), specificity of 367f kilogram-scale routes 284f
- stereoselective hydrolysis 353f pseudo-enzymes see synthetic enzymes
I- synthesis of heterocyclic compounds 384f pseudoephedrine, industrial synthesis of 24
pig liver 2,3-oxidosqualene cyclase 28f Pseudomonas lipases, synthesis of p-blockers 385
P-0 bonds, cleavage of 235ff Pseudomonas pseudoalcalignes, maleate hydrat-
- formation of 228ff ase 114
- forming reactions, listing of 234f Pseudomonas putida 363f
pollutants, recalcitrant - 202 - benzoylformate decarboxylase 65ff
poly-alanine, immobilized -, preparation of 5OOf - formation of alicyclic compounds by oxidation
poly-L-alanine, epoxidation of, chalcone 499f reactions 374ff
- - “chalcone-type” substrates 499ff - hydroxylation of carboxylic acids 363
poly-leucine, epoxidation by 499ff - monosaccharide carboxylic acid dehydratases
- - preparation of natural products and pro- 115

drugs 501f - oxaloacetate decarboxylase 57f
- immobilized -, preparation of 501 - oxidation of styrene 375
poly-L-leucine, preparation of 503f Pseudomonas sp., eugenol degradation pathway
- stereoselective carbonylation by, palladium cata- 338
lyzed - 505f - production of ferulic acid 337
poly-L-valine, stereoselective electrochemical re- pyrethroid insecticides, using Arthrobacter lipase
duction by 505f resolution 369
polychlorinated biphenyls (PCB), degradation of pyrethroid precursors, synthesis of, use of a
207 monooxygenase 282
- - use of an esterase 283
- oxygenolytic cleavage of 209
- - use of oxynitrilases 282
- patterns of dechlorination 208
polycyclic biotransformation products 376ff pyrophosphate, p K , values 222
pyrroles, chlorinated - 186
- use of alcohol dehydrogenases 382f
pyruvate decarboxylase (PDC) 23ff, 49ff
polyenes, cationic cyclization of, use of catalytic - activation of 53
antibodies 430f
- acyloin condensation 23ff
polynucleotide synthesis, enzyme catalyzed phos-
- biotransformations 53ff
phate bond formations 389
- decarboxylation of fluoropyruvate 54, 56
polyol dehydrogenases 306 - mechanism 49ff
polyols, oxidation-of 300 - of Saccharomyces cerevisiae 50ff
- - according to the Bertrand-Hudson rule 301
- of yeast 54f
polypeptides, as epoxidation catalysts 499ff - of Zymomonas mobilis 49f, 53ff
porcine pancreatic lipase (PPL) 368ff - structure 49ff
- asymmetric hydrolysis 368f
pyruvate kinase, phosphorylation by 224
- catalyzed hydrolysis 358f
porphyrin metalation, use of catalytic antibodies
477 Q
potato lipoxygenase 365 quinolines, chlorinated - 187
PPL see porcine pancreatic lipase
prednisolone, multienzyme synthesis 382f
prephenate dehydratase, deregulation of 317ff R
- feedback inhibition, by L-phenylalanine 319 rabbit muscle aldolase (RAMA) 7ff
prodrugs, activation of, antibody mediated 442ff - synthesis of azasugars 1Off
- carbamate, cleavage by abzymes 444f - synthesis of carbohydrates 10f
- of chloramphenicol, hydrolysis of 442f - synthesis of cyclitols 13
- of 5-fluorodeoxyuridine, activation of 442f - use in synthesis of heterocyclic compounds
progesterone, biotransformation of 381 388f, 391
propionic acid, production of, by Propionibacter- rational entropy, in enzyme catalysis 415ff
ium sp. 345 reactive immunization, induction of catalysis in
prostaglandin synthesis, use of porcine pancreatic antibody binding sites 439ff
lipase 369f rearrangements, use of catalytic antibodies 469f
532 Index
redox reactions, use of catalytic antibodies 477ff sugars, synthesis of, by one-pot multiple enzyme
reduction reactions, catalyzed by yeast enzymes catalysis 18
370ff - - by two sep multiple enzyme catalysis 19
- use of catalytic antibodies 478f sulfides, electrochemical enantioselective oxidation
retro-aldol reaction, use of catalytic antibodies of, use of poly-L-valine 506
468 Symbiobacterium sp., tyrosine-phenol lyase 95ff
retro-Henry reaction, use of catalytic antibodies syn-eliminations, of selenoxide 41%
468 synthases, systematic names 6
rhamnulose-1-phosphate aldolase, overexpression synthetic enzymes 491ff
of 14 - artificial peptides in stereoselective synthesis
Rhizopus arrhizus, enzymatic reduction by 371f 491ff
rhodium polypeptide complex, stereoselective hy- - cyclic dipeptides 492ff
drogenation by 507f - poly-leucine 499ff
Rhodotorula glutinis, phenylalanine-ammonia - use of linear dipeptides 508ff
lyase 139ff - use of tetrapeptides 511ff
- production of L-phenylalanine 141 - use of tripeptides 510ff
- use stereoselective synthesis 492ff
S
Saccharomyces cerevisiae, pyruvate decarboxylase T
50ff. 54 tagatose-1,6-diphosphate aldolase, overexpression
Salmonella typhimurium, cY,/i-dihydroxyacid dehy- of 14
dratase 112 tartronate semi-aldehyde synthase 85f
