Diagnostic Microbiology and Infectious Disease 49 (2004) 89 97

www.elsevier.com/locate/diagmicrobio

Mycobacteriology

Accurate mapping of mutations of pyrazinamide-resistant Mycobacterium tuberculosis strains with a scanning-frame oligonucleotide microarray
Mary Margaret Wadea, Dmitriy Volokhovb, Mike Peredelchukb, Vladimir Chizhikovb, Ying Zhanga,*
a

Department of Molecular Microbiology and Immunology, Bloomberg School of Public Health, Johns Hopkins University, Baltimore, MD, USA b Center for Biologics Evaluation and Research, Food and Drug Administration, Kensington, MD, USA Received 15 October 2003; accepted 8 January 2004

Abstract The increasing emergence of drug-resistant Mycobacterium tuberculosis poses signicant threat to the treatment of tuberculosis. Conventional susceptibility testing for the front-line tuberculosis drug pyrazinamide (PZA) is difcult, because of the requirement for acid pH for the drug to show activity. Resistance to PZA in M. tuberculosis is caused by mutations in the pncA gene, and detection of pncA mutations can be an indicator of PZA resistance. In this study, we examined the feasibility of a microarray-based approach exploiting short overlapping oligonucleotides (sliding-frame array) to rapidly detect pncA mutations (substitutions, deletions, and insertions) in multiple strains of PZA-resistant M. tuberculosis. The genetic mapping of these mutations is necessary to link the gene sequence to the protein function dened by mutant phenotype. Microarray analysis was performed in a blind manner using 57 isolates of M. tuberculosis for which the sequence of the pncA gene was previously determined. Our results showed that all mutations could be unambiguously detected, suggesting that microarray can be a routine and valuable tool for rapid identication of drug-resistant M. tuberculosis isolates. We expect that mutation mapping with a sliding-frame microarray will accelerate the molecular analysis of drug-resistant M. tuberculosis bacteria and the microorganism populations. 2004 Elsevier Inc. All rights reserved.

1. Introduction Tuberculosis (TB) is the leading cause of death by an infectious agent with more than 7 million new cases and approximately 2 million deaths worldwide every year (Corbett et al., 2003; Raviglione, 2003; Soini and Musser, 2001). Prevalence of TB is increasing in some parts of the world as a result of HIV infection, which weakens the host immune system and allows latent TB to reactivate (Corbett et al., 2003; Paterson, 2003). Both HIV infection and the emergence of drug-resistant strains pose signicant threat to the control of the disease (Espinal, 2003; Zhang and Mitchison, 2003). Therefore, rapid drug susceptibility testing is a necessary part of effective monitoring of drug-resistant M. tuberculosis strains and can provide useful clinical guidance for the treatment of the disease.

* Corresponding author: Tel.: 1-410-614-2975; fax: 0105. E-mail address: yzhang@jhsph.edu (Y. Zhang).

1-410-955-

Pyrazinamide (PZA) is an important rst-line drug that allows TB therapy to be shortened from the previous 9 12 months to the current 6 months, because of its ability to kill in an acid pH environment a population of semi-dormant bacilli not eliminated by other TB drugs (Heifets and Lindholm-Levy, 1992). Previous studies have shown that mutations in the pncA gene encoding pyrazinamidase involved in activation of PZA to the active form pyrazinoic acid is the primary mechanism of PZA resistance in M. tuberculosis (Cheng et al., 2000; Hirano et al., 1997; Lemaitre et al., 1999; Mestdagh et al., 1999; Morlock et al., 2000; Scorpio et al., 1997b; Scorpio and Zhang, 1996; Sreevatsan et al., 1997; Zhang and Telenti, 2000). Strains of M. bovis, including BCG, are naturally resistant to PZA, because of a point mutation of C to G change at nucleotide 169 of the pncA, causing amino acid substitution of His57Asp (Scorpio and Zhang 1996), which can be used for rapid differentiation of M. bovis from M. tuberculosis (Scorpio et al., 1997a). PZA susceptibility testing has proven to be difcult, because of the requirement of an acidic pH for drug activity (Hewlett et

0732-8893/04/$ see front matter 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.diagmicrobio.2004.01.001

