Diagnosing the Mutation for Progressive Rod-Cone Degeneration in Canines

Progressive retinal atrophy (PRA) is a group of inherited canine diseases characterized by the retinal dystrophy causing progressive loss of vision and eventually blindness (1). The most common disease in this group is progressive rod-cone degeneration (PRCD), which is an autosomal recessive disease. Unlike other forms of PRA, dogs affected by PRCD develop normal photoreceptors and progressive rod-led degeneration occurs later. While most PRA disease affect only one breed of dog, PRCD affects many including English and American cocker spaniels, miniature and toy poodles, Australian cattle dogs, Chesapeake Bay retrievers, Entlebucher sennenhund, Labrador retrievers, Nova Scotia duck tolling retrievers and Portuguese water dogs. The rate and time of onset are different within and between breeds (1). Though, the mutation that causes PRCD and its corresponding gene has just recently been discovered, the locus responsible was mapped to chromosome 9 and associated with a DNA marker that had previously been used in diagnostic linked-marker tests. But this test isnt prefect because recombination can separate the mutation from the marker creating affected dogs with negative results and dogs with the normal alleles with positive results (1). With the discovery of the mutation responsible for PRCD, a more accurate test using PCR-RFLP has been developed to differentiation healthy dogs, carriers and dogs with the disease (2). This will allow breeders to identify carrier dogs and prevent them from breeding; thereby eventually weeding out the PRCD allele from the canine population (1). This is especially important for PRCD compared to other PRA mutations because it affects multiple breeds; so purebreds arent the only dogs at risk for acquiring this disease. Also by knowing the mutation that causes the disease, gene therapy may be developed to help treat the disease (1). The assay used to diagnosis PRCD is a PCR-RFLP assay. A small section of the 9th chromosome is amplified producing a 512 bp sequence. Reagents: Forward primer: ccagtggcagcaggaacc (2) Tm = 60C Reverse primer: ccgacctgctgcccacgactg (2) Tm = 72C 2x Buffer Solution with Taq polymerase (final: 2 units polymerase, 1.5 mM MgCl2, 1 uM dNTPs) (3) Nuclease-free water Template DNA from canine Controls: Reagent blank Same reagents without template DNA Negative control Same reagents with DNA from dog known to lack the mutation

Positive control Same reagents with DNA from a dog known to have the mutation

Outline: 1. Obtain a good quality sample of DNA from dog cells 2. Dilute the buffer solution to working concentration with nuclease-free water and add forward and reverse primer and template DNA in the appropriate amount to make 25 uL reaction solution. Ex (3): o 12.5 uL 2x Buffer solution o 2.5 uL Forward primer o 2.5 uL Reverse primer o 3 uL template DNA o 4.5 uL nuclease-free water 3. Samples were subjected to 35 PCR cycles (2) o Denature: 1 minute at 95C o Annealing: 2 minutes at 58C o Extension: 0.5 minutes at 70C 4. Samples were incubated for an addition 5 minutes after last cycle to complete extension 5. PCR products were incubated at 37C for 2 hours with restriction endonucleases o Rsa1 (GT|AC) cuts PCR product with A allele (PRCD allele) o ApaL1 (G|TGCAC) cuts PCR product with G allele (normal allele) 6. Endonuclease treated samples were electrophoresed in 1% agarose gel for 1 hour at 100 V (2). 7. Bands were detected using ethidium bromide under UV light DNA sequence: PCR product Forward primer gctcaagtgt tcacatctgt gacaacttgg tgaccccact caggatgggc tctcctgcag ccaccctctt gccaaccggg ggagagagga ctcctgggag tttcccatca gctggagtcc ggcccgggcg gagcccagcg cctccagtcc tgcgtcgagg ctagactaga atccagaatg gcccagtgag aatcagcttg agcagtggct actctgtccg cctactcagc tccaaccgtg gaagctaggg gctggagggc gagcacgcgg ccggtccccc ctgcccacag gagcagacgg tcgggcaggt aagcggctgc Reverse primer gggttaggcc tttaccctgc ctgcacaagg tccagtggca ggcagggcca gggcagctga tgctctggcg ggggccatgg ggtgcagggg tgcagggagg tcgcaggtgc ggccaggaga ctcttcctcc ggcagcaggt ctgggctggg ccgaccgtgc PRCD mutation caggtcctag caccgcaggc tcgggttggc gcaggaacct ttttggcctt gccatgtrca ccgccggttc gcagggatgg ctgcctggac tccagagagg tccgagactg gggggttctg cgcccacagg cggagagaga ggaggcaggg ctgggcaggt 1050 1100 1150 1200 1250 1300 1350 1400 1450 1500 1550 1600 1650 1700 1750 1800

agccccttga gacagcttga gttaatcagt agcctcctaa tgtgagagcc ggaggggatg accttggcca agaagctgat ggtgaggggt ggggaggatt gggcgggggc agcccaacac ctcttccagc ggcagtcgtg aaggcagagt cctggccgcc

r ke ar M

ed ct fe Af

al m r No

er rri Ca 603 bp

er rk a M

d te ec f Af

al rm No

ri ar C

er

512 bp 397 bp 310 bp

512 bp

396 bp

281 bp 234 bp 194 bp

116 bp Rsa1 Restriction Enzyme

118 bp 115 bp ApaL1 Restriction Enzyme

The predicted results of a healthy dog, affected dog, and a carrier are shown above for digests with either Rsa1 or ApaL1. Deviation from these results could be caused from contamination or failure to follow the procedure. Reagent blank, positive and negative controls should also be run with the samples as a reference for diagnosis, to ensure proper protocols were following and results are accurate. If any bands are seen in the reagent blank beside primers, contamination is probable and the assay should be repeated with more attention spend on sources of contamination. If either the positive or negative control has the opposite of their predicted result, make sure the proper samples and restriction endonuclease was used. References: 1. 2. Petersen-Jones, S. (2005). Advances in the molecular understanding of canine retinal disease. Journal of Small Animal Practice 46: 371-380. Agurirre et al. (2005). US Patent No. 2005/0282212A1. Washington, DC: US Patent and Trademark Office.

3.

Randall et al. (1988). Primer-Directed Enzymatic Amplification of DNA with a Thermostable DNA Polymerase. Science, New Series 239(4839): 487-491.