1

I. INTRODUCTION

I.1. Conservation Genetics The biological diversity of our planet is rapidly diminishing as a direct and indirect consequence of human behaviour. A large number of species are already extinct, and the populations of many others have been reduced to levels where they risk extinction. Species are being lost at a rate that far exceeds the emergence of new species. The current extinction problem has been called the sixth extinction as its magnitude compares with that of other five mass extinctions revealed in geological records. In the past two decades, genetic technologies have been used to determine in precise detail the prospective status of several endangered species. With the application of molecular techniques in genetic studies of endangered species, conservation genetics has become a distinct discipline. The science of conservation genetics is a mixture of ecology, molecular biology, population genetics, mathematical modeling and evolutionary systematics (Frankham et. al. 2002). Identification of species using molecular techniques can prove necessary in conditions where the identity of defecators may not always be known, as in the field. In recent years, genotyping using faecal DNA extracts has become a useful tool to solve some of the problems associated with the study of rare and endangered wild animal species (Ernest et al. 2000, Taberlet et al. 1997, Taberlet and Luikart 1999). The technique is based on the Polymerase Chain Reaction (PCR), which allows the amplification of DNA from minute amounts of source material (Mullis and Faloona 1987). Thus, it is no longer necessary to acquire large amounts of fresh tissue for genetic analyses. Consequently, DNA extracted from source materials that can be obtained without catching the target animal, such as faeces or hair follicles, can now be used to generate a genetic profile unique to the animal from which the sample originated (Farrell et al. 2000, Hedmark et al. 2004, Kohn et al. 1999). In the case of faecal samples, DNA is extracted from epithelial cells shed from the intestinal lining (Hoss et al. 1992).

2 I.2. Mitochondrial DNA markers Mitochondrial DNA (mtDNA) is an extra-nuclear genome that is maternally inherited, haploid and non-recombining. Because each cell has a large number of mitochondria, amplification of specific segments of mtDNA is relatively straightforward, even from non-invasively collected, degraded DNA samples. Because of moderate intraspecific variation, the mtDNA cytochrome b (cyt b) gene can unequivocally determine the species from which a sample was obtained (see Figure 1). The dendrogram depicted below illustrates the potential of using mtDNA cyt b as a marker for species identification, even from degraded samples like scats. Particularly noteworthy is the neat clustering obtained across different field species and the strong alignment of a scat sample with reference tiger sequences from GenBank database suggesting it may likely have originated from tiger.

Figure 1. Neighbor Joining (NJ) genetic distance tree constructed using 110 bp of mtDNA cytochrome b sequences from different felid species (Data obtained from B. Yumnam, personal communication).

Figure 2. Genomic organization of the 17 kb long cytoplasmic mitochondrial (Cymt) DNA. Depicted in the schematic representation is the control region (CR) segment, and the corresponding PCR primer pair, CR-UPF/CR-R2B, which is used in this study (Adapted from Luo et. al. 2004).

The mitochondrial genome comprises a circular chromosome of DNA (Figure 2). Vertebrate mtDNA ordinarily contains 36 or 37 genes; two for ribosomal RNAs , 22 for tRNAs and 12 or 13 subunits of multimeric proteins of the inner mitochondrial membrane. In addition there is a noncoding sequence termed the control region (CR) due to its role in replication and transcription of mtDNA molecules. Exons in the mtDNA are tightly packed with no spacing introns and. MtDNA is histonefree, has limited repair ability, and therefore has a relatively high mutation-fixation rate (5 to 10 times that of single copy nuclear DNA). The rate of evolution is different for different regions of the mtDNA and has been used to examine various phylogenetic relationships. 12s rDNA is

4 highly conserved and has been employed to illustrate phylogeny of higher categorical levels, such as in phyla or subphyla. 16s rDNA is usually used for phylogenetic studies at mid-categorical levels such as in families or rare genera. Compared to 12s and 16s rDNA, the mitochondrial protein-coding genes evolve much faster and are powerful markers for inferring evolutionary history in lower categorical levels such as families, genera and species. This feature of mtDNA is suitable for resolving taxonomic uncertainties on conservation genetics (Moritz 1994).