90

M.M. Wade et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 89 97

al., 1995). Although the BACTEC method (Siddiqi, 1992; Tortoli et al., 2002) has improved PZA susceptibility testing, false resistance can still be a problem in some cases with the current 100 g/mL PZA as a resistance cutoff at pH 6.0 (Davies et al., 2000; Morlock et al., 2000). In addition, although the BACTEC method has reduced the time of drug susceptibility testing by the use of radioactive (14C)-palmitate, it still depends on the slow growth of M. tuberculosis, which can take about 714 days (Siddiqi, 1992). Molecular testing of mutations in the genes associated with the drug resistance has the main advantage of being rapid and eliminating the need for the often timeconsuming phenotype-based susceptibility testing. Although various molecular methods, such as polymerase chain reaction (PCR) SSCP (Davies et al., 2000; Scorpio et al., 1997b), dideoxy ngerprinting (Felmlee et al., 1995; Liu et al., 1998), heteroduplex formation (Skotnikova et al., 2002; Thomas et al., 2001), amplication refractory mutation system (ARMS-PCR) (Fan et al., 2003), and PCR peptide nucleic acid (PNA) based enzyme-linked immunosorbent assay (ELISA) (Bockstahler et al., 2002) have been developed for rapid screening of potential drug-resistant mutants, these techniques are still tedious and do not demonstrate required sensitivity and high-throughput sample screening capability. To date, the most accurate and reliable method for mutation detection is DNA sequencing, which can be expensive and challenging if multiple genes are involved in resistance or if resistance mutations are not clustered in the target gene. Hybridization of DNA samples with miniature glass microchips containing oligonucleotide probes has been used in a variety of genomic studies (Chizhikov et al., 2001; Hacia, 1999; Hacia and Collins, 1999; Hacia et al., 1999; Volokhov et al., 2002). This technique allows for the analysis of several genetic markers in one simple hybridization experiment. Microarrays composed of short oligonucleotide probes were demonstrated to be a valuable tool for detecting minor genetic changes in the microorganism population (Cherkasova et al., 2003; Joyce et al., 2002; Kato-Maeda et al., 2001). Such an approach has previously been used for successful analysis of rifampin resistance determinants in M. tuberculosis strains (Gingeras et al., 1998; Troesch et al., 1999). In the current study, we developed and evaluated the sliding-frame oligonucleotide microarray for rapid screening of PZA-resistant M. tuberculosis strains based on accurate mapping of mutations in the pncA gene that cause PZA resistance.

cultured in Middlebrook 7H9 liquid medium with albumindextrose-catalase enrichment (Difco, Detroit, MI) at 37C for 23 weeks. Genomic DNA was isolated as previously described (Zhang et al., 1992). Two primers, Myc-Forw (CTGCCGCGTCGGTAGGCAAACTGC) and T7-MycRev (CGTTAATACGACTCACTATAGGGCCAACAGTTC ATCCCGGTTCGGC), positioned 31 bp upstream and 7 bp downstream of the M. tuberculosis pncA gene, were used for PCR amplication of the entire pncA gene. The reverse PCR primer contained the T7 RNA polymerase promoter sequence at the 5 ends for the sequential synthesis of the ssRNA probe. The standard PCR mixture (30 l) contained 1.5 units of HotStarTaq DNA polymerase, 1 the recommended buffer supplemented with 2.5 mM MgCl2 (Qiagen, Chatsworth, CA), 500 nM of each forward and reverse primers, 200 M of each dNTP (dATP, dGTP, dCTP, and dTTP), and 1 l DNA template (approximately 0.1 g of DNA template). PCR was performed using a Gene Amp PCR System 9700 thermocycler (Applied Biosystems, Foster City, CA) with the following cycle conditions: initial denaturing at 95C for 15 min followed by 40 cycles at 94C for 40 s, 55C for 40 s, 72C extension for 40 s, and the nal extension at 72C for 10 min. The presence of amplied PCR products was detected by 1% agarose gel electrophoresis followed by ultraviolet detection after ethidium bromide staining. To determine the sequence, PCR amplied DNA fragments were puried using the 1% agarose gel electrophoresis, cut from the gel followed by extraction from the gel using a gel-purication kit (Qiagen, Chatsworth, CA) according to manufacturers instructions. The PCR products were directly sequenced using an automatic DNA sequencer (ABI 377, Applied Biosystems) using forward and reverse primers described above. 2.2. Preparation of uorescently labeled hybridization samples Single-stranded RNA samples for microarray analysis were synthesized by T7 polymerase-driven transcription of the amplicons using the MEGAscript T7 High Yield Transcription Kit (Ambion, Austin, TX). RNA transcription was conducted in a 30 l reaction mixture containing 2 l of MEGAscript T7 Enzyme Mix, 1 reaction buffer; 5 mM of ATP, UTP, CTP, and GTP; and approximately 0.1 0.5 g of the pncA PCR product as template. After 2 hours of incubation at 37C, the unincorporated NTPs were removed by purication through the Centrisep Spin Columns (Princeton Separations, Adelphia, NJ) according to the manufacturers protocol. The MICROMAX ASAP RNA Labeling Kit (Perkin Elmer, Boston, MA) was used to incorporate Cy3 uorophore into the ssRNA molecules. Fluorescently labeled ssRNA samples were puried from unincorporated dye using the Centrisep Spin Columns, dried under vacuum, and solubilized in the supplemented MICROMAX Hybridization Buffer III at a nal concentration of 0.51.0 M.

2. Materials and methods 2.1. Bacterial strains, genomic DNA isolation, PCR, and DNA sequencing PZA-resistant M. tuberculosis strains obtained previously (Cheng et al., 2000; Scorpio et al., 1997b) were