screening of abzymes 445 - acyloin condensation of glyoxalate 86
selenoxide, syn-eliminations, parameters for 421 taxol, preparation of, using poly-leucine catalyzed
- - substrate desolvation 419ff epoxidation 501f
D-serine dehydratase 113 taxol synthesis, use of lipases 385f
L-serine dehydratase 113 TCTD see tetrachlorothiophene dioxide
Serratia marcescens, vanillin formation by 336 TDC see tyrosine decarboxylase
sialic acid, structure of 16 terpenes, chlorinated - 185
- enzymatic biosynthesis of 365
- synthesis by sialyl aldolase 257ff
terpenoid biosynthesis 28ff
sialic acid aldolase 15ff
tetrachlorothiophene dioxide (TCTD), Diels-Ald-
sialyltransferases 259f
er cycloaddition 418
solerone, structure of 27 tetrapeptide catalysts, D-proline based -, acylation
D-sorbitol dehydrogenases 306 of alcohols 512f
soybean lipoxygenase 365 - L-proline-based, acylation of alcohols 512
stereoisomeric alcohols, separation of, antibody tetrapeptides, use in stereoselective synthesis
mediated - 432 511ff
stereospecificity, of acylases 356 thermolysin, peptide synthesis 355f
steroids, biosynthesis of 28ff - production of aspartame 286f
- chlorinated - 186
Thermus thermophilus, fumarase 109
- hydroxylation of 381 thiamine pyrophosphate, structure of 50
steroid synthesis, microorganism reductions 378 thiophenes, chlorinated - 187
Strecker reaction, cyclic - dipeptide catalyzed - L-threonine, aspartate derived amino acids, in co-
496f rynebacteria 323
- use of titanium dipeptide complex catalysts - bacterial production of, pathway engineering
508ff 321ff
Streptococcus faecalis, tyrosine decarboxylase 83 threonine aldolase 19f, 89f
- tyrosine-phenol lyase 95ff - from mammalian tissues 19
Streptomyces aureofaciens, bromoperoxidase of - synthesis of amino acids 20
195 L-threonine dehydratase 113
Streptomyces cattleya, formation of fluoroacetate thyroxine, thyroid metabolite 191
199f titanium dipeptide complex 508
Streptomyces venezuelae, bromoperoxidases 182 a-tocopherol, biocatalytic synthesis, by pyruvate
structured lipids, production of 289f decarboxylase 27
structured triglycerides, production of 289 - enzymatic synthesis of 388ff
styrene oxidation, by Pseudomonas putida 375 TPL see L-tyrosine phenol-lyase
Index 533
transaldolase, use in multienzyme systems 20 - of Erwinia herbicola 95ff
transaminase, reaction scheme 324 - of Streptococcus faecalis 95ff
transferases, carbon-carbon bond formation 6 - of Symbiobacterium sp. 95ff
transglycosylation, chitooligosaccharide synthesis - products from TPL catalyzed reactions 94
25 1
- diastereoselectivity of 248
- glycopeptide synthesis 252 U
- simple alcohols as acceptor substrates 247f uridine triphosphate (UTP), and phosphodiester
transition state analog, chemical synthesis of formation 233
407ff uridylate biosynthesis, pathways 445
- chorismate mutase reaction 416
- conjugation to carrier proteins 409
- for acyl cleavage reaction via tetrahedral transi- V
tion states 411 vanadium haloperoxidases 193
- generation of catalytic antibodies 410ff vanilla flavor, natural - 334
transketolase 20ff vanillin, fermentative production of 334ff
- from spinach leaves 21 - - by hydrolysis of curcumin 335
- synthesis of a bark beetle pheromone 22 - - by plant cell culture 335
- synthesis of deoxysugars 23 - - ferulic acid as intermediate 336ff
- synthesis of fagomine 22 - - from ferulic acid 338ff
- use in organic synthesis 20f - - from glucose 335ff
translational entropy, in enzyme catalysis 417ff - - from isoeugenol 335f
Trichoderma viride, cellulase of, glycosylation - - with dioxygenase 335f
255 - - with lipoxygenase 335f
trifluoramphenicol, hydrolysis of, use of catalytic
- production by Amycolatopsis 339f
antibodies 439f
triglycerides, production of structured - 289 vanillin formation, by Serratia marcescens 336
triol, structure of 22 vinyl guaiacol, formation from ferulic acid 346f
tripeptide benzamide, catalysis of enantioselective vitamin C, synthesis of, use of Gluconobacter oxy-
acylation 510ff duns 297
tripeptides, use in stereoselective synthesis 510ff
trisaccharides, synthesis by glycoslation 253f
- synthesis by immobilized glycosyltransferases Y
258 Yarrowia lipolytica, formation of y-decalactone
Trypanosoma brucei, ornithine decarboxylase 78 341f
L-tryptophan, analogs 94 yeast see also bakers’ yeast, brewers’ yeast
- cleavage of, by tryptophanase 91 - biotransformation of furanyl acrolein 387
- expression of glycosyltransferases 268
- conversion to indole-3-acetic acid 89
- decarboxylation of, by aromatic t-amino acid - reduction reactions 370ff
decarboxylase 83 - use in prostaglandin synthesis 377f
- substitution 94 yeast alcohol dehydrogenase 359ff