The mitochondrial CR is the major noncoding region of the vertebrate mtDNA molecule. Due to the fast rate of evolution, the CR has been typically deemed to be most appropriate for intraspecific studies. Thus the mtDNA CR is a powerful marker for determining the current status of population structure and identification of subspecies and species (Luo et. al. 2004, Wan et. al. 2004).

I.3. Objectives The objectives of the work are - To carry out sequencing of the mtDNA control region (CR) in wild tiger samples. - To perform a tentative assessment of variation among CR sequences in Indian tigers.

II. MATERIALS and METHODS

II.1. DNA Extraction (a) Blood samples DNA from blood samples of eight radio-collared tigers was isolated using the DNeasy Blood and Tissue Kit (QIAGEN Ag, Germany). 20 l of Proteinase K solution was pipetted in a 1.5 l microecntrifuge tube. To it, 100 l of whole blood and 100 l of PBS buffer were added, followed by 200 l of Buffer AL. The mixture was incubated at 56C for 10 minutes, with intermittent vortexing. Then 200 l of ethanol (96 100%) was added and mixed by vortexing. The entire mixture was transferred to a DNeasy spin column containing a 2 ml collection tube, and centrifuged at 8,000 rpm for 1 minute. The flow through and the collection tube were discarded. After placing the spin column in a new 2 ml collection tube, 500 l of Buffer AW1 was added and centrifuged at 8,000 rpm for 1 minute. The flow through and collection tube were again discarded. The spin column was then washed with 500 l of Buffer AW2, by centrifugation at 12,000 rpm for 3 minutes. To dry the DNeasy membrane and remove residual ethanol, the spin column was placed in a new collection vial and centrifuged at 12,000 rpm for 1 minute. The dried membrane was then placed in a clean 1.5 ml micro centrifuge tube and 200 l of Buffer AE was pipetted directly onto the DNeasy membrane. The setup was incubated at room temperature for 5 minutes, and then centrifuged for 1 minute at 8,000 rpm to elute the DNA. The elution was repeated once more for obtaining maximum DNA yield. Eluted DNA was stored at -20C for long-term or for immediate use at 4C to avoid repeated freeze thaw cycles. (b) Scat samples Scat (faecal) samples, collected from the field were stored at ambient temperature in 15 ml screw cap polypropylene vials containing 10 ml of DMSO salt solution (DETs Buffer; 20% DMSO, 0.25 M sodium-EDTA, 100 mM Tris, pH 7.5, and sodium chloride to saturation) as a preservative (Frantzen et. al. 1998). The extractions were carried in a quasi- clean room dedicated to low- copy DNA extraction and devoid of concentrated

6 PCR products. DNA extraction from faecal samples was performed using the guanidine isothiocyanate - silica based extraction protocol, albeit with few modifications (Frantzen et. al. 1998). Guanidine isothiocyanate is extremely hazardous and produces toxic isocyanide gas on reacting with acidic solutions. Thus, all waste solutions generated during the DNA extraction process were neutralized by discarding in a highly alkaline solution of 10 M sodium hydroxide, before disposal down the drain pipes. Approximately 250 l of the faecal sample was added to 900 l of L6 lysis solution (5 M Guanidine isothiocyanate, 100 mM Tris, pH 6.4, 20 mM EDTA, pH 8.0, and 1.3% Triton X-100) in a fresh 1.5 ml microcentrifuge tube (MCT). The mixture was incubated overnight at room temperature with intermittent vortexing to thoroughly suspend the faecal pellets. The mixture was centrifuged at 8,000 rpm for 1 minute to pellet the faecal debris, the next morning. The supernatant was transferred to a fresh 1.5 ml MCT, and 100 l of 10% polyvinyl pyrrolidone (PVP) solution was added to it and mixed by gentle inversion. The setup was left to stand at room temperature for 30 minutes, and then centrifuged at 12,000 rpm for 3 minutes. The pellet was discarded while the supernatant was transferred to a new 1.5 ml MCT and mixed with 50 l of 6% silica solution by gently inverting the tubes. The setup was incubated at room temperature for about 30 minutes to allow the positively charged silica matrix to bind with the negatively charged phosphate backbone in the DNA molecules. The mixture was then centrifuged at 12,000 rpm for 1 minute to pellet the silica matrix containing the embedded DNA. After discarding (decanting) the supernatant, the pellet was washed twice with 500 l of L2 Solution (5 M Guanidine isothiocyanate, 100 mM Tris, pH 6.4, and 20 mM EDTA, pH 8.0), then twice more with 500 l of Ethanol wash buffer (100 mM Tris, pH 7.5, 100 mM sodium chloride, 1 mM EDTA, pH 8.0, and 60% ethanol). This was followed by one wash with 500 l of ice-cold 80% Ethanol and then 500 l with ice-cold Acetone. All washing steps were performed at 12,000 rpm for 1 minute. The washed pellet was then air dried at 55C for about two to three minutes, and 75 l of 1X TE buffer (10 mM Tris, 1mM EDTA, pH 8.0) was added to the now dried pellet. The suspension was mixed by tapping or vortexing the tube and incubated at 55 C for 10 minutes. The eluted DNA was recovered from the silica suspension by centrifugation at 12,000 rpm for 3 minutes.