M.M. Wade et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 89 97

91

2.3. Design of oligonucleotide probes for scanning-frame microarray Overlapping oligonucleotide probes (oligoprobes) were designed on the basis of the nucleotide sequence of the complete pncA gene of M. tuberculosis (GenBank accession number NC_000962). Our previous studies showed that the set of short oligoprobes with basic melting temperature about 4751C and overlapping at half of the lengths ensures an efcient and condent detection of any single-base mutation in the target gene (Cherkasova et al., 2003). Totally, 79 oligoprobes were designed for microarray analysis of mutations in the pncA gene with tting physico-chemical properties (oligoprobe size range from 14 to 20 nucleotides, GC content 47 86%, and predicted melting temperature 49 55C). An additional oligoprobe complementary to the forward primer was used to monitor the synthesis of fulllength ssRNA. The 5 end of each oligoprobe was modied during the synthesis using the TFA Aminolink CE reagent (PE Applied Biosystems, Foster City, CA) for immobilization of the oligonucleotides to CodeLink Activated Slides (Amersham Biosciences, Piscataway, NJ). 2.4. Microchip design and fabrication The microarray containing 79 pncA-specic oligoprobes was spotted in quadruplicate using a contact microspotting robotic system PIXSYS 5500 (Cartesian Technologies, Inc., Ann Arbor, MI) equipped with a microspotting pin CMP7 (ArrayIt, Sunnyvale, Calif.). Quadruplication of each oligoprobe on microchip ensured the quality of microchip fabrication and enabled application of statistical methods for analysis of microarray data. The average size of spots was 250 m, whereas the spacing between spots was 450 m. Each oligoprobe spotting mixture contained 200 M pncA-specic oligoprobe and 10 M quality control oligonucleotide (Volokhov et al., 2002) in 1 printing buffer (150 mM sodium phosphate, pH 8.5). Printed slides were additionally incubated a few hours at 80% humidity at room temperature. Residual reactive groups on the slide surface were inactivated using treatment with prewarmed blocking solution (0.1 M Tris-HCl, 50 mM ethanolamine, and 0.1% sodium dodecyl sulfate [SDS], pH 9.0) at 50C for 30 min. Slides were washed once for 30 60 min with 4 SSC, 0.1% SDS (prewarmed to 50C) to remove unbound oligonucleotides; this was followed by ve washes for 1 min each with distilled water. Traces of water were removed by centrifugation at 800 rpm for 3 min. 2.5. Hybridization conditions Hybridization between microarray oligoprobes and uorescently labeled ssRNA samples was performed in the MICROMAX Hybridization Buffer III (Perkin Elmer) for 1 hour at 60C. Before hybridization, Cy3-labeled ssRNA sample was mixed with a Cy5-QC probe (Volokhov et al.,

2002) at molar ratio 10:1, followed by denaturing at 95C for 1 min. Each hybridization mixture was placed on the area of microarray and covered with an 18 9-mm glass coverslip (Erie Scientic, Portsmouth, NH) to prevent evaporation of the probe during incubation. Each microarray slide was capable of carrying out simultaneous microarray analysis of ve different RNA samples. After hybridization, the slides were washed once for 15 min with 4 SSC with 0.1% SDS (prewarmed to 60C), once for 5 min with 2 SSC buffer, and once with 1 SSC buffer, followed by centrifugation at 800 rpm for 3 min to remove any traces of the buffer. 2.6. Microarray scanning and image analysis The uorescent images of processed microarray slides were generated using ScanArray 5000 (Perkin Elmer, Boston, MA, USA) equipped with two lasers operating at 632 nm (for excitation of Cy5 dye) and 543 nm (for excitation of Cy3 dye). To identify positions of the pncA gene where mutations could occur, the intensities of uorescent signals from each array element measured for the reference pncA gene (without mutations) and potentially mutated gene were compared. The ratios of signals were normalized using linear regression model.

3. Results 3.1. Optimization of microchip The set of sliding oligoprobes, overlapping at half their length, capable of detecting any potential mutation in the mycobacterial pncA gene was designed using empirical criteria described previously (Anthony et al., 2003; Cherkasova et al., 2003; Matveeva et al., 2003). In total, 79 oligoprobes covering the entire coding and promoter region of the pncA gene, plus one additional oligonucleotide identical to the sequence of the forward primer, were included in the nal microarray to monitor the emergence of spontaneous alterations in the sequence of the pncA gene. Primarily, the screening of different commercially available brands of microarray slides proposed for immobilization of short oligoprobes has been conducted in our laboratory to identify the slide coating that is the most suitable for accurate detection of minor genetic changes and that ensures high sensitivity and specicity of hybridizationbased detection. The study showed that CodeLink Activated (CLA) slides have met most of those requirements. CLA slides are coated with a novel 3-D surface chemistry comprised of a long-chain, hydrophilic polymer containing amine-reactive groups (http://www.surmodics.com/ 3dlink.html). The cross-linked polymer, combined with end-point attachment, orients the immobilized DNA and holds it away from the surface of the slide. This type of immobilization excludes the need to use additional spacers

92

M.M. Wade et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 89 97

Fig. 1. Dependence of microarray discrimination efciency on the slide surface coating and the nature of uorescently labeled sample. A, Hybridization prole of RNA sample hybridized with the microarray fabricated using silylated slide. B, Prole of the sample but hybridized with microarray immobilized on the CodeLink slide. C, Hybridization prole of ssDNA sample hybridized with the microarray fabricated using silylated surface.

