Biotechnol Lett DOI 10.

1007/s10529-011-0667-8

ORIGINAL RESEARCH PAPER

Sleeping Beauty-mediated knockdown of sheep myostatin by RNA interference

Shengwei Hu Wei Ni Wujiafu Sai Hui Zhang Xudong Cao Jun Qiao Jinliang Sheng Fei Guo Chuangfu Chen

Received: 5 May 2011 / Accepted: 1 June 2011 Springer Science+Business Media B.V. 2011

Abstract Myostatin is a negative regulator of skeletal muscle growth. Myostatin dysfunction therefore offers a strategy for promoting animal muscle growth in livestock production. Knockdown of myostatin was achieved by combining RNA interference and the Sleeping Beauty (SB) transposon system in sheep cells. Four targeting sites of sheep myostatin were designed and measured for myostatin silencing in sheep fetal broblasts by real-time PCR. The sh3 construct induced signicant decrease of myostatin gene expression by 90% (P \ 0.05). Myostatin silencing induced by SB-mediated sh3 was further tested in stably transfected cells. SB transposition increased the integration frequency of genes into sheep genomes and mediated a more efcient myostatin knockdown than random integration of sh3. We suggest that SB-mediated shRNA provides a novel potential tool for gene knockdown in the donor cells of animal cloning.
S. Hu W. Ni W. Sai H. Zhang J. Qiao J. Sheng F. Guo C. Chen (&) College of Animal Science and Technology, Shihezi University, Shihezi 832003, China e-mail: chencf1962@yahoo.com S. Hu W. Ni Key Laboratory of Agrobiotechnology, Shihezi University, Shihezi 832003, China X. Cao School of Medicine, Shihezi University, Shihezi 832003, China

Keywords Myostatin RNA interference Sheep fetal broblasts Sleeping Beauty

Introduction Myostatin is a transforming growth factor-b family member that acts as a negative regulator of skeletal muscle development and growth. Myostatin knockout in mice doubles the skeletal muscle weight throughout the body (McPherron et al. 1997). Natural mutations of myostatin occur in some cattle breeds (Kambadur et al. 1997; McPherron and Lee 1997) and dogs (Mosher et al. 2007). Similarly, these animals show a double-muscled phenotype of dramatically increased muscle mass. These ndings have suggested that strategies capable of inhibiting myostatin expression may be applied to enhance animal growth performance in livestock production. RNA interference (RNAi), a method of sequence specic gene knockdown, has been used to analyse gene function and develop novel animal models. Several groups, including our own, have developed transgenic RNAi mice that can produce a gene knockdown phenotype by stably integrated shRNA expression vector in vivo (Hemann et al. 2003; Wang et al. 2010). These ndings make shRNA transgenics an attractive alternative to homologous gene knockout, especially for livestock animal for which stem

123

Biotechnol Lett

cells have yet to be derived. Recently, transgenic RNAi sh with myostatin silenced were successfully produced, which led to increased muscle mass (Lee et al. 2009). These ndings suggest that livestock could be produced with enhanced muscle mass by knocking down myostatin using RNAi technology. The Sleeping Beauty (SB) transposon system is a non-viral DNA delivery system in which transposase directs integration of SB transposon into TA-dinucleotide sites of cell genome (Ivics et al. 1997). SB displays a certain degree of specicity in target-site utilization (Vigdal et al. 2002) and can effectively mediate transposition of foreign genes in cultured cell lines (Ivics et al. 1997; Izsvak et al. 2000) and in vivo in adult animals (Belur et al. 2003; Kren et al. 2003). Combining RNAi-mediated gene silencing and SB transposition has previously been used to down-regulate genes expression. Examples include SB-mediated RNAi targeting the lamin A gene (Heggestad et al. 2004) and the huntingtin gene, which may serve as a potential therapy for Huntington disease (Chen et al. 2005). In this study, we investigated the possibility of combining RNAi and the SB transposon to achieve stable and high-level reduction of myostatin expression in sheep fetal broblasts. Our results show that specic shRNAs targeted to sheep myostatin significantly reduced myostatin mRNA expression in cell culture. Moreover, SB transposon-mediated shRNAs have an increased transgenic integration rate and induce a more efcient myostatin knockdown than random integration of anti-myostatin shRNA.