7 About 65 l of the 1X TE buffer containing the eluted DNA was gently aspirated out using a micropipette, taking care not to pick up loose silica pellet dislodged at the bottom of the tube. The DNA was transferred to a sterile 1.5 MCT and stored at 4 C. The amount of extracted DNA was visually estimated by electrophoresis on 0.8% agarose gels, using 0.5X TBE electrophoresis buffer and ethidium bromide (10 g for up to 300 ml of gel) staining. Solutions and Buffers 10 X TBE (Tris/borate/EDTA) Electrophoresis Buffer Tris Base 242g Boric Acid 55g 0.5M EDTA, pH8.0 100ml Water to 1 litre 1M Tris-HCl [tris(hydroxymethyl)aminomethane] Tris base 121g Water to 800ml Adjust to desired pH with concentrated HCl. Mix and add water to 1 litre. 10M NaOH NaOH Water 5M NaCl NaCl Water 400g to 1 litre 292g to 1 litre

0.5M EDTA, pH8.0 sodiumEDTA 186.1g Water to 700ml Adjust to desired pH with 10M NaOH. Mix and add water to 1 litre. 1X TE (Tris/EDTA) Buffer, pH 8.0 1 M Tris, pH8.0 10ml 0.5M EDTA, pH 8.0 2ml Water to 1 litre 10mg/ml Ethidium Bromide Ethidium Bromide 0.2g Water to 20ml Mix well and store in dark at 4C. Add 1 l to molten agarose gel (for up to 300ml) before pouring on gel assembly.

L6 Lysis Buffer GuSCN 12g (5M) 1M Tris-HCL, pH6.4 2ml (100mM) 0.5M EDTA, pH8.0 0.8ml (20mM) 13% Triton-X-100 2ml (1.3%) Water to 20ml Store in dark at room temperature (RT) L2 Wash Buffer GuSCN 12g (5M) 1M Tris-HCL, pH6.4 2ml (100mM) 0.5M EDTA, pH8.0 0.8ml (20mM) Water to 20ml Store in dark at room temperature (RT) Ethanol Wash Buffer 1M Tris-HCL, pH7.5 10ml (100mM) 0.5M EDTA, pH8.0 0.2ml (1mM) 5M NaCl 2ml (100mM) Absolute Ethanol 60ml (60%) Water to 100ml 6% Silica suspension Silicon dioxide 3g Ultrapure Water to 50ml Add contents in a 50 ml Falcon tube. Mix suspension by vortexing and let it stand for 24 hrs at RT. Decant 43 ml of the milky supernatant from top, and add fresh ultra pure water to 50 ml. Keep for 5 hrs at RT to allow silica particles to settle at the bottom, and then decant 44 ml of supernatant from top. Add 60 l of concentrated HCl, mix and autoclave. Adjust volume to 50 ml with sterile ultra pure water and store at 4C in 2 ml aliquots. 10% Polyvinyl pyrrolidone (PVP) suspension PVP 1g 1X TE, pH8.0 to 10ml Mix well by vortexing and store at 4C.

