Sensors and Actuators B 46 (1998) 220 – 225

Microfabricated disposable DNA sensor for detection of hepatitis

B virus DNA
Koji Hashimoto *, Keiko Ito, Yoshio Ishimori
En6ironmental Engineering Laboratory, Research and De6elopment Center, Toshiba Corporation, 1, Komukai, Toshiba-cho, Saiwai-ku,
Kawasaki 210, Japan
Received 24 June 1997; received in revised form 16 January 1998; accepted 22 January 1998

Abstract

The authors report here a preliminary evaluation of a microfabricated disposable-type DNA sensor, based on photolithography
technique, for the detection of hepatitis B virus (HBV) genome DNA. The DNA sensor was reacted with the HBV-DNA-inserted
plasmid (pYRB259), immersed in a 100 mmol/l Hoechst 33258 solution and washed with a phosphate buffer. The electrochemical
analysis showed that the anodic peak current derived from Hoechst 33258 bound to the formed hybrids on the electrode was
increased with increasing the concentration of pYRB259 in the range from 104 to 106 copy/ml. Then, the authors evaluated the
concentration of HBV-DNA extracted from patients’ sera using a DNA sensor and competitive polymerase chain reaction
(C-PCR). A correlation coefficient of 0.89 was obtained between the two assay methods. The variance for each sample in triplicate
measurements ranged from 2 to 6% in the inter-assay using the DNA sensor. These results suggest that the microfabricated
disposable DNA sensor can provide a specific and quantitative detection of HBV-DNA in sera. © 1998 Elsevier Science S.A. All
rights reserved.

Keywords: DNA sensor; Photolithography; Disposable; Oligonucleotide; Hoechst 33258; Hepatitis B virus

1. Introduction Recently, biosensors for sequence-specific detection

of DNA have been reported [8–17]. All of these biosen-
The specific and quantitative detection of DNA sors consist of a DNA probe coupled to a transducer
which exists in biological samples such as blood, serum, that converts a recognition event into a measurable
tissue, or body fluid is of great significance in the
biomedical field. The results of such analyses can be
used not only to identify infectious diseases but also to
determine appropriate therapies [1 – 3]. In particular,
the quantification of hepatitis B virus (HBV) DNA
and/or hepatitis C virus (HCV) RNA in patients sera is
of practical value for assessing the efficiency of inter-
feron therapy. Various novel techniques such as the
branched DNA probe (bDNA-probe) [4,5] and the
competitive polymerase chain reaction (C-PCR) [6,7]
have been developed for the quantitative analysis of
viral DNA and RNA. However, these methods involve
complex procedures and a long time to obtain data.
Therefore, an easy, faster, highly sensitive, sequence-
specific and quantitative gene detection method has
been long overdue.

* Corresponding author. Tel.: + 81 44 5492167; fax: +81 44

5201307; e-mail: kouji.hashimoto@toshiba.co.jp Fig. 1. Structure of microfabricated DNA sensor.

0925-4005/98/$19.00 © 1998 Elsevier Science S.A. All rights reserved.