generated through multiple cloning steps involving several different plasmids. The IR/DR elements from plasmid pT-SVNeo (Ivics et al. 1997) were rst cloned into pBluescript II KS to generate pSB-TnMCS. The left IR/DR was removed with KpnI and BamHI, blunted, and cloned into the EcoRV site, while the right IR/DR was removed with EcoRI and SalI, blunted, and cloned into the blunted SacI site of pBluescript II KS. The blunted XhoI and SalI fragment (containing the entire neomycin expression cassette) of pMC1neo PolyA vector (Stratagene) was cloned into pSB-Tn-MCS, generating SB-Tn-Neo. A BamHI and XbaI fragment containing sh3 or shScr cassette was subcloned into the BamHI and XbaI site of the SB-Tn-Neo vector, generating SB-Tn-sh3 or SB-Tn-shScr. Cell culture, transfection and selection Sheep broblast cells were isolated and cultured as previously described (Hu et al. 2011); 2 9 105 cells per well were seeded in 12-well plate and cultured in fresh DMEM without antibiotics to achieve 8090% conuency on the day of transfection. The cells were then transfected with 1.8 lg/well of each anti-myostatin shRNA vectors using Lipofectamine 2000. Scrambled shRNA transfected cells were used as control group. To generate stable shRNA-expressing cell lines, sheep broblasts were seeded in 6-well plate and cultured in fresh DMEM without antibiotics to achieve 8090% conuency on the day of transfection. Sheep broblasts were co-transfected with SBTn-sh3 and either pCMV/SB11 or pcDNA 3.1 at ratio of 1:1 using Lipofectamine 2000 (Invitrogen) according to the manufacturers protocol. Cells co-transfected with SB-Tn-shScr and pCMV/SB11 were used as control group. After 48 h transfection, cells were split into 100 mm dish at an appropriate dilution for G418 selection (500 mg/ml). Colonies were stained with methylene blue and counted after 14 days of selection. Real-time RT-PCR analysis Total RNA was isolated 48 h post-transfection using Trizol (Invitrogen) according to the manufacturers instructions. From puried RNA, cDNA was synthesized using random hexamer primers and Superscript First-Strand Synthesis System (Invitrogen). The

Materials and methods Target sites of sheep myostatin and plasmid construction The sheep myostatin mRNA sequence (GenBank accession number NM_001009428) was analysed for potential siRNA targets using the Dharmacon siDESIGN Center software. Four regions were selected for further testing (Table 1). The shRNA-annealed oligonucleotides were cloned into the psU6-1-shEGFP containing the sheep U6 promoter (Hu et al. 2011) to generate anti-myostain shRNA expression vectors (psU6-1-shMSTN). The construction of the SB transposon-mediated shRNA expression vectors (SB-Tn-shRNA) was