9 II.2. Polymerase Chain Reaction (PCR) The PCR, which is at the heart of genotyping, allows the amplification of an equivalent region of DNA from different individuals or species. The sequences of the fragments flanking the region to be amplified need to be known so that specific oligonucleotide primers can be designed that can be annealed on opposite strands and extended towards each other using a thermostable DNA polymerase. A PCR cycle consists of denaturing the target DNA duplexes, annealing of the primers and polymerisation of new doublestranded segments. Repeated cycles of synthesis and denaturation result in an exponential increase in the number of segments replicated (Mullis and Faloona 1987). In this protocol, a short segment (~250bp) of the mtDNA Control Region (CR) sequence was amplified using the primer pair CR-UPF/ CR-R2B (Luo et al. 2004, primer details provided below). The reaction was carried out according to the conditions described below. CR-UPF CR-R2B 5-TCA AAG CTT ACA CCA GTC TTG TAA ACC -3 5-CGT GTT GTG TGT TCT GTA T-3 l 11.9 2.5 1.5 2.0 1.0 0.5 0.5 0.1 5.0 ---25.0 Final concentration ---1X 1.5mM 0.8mM 0.1mg/ml 0.2M 0.2 M 0.5 Unit 10-100ng

Ingredients Ultrapure Water 10X PCR buffer 25mM MgCl2 10mM dNTPs 2.5mg/ml BSA 10uM Fwd primer 10uM Rv primer 5Units/ul Taq DNAPolymerase DNA Total volume

All PCR reagents were obtained from Applied Biosystems (USA), except primers which were synthesized at Axygen Inc. (India). The thermocycling parameters were - initial denaturation at 94C for 2 minutes, followed by 30 cycles at 94C for 20 seconds, 52C for 20 seconds and 72C for 40 seconds. The final soak time was kept for 10 minutes at

10 72C. PCR reactions were performed either on the PTC-100 DNA Engine Cycler (MJ Research, USA) or the ABI-2720 PCR Machine (Applied Biosystems, USA). PCR products were resolved by electrophoresis on 2% Agarose (Amresco Corp., USA) gels at 10 Volts per centimeter for 30 minutes. PCR product clean-up Prior to performing sequencing of the amplified products, it is essential that PCR products are rid of excess salts, dNTPs and primers as these substances if present will interfere during the sequencing reaction. In order to make the template amenable to DNA sequencing, a commercial method (QIAquick PCR purification Kit, QIAGEN Ag, Germany) was used to clean the PCR products. The kit uses a silica gel-based membrane to bind the DNA in the presence of high concentrations of chaotropic salts, present in the proprietary Buffer PB. Salts are removed with an ethanol wash and the DNA is eluted with a low ionic strength Tris buffer. Approximately five volumes of Buffer PB were added to one volume of the PCR sample. QIAquick spin column was placed in a provided 2ml collection tube. The sample was applied to the QIAquick column to bind DNA, and was centrifuged for 60 seconds at 12,000 rpm. All centrifugation steps in the protocol were carried out at 12,000rpm. The flow-through was discarded. The QIAquick column was placed back into the same tube. For washing 0.650 ml Buffer PE was added to the QIAquick column, and was centrifuged for 60sec. The flow-through was discarded and the QIAquick column was placed back in the same tube. The column was centrifuged for an additional 1min. to remove residual ethanol from Buffer PE. QIAquick column was placed in a clean 1.5ml micro centrifuge tube. 35 l Buffer EB (10m M Tris-Cl, pH 8.5) was added to elute DNA to the center of the QIAquick membrane and the column was centrifuged for 1 minute. The concentration of purified PCR product obtained after clean-up was assessed by agarose gel electrophoresis using 3 l of the DNA extract.