PII S0925-4005(98)00121-X
 K. Hashimoto et al. / Sensors and Actuators B 46 (1998) 220–225
signal and are classified into optical methods [8,9],
electrochemical methods [10 – 15] and quartz crystal mi-
crobalance (QCM) methods [16,17] according to detec-
tors used.
The authors have devised a unique, electrochemical
DNA detection method called the ‘DNA sensor,’ which
is based on a gold electrode supporting DNA probes
and a DNA binder (Hoechst 33258) as a hybridization
indicator [14]. In the previous study using oncogene
v-myc as a model DNA, it could detect 104 copy/ml of
the target DNA in about 1 h by measuring the anodic
peak current (ipa) derived from Hoechst 33258 bound to
the hybrids formed on the DNA sensor. Furthermore,
hybridization reaction and binding reaction of Hoechst
33258 to hybrids formed on the gold electrode were
quantitatively analyzed using a QCM [17]. However,
the precision and the reproducibility of the DNA sensor
are not so good for practical use because of the hand-
made electrodes. Furthermore, a large number of the
uniform DNA sensor was required for the practical
evaluation of clinical samples.
Here, the authors report a preliminary evaluation of
a microfabricated disposable DNA sensor, based on a
photolithography technique, for the specific and quanti-
tative detection of HBV-DNA in patients’ sera.
2. Materials and methods
2.1. Disposable DNA sensor
Fig. 1 shows the structure of the disposable DNA
sensor. Both a titanium thin film (99.9%, 500 Å) and a
gold thin film (99.99%, 5000 Å) were subsequently
formed using a 2-dimensional sputtering system (CFS-
8ES, Tokuda, Japan) on a Pyrex glass plate (f= 3
inch, d =1.0 mm, Corning) treated with a piranha
solution (H2SO4:H2O2 =2:1). Then, the electrode (f=
300 mm) was photolithographically processed on the
plate using a photo-resist, AZ4620A (Hoechst Industry,
Tokyo, Japan). The photo-resist was baked at 200°C
for 30 min for the purpose of post baking and perma-
nent insulating of the DNA sensor. The characteristics
of the disposable DNA sensor were estimated by mea-
suring the cathodic current in a 0.5 mol/l sulfuric acid
solution (0 1.7 V, 50 V/s). This value reflects the
surface area and the surface conditions such as the
crystal structure of the electrode.
2.2. Apparatus
Electrochemical analyses were carried out using an
electrochemical analyzer (Model BAS-100B) manufac-
tured by Bioanalytical Systems (BAS, West Lafayette,
IN) and Toshiba (Kawasaki, Japan) J-3100 computer
system with data storage. Voltammetric experiments
221
were carried out in a conventional cell with three
electrodes at 25°C (a reference electrode Ag/AgCl
(BAS), a counter electrode Pt wire (f = 0.5 mm) and
another electrode described below). Unless otherwise
noted, voltammetry was carried out at 100 mV/s in a
1/15 mol/l sodium phosphate buffer (pH 7.0).
2.3. DNA preparation
A DNA probe having a mercaptohexyl group at the
5’-phosphate end which was complementary to HBV-
DNA (P1: 5%HS-PdCGTCCCGTCGGCGCTGAAT-
C3%), a target DNA complementary to the probe (C1:
5%PdGATTCAGCGCCGACGGGACG3%) and a set of
primers for the competitive PCR reaction (p1:
5%PdTCGTGTTACAGGCGGCCTTT3% and p2: 5%Pd-
CGAACCACTGAACAAATGGC3%) were purchased
from Takara-shuzo (Kyoto, Japan). A DNA probe P2
was made by annealing the equivalent amount of the
DNA probe P1 and the target DNA C1 in a 10 mmol/l
Tris–HCl (pH 8.0) − 1 mmol/l EDTA solution, re-
ferred to here as TE buffer at 43°C for 1 h. The
concentrated stock solutions prepared with TE buffer,
were stored at 4 or − 20°C until use. A recombinant
plasmid DNA pYRB259 containing a BamHI fragment
of HBV-DNA (subtype: ayr) was obtained from Jichi
Medical School (Tochigi, Japan) [18]. Clinical samples
were supplied by the Department of Medical Science,
Toshiba Hospital (Tokyo, Japan). Nucleic acids con-
taining HBV-DNA were extracted from 200 ml of pa-
tients’ sera by a standard method using phenol/
chloroform and were dissolved in 200 ml of 300 mmol/l
sodium chloride–30 mmol/l sodium citrate (pH 7.0) −1
mmol/l EDTA, referred to here as 2×SSC-1 mmol/l
EDTA buffer [19]. The total nucleic acid concentration
was quantified using a spectrophotometer or DNA
quantification reagent Picogreen™ (Molecular Probes,
Eugene, OR).
2.4. Competiti6e PCR for HBV-DNA
An internal standard DNA (360 base pair) was con-
structed using the PCR MIMIC™ Construction Kit
(Clontech, Palo Alto, CA). The primers (p1 and p2)
and the internal standard DNA for C-PCR were used
for the specific and quantitative detection of HBV-
DNA [20]. The amount of HBV-DNA in each samples
extracted from patients’ sera was quantified using six