123

Biotechnol Lett Table 1 Target sequences examined

No 1 2 3 4

siRNA target sequence GAAAGACGGTACAAGGTAT CCCAGAACCAGGAGAAGAA CAAAGATGCTATAAGACAA GGCCAATTACTGCTCTGGA

Position 540558 723741 219237 915933

Region ORF ORF ORF ORF

GC% 42 53 32 52

prepared cDNA was quantied at 260 nm. The following primers were used for myostatin amplication (MSTN-F 50 -ATCCGATCTCTGAAACTTGA CAT-30 and MSTN-R 50 -AGTCCTTCTTCTCCTGG TTCTG-30 ) and for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (GAPDH-F 50 -GGCGC CAAGAGGGTCAT-30 and GAPDH-R 50 -GTGGT TCACGCCCATCACA-30 ). Real-time PCR (Stratagene MX3000P) was carried out using SYBR Green (TaKaRa Biotech, Dalian) following the manufacturers protocol. PCR consisted of denaturation at 95C for 5 min followed by 45 cycles at 95C for 15 s, 56C for 15 s and 72C for 10 s. Cycle threshold (Ct) values were normalized to GAPDH, and comparative quantication of myostatin mRNA was done by the DDCt method (Livek and Schmittgen 2001). Western blot analysis G418-resistant cells were harvested and lysed for analysis of myostatin expression. Equal amounts of total proteins were run on 12% (v/v) gel electrophoresis and electrophoretically transferred to a nitrocellulose membrane. A primary rabbit anti-myostatin and monoclonal anti-GAPDH (Sigma) were used in the western blotting. The washed membranes were incubated with 1:1,000 dilution of secondary antibody linked to horseradish peroxidase (HPR). HPR activity was detected using western blot chemiluminescence (Promega). Band intensities were estimated by densitometry and corrected by the respective GAPDH band intensities. Splinkerette-PCR Genomic DNA was isolated from G418-resistant sheep cell clones. Splinkerette-PCR was performed as described (Devon et al. 1995) on Sau3AI-digested genomic DNA. Primers for primary PCR were

primerette-short (50 -CCTCCACTACGACTCACT 0 GAAGGGC-3 ) and PK1 (50 -ATTGTCTGTTGTGC CCAGTCATAG-30 ). A secondary nested PCR entailed primerette-nested (50 -GGGCAAGCAGTCCTAA CAACCATG-30 ) and PK2 (50 -GCGTGCAATCCAT CTTGTTCAATG-30 ). PCR products were sequenced and sequences were maped to the incomplete sheep genome (http://www.livestockgenomics.csiro.au/).

Results and discussion Transient knockdown of myostatin Four target sites of sheep myostatin were designed by the Dharmacon siDESIGN Center software (Table 1). For each target site, anti-myostatin shRNA expression vectors were constructed and conrmed by sequencing. Sheep broblast cells were transiently transfected with anti-myostatin shRNA vectors and evaluated for silencing of mytostatin by real time RTPCR (Fig. 1). Out of the four anti-myostatin shRNA vectors, three resulted in 5690% decreases in myostatin mRNA levels compared to the scrambled shRNA control (Fig. 1). The sh3 transfected cells showed the greatest reduction in myostatin mRNA expression to 10%, which was signicantly lower than for the scrambled shRNA transfected cells (P \ 0.05). SB transposon increases integration efciency In the sheep broblasts co-transfected with SB-Tnsh3 and pCMV/SB11, more G418-resistant integrants (97 colonies) were identied than that in the broblasts co-transfected with SB-Tn-sh3 and pcDNA 3.1 (32 colonies). The SB transposon resulted in threefold increase of gene integration efciency in sheep broblasts. Together with broblast cells as the most widely used donor cells for cloning of livestock

123

Biotechnol Lett
Level of myostatin mRNA (%)
120 100 80 60 40 20 0

Level of myostatin mRNA (%)

120 100 80 60 40 20 0

* * *
shScr sh1 sh2 sh3 sh4

* *
shScr+SB+ sh3+SB+ sh3+SB-

Fig. 1 Inhibition of myostatin expression in sheep cells transfected with four different anti-myostatin shRNAs. The level of myostatin mRNA expression was determined by realtime RT-PCR 48 h post-transfection and normalized to GAPDH expression. Three independent experiments were performed on triplicate samples. shScr scrambled shRNA control, sh1-4 anti-myostatin shRNA vectors. * Statistically signicant difference (P \ 0.05) with scrambled shRNA control