11

Box 1. Technical Note: Considerations when cleaning up PCR products for

sequencing When performing direct sequencing using PCR products, it is essential to separate the PCR product away from potentially interfering substances that may remain in solution after the PCR reaction. These contaminants can participate, and thus interfere, in the cycle sequencing reaction and lead to poor quality data or no data at all. Most importantly, primers and dNTPS should be removed. If both forward and reverse PCR primers remain in solution, they will both act as sequencing primers, resulting in multiple peaks from beginning to end as each primer can anneal to complementary strands with different nucleotide composition, and thus lead to overlapping fragments and unreadable data. Excess dNTPs should also be removed as they will upset the specific ratios of dNTPs/ddNTPs required for optimal extension and termination in the cycle sequencing reaction. Another consideration when choosing the PCR cleanup method is the determination of the presence of a single band or multiple bands that may result from the PCR reaction. Once the PCR reaction is completed, one should run a small aliquot on an agarose gel to assess its quality. If it is a single specific band, then it will be sufficient to remove excess PCR reactants using one of the methods listed below. If the PCR reaction generates multiple bands, an excessive amount of primer-dimers, or low-intensity smearing, it will then be necessary to run the PCR product out on a gel, excise the band of interest, and purify it away from the gel. Alternatively, one may want to spend some time optimizing the PCR reaction to eliminate the presence of these additional bands or artifacts and thus save some downstream time in gel purifying PCR products for sequencing. Regardless of which purification method is chosen, one should always quantitate the PCR product obtained after purification as no cleanup method will give 100% recovery. Any quantitative estimates made when initially running the PCR product out on an analytical gel will be inaccurate as one will inevitably lose some product during purification, especially when gel purifying.

12

II.3. DNA Sequencing Cycle sequencing of the purified PCR products was performed according to the conditions provided below. Ingredients Ultrapure water 2.5 X Ready Reaction Mix 5 X Sequencing Buffer 5 M Primer F /R Purified DNA template ----Total reaction volume 10.00 All cycle sequencing reagents were provided in the BigDye v3.1 Cycle Sequencing Kit (Applied Biosystems, USA). The thermocycling parameters were - initial denaturation at 96C for 1 minute, followed by 25 cycles at 96C for 10 seconds, 50C for 5 seconds and 60C for 4 minutes. The cycle sequenced samples were then cleansed of excess unincorporated dye terminators, dNTPs, primers and salts before loading on the DNA sequencer instrument. Sequencing PCR Cleanup Ethanol/EDTA/Sodium Acetate Precipitation 10 l of ultrapure water was added to the cycle sequenced products to bring the total volume to 20 l, and the contents transferred to a fresh 1.5 ml micro-centrifuge tube. Then, 2 l of 125 mM EDTA, pH8.0 and 2 l of 3 M sodium acetate, pH 5.0 were added to the mixture, followed immediately by 50 l of Absolute Ethanol. The contents were mixed by vortexing and the set up was incubated for 15 minutes at room temperature. The mixture was centrifuged for 15 minutes at 12,000 rpm at room temperature, and the supernatant was carefully decanted taking care not to dislodge the loose pellet at the bottom of the tube. The pellet was then washed twice with 250 l of 70 % Ethanol by centrifugation for 10 minutes at 12,000 rpm. The supernatant was removed by gentle decantation. The washed pellet was then air-dried at room temperature with the lid open. 10 l of Hi-di Formamide (Applied Biosystems, USA) was added to the tubes containing l 2.25 0.50 1.75 0.50 5.00

13 the dried pellet if sequencing was to be carried out immediately or stored at -20C if to be done at a later period.

Box 2. Automated Fluorescent DNA Sequencing

Automated fluorescent DNA sequencing or cycle sequencing utilizes a variation of the Sanger chain-termination protocol. In this method, the DNA to be sequenced acts as a template molecule to which a short, complementary oligonucleotide (primer) will anneal to begin enzymatic extension and amplification of a specific region of double-stranded DNA. The newly created fragments will be complementary to the template DNA. This process takes place during the cycle sequencing reaction, a process that each sample must undergo in order to become amplified and fluorescently labeled for detection on the DNA sequencer instrument. In this cycle sequencing reaction, template and primer are combined together with a reaction mixture composed of dNTPs, fluorescently labeled ddNTPs, polymerase enzyme and buffer. The cycle sequencing reaction is composed of three steps - denaturation at 96C, annealing at 50C and extension at 60C. These steps are repeated for 25 cycles to ensure sufficient amplification of the labeled DNA. Chain elongation occurs during the extension step when a dNTP is added, and the fragment continues to grow. However, chain termination occurs when a fluorescently labeled ddNTP is incorporated. A ddNTP contains a hydrogen atom instead of a hydroxyl group at its 3 end and cannot participate in further extension. Therefore, when a ddNTP is incorporated, further chain elongation is blocked and this results in a population of truncated products of varying lengths. When separated by electrophoresis, a "ladder" of these truncated products will form, each differing in size by one nucleotide, with the smallest terminated fragments running fastest on the capillary array. There are four different ddNTPs that correspond to each of the four DNA nucleotides, and each ddNTP has a different colour. Thus, each truncated fragment will contain a fluorescently labeled ddNTP at its 3 end, and the sequencing ladder will be composed of coloured bands. The sequence can then be determined by correlating the colour of a band on the capillary with its specific ddNTP, and the order in which they ran

