Journal of Microbiological Methods 75 (2008) 365–368

Contents lists available at ScienceDirect

Journal of Microbiological Methods

j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / j m i c m e t h

Note

Simultaneous detection of six human diarrheal pathogens by using DNA microarray

combined with tyramide signal amplification
Dazhi Jin 1, Hongjuan Qi, Suhong Chen, Ting Zeng, Qiqi Liu, Shengqi Wang ⁎
Beijing Institute of Radiation Medicine, No. 27 Taiping road, Beijing, China

A R T I C L E I N F O A B S T R A C T

Article history: Multiplex PCR and DNA microarray were combined with tyramide signal amplification (TSA) to develop a
Received 21 December 2007 reliable method suitable for simultaneous detection of six species of human diarrheal pathogens (Yersinia
Received in revised form 18 June 2008 enterocolitica, Shigella spp, Salmonella typhi, Brucella spp, Vibrio cholera and Escherichia coli O157:H7).
Accepted 20 June 2008
Meanwhile, our method could distinguish V. cholera serotype O1 from O139, and O157:H7 from O157: non-
Available online 2 July 2008
H7. This assay conferred a specificity of 100% for target pathogens. The limit of detection was 103 °CFU/mL
approximately. The results of 98.6% (357/362) clinical specimens and 100% (5/5) mocked double-blind
Keywords:
Human diarrheal pathogens
samples were the same to that from conventional assay. Consequently this assay is sensitive and a specific
Detection tool suitable for diagnostic detection and surveillance of multiple human pathogens.
DNA microarray © 2008 Published by Elsevier B.V.
Tyramide signal amplification

Diarrhea and enteritis are two major intestinal diseases in clinic, and
often lead to clinical complications, such as septicemia, encephalitis and
meningitis, etc (Evan, 1998; Fratamico et al., 2005). Recent statistical
reports from the Ministry of Health People Public of China have shown
that a large portion of incidents related to diarrhea and food poisoning
are mainly caused by six species of aforementioned pathogens (Ministry
of Health P.R. China, 2006.). Obviously, infection and epidemic of
pathogenic bacteria still remains as one of the major threats to human
health, and therefore is a severe hygienic problem worldwide so far.
Conventional microbiological methods are often limited by the
length of time and trivial steps required to complete the assay (Kong
et al., 2002). The enzyme-linked immunological protocols (Luk, 1994)
and molecular biological assays based on DNA probing (Mooney et al.,
1995) or PCR amplification (Gonza'lez et al., 2003; Osorio et al., 2000;
Kong et al., 2002; Brasher et al., 1998)had overcome the problems
associated with culture-based assays due to their specificity, sensitivity
and rapidity. To date, DNA microarray combined with multiplex
PCR has been applied widely to detect and identify various genera
or species of pathogenic microorganisms (Call et al., 2001; Gonza'lez
et al., 2004; Del et al., 2002; Chizhikov et al., 2002; Jin et al., 2006).
In this study, we described an assay of the coupled multiplex PCR-
microarray, which employed nine primer sets to detect six species
or genus of pathogenic diarrheal microorganisms using a TSA-Cy3
reporting system.
⁎ Corresponding author. Beijing Institute of Radiation Medicine, No. 27 Taiping road,
Beijing 100850, China. Tel./fax: +86 10 66932211.
E-mail addresses: dazhijin_y@hotmail.com (D. Jin), sqwang@nic.bmi.ac.cn (S. Wang).
1
The author's current institute is Zhejiang Provincial Center for Disease Control and
Prevention, Hangzhou, China. Tel./fax: +86 571 87115285.
Strains of bacteria used in this study are listed in Table 1. A total of
92 strains of bacteria from 18 genera or species were obtained from
National Institute for the Control of Pharmaceutical and Biological
Products of China. The local strains of Vibrio cholera O1 (569B),
V. cholera Ogawa, V. cholera O139 and Escherichia coli O157: H7, and
some intestinal bacteria strains were provided by Zhejiang Provincial
Center for Disease Prevention and Control, China. All these selected
strains were cultured for 24–36 h according to the conventional
method as described (Evan, 1998; Miliotis, 2003).
362 clinical specimens (anus swabs) were provided by Zhejiang
provincial Center for Disease Prevention and Control, China. The
pathogens that isolated from clinical specimens were identified by the
conventional method and the appropriate API test system (bioMerieux
SA, Lyon, France) respectively. Meanwhile, 5 mocked double-blind
samples containing Yersinia enterocolitica, Brucella and mixed patho-
gens were prepared. Genomic DNA of bacteria was extracted by
centrifugation, lysate buffer (Triton x-100, NP40) as previously
described (Jin et al., 2006).
All the primer pairs and probes were designed from the specific
genes of target pathogens. The corresponding loci chosen were: ail,
ipaH, vipR, BCSP, ctxA, LPSgt, rfbE, fliC, and 16S rDNA was used as an
internal control. Eight PCR primer sets and eight internal probes were
designed using the Primer 5.0 program (PE Biosystems, Foster City, CA).
The reverse primers were labeled with biotin group. All the oligo-
nucleotide probes were attached to an amino-modified group at the
3′ end to allow covalent bonding to the aldehyde-coated glass slide. An
additional polyethleneglycol spacer was linked to 3′ end of in front
of an amino group. Based on the previous study (Jin et al., 2006), we
chose a region on 16S rDNA gene as the internal control.
DNA microarray was designed to have 10 probes surrounding
six columns and five rows included 1 internal control and 1 negative