for oligoprobes. Simultaneous comparison of silylated and CLA slides showed that the discriminatory power (ratio of signals from the same oligoprobe hybridized with the uorescent samples complementary to the probe or containing one nucleotide mismatch) of CLA slides is higher than that of silylated slides (Fig. 1A and 1B). Hybridization protocols for CodeLink activated slides were also optimized to guarantee high condence of mutation detection. Thus, we found that the use of a a uorescently labeled ssRNA sample instead of ssDNA could substantially improve the discriminatory power of the assay (Fig. 1C). Partial degradation of ssRNA by treatment with 0.1 M NaOH did not exhibit a noticeable effect on discrimination (data not shown). Another important parameter of the hybridization mixture, the concentration of ssRNA, was found to be crucial for the consistency of microarray data. To make a linear regression model applicable for the normalization of hybridization data, the concentrations of the reference strain H37Rv and the mutant BCG uorescently labeled samples should not differ signicantly. We found that the concentration of uorescently labeled ssRNA samples in the range 0.51.0 M is most reliable for the condent detection of any minor genetic changes in the target sequences. 3.2. Evaluation of sliding-frame microarray using M. tuberculosis isolates with known sequences Discriminatory capability of sliding-frame microchip was evaluated primarily using hybridization with several M. tuberculosis isolates containing known mutations in the pncA gene (isolates W296, M43548, 21, 8989, 10467, T7527, and H3628) characterized in our previous studies (Cheng et al., 2000; Scorpio et al., 1997b). Ratios of normalized uorescence signals of the reference strain H37Rv

and strains containing mutations in the pncA gene are shown in Fig. 2. The use of short and half-length overlapping oligoprobes was demonstrated to be sufcient to guarantee the reliable monitoring of the pncA gene sequence stability and identifying of approximate positions where mutations occurred. The ratios of signal intensities between the reference and mutants were found to vary in a wide range from 6.5 to 2500, depending on the sequence of the oligoprobes and the position and nature of the mutation (Anthony et al., 2003). Of various mutations (substitutions, deletions, and insertions) distributed along the pncA gene, only one mutation (A G in position 11 upstream of the start codon) in the PZA-resistant M. tuberculosis isolate 9869 escaped identication, possibly because of the positioning of this mutation near the ends of both adjacent overlapping oligoprobes. A similar blind effect was observed elsewhere (Anthony et al., 2003). The probability of such negative events might be substantially reduced by increasing an overlapping index (number of oligoprobes containing each nucleotide of target sequence) from two used in the present study to three or even higher. We redesigned the oligoprobe and conrmed that the new probe could unambiguously identify the target mutation (data not shown). Although all designed oligoprobes had similar predicted melting temperatures (See Materials and methods for details), some oligoprobes revealed substantially lower RNAbinding capability than others (data not shown). Analysis of the secondary structure of these oligoprobes showed that they could form stable hairpin structures (Fig. 3) that are likely to interfere with the binding capability of the oligoprobe (Anthony et al., 2003). Subsequent synthesis of alternative oligoprobes that lacked the capability to form stable hairpin-like secondary structures allowed us to achieve reliable discrimination between reference and mutant pncA variants (data not shown).

M.M. Wade et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 89 97

93

Fig. 2. Evaluation of microarray discrimination efciency using several reference M. tuberculosis strains containing known single point mutations in the pncA gene.

3.3. Evaluation of the M. tuberculosis microchip using coded samples Evaluation of the developed sliding-frame microchip designed for the high throughput monitoring of mutations in the pncA gene was conducted using a blind experiment. Coded DNA samples of 57 M. tuberculosis isolates (Table 1) with and without mutations in the pncA gene were prepared and submitted for microarray analysis to the Laboratory of Method Development (CBER, FDA). The presence or absence of mutations in the pncA gene was revealed to

the operator only after microarray results were nalized. The capability to simultaneously analyze several RNA samples on each slide in a short time (less than 1 hour for all procedures, including hybridization, posthybridization processing, and slide scanning) allowed us to complete the analysis of these isolates in 6 hours. Results of microarraybased monitoring of pncA mutations (substitutions, insertions and deletions) were in complete concordance with the results of DNA sequencing of these isolates (Cheng et al., 2000; Scorpio et al., 1997b). Thus, the results of the study conrmed the feasibility of microarrays composed of short half-length overlapping oligoprobes for rapid and reliable screening of mutations in the genes involved in bacterial drug resistance. 4. Discussion The increasing emergence of drug-resistant TB poses a signicant threat for the control and treatment of the disease. Early identication of drug-resistant strains of M. tuberculosis is important for choosing appropriate drugs to which the bacteria are still sensitive and for guiding treatment. However, the current drug susceptibility testing still relies on culturing of the bacilli and can take a lengthy period of 2 6 weeks, because of the slow growth of M. tuberculosis. Often TB chemotherapy is given as soon as the diagnosis is made without any drug susceptibility data, which are only available several weeks after initiation of therapy. This treatment strategy can lead to the use of inappropriate drugs, to which the bacteria are already resistant. Recent progress in our understanding of the molecular basis of drug resistance in TB has allowed for the identication of drug resistance genes and of mutations associated with drug resistance (Zhang and Mitchison, 2003; Zhang and Telenti, 2000; Zhang and Young, 1994). This has stim-

Fig. 3. Possible secondary structure of microarray oligoprobes. Some oligoprobes demonstrating low sample-binding capability were analyzed using mFold software developed by Dr. Michael Zuker (http://biotools. idtdna.com/mfold/).