14 on the capillary. So, the first and smallest band visualized will correspond to the first labeled nucleotide incorporated immediately adjacent to the primer. The second band will be the fragments that consist of 1 unlabeled dNTP and 1 labeled ddNTP that terminated those particular growing chains. The third band will be made up of 2 unlabeled dNTPS followed by 1 labeled ddNTP, and so on. Once the sample has been amplified and labeled, it must be electrophoresed for separation of the labeled fragments and their visualization. As mentioned before, the ddNTPs are fluorescently labeled. The attached dyes are energy transfer dyes and consist of fluorescein energy donor dye linked to an energy acceptor dichlororhodamine dye. This energy transfer system is much more sensitive than a single dye system and permits less DNA for detection. These dye-labeled fragments are loaded onto the sequencers and during electrophoresis, migrate either through the liquid polymer in the capillary arrays and are separated based on their size. Towards the end of the capillary, they pass through a region that contains a read window, behind which a laser beam passes back and forth behind the migrating samples. This laser excites the fluorescent dyes attached to the fragments and they then emit light at a wavelength specific for each dye. This emitted light is separated according to wavelength by a spectrograph onto a cooled, chargecoupled device, or CCD camera, so that all four fluorescent emissions can be detected by one laser pass. The data collection software collects these light intensities from the CCD camera at particular wavelength bands, or virtual filters, and stores them onto the sequencers computer as digital signals for processing. The analysis software then interprets the fluorescent intensity at each data point and assigns its base call interpretations.

15

III. RESULTS and DISCUSSION

III.1. DNA extraction DNA extraction was successfully carried out from a total of fifteen individual tigers, of which seven were from blood samples of radio collared tigers, while the rest eight samples originated from scats (Table1).

III.2. PCR of mtDNA control region PCR was successful in all fifteen samples. A 250 base pair band was obtained on the gel, which conforms to the length targeted for amplification using the primers CR-UPF and CR-R2B. The PCR products were present at a high concentration even after clean-up, as observed in the gel image below figure 3.

Figure 3. Purified PCR products obtained after clean-up. The band intensity observed is from 3 l of eluted DNA. Lane numbers correspond to sample numbers in Table 1.

16

III.3. DNA sequencing of purified PCR products DNA sequences of good quality were obtained from eleven of the fifteen samples (Table1). Three DNA sequences originating from scat were of poor quality, while a fourth was reasonably good. An idea of the quality of good DNA sequences obtained with eleven samples is shown in the sample sequence on Figure 4, depicted by the tidy separation of the nucleotide peaks with very low noise in the electropherogram. Table 1. Sample details and DNA sequence quality obtained
Sl No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Sample ID D254 D256 D396 D430 D402 D531 D490 D491 D492 D569 D576 D577 D582 D587 D691 Sample type Blood Blood Blood Blood Blood Blood Scat Scat Scat Scat Scat Scat Scat Blood Scat Sequence quality Location Kanha Tiger Reserve (KTR) KTR KTR KTR KTR Ranthambore Tiger Reserve KTR KTR KTR Pench Tiger Reserve (PTR) PTR PTR PTR Bandhavgarh Tiger Reserve Manipur State Forward Good Good Good Good Good Good Fair Good Good Good Fair Fair Fair Good Good Reverse Good Good Good Good Good Good Good Good Good Good Poor Poor Poor Good Good Overall quality Good Good Good Good Good Good Fair Good Good Good Poor Poor Poor Good Good

17

TTCAAGGAAGAAGCAATAGCCCCACCATCAGCACCCAAAGCTGAAATTCTTT CTTAAACTATTCCTTGCCAATACCAAAAAACAACCCCATGACTTTCATAATTC ATATATTGCATATACCCGTACTGTGCTTGCCCAGTATGTCCTCATCCCCACAA AAAATAAGTGAAAAAATCCTCAATCCCCGTTAATACAGAACACACAA

Figure 4. MtDNA control region sequence (top) and electropherogram (bottom) of a DNA sequence obtained from a tiger sample. Note the clean and well-spaced nucleotide peaks, and the complete absence of interfering dye blobs (unincorporated fluorescently labeled ddNTPs) which result in precise base calling.