0167-7012/$ – see front matter © 2008 Published by Elsevier B.V.

doi:10.1016/j.mimet.2008.06.020
366 D. Jin et al. / Journal of Microbiological Methods 75 (2008) 365–368

Table 1 DNA, 2.5 U Taq DNA polymerase (TaKaRa Biotechology Co. Ltd), 3.0 mM
Reference strains used in this study MgCl2 and 500 nM each primer. PCR was performed for 35 cycles under
Species ATCC accession no.a except particular notes the following conditions: 94 °C for 5 min; 35 cycles of 94 °C for 30 s,
Salmonella spp 50001, 50004, 50013, 50017, 50019, 50035 55 °C for 30 s, 72 °C for 30 s; and 72 °C for 5 min; 4 °C forever on the DNA
50760, 50835, 50041, 50096, 14028 thermal system (icycler, Bio-Rad, Hercules, CA, USA). The different ratio
Salmonella typhi 50073, 19430, 6539 of forward to reverse (labeled with biotin) primer of each set was
Salmonella typhimurium 14028, 50115
optimized following a value of 1:1, 1:2, 1:3, 1:5, 1:10 and 1:20 respec-
Salmonella paratyphi A 12176, 11511
Salmonella paratyphi B 10719, 19940, 8759 tively. Other components were as above. Through analysis of signal
Salmonella paratyphi C 13428, 9068 intensity the suitable ratios corresponding to nine primer sets would
Escherichia coli O157:H7 44752, 43889, 43859, W933, 882364, EDL 933 be confirmed.
Escherichia coli O157:non-H7 S14-91, CB569, 5412, 493/89 4 μL PCR products was mixed with 6 μL of hybridization buffer
Escherichia coli O55:H7 5905, 5A, 5B
Escherichia coli O26:H11 13C07, 13C08
(5 × SSC, 0.2% SDS, 5% formamide) without heat denaturation treat-
Escherichia coli O111:NM 403, 405, TW00186 ment, and then transferred to one well on the slide, which was
Listeria monocytogenes 54003, 54005, 54006, 54007 placed in a humidified chamber. The chamber was submerged in a
Listeria innocua 33090 50 °C water bath, and incubated for 1 h. After removed from the
Listeria seeligeri 35967
hybridization chamber, the slide was washed in solution A (1 × SSC,
Listeria grayi 25401
Listeria welshimerii 35897 0.2% SDS), solution B (0.2 × SSC) and washing solution C (0.1 × SSC) in
Shigella spp 51081, 51207, 51335, 51424, 35964, 49345, 29029 sequence for 1 min, then air-dried. Subsequently 1:1500 diluted
Vibrio parahaemolyticus 20502, 20506, 20507, 20511 streptavidin-horseradish peroxidase was incubated in each well on
Vibrio cholera 16025, 16026, 16028 the slide for 30 min at 37 °C, and the slide was washed with PBS-T
Vibrio cholera O139 M045, 1837
(0.05% Tween 20) 1 min for three times. Finally, 1:1000 diluted TSA-
Vibrio cholera O1 569B,Ogawa
Staphylococcus aureus 26001, 26111, 26113,13565,27661 Cy3 (in 1 × PBS plus 1% BSA) was incubated in each well for 30 min at
Proteus spp 49027, 49101, 49102, 49103 37 °C, and the slide was washed according to above step, dried at room
Bacillus cereus 63301,6051,63509 temperature.
Clostridium botulinum 64201 64203
Fluorescent measurements of DNA microarray was generated by
Clostridium perfringens 64711,13048
Yersinia enterocolitica 52207, 52211, 52215, 52217, 52302 scanning the slide on the GenePix 4000B scanner (Axon, USA). The
Brucella spp 23456, 23457, 23458, 23459, 11778, 25840 fluorescent signals were quantified using GenePix5.0 software (Axon,
23447, 23448, 23449, 23450, 23365 USA). All the experiments were done in triple. The cutoff value of each
Campylobacter jejuni 33560, 7709, 29428, 43429 probe was calculated through the mean of the spot intensity in order
Aeromonas hydrophila 10501, 35654, 23211, 23213
to determine the signals objectively.
Enterococcus faecalis 32219, 32220, 32221, 32223
Citrobacter freundii CMCC (B) 48016 DNA microarray was evaluated for sensitivity using a series of
Enterobacter aerogenes CMCC (B) 45103 10-fold dilution (106 cfu/ml to 101 cfu/ml) from pure culture. We
a
American Type Culture Collection (ATCC) accession number for positive-control selected genomic DNA from Salmonella typhi, Shigella spp, Brucella
strains. spp, Y. enterocolitica, V. cholera O139, E. coli O157:H7 respectively. Each
dilution series was repeated three times. Two following ways were
utilized for evaluating sensitivity. One way for S. typhi: each diluted
control. The location spots (complementary sequence of 16S-R) sur- concentration of genomic DNA of S. typhi was diluted with super-
rounded the array were used to identify the position of each target natant of stool samples from healthy volunteers, and the other way for
probe. The layout of DNA microarray was shown in Fig. 1-a. genomic DNA of target pathogens in pure culture.
PCR reaction was performed in a volume of 50 μL with 1 × PCR We interrogated the difference of two labeling methods, TSA-Cy3
buffer (TaKaRa Biotechology Co. Ltd), 250 μM deoxynucleotide mixture and Cy3 end labeling. PCR products of S. typhi labeled with biotin were
(each of dATP, dUTP, dCTP and dGTP), 20–50 ng of purified genomic diluted by a series of 10-fold dilutions. A parallel dilution series of