94

M.M. Wade et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 89 97 Table 1 (continued) Strain 29 10467 3 H2374 37 11552 11830 941392 APZAR1 APZAR3 10274 pncA gene changesa T to G at 488; Val163Arg C deletion at 514 No changes found No changes found No changes found No changes found No changes found No changes found No changes found No changes found No changes found PZA susceptibility R R S S S S S S S S S

Table 1 M. tuberculosis strains analyzed by scanning-frame oligonucleotide microarray Strain H37Rv 9869 H4171 H3628 APZAR6 RK56 955293 8989 M43548 M. bovis BCG 11627 F43948 2721-1 T7527 9953 25 A7153 H3652 27795 T5721 21 17 M52997 31 T61823 BD195 VA205 10426 CDCBP98 M4812 9579 10347 10800 11041 pncA gene changesa No changes (reference strain) 11 promoter mutation A to G 11 bp deletion at start codon A to C at 35; Asp12Ala T to C at 40; Cys14Arg T to C at 40; Cys14Arg G deletion at 71 C to T at 137; Ala46Val C to A at 153; His51Gln C to G at 169; His57Asp A insertion at 193 C to G at 206; Pro69Arg C to G at 206; Pro69Arg T to C at 214; Cys72Arg T to C at 214; Cys72Arg G to T at 233; Gly78Val A to G at 245; His82Arg T to C at 254; Leu85Pro T to C at 254; Leu85Pro T to C at 254; Leu85Pro T to G at 269; Ile90Ser C to A at 285; Tyr95Stop G to A at 289; Gly97Ser T to C at 355; Tyr118Arg GG insertion at 392 G to A at 394; Gly132Ser G to A at 394; Gly132Ser C to T at 401; Ala134Val G to C at 415; Val139Leu G to C at 415; Val139Leu C to A at 418; Arg140Ser; 8 bp deletion at 446 C to A at 418; Arg140Ser; 8 bp deletion at 446 C to A at 418; Arg140Ser; 8 bp deletion at 446 C to A at 418; Arg140Ser; 8 bp deletion at 446 C to A at 418; Arg140Ser; 8 bp deletion at 446 C to A at 418; Arg140Ser; 8 bp deletion at 446 C to A at 418; Arg140Ser; 8 bp deletion at 446 C to A at 418; Arg140Ser; 8 bp deletion at 446 C to A at 418; Arg140Ser; 8 bp deletion at 446 C to A at 418; Arg140Ser; 8 bp deletion at 446 C to A at 418; Arg140Ser; 8 bp deletion at 446 C to A at 418; Arg140Ser; 8 bp deletion at 446 C to A at 418; Arg140Ser; 8 bp deletion at 446 A to C at 422; Gln141Pro A to C at 422; Gln141Pro G deletion at 443 PZA susceptibility S R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R

a pncA nucleotide changes and their corresponding amino acid changes. Concordance between the microarray and conventional sequencing data was 100% (See details in text). S, susceptible; R, resistant; PZA, pyrazinamide.

11135 9131 9132 9769 9811 10348 10350 11243 11823 W76757 W57575 W296

R R R R R R R R R R R R (continued)

ulated considerable interest in developing molecular tests for rapid detection of drug resistance in M. tuberculosis (Alcaide and Telenti, 1997; Caws and Drobniewski, 2001; Soini and Musser 2001). It is relatively easy to develop assays to detect resistance caused by mutations in a small region of a single resistance gene, such as rpoB, in which mutations cause rifampin (RIF) resistance (Telenti et al., 1997). Indeed, a commercial kit, Inno-LiPA Rif.TB (LiPA) assay, has been developed by a Belgian company, Innogenetics, for rapid detection of rpoB mutations in RIF resistance in multiple drugresistant TB (Rossau et al., 1997). However, for other drug resistance, because multiple genes (katG, inhA, ndh in the case of isoniazid resistance) are involved in resistance, or because diverse mutations are scattered in a single gene (e.g. pncA in PZA resistance), it has been difcult to develop reliable molecular methods for rapid detection of TB drug resistance. Several molecular methods, such as PCR-SSCP (Davies et al., 2000; Scorpio et al., 1997b), dideoxy ngerprinting (Felmlee et al., 1995; Liu et al., 1998), heteroduplex formation (Skotnikova et al., 2002; Thomas et al., 2001), amplication refractory mutation system (ARMS-PCR) (Fan et al., 2003), PCR-PNA based ELISA (Bockstahler et al., 2002), molecular beacon assays (Piatek et al., 2000), and PCR-RFLP analysis (Mokrousov et al., 2002; Sreevatsan et al., 1998) have been used for detection of drug resistance in TB with variable success. Many of these techniques are tedious, time-consuming, and lack the sensitivity necessary to detect all mutations (Victor et al., 2002). These drawbacks have prevented the use of molecular methods for the detection of drug resistance in TB, except for RIF resistance. Other methods, such as a PCR-PNA based ELISA and molecular beacons, have been used to detect point mutations in genes associated with isoniazid and RIF resistance in M. tuberculosis (Bockstahler et al., 2002; Piatek et al., 2000). A major drawback of the above methods is that they can be used only for detecting known mutations in a dened site or region, but are not sensitive enough to be used for detecting unknown mutations in a target gene. Although DNA sequencing is the