III.4. Sequence and phylogenetic analyses

18 The reverse and forward sequences from thirteen samples were aligned and edited using the software BioEdit7.0 and the Multiple Alignment tool Clustal W (Hall 1999). Control Region sequences of tiger and leopard, obtained from the GenBank online repository were also included in the analysis. Apart from major nucleotide differences and insertion sequences between tiger and leopard, the sequences were devoid of variation within the tiger samples (Table 2). A neighbour joining (NJ) tree based on pair-wise sequence differences between samples was constructed using the software MEGAv3.1 (Kumar et al. 2004). The absence of phyletic groups within the tiger sequences echoed the uniform lack of variation across this species at the CR locus (Figure 5). Similar low levels of variation have been reported in other subspecies (Luo et. al. 2004)

Figure 5.

Neighbour Joining (NJ) Tree constructed from mtDNA control region

sequence data of various tiger samples across the country. Included in the analysis are reference samples of Indian and Amur tiger (Accession Nos. AY452114.1 and AY452115.1 respectively), obtained from the Genbank website. Leopard (AY4521216.1) has been used as outgroup. The dendrogram was constructed using the program MEGA. Nodal bootstrap values represent the strength of the relationship. Values on branches depict evolutionary divergence between taxa in million years ago (MYA). Table 2. Multiple Alignment result of tiger mtDNA CR sequences

19
10 20 30 40

....|....|....|....|....|....|....|....| P.tigris altaica_AY452115.1 P.tigris tigris_AY452114.1 P.pardus_AY4521216.1 D254 D256 D396 D531 D569 D491 D492 D691 D402 D430 D587 AGCCCCACCATCAGCACCCAAAGCTGAAATTCTTTCTTAA ........................................ ...................................-.... ............................ ........... ........................................ ........................................ ........................................ ........................................ ........................................ ........................................ ........................................ ........................................ ........................................ ........................................ 50 60 70 80 ....|....|....|....|....|....|....|....| ACTATTCCTTG-CCAATACCAAAAAACAACCCCATGACTT ...........GT........................... ...G..G....--........G...T.G..A.GG.A.... ...........-......... .................. ...........-............................ ...........-............................ ...........-............................ ...........-............................ ...........-............................ ...........-............................ ...........-............................ ...........-............................ ...........-............................ ...........-............................

P.tigris altaica_AY452115.1 P.tigris tigris_AY452114.1 P.pardus_AY4521216.1 D254 D256 D396 D531 D569 D491 D492 D691 D402 D430 D587

90 100 110 120 ....|....|....|....|....|....|....|....| P.tigris altaica_AY452115.1 TCATAATTCATATATTGCATATACCCGTACTGTGCTTGCC P.tigris tigris_AY452114.1 ........................................ P.pardus_AY4521216.1 ..G.......CG.........CT.T............... D254 ........................................ D256 ........................................ D396 ........................................ D531 ........................................ D569 ........................................ D491 ........................................ D492 ........................................ D691 ........................................ D402 ........................................ D430 ........................................ D587 ........................................

130

140

150

160

20
....|....|....|....|....|....|....|....| P.tigris altaica_AY452115.1 CAGTATGTCCTCATCCCCAC---AAAAAATAAGTGAAAAA P.tigris tigris_AY452114.1 ....................---................. P.pardus_AY4521216.1 .......G......TT..CGGTG.GG.CGC.GACCTG.GC D254 ....................---................. D256 ....................---................. D396 ....................---................. D531 ....................---................. D569 ....................---................. D491 ....................---................. D492 ....................---................. D691 ....................---................. D402 ....................---................. D430 ....................---................. D587 ....................---.................