- tryptophanase catalyzed cleavage of, mecha- - reduction of /.?-keto esters 359ff
nism 92 - reduction of simple ketones 359
tryptophanase 91ff - synthesis of a pheromone component 360
- structure 92 - synthesis of compactin 360
L-tyrosine, decarboxylation of, by tyrosine decar- - synthesis of mevinolin 360
boxylase 82 yeast pyruvate decarboxylase 24, 55
- synthesis of, by tyrosine phenol-lyase 94 Yersinia pseudotuberculosis, biosynthesis of CDP-
tyrosine decarboxylase (TDC) 82f ascarylose 119ff
- of Streptococcus faecalis 83
tyrosine phenol-lyase (TPL), mechanism of action,
with /.?-substituted L-alanines 97 Z
- - with L-tyrosine 96 Zymomonas mobilis, pyruvate decarboxylase 25,
- of Citrobacter freundii 95ff 49f, 53ff

Biotechnology Vol 8b Bio Transformation II, 2nd Ed

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Biotechnology Vol 8b Bio Transformation II, 2nd Ed

Uploaded by

Copyright:

Available Formats

Biotechnology

All volumes are also displayed on our Biotech Website:

Prof. Dr. A. Piihler Prof. Dr. P. J. W. Stadler Industrial Consultant:

Library of Congress Card No.: applied for

British Library Cataloguing-in-PublicationData:

Die Deutsche Bibliothek - CIP-Einheitsaufnahme

A catalogue record for this book

0 WILEY-VCH Verlag GmbH, D-69469 Weinheim (Federal Republic of Germany), 2000

Printed on acid-free and chlorine-free paper.