animals, the increase of transgene integration frequency in such cells could make the selection of transgenic donor cells more efcient. Knockdown of sheep myostatin by SB-mediated RNAi To address stable and effective silencing of myostatin gene expression, sheep broblasts were co-transfected with SB-Tn-sh3 and either SB transposase plasmid (pCMV/SB11) or control plasmid (pcDNA 3.1). The transfected cells were selected and harvested for myostatin transcript and protein analysis. Real-time RT-PCR analysis revealed that SB-mediated sh3 induced a 89% decrease in the level of myostatin transcripts, whereas only a 54% decrease of myostatin transcripts was observed for the sh3 in the absence of SB transposase when compared with SB-mediated shScr (P \ 0.05) (Fig. 2a). Western blot analysis showed that myostatin protein levels in SB-mediated sh3-integrated cells were 2.5 times as less as that in cells with sh3 stably integrated in the absence of SB transposase (Fig. 2b). These results showed that SB-mediated shRNA induced a more efcient myostatin knockdown in sheep broblasts than random integration of shRNA. Analysis of integration sites in sheep broblasts To characterize SB integration sites in sheep cells, we used splinkerette-PCR on genomic DNA digested

Fig. 2 Myostatin expression levels in sheep cells treated with SB-mediated shRNA. Sheep broblasts were co-transfected with SB-Tn-sh3 and either SB transposase plasmid (pCMV/ SB11) or control plasmid (pcDNA 3.1). Myostatin transcript and protein levels were analysed in the stably transfected cells after 14 days of G418 selection. a The amounts of myostatin mRNA were determined using real-time RT-PCR and normalized to GAPDH expression. b Western blot analysis of myostatin protein expression levels in the stably transfected cells. sh3 ? SB-, SB-Tn-sh3 co-transfected with pcDNA 3.1; sh3 ? SB1, SB-Tn-sh3 co-transfected with pCMV/SB11; shScr ? SB1, SB-Tn-shScr co-transfected with pCMV/SB11. * Statistically signicant difference (P \ 0.05) with scrambled shRNA control

with Sau3AI to identify junction sites between transposon and genomic DNA. Sequence analysis of junction fragments indicated that the SB transposons were anked by TA dinucleotides and lacked plasmid sequences adjacent to the transposons. Four of these integration sites were unique and could be mapped electronically of sheep 3, 7, 13 and X chromosomes, all located in intergenic regions of the chromosomes (Table 2). However, the data presented in this study are still limited; it is necessary to examine whether SB-mediated transgene can integrate into sheep genes or result in mutagenesis and chromosomal aberration, but our observation indicate that the targeted cells showed no abnormal morphology or growth. Our study shows stable and efcient knockdown of the myostatin expression in sheep broblasts using

123

Biotechnol Lett Table 2 Integration sites in sheep broblasts Flanking sequence of integration site CATTGCCAAGTTTTTCCTTTAAGTTCATTA ATGCCAAGTTTGGAAACTGGCACTTTAATA AAGATAATGACAAGTTTGATAAGTTTTATA TGTGGAAAAGCAACATTTAGTTCATTGATA
a