reaction tubes which contained the internal standard
DNAs (102, 103, 104, 105, 106, 107 copies), respectively
[7]. PCR was cycled 30 or 40 times using the thermal
cycler PC 700 (Astec, Fukuoka, Japan). A PCR cycle
included denaturation at 94°C for 45 s, the primer
annealing at 60°C for 45 s and the primer extension at
74°C for 90 s. The amplified DNA was visualized using
electrophoresis stained with ethidium bromide in 3%
222 K. Hashimoto et al. / Sensors and Actuators B 46 (1998) 220–225
Nusieve agarose gel 3:1 (FMC BioProducts, Rockland,
ME).
2.5. Immobilization of DNA probe
The electrode was immersed in an 1 mol/l sodium
chloride–50 mmol/l phosphate buffer (pH 7.0) contain-
ing the DNA probe P1 or P2 at room temperature for
3 h and washed with distilled water. The DNA probe
was immobilized on the gold electrode through the
mercaptohexyl group of the 5%-phosphate end by
chemisorption. In the case of the immobilization of the
DNA probe P2, the target DNA C 1 was dissociated
from the P2 on the surface of the electrode by a
treatment with 0.2 mol/l sodium hydroxide – 1 mmol/l
EDTA solution for 5 min after immobilization. Then,
the electrode was immersed into a hybridization buffer
(2 × SSC-1 mmol/l EDTA) at 43°C, for 30 min, with
continuous shaking (150 rpm) to remove the non-spe-
cifically bound DNA probe.
2.6. HBV-DNA detection with the DNA sensor
The DNA sensor was immersed in a 100 ml of
2 × SSC–1 mmol/l EDTA buffer containing the target
DNA denatured in a boiling water for 3 min. The
hybridization reaction was carried out at 43°C for 1 h
with shaking. After the reaction, the sensor was washed
with a hybridization buffer to remove the non-specifi-
cally bound DNA. Then, the sensor was immersed in a
100 mmol/l Hoechst 33258 solution (10 mmol/l Tris–
HCl (pH 7.5)–100 mmol/l sodium chloride) in a plastic
vessel at room temperature for 5 min under dark condi-
tions and washed with a 1/15 mol/l phosphate buffer
(pH 7.0) for 5 min. The anodic peak current (ipa)
derived from the Hoechst 33258, associated with the
hybrids formed on the electrode obtained by linear
sweep voltammetry (LSV), was used to determine the
quantity of HBV-DNA. When the anodic current was
over 110 nA, the sample was diluted 10- to 1000-fold
with 2× SSC–1 mmol/l EDTA buffer for re-evaluation
of the amount of HBV-DNA.
3. Results and discussion
3.1. Characterization of the disposable DNA sensor
Before the probe immobilization, the electrochemical
property of the disposable DNA sensor was estimated
by measuring the cathodic current in a sulfuric acid
solution. The cyclic voltammogram showed the typical
wave of gold in a sulfuric solution. It was assumed that
the clean surface of the gold electrode was obtained for
the DNA probe immobilization [21]. Furthermore, a
low scatter of the cathodic current with CV of less than
Fig. 2. The effect of DNA probe immobilization conditions on
hybridization efficiency.
1.16% (n= 40) indicated the uniformity of the dispos-
able electrodes.
3.2. Probe immobilization
The authors studied the probe immobilization condi-
tions to improve the hybridization efficiency on the
DNA sensor. The DNA probe P1 or the double-
stranded form P2 were immobilized on the gold elec-
trode. In the case of the probe P2 immobilization, the
probe was denatured to the single-stranded form by
alkaline treatment on the electrode surface. The anodic
currents of Hoechst 33258 derived from the DNA
sensor were measured for solutions containing 108 and
0 copy/ml pYRB259 in the hybridization buffer (Fig.
2). Voltammetric experiments showed that the higher
anodic current was always obtained from the DNA
sensor reacted with pYRB259 compared with the data
without target DNA confirming that the microfabri-
cated disposable DNA sensor can indeed detect target
DNA. The biggest difference in the currents (Dipa)
between the DNA sensors (24 nA) was obtained when
the immobilization of the DNA probe P2 was carried
out at a concentration of 2.5 mg/ml. This value was
about 1.6-fold higher than an optimum condition of
conventional single-stranded probe P1 immobilization
(15 nA). It was assumed that this concentration range
of probe P2 immobilization was most suitable for sensi-
tive HBV-DNA detection using the DNA sensor. The
quantity of the hybridized target increased with increas-
ing the probe concentration from 0 to 2.5 mg/ml and 0
to 1 mg/ml in the case of the DNA probe P2 and P1,
respectively. However, with larger amounts of the
probe immobilized on the solid surface, a lower hy-
bridization efficiency was observed due to an increase
of steric hindrance [17].
 K. Hashimoto et al. / Sensors and Actuators B 46 (1998) 220–225 223