Prof Dr. M.J. Beker Prof Dr. T K.Ghose

Prof Dr. J. D. Bu’Lock Prof Dr. I. Goldberg

Prof Dr. C.L.Cooney Prof Dr. G. Goma

Prof Dr. H. W Doelle Sir D. A. Hopwood

Prof Dr.J. Drews Prof Dr. E.H. Houwink

Prof Dr. A.Fiechter Prof Dr. A.E.Humphrey

Prof Dr. I. Karube Prof Dr. K. Schiigerl

Pro$ Dr. M. A. Lachance Pro$ Dr. €? Sensi

Prof Dr. Y: Liu Prof Dr. Y H. Tan

Prof Dr. J. E Martin Prof Dr. D. Thomas

Prof Dr. B. Mattiasson Prof Dr. W Verstraete

Prof Dr. M. Roehr Pro$ Dr. E. - L. Winnacker

Prof Dr. H. Sahm

Introduction 1 7 Regioselective Oxidation of

Dr. Paul Bentley Dr. Sabine Flitsch

Prof. Dr. G. Michael Blackburn Dr. Ian Fotheringham

Prof. Dr. Uwe T. Bornscheuer Dr. Arnaud Gargon

Dr. Antony D. M. Curtis Dr. Simon A. Jackman

Dr. Simon Jones Dr. Jiirgen Rabenhorst

Dr. David R. Kelly Dr. Gary K. Robinson

Dr. Jane McGregor-Jones Dr. Michael Schedel

Dr. Jassem Mahdi Dr. Jane Stratford

biotransformations. Catalytic antibodies are ripe for development. A Third Edition of

1 Carbon-Carbon Bond Formation

1 Introduction torical perspective of developments within this

FDP aldolase TDP aldolase

D-Fructose 1,6-diphosphate D-Tagatose 1,gdiphosphate

Fuc 1-P aldolase $ Rha 1-Paldolase

L-Fuculose 1-phosphate L-Rhamnulose 1-phosphate

Dihydroxyacetone 1-phosphate (DHAP)

Fig. 1. Four stereo-complementaryDHAP dependent aldolases.

facilitates the synthesis of carbohydrates as

of highly pure DHAP (FESSNER and SINERIUS,

0 FDP aldolase Steps

Fig. 5. Applications of the thio-analog of dihydroxyacetone phosphate (3) in synthesis.

sis normally delivers products with (3S,4R)- OH

azido-2-hydroxypropanal (Fig. 8); the same formation of 6-deoxy azasugars (KAJIMOTO et

respectively, as the aldehyde substrate in a NHAc R

1,4-Dideoxy-l,4-imino-~-arabitino1 (25), a Aldolase catalyzed reaction of thioalde-

OH 1 FDPaldolase 1 Rha 1-Paldolase Ho

and enantiomers of (31) as required (EFFEN-

Sweet potato acid

Fig. 14. RAMA catalyzed aldol condensation with

(37a) was prepared using a one-pot strategy

1995). For example, ozonolysis of cyclohexene

as the ketone donor (Rosso and ADAMS,1967;

strates for further reaction (GIJSENand WONG,

I 1 DERA amino acids. L-Amino acids predominated but

2.4 Glycine Dependent Aldolases

Transaldolase catalyzes in vivo the transfer

lase (EC 2.2.1.1) are enzymes found in both

elaboration delivering the pyrrolidine deriva-

bond is formed by reaction of an aldehyde, t

During their investigations using isolated