SB transposon CAGTTGAA CAGTTGAA CAGTTGAA CAGTTGAA

Chromosome Chrom 3 Chrom 7 Chrom 13 Chrom X

Gene hita No hit No hit No hit No hit

The result was from the blast analysis between anking sequences and Bos taurus genome Heggestad AD, Notterpek L, Fletcher BS (2004) Transposonbased RNAi delivery system for generating knockdown cell lines. Biochem Biophys Res Commun 316:643650 Hemann MT, Fridman JS, Zilfou JT, Hernando E, Paddison PJ, Cordon-Cardo C, Hannon GJ, Lowe SW (2003) An epiallelic series of p53 hypomorphs created by stable RNAi produces distinct tumor phenotypes in vivo. Nat Genet 33:396400 Hu SW, Ni W, Hazi W, Zhang H, Zhang N, Meng R, Chen CF (2011) Cloning and functional analysis of sheep U6 promoters. Anim Biotechnol (accept) Ivics Z, Hackett PB, Plasterk RH, Izsvak Z (1997) Molecular reconstruction of sleeping beauty, a Tc1-like transposon from sh, and its transposition in human cells. Cell 91:501510 Izsvak Z, Ivics Z, Plasterk RH (2000) Sleeping beauty, a wide hostrange transposon vector for genetic transformation in vertebrates. J Mol Biol 302:93102 Kambadur R, Sharma M, Smith TPL, Bass JJ (1997) Mutations in myostatin (GDF8) in double-muscled Belgian blue and Piedmontese cattle. Genome Res 7:910915 Kren BT, Gosh SS, Linehan CL, Roy-Chowdhury N, Hackett PB, Roy-Chowdhury J, Steer CJ (2003) Hepatocyte-targeted delivery of sleeping beauty mediates efcient transposition in vivo. Gene Ther Mol Biol 7:231240 Lee CY, Hu SY, Gong HY, Chen MHC, Lu JK, Wu JL (2009) Suppression of myostatin with vector-based RNA interference causes a double-muscle effect in transgenic zebrash. Biochem Biophys Res Commun 387:766771 Livek KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCt method. Methods 25:402408 McPherron AC, Lee SJ (1997) Double muscling in cattle due to mutations in the myostatin gene. Proc Natl Acad Sci USA 94:1245712461 McPherron AC, Lawler AM, Lee SJ (1997) Regulation of skeletal muscle mass in mice by a new TGF-b superfamily member. Nature 387:8390 Mosher DS, Quignon P, Bustamante CD, Sutter NB, Mellersh CS, Parker HG, Ostrander EA (2007) A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genet 3:779786 Vigdal TJ, Kaufman CD, Izsvak Z, Voytas DF, Ivics Z (2002) Common physical properties of DNA affecting target site selection of Sleeping Beauty and other Tc1/mariner transposable elements. J Mol Biol 323:441452 Wang PY, Jiang JJ, Li N, Sheng JL, Ren Y, Chen CF, Guo ZR (2010) Transgenic mouse model integrating siRNA targeting the foot and mouth disease virus. Antivir Res 87:265268

SB-mediated RNAi. By using the SB transposon gene transfer system, increased integration frequency and effective gene knockdown can be observed in sheep broblasts. The SB transposon effectively integrated foreign genes into the sheep chromosomes as reported in other animal cells (Izsvak et al. 2000; Dupuy et al. 2001). Transposon insertion occurred on a variety of chromosomes and chromosomal regions. Furthermore, we have obtained large numbers of SB-mediated transgenic embryos by somatic cell nuclear transfer (data not shown). However, it is possible that SBmediated shRNA expression in transgenic cloned embryo or animal is negatively affected by DNA methylation and histone deacetylation induced by SB transposition into the sheep genomes, which may reduce the degree of myostatin knockdown in animals. In summary, this study suggests that the SB transposon-mediated shRNA can be used as a potential tool to down-regulate gene expression in the donor cells for animal cloning.
Acknowledgments This work was supported by grants from the 973 Program (2010CB530200) and Projects of Cultivating New Varieties by Transgenic Technology (2009ZX08005003B).

References
Belur LR, Frandsen JL, Dupuy AJ, Ingbar DH, Largaespada DA, Hackett PB, McIvor RS (2003) Gene insertion and long-term expression in lung mediated by the Sleeping Beauty transposon system. Mol Ther 8:501507 Chen ZJ, Kren BT, Wong PY, Low WC, Steer CJ (2005) Sleeping beauty-mediated down-regulation of huntingtin expression by RNA interference. Biochem Biophys Res Commun 329:646652 Devon RS, Porteous DJ, Brookes AJ (1995) Splinkerettesimproved vectorettes for greater efciency in PCR walking. Nucleic Acids Res 23:16441645 Dupuy AJ, Fritz S, Largaespada DA (2001) Transposition and gene disruption in the male germline of the mouse. Genesis 30:8288

123