3.3. HBV-DNA detection

Initially the authors estimated the sensitivity of the

disposable DNA sensor using a recombinant plasmid
pYRB259 containing a BamHI fragment of HBV-
DNA. The dilution experiments with pYRB259 indi-
cated that the detection threshold of the DNA sensor
was 104  105 copy/ml in the hybridization buffer (Fig.
3). Furthermore, the ipa values derived from the
Hoechst 33258 bound to the hybrids formed on the
electrodes were related to the logarithm of the concen-
Fig. 4. Quantitative C-PCR with internal standard. M: molecular
tration of pYRB259 in the range 104 to 106 copy/ml.
weight marker (pBR322/Msp I digest).
The DNA sensor detects pYRB259 containing HBV-
DNA quantitatively, with high sensitivity.
4. Conclusions
To investigate the performance of the DNA sensor in
clinical samples, the authors estimated the concentra-
The authors have developed a disposable DNA sen-
tion of HBV-DNA in the samples, extracted from
sor. Introduction of a microfabrication process helped
patients’ sera, using the calibration curve mentioned
to reduce the variance among the DNA sensors to less
above. The variance for each clinical sample in tripli-
than 6%. Furthermore, HBV-DNA extracted from pa-
cate measurements ranged from 2 to 6% in the inter-
tients’ sera was quantified in the range 104 to 106
assay.
copy/ml and the DNA sensor showed a good correla-
tion with C-PCR, although the samples extracted from
3.4. Correlation between DNA sensor and C-PCR patients’ sera contained not only HBV-DNA but also
nanogram levels of human genomic DNA which were
The HBV-DNA concentrations determined by the 103-fold higher values than HBV-DNA. From these
DNA sensor in clinical samples were compared with preliminary experiments, the authors suggest that the
those obtained by a conventional nucleic acid quantifi- microfabricated disposable DNA sensor can provide a
cation method, C-PCR. Fig. 4 showed an example of specific and quantitative detection of HBV-DNA in
C-PCR results for HBV-DNA and internal standard sera. Viral quantification can be a valuable tool for
DNA, which were amplified to 513 and 360 base pair monitoring antiviral therapy and disease trends and for
fragments, respectively. In this experiment, HBV-DNA developing a more informed prognosis.
was quantified as 105 copy. Linear regression analysis The correlation coefficient between the bDNA=probe
revealed a correlation coefficient of 0.89 between both method developed by Chiron (Emeryville, CA) and
methods and the best-fit line was represented by the C-PCR in the measurement of HCV-RNA was reported
equation y=0.60 x +2.57 in the range 105 to 108 as 0.70 [4]. The authors found the correlation coeffi-
copy/ml of HBV-DNA (Fig. 5).