Fig. 1. a. Layout of DNA microarray. The name of gene was corresponding to target pathogen. Each probe was spotted as two. b. The typical hybridization results of six species of
human pathogenic microorganism and non-target bacteria from pure bacterial cultures. (1) non-target bacteria; (2) Yersinia enterocolitica; (3) Brucella spp.; (4) Shigella spp.;
(5) Salmonella typhi; (6) Vibrio cholera non-O139; (7) Vibrio cholera O139; (8) Escherichia coli O157:non-H7; (9) Escherichia coli non-O157:H7; (10) Escherichia coli O157:H7.
 D. Jin et al. / Journal of Microbiological Methods 75 (2008) 365–368 367

Table 2
Genes targeted for multiplex PCR and DNA microarray hybridization

Pathogenic microorganism Target genea GenBank accession no.b Primer namec Frag. size (bp) Primer sequence(5′-3′)
Vibrio cholera O139 ctxA DQ774432 ctxA-F 174 CACCCAACATGTTTAACGTTAATG
ctxA-R ATCTATCTCTGTAGCCCCTATTAC
ctxA-P CATACAGTCCTCATCCAGATGAACAAGAAGTTTCTGCTTTAGGTG
LPSgt U72485 LPSgt-F 262 CAGATTGTGATATGATAAGAGCGC
LPSgt-R ATAACAACTGAGATATCAAGCGTC
LPSgt-P TCGATAAGAAGAGATAAAGATCTGAGTTATCTAAAGATATTTGATTTAATGTTTT
rfbE-F AACTATTACTACAGGTGAAGGT
Escherichia coli O157:H7 rfbE S83460 rfbE-R 125 TAGCCTATAACGTCATGCCAA
rfbE-P AGGCCAAGGATTAGCTGTACATAGGCA
filC-F GGTGGGATTACTTATCAGGCTAC
filC AM228905 filC-R 162 ATCCACATAAGACTTCGCAGCATC
filC-P AGATGTAGTATTGAGCGAAACCAAAGCGGCTGCCGCGACATCTTCAATTAC
ail-F AGGTTCGTTTGCTTATACCCATCAG
Yersinia enterocolitica Ail AY004311 ail-R 116 GCTTAATGCGGAAAGATGGCCCC
ail-P TTTCTTCTATGGCAGTAATAAGTTTGGTCACGGTGATCTTGA
ipaH-F CTCAGTGCCTCTGCGGAGCTTCG
Shigella spp ipaH DQ448042 ipaH-R 234 GAGAGTTCTGACTTTATCCCG
ipaH-P GAAGGCCTTTTCGATAATGATACCGGCGCTCTGCTCTCCC
vipR-F GGTTTCATCATTTCTGGCCTCCG
Salmonella typhi vipR X67785 vipR- 337 CTCTGCTCCGTCAAGATCTTTTCACC
RvipR-P CTTCAATAATGCCAGCAGCTCCAACCCCGAAATAGATA
BCSP-F TGGCTCGGTTGCCAATATCAA
Brucella spp BCSP DQ229169 BCSP-R 223 CGCGCTTGCCTTTCAGGTCTG
BCSP-P CTGGCGACGCTTTACCCGGAAACGATCCATA
16S-F CGCTGGCGGCAGGCCTAACACATGC
Internal control 16S rDNA U00096 16S-R 500 CGCGGCTGCTGGCACGGAGTTAGCC
16S-P ACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTAGGGAATATTG
a
Genetic locus targeted by the described PCR primers and probes: ctxA: toxin sub-unit A, LPSgt: glycosotransferase, rfbE: O antigen for O157 serotype, fliC: H7 flagellar antigen, ail:
attachment invasion locus, ipaH: invasion plasmid antigen H, vipR: regulating Vi antigen expression, BCSP: 31-kDa cell surface protein.
b
Representative GenBank accession number from which the probe sequence was derived.
c
F, sequence of the forward primer; R, sequence of the reverse primer; P, Oligonucleotide probe.