M.M. Wade et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 89 97

95

most reliable method for mutation detection, it is expensive and impractical to search for mutations in multiple-resistance genes where the location of mutations cannot be predicted. A high-density probe array that incorporates all four possible nucleotides at a given position of the 16S rRNA gene and the rpoB gene (also called resequencing) has been used successfully for species identication and detection of rpoB mutations in RIF resistance (Troesch et al., 1999). However, use of this technology for the detection of other more challenging drug resistance in TB has not been reported. In the present study, we used a similar technology of array hybridization requiring a much smaller number of oligoprobes (80 versus over 5000 in the resequencing method), which is more feasible and economical. We have shown that microarray technology can be reliably used for rapid detection of pncA mutations (substitutions, deletions, and insertions) in PZA-resistant strains. Over the past few years, tremendous progress has been made in genomics, stimulated by the development of miniature devices, called microarrays or microchips, containing sequence-specic probes immobilized on a solid surface, allowing simultaneous analysis of multiple genetic markers in one hybridization experiment. The scope of microarray application is broad and includes gene expression proling, detection and genotyping of different microorganisms, detection of single nucleotide polymorphisms, and rapid resequencing of target genes (Hacia, 1999; Kurian et al., 1999). Whereas long microarray probes are more suitable for the detection and expression proling, short oligonucleotides are appropriate for the detection of minor genetic changes, such as a single nucleotide mismatch, deletion, or insertion. Additionally, the use of short oligonucleotides enables the exploitation of multiple individual oligoprobes for each target gene. High redundancy of analysis has allowed for the substantial reduction in microarray data misinterpretation. We have shown that microarrays can be a routine and valuable instrument for applications related to detecting viral and bacterial pathogens (Chizhikov et al., 2001; Chizhikov et al., 2002; Volokhov et al., 2002) and monitoring genetic heterogeneity of viral populations (Amexis et al., 2002; Cherkasova et al., 2003). By combining PCR amplication of target genetic markers with microarray hybridization, we have obtained a highly sensitive and specic method that, in contrast to traditional gel-based analysis of PCR products, is not affected by the appearance of undesired nonspecic PCR products. The appearance of such products is typical when the sensitivity of PCR amplication is increased. Moreover, multiplex PCR-microarray methods enable simultaneous analysis of not one but several target genes in a single hybridization. Microarrays composed of short oligonucleotides (14 20mers) overlapping target sequences can be used for the conrmation of short target sequences (Anthony et al., 2003; Cherkasova et al., 2003; Hacia, 1999). However, the fabrication of such resequencing microchips is expensive and sometimes not affordable. In this study we showed that

the microarray containing the set of half-length overlapping oligoprobes could be a valuable instrument for obtaining sufcient information about the presence and approximate positions of minor genetic changes in target gene(s). Because of the simplicity and minimal time requirement for analysis, this approach could prove to be useful for the screening of large numbers of clinical samples to identify potential drug-resistant strains of M. tuberculosis. Future studies incorporating other TB drug resistance genes are needed to further assess whether this microarray-based technology can be used for rapid detection of drug-resistant TB in clinical microbiology labs. Acknowledgments We thank Avi Rasooly for his generous help and encouragement. This work was supported by NIH grant R01-AI44063 and R01-AI/HL49485 to YZ. References
Alcaide F, Telenti A (1997). Molecular techniques in the diagnosis of drug-resistant tuberculosis. Ann Acad Med Singapore 26, 647 650. Amexis G, Rubin S, Chizhikov V, Pelloquin F, Carbone K, Chumakov K (2002). Sequence diversity of Jeryl Lynn strain of mumps virus: Quantitative mutant analysis for vaccine quality control. Virology 300, 171179. Anthony RM, Schuitema AR, Chan AB, Boender PJ, Klatser PR, Oskam L (2003). Effect of secondary structure on single nucleotide polymorphism detection with a porous microarray matrix; implications for probe selection. Biotechniques 34, 10821086, 1088 1089. Bockstahler LE, Li Z, Nguyen NY, Van Houten KA, Brennan MJ, Langone JJ, Morris SL (2002). Peptide nucleic acid probe detection of mutations in Mycobacterium tuberculosis genes associated with drug resistance. Biotechniques 32, 508 510, 512, 514. Caws M, Drobniewski FA (2001). Molecular techniques in the diagnosis of Mycobacterium tuberculosis and the detection of drug resistance. Ann N Y Acad Sci 953, 138 145. Cheng SJ, Thibert L, Sanchez T, Heifets L, Zhang Y (2000). pncA mutations as a major mechanism of pyrazinamide resistance in Mycobacterium tuberculosis: Spread of a monoresistant strain in Quebec, Canada. Antimicrob Agents Chemother 44, 528 532. Cherkasova E, Laassri M, Chizhikov V, Korotkova E, Dragunsky E, Agol VI, Chumakov K (2003). Microarray analysis of evolution of RNA viruses: Evidence of circulation of virulent highly divergent vaccinederived polioviruses. Proc Natl Acad Sci U S A 100, 9398 9403. Chizhikov V, Rasooly A, Chumakov K, Levy DD (2001). Microarray analysis of microbial virulence factors. Appl Environ Microbiol 67, 3258 3263. Chizhikov V, Wagner M, Ivshina A, Hoshino Y, Kapikian AZ, Chumakov K (2002). Detection and genotyping of human group A rotaviruses by oligonucleotide microarray hybridization. J Clin Microbiol 40, 2398 2407. Corbett EL, Watt CJ, Walker N, Maher D, Williams BG, Raviglione MC, Dye C (2003). The growing burden of tuberculosis: Global trends and interactions with the HIV epidemic. Arch Intern Med 163, 1009 1021. Davies AP, Billington OJ, McHugh TD, Mitchison DA, Gillespie SH (2000). Comparison of phenotypic and genotypic methods for pyrazinamide susceptibility testing with Mycobacterium tuberculosis. J Clin Microbiol 38, 3686 3688.