Fig. 3. Calibration curve for the amount of pYRB259 using DNA Fig. 5. Correlation between DNA sensor and C-PCR of HBV-DNA
sensor. The error bars: mean 9 S.D. extracted from patients’ sera.
224 K. Hashimoto et al. / Sensors and Actuators B 46 (1998) 220–225
cient between the DNA sensor and C- PCR to be 0.89.
In these methods, there were differences in conditions
such as DNA extraction methods, probes and primers.
These reaction conditions are very important for the
detection of specific DNA sequences, especially with
regard to quantification with high sensitivity. In the
field of DNA quantification, there is no standard
method yet. Standardization is necessary for gene diag-
nosis using DNA probes.
Ito et al. reported a specific probe immobilization to
get a high efficiency for the hybridization using a QCM.
The probe was annealed with its fully complimentary
sequence and denatured by treating with an alkaline
solution after immobilization. This probe immobiliza-
tion made the hybridization efficiency about 2-fold
higher than the conventional single-stranded probe im-
mobilization due to the less sterichindrance. This
method was suitable for the microfabricated disposable
DNA sensor. Furthermore, Hoechst 33258 bound not
only double stranded part of the hybrid DNA (20 base
pair) but also to single stranded target DNA. There-
fore, the size of target DNA is important for
calibration.
The microfabricated disposable DNA sensor can
provide a quick and convenient method for determining
target DNAs specifically and quantitatively. The au-
thors plan to further improve the sensitivity of the
DNA sensor to increase its range of applications for the
detection of other viruses and bacteria.
Acknowledgements
We are grateful for the invaluable contributions of
Dr. K. Takahashi and Dr. S. Mishiro, Department of
Medical Science, Toshiba Hospital and Dr. H.
Okamoto and Dr. M. Mayumi, Jichi Medical School.
We also wish to thank Hiroyuki Suzuki and Mitsuru
Ishibashi for manufacturing the DNA sensor and Man-
abu Kawada for evaluating the electrochemical prop-
erty of the DNA sensor.
References
[1] H. Okamoto, Y. Sugiyama, S. Okada, K. Kurai, Y. Akahane, Y.
Sugai, T. Tanaka, K. Sato, F. Tsuda, Y. Miyakawa, M.
Mayumi, Typing hepatitis C virus by polymerase chain reaction
with type-specific primers: application to clinical surveys and
tracing infectious sources, J. Gen. Virol. 73 (1992) 673–679.
[2] S. Pang, Y. Koyanagi, S. Miles, C. Wiley, H.V. Vinter, I.S.Y
Chen, High levels of unintegrated HIV-1 DNA in brain tissue of
AIDS dementia patients, Nature 343 (1990) 85–89.
[3] A. Meyerhans, R. Cheyneier, J. Albert, M. Seth, S. Kwok J.
Sninsky, L. Morfeldt-Månson, B. Asjö, S. Wain-Hobson, Tem-
poral fluctuations in HIV quasispecies in vivo are not reflected
by sequential HIV isolation, Cell 320 (1989) 1458–1462.
[4] K.E. Sherman, J. O’Brien, A.G. Gutierrez, S. Harrison, M.
Urdea, P. Neuwald, J. Wilber, Quantitative evaluation of hepati-
tis C virus RNA in patients with concurrent human immunodefi-
ciency virus infections, J. Clin. Microbiol. 31 (1993) 2679–2682.
[5] M.S. Urdea, T. Horn, T.J. Fultz, M. Anderson, J.A. Running, S.
Hamren, D. Ahle, C-A. Chang, Branched DNA amplification
multimers for the sensitive, direct detection of human hepatitis
virus, Nucleic Acids Res. 24 (1991) 197 – 200.
[6] A.M. Wang, M. Doyle, D.F. Mark, Quantitation of mRNA by
the polymerase chain reaction, Proc. Natl. Acad. Sci. USA 86
(1989) 9717 – 9721.
[7] P.D. Siebert, W. Larrick, Competitive PCR, Nature 359 (1992)