PCR products labeled with Cy3 was prepared according to the assay
described previously (Jin et al., 2006).
Oligonucleotide sequence of primers and probes used in this study
are shown in Table 2. The specificity of primers and probes was con-
firmed by 92 reference strains from 18 genera or species. The results
indicated that the positive signals emerged at the position of internal
probe, while blank control and non-bacterial DNA control showed no
signals (Fig. 1-b).
Different ratio of the forward primer vs reverse primer (labeled
with biotin) was tested in PCR reaction for each amplicon. The results
showed that the intensity of the hybridization signal from each probe
was the highest while the ratios of the primer pairs for 16S rDNA, ctxA,
LPSgt, rfbE, fliC, ail, ipaH, vipR, and BCSP gene were adjusted to be 1:10,
1:10, 1:10, 1:10, 1:5, 1:10, 1:10, 1:5 and 1:5, respectively. The cutoff
value is a proxy to determine hybridization results. The average
intensity of signals from negative bacteria and blank control plus 2SD
was calculated as cutoff value of probe (data not shown).
A total of 92 strains of bacteria from 18 genera or species were
tested by DNA microarray assay established as above. The hybridiza-
tion results indicated that high specificity of hybridization signals was
obtained from six species of bacteria. In addition, two serotypes were
discriminated between V. cholera O1 and O139 as well as E. coli O157:
H7 and non H7. No cross-reacted signals were detected for each target
pathogen. Furthermore, positive signal was obtained from internal
control probe in each reaction with bacterial genomic DNA, and no
signals emerged by the negative control probe in any reaction.
We chose S. typhi as target pathogen to compare the method of
TSA-Cy3 labeling with the assay of Cy3 end labeling. A series of images