96

M.M. Wade et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 89 97 Paterson R (2003). Initiative to unify control of HIV/AIDS and tuberculosis. Lancet Infect Dis 3, 119. Piatek AS, Telenti A, Murray MR, El-Hajj H, Jacobs WR Jr, Kramer FR, Alland D (2000). Genotypic analysis of Mycobacterium tuberculosis in two distinct populations using molecular beacons: Implications for rapid susceptibility testing. Antimicrob Agents Chemother 44, 103 110. Raviglione MC (2003). The TB epidemic from 1992 to 2002. Tuberculosis (Edinb) 83, 4 14. Rossau R, Traore H, De Beenhouwer H, Mijs W, Jannes G, De Rijk P, F Portaels (1997). Evaluation of the INNO-LiPA Rif. TB assay, a reverse hybridization assay for the simultaneous detection of Mycobacterium tuberculosis complex and its resistance to rifampin. Antimicrob Agents Chemother 41, 20932098. Scorpio A, Collins D, Whipple D, Cave D, Bates J, Zhang Y (1997a). Rapid differentiation of bovine and human tubercle bacilli based on a characteristic mutation in the bovine pyrazinamidase gene. J Clin Microbiol 35, 106 110. Scorpio A, Lindholm-Levy P, Heifets L, Gilman R, Siddiqi S, Cynamon M, Zhang Y (1997b). Characterization of pncA mutations in pyrazinamide-resistant Mycobacterium tuberculosis. Antimicrob Agents Chemother 41, 540 543. Scorpio A, Zhang Y (1996). Mutations in pncA, a gene encoding pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug pyrazinamide in tubercle bacillus. Nat Med 2, 662 667. Siddiqi SH (1992). Antimicrobial susceptibility testing: Radiometric (BACTEC) test for slowly growing mycobacteria. In Clinical Microbiology Procedures. Ed, HD Isenberg. Washington, DC: ASM Press, pp 14 25. Skotnikova OI, Soboleva A, Mikhailovich VM, Griadunov DA, Irtuganova OA, Nosova E, Isaeva EL, Lapa SA, Zasedatelev AS, Litvinov VI, Moroz AM, Mirzabekov AD (2002). Molecular genetic methods for the detection of rifampicin-resistant Mycobacterium tuberculosis strains. Vestn Ross Akad Med Nauk 2, 36 39. Soini H, Musser JM (2001). Molecular diagnosis of mycobacteria. Clin Chem 47, 809 814. Sreevatsan S, Bookout JB, Ringpis FM, Mogazeh SL, Kreiswirth BN, Pottathil RR, Barathur RR (1998). Comparative evaluation of cleavase fragment length polymorphism with PCR-SSCP and PCR-RFLP to detect antimicrobial agent resistance in Mycobacterium tuberculosis. Mol Diagn 3, 8191. Sreevatsan S, Pan X, Zhang Y, Kreiswirth BN, Musser JM (1997). Mutations associated with pyrazinamide resistance in pncA of Mycobacterium tuberculosis complex organisms. Antimicrob Agents Chemother 41, 636 640. Telenti A, Honore N, Bernasconi C, March J, Ortega A, Heym B, Takiff HE, Cole ST (1997). Genotypic assessment of isoniazid and rifampin resistance in Mycobacterium tuberculosis: A blind study at reference laboratory level. J Clin Microbiol 35, 719 723. Thomas GA, Williams DL, Soper SA (2001). Capillary electrophoresisbased heteroduplex analysis with a universal heteroduplex generator for detection of point mutations associated with rifampin resistance in tuberculosis. Clin Chem 47, 11951203. Tortoli E, Benedetti M, Fontanelli A, Simonetti MT (2002). Evaluation of automated BACTEC MGIT 960 system for testing susceptibility of Mycobacterium tuberculosis to four major antituberculous drugs: Comparison with the radiometric BACTEC 460TB method and the agar plate method of proportion. J Clin Microbiol 40, 607 610. Troesch A, Nguyen H, Miyada CG, Desvarenne S, Gingeras TR, Kaplan PM, Cros P, Mabilat C (1999). Mycobacterium species identication and rifampin resistance testing with high-density DNA probe arrays. J Clin Microbiol 37, 49 55. Victor TC, van Helden PD, Warren R (2002). Prediction of drug resistance in M. tuberculosis: Molecular mechanisms, tools, and applications. IUBMB Life 53, 231237.