557 – 558.
[8] P.A.E. Piunno, U.J. Krull, R.H.E. Hudson, M.J. Damha, H.
Cohen, Fiber optic biosensor for fluorometric detection of DNA
hybridization, Anal. Chim. Acta 288 (1994) 205 – 214.
[9] K. Bondeson, A. Frostel-Karlsson, L. Fagerstam, G. Magnus-
son, Lactose repressor-operator DNA interactions: Kinetics
analysis by a surface plasmon resonance biosensor, Anal.
Biochem. 214 (1993) 245 – 251.
[10] J. Wang, G. Rivas, X. Cai, N. Dontha, H. Shiraishi, D. Luo,
F.S. Valera, Sequence-specific electrochemical biosensing of M.
tuberculosis DNA, Anal. Chim. Acta 337 (1997) 41 – 48.
[11] S. Liu, J. Ye, P. He, Y. Fang, Voltammetric determination of
sequence-specific DNA by electroactive intercalator on graphite
electrode, Anal. Chim. Acta 335 (1996) 239 – 443.
[12] K.M. Millan, S.R. Mikkelsen, Voltammetric DNA biosensor for
cystic fibrosis based on a modified carbon paste electrode, Anal.
Chem. 66 (1994) 2943 – 2948.
[13] K. Hashimoto, K. Ito, Y. Ishimori, Novel DNA sensor for
electrochemical gene detection, Anal. Chim. Acta 286 (1994)
219 – 224.
[14] K. Hashimoto, K. Ito, Y. Ishimori, Sequence-specific gene detec-
tion with a gold electrode modified with DNA probes and an
electrochemically active dye, Anal. Chem. 66 (1994) 3830–3833.
[15] S.R. Mikkelsen, Electrochemical biosensors for DNA sequence
detection, Electroanalysis 8 (1996) 15 – 19.
[16] Y. Okahata, Y. Matsunobu, K. Ijiro, M. Mukae, A. Makami, K.
Makino, Hybridization of nucleic acids immobilized on a quartz
crystal microbalance, J. Am. Chem. Soc. 114 (1992) 8299–8300.
[17] K. Ito, K. Hashimoto, Y. Ishimori, Quantitative analysis for
solid-phase hybridization reaction and binding reaction of DNA
binder to hybrids using a quartz crystal microbalance, Anal.
Chim. Acta 327 (1996) 29 – 35.
[18] H. Okamoto, M. Imai, M. Shinozaki, Y. Hoshi, H. Iizuka, T.
Gotanda, F. Tsuda, Y. Miyakawa, M. Mayumi, Nucleotide
sequence of a cloned hepatitis B virus genome, subtype ayr:
comparison with genomes of the other three subtype, J. Gen.
Virol. 67 (1986) 2305 – 2314.
[19] F. M. Ausbel et al. (Eds), Current Protocols in Molecular
Biology, Wiley-Interscience, New York, 1987, Chapter 2.1.3.
[20] H. Okamoto, K. Yano, Y. Nozaki, A. Matsui, H. Miyazaki, K.
Yamamoto, F. Tsuda, A. Machida, S. Mishiro, Mutations
within the S gene of hepatitis B virus transmitted from mothers
to babies immunized with hepatitis B immune globulin and
vaccine, Pediatric Res. 32 (1992) 264 – 268.
[21] D.T. Sawyer, J.L. Roberts Jr., Experimental Electrochemistry
for Chemists, Wiley, New York, 1974, p. 67.
Biographies
Koji Hashimoto received his Ph.D. degree in applied
chemistry from Tokyo University of Agriculture and
 K. Hashimoto et al. / Sensors and Actuators B 46 (1998) 220–225
Technology in 1998. In 1989 he became a member of
the Research and Development Center Toshiba Cor-
poration and studied the DNA sensor based on an
electrochemical reaction since 1990.
Keiko Ito received the B.Agr. degree in agricultural
chemistry from Nagoya University and became a
member of the Research and Development Center
Toshiba Corporation in 1990. She has been working
on the development of biosensors for sequence-spe-
225
cific detection of DNA using an electrode and a
quartz crystal microbalance.
Yoshio Ishimori received the Ph.D. degree in
engineering from Tokyo Institute of Technology and
became a member of the Research and Development
Center Toshiba Corporation in 1982. His current
research work is focused on the development of
biosensors including the electrochemical DNA
sensor.