Fig. 2. A series of scanning image obtained from serial dilution of Salmonella typhi PCR products. A: TSA-Cy3 labeling; B: Cy3 end labeling.
368 D. Jin et al. / Journal of Microbiological Methods 75 (2008) 365–368
and data corresponding to each concentration were analyzed using
GenePix pro 4.0 software (Fig. 2). These results indicated that the
method of TSA-Cy3 labeling was ten times more sensitive than the
assay of Cy3 end labeling.
The sensitivity of DNA microarray was evaluated based on cutoff
values, hybridization signals were shown positive for dilution con-
taining as high as 103 cfu/mL of each species of pathogens, which
included S. typhi. It was clear that background of genomic DNA in stool
samples did not have an affect to the limit of detection.
A total of 362 clinical specimens were detected by bacteria culture,
API test system and DNA microarray, respectively. Negative and
positive controls were included in parallel with each test to avoid
false–positive and false–negative results. The results showed that 137
(37.8%) were detected positive of V. cholera O139 by the conventional
bacteria culture method, while 142 (39.2%) were positive by using
DNA microarray. In addition, 10(2.7%) were detected Shigella spp
positive, 4(1.1%) were detected E. coli O157:H7 positive and 6(1.7%)
were S. typhi positive by both two detection methods. Other two
target pathogens were not detected in all clinical specimens.
Furthermore, the results obtained by the appropriate API test system
were the same to that of DNA microarray. All the clinical specimens
were collected from an epidemic of V. cholera, so it was predicable that
pathogenic V. cholera O139 should be the etiological agent in this
epidemic, which was confirmed experimentally by the assay
described here. The results also showed that 357 (98.6%) specimens
identified by DNA microarray were also positive by conventional
bacteria culture method. However, DNA microarray was able to detect
5 extra positive specimens that were negative with the conventional
method, but were positive with the appropriate API test system,
suggesting DNA microarray was more intact than the conventional
culture method assay when clinical specimens contained dead or
inactive bacteria.
5 mocked double-blind samples were detected by using DNA
microarray. The results showed that there were 4 positive samples
including 1 Y. enterocolitica, 1 Brucella spp, 2 mixed pathogens (E. coli
O157:H7 and Shigella spp; E. coli O157:H7 and S. typhi), and 1 negative
samples in 5 mocked samples.
In this report, we have established an assay using DNA microarray
coupled with multiplex PCR and TSA-Cy3 labeling method for simul-
taneous identification of six species of human diarrheal pathogenic
microorganisms and discriminate V. cholera serotype O139 from O1
based on the present of the LPSgt gene, and specifically detect E. coli
O157 and serotype H7 based on the O157-(rfbE) and H7-specific(fliC)
gene, which provides a valuable assay for epidemiological investiga-
tion and preliminary diagnoses.
Acknowledgments
Grant numbers and sources of support: this work was supported
by the Military Medicine and Health Science Foundation of China.
(No. 06G120).
References
Brasher, C.W., DePaola, A., Jones, D.D., Bej, A.K., 1998. Detection of microbial pathogens
in shellfish with multiplex PCR. Curr. Microbiol. 37, 101–107.
Call, D.R., Brockman, F.J., Chandler, D.P., 2001. Detecting and genotyping Escherichia coli
O157:H7 using multiplexed PCR and nucleic acid microarrays. Int. J. Food Microbiol.
67, 71–80.
Chizhikov, V., Wagner, M., Ivshina, A., Hoshino, Y., Kapikian, A.Z., Chumakov, K., 2002.
Detection and genotyping of human group A rotaviruses by oligonucleotide microarray
hybridization. J. Clin. Microbiol. 40, 2398–2407.
Del, C.A., Marquez, I., Guijarro, J.A., 2002. Simultaneous detection of Aeromonas
salmonicida, Flavobacterium psychrophilum, and Yersinia ruckeri, three major fish
pathogens, by multiplex PCR. Appl. Environ. Microbiol 68, 5177–5180.
Evan, A.S., 1998. In: Evan, A.S. (Ed.), Bacterial Infections of Humans. Plenum Medical
Book Company, New York, NY.
Fratamico, P.M., Bhunia, K.A., Smith, L.J., 2005. In: Fratamico, P.M., Bhunia, K.A., Smith, L.J.
(Eds.), Food Pathogens: Microbiology and Molecular Biology. Caister Academic
Press, Norwich.
Gonza'lez, S.F., Osorio, C.R., 2003. Development of a PCR based method for the detection
of Listonella anguillarum in fish tissues and blood samples. Dis. Aquat. Org. 55,
109–115.
Gonza'lez, S.F., Krug, M.J., Nielsen, M.E., Santos, Y., Call, D.R., 2004. Simultaneous
detection of marine fish pathogens by using multiplex PCR and a DNA microarray.
J Clin Microbiol 42, 1414–1419.
Jin, D.Z., Wen, S.Y., Chen, S.H., Lin, F., Wang, S.Q., 2006. Detection and identification of
intestinal pathogens in clinical specimens using DNA microarrays. Mol. Cell. Probes
20, 337–347.
Kong, R.Y.C., Lee, S.K.Y., Law, T.W.F., Law, S.H.W., Wu, R.S.S., 2002. Rapid detection of
six types of bacterial pathogens in marine waters by multiplex PCR. Water Res 36,
2802–2812.
Luk, J.M., 1994. A PCR enzyme immunoassay for detection of Salmonella typhi.
Biotechniques 17 (6), 1038–1040.
Miliotis, M.D., 2003. In: Miliotis, M.D. (Ed.), International Handbook of Foodborne
Pathogens. Marcel Dekker, New York, Basel.
Ministry of Health P.R. China, 2006. Statistics of Legal Infectious Disease Broke Out in
2001–2006. www.moh.gov.cn.
Mooney, J., Powell, E., Clabby, C., Powell, R., 1995. Detection of Aeromonas salmonicida in
wild Atlantic salmon using a specific DNA probe test. Dis. Aquat. Org. 21, 131–135.
Osorio, C.R., Toranzo, A.E., Romalde, J.L., Barja, J.L., 2000. Multiplexed PCR assay for ureC
and 16S rRNA genes clearly discriminates between both subspecies of Photobacterium
damselae. Dis. Aquat. Org. 40, 177–183.