Espinal MA (2003). The global situation of MDR-TB. Tuberculosis (Edinb) 83, 44 51. Fan XY, Hu ZY, Xu FH, Yan ZQ, Guo SQ, Li ZM (2003). Rapid detection of rpoB gene mutations in rifampin-resistant Mycobacterium tuberculosis isolates in shanghai by using the amplication refractory mutation system. J Clin Microbiol 41, 993997. Felmlee TA, Liu Q, Whelen AC, Williams D, Sommer SS, Persing DH (1995). Genotypic detection of Mycobacterium tuberculosis rifampin resistance: Comparison of single-strand conformation polymorphism and dideoxy ngerprinting. J Clin Microbiol 33, 16171623. Gingeras TR, Ghandour G, Wang E, Berno A, Small PM, Drobniewski F, Alland D, Desmond E, Holodniy M, Drenkow J (1998). Simultaneous genotyping and species identication using hybridization pattern recognition analysis of generic Mycobacterium DNA arrays. Genome Res 8, 435 448. Hacia JG (1999). Resequencing and mutational analysis using oligonucleotide microarrays. Nat Genet 21, 42 47. Hacia JG, Collins FS (1999). Mutational analysis using oligonucleotide microarrays. J Med Genet 36, 730 736. Hacia JG, Fan JB, Ryder O, Jin L, Edgemon K, Ghandour G, Mayer RA, Sun B, Hsie L, Robbins CM, Brody LC, Wang D, Lander ES, Lipshutz R, Fodor SP, Collins FS (1999). Determination of ancestral alleles for human single-nucleotide polymorphisms using high-density oligonucleotide arrays. Nat Genet 22, 164 167. Heifets L, Lindholm-Levy P (1992). Pyrazinamide sterilizing activity in vitro against semidormant Mycobacterium tuberculosis bacterial populations. Am Rev Respir Dis 145, 12231225. Hewlett D Jr, Horn DL, Alfalla C (1995). Drug-resistant tuberculosis: Inconsistent results of pyrazinamide susceptibility testing. JAMA 273, 916 917. Hirano K, Takahashi M, Kazumi Y, Fukasawa Y, Abe C (1997). Mutation in pncA is a major mechanism of pyrazinamide resistance in Mycobacterium tuberculosis. Tuber Lung Dis 78, 117122. Joyce EA, Chan K, Salama NR, Falkow S (2002). Redening bacterial populations: A post-genomic reformation. Nat Rev Genet 3, 462 473. Kato-Maeda M, Rhee JT, Gingeras TR, Salamon H, Drenkow J, Smittipat N, Small PM (2001). Comparing genomes within the species Mycobacterium tuberculosis. Genome Res 11, 547554. Kurian KM, Watson CJ, Wyllie AH (1999). DNA chip technology. J Pathol 187, 267271. Lemaitre N, Sougakoff W, Truffot-Pernot C, Jarlier V (1999). Characterization of new mutations in pyrazinamide-resistant strains of Mycobacterium tuberculosis and identication of conserved regions important for the catalytic activity of the pyrazinamidase PncA. Antimicrob Agents Chemother 43, 17611763. Liu YC, Huang TS, Huang WK, Chen CS, Tu HZ (1998). Dideoxy ngerprinting for rapid screening of rpoB gene mutations in clinical isolates of Mycobacterium tuberculosis. J Formos Med Assoc 97, 400 404. Matveeva OV, Shabalina SA, Nemtsov VA, Tsodikov AD, Gesteland RF, Atkins JF (2003). Thermodynamic calculations and statistical correlations for oligo-probes design. Nucleic Acids Res 31, 4211 4217. Mestdagh M, Fonteyne PA, Realini L, Rossau R, Jannes G, Mijs W, De Smet KA, Portaels F, Van den Eeckhout E (1999). Relationship between pyrazinamide resistance, loss of pyrazinamidase activity, and mutations in the pncA locus in multidrug-resistant clinical isolates of Mycobacterium tuberculosis. Antimicrob Agents Chemother 43, 2317 2319. Mokrousov I, Narvskaya O, Otten T, Limeschenko E, Steklova L, Vyshnevskiy B (2002). High prevalence of KatG Ser315Thr substitution among isoniazid-resistant Mycobacterium tuberculosis clinical isolates from northwestern Russia, 1996 to 2001. Antimicrob Agents Chemother 46, 14171424. Morlock GP, Crawford JT, Butler WR, Brim SE, Sikes D, Mazurek GH, Woodley CL, Cooksey RC (2000). Phenotypic characterization of pncA mutants of Mycobacterium tuberculosis. Antimicrob Agents Chemother 44, 22912295.

M.M. Wade et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 89 97 Volokhov D, Rasooly A, Chumakov K, Chizhikov V (2002). Identication of Listeria species by microarray-based assay. J Clin Microbiol 40, 4720 4728. Zhang Y, Garcia MJ, Lathigra R, Allen B, Moreno C, van Embden JD, Young D (1992). Alterations in the superoxide dismutase gene of an isoniazid-resistant strain of Mycobacterium tuberculosis. Infect Immun 60, 2160 2165.

97

Zhang Y, Mitchison D (2003). The curious characteristics of pyrazinamide: A review. Int J Tuberc Lung Dis 7, 6 21. Zhang Y, Telenti A (2000). Genetics of drug resistance in Mycobacterium tuberculosis. In Molecular Genetics of Mycobacteria. Washington D.C.: ASM Press, pp. 235254. Zhang Y, Young D (1994). Molecular genetics of drug resistance in Mycobacterium tuberculosis. J Antimicrob Chemother 34, 313319.