170 180 190 ....|....|....|....|....|....|....|....| P.tigris altaica_AY452115.1 ATCCTCAATCCCCGTTAATACAGAACACACAACAG P.tigris tigris_AY452114.1 ...................................P.pardus_AY4521216.1 ..GTA....ATATC.ATTC.T.TT...T.A....CD254 ...................................D256 ...................................D396 ...................................D531 ...................................D569 ...................................D491 ...................................D492 ...................................D691 ...................................D402 ...................................D430 ...................................D587 ...................................-

IV. SUMMARY AND CONCLUSION

21

The present work is an attempt to tentatively assess the level of variation in the mitochondrial control region (CR) sequence among wild Indian tigers (P. tigris tigris). The CR marker displays low level of variation in the Indian tiger and other subspecies (Luo et. al. 2004, Sharma et. al. 2008). A published primer pair CR-UPF/CR-R2B was used for PCR amplification and sequencing of the CR locus from blood and scat samples belonging to fifteen individual tigers. The sampled regions cover the Central (n=13, Kanha, Prench, Bandhavgarh), Western (n=1, Ranthambore), and North-Eastern (n=1, Tamenglong, Manipur) parts of the extant tiger range in India. DNA extraction and PCR was successful in all fifteen samples. However upon DNA sequencing, three sequences were of poor quality, so were excluded from further downstream analysis. Multiple alignment and phylogenetic analysis of the remaining thirteen CR sequences together with reference sequences of Amur and Indian tigers, and Leopard, obtained from the Genbank repository was performed. No distinct branching or clusters was observed among the tiger samples. The result is characteristic of the uniform low levels of variation observed with this marker across tiger subspecies.

V. References

22

Ernest HB, Penedo MC, May BP, Syvanen M, Boyce WM (2000). Molecular tracking of mountain lions in the Yosemite Valley region in California: genetic analysis using microsatellites and faecal DNA. Molecular Ecology 9, 433-442. Farrell LE, Romant J and Sunquist ME (2000). Dietary separation of sympatric carnivores identified by molecular analysis of scats. Molecular Ecology 9, 1583-1590. Frankham R, Ballou JD and Briscoe DA (2002). Introduction to conservation Genetics. Cambridge University Press, New York. Frantzen MAJ, Silk JB, Ferguson JWH, Wayne RK and Kohn MH (1998). Empirical evaluation of preservation methods for faecal DNA. Molecular Ecology 7, 1423-1428. Hall TA (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41, 95-98 Hedmark E, Flagstad O, Segerstrom P, Persson J, Landa A and Ellegren H (2004). DNA-based individual and sex identification from wolverine (Gulo gulo) faeces and urine. Conservation Genetics 5, 405-410. Hss M, Kohn M, Pbo S, Knauer F and Schrder W (1992). Excrement analysis by PCR. Nature 359, 199. Kohn MH, York EC, Kamradt DA, et al. (1999). Estimating population size by genotyping faeces. Proceedings of the Royal Society of London Series B-Biological Sciences 266, 657-663. Kumar S, Tamura K and Nei M (2004). MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Briefings in Bioinformatics 5:150-163. Luo SJ, Kim JH, Johnson WE, van der Walt J, Martenson J, et al. (2004). Phylogeography and genetic ancestry of tigers (Panthera tigris). PLoS Biology 2(12), e442. Moritz C (1994). Applications of mitochondrial DNA analysis in conservation: a critical review. Molecular Ecology 3, 401-411. Mullis KB and Faloona F (1987). Specific synthesis of DNA in vitro via a polymerasecatalysed chain reaction. Methods in Enzymology 155, 335-350. Sharma R, Stuckas H, Bhaskar R, Rajput S,Khan I, Goyal SP and Tiedemann R (2008). mtDNA indicates profound population structure in Indian tiger (Panthera tigris tigris). Conservation Genetics (DOI 10.1007/s10592-008-9568-3)

23

Taberlet P, Camarra JJ, Griffin S, et. al. (1997). Noninvasive genetic tracking of the endangered Pyrenean brown bear population. Molecular Ecology 6, 869-876. Taberlet P and Luikart G (1999). Non-invasive genetic sampling and individual identification. Biological Journal of the Linnean Society 68, 41-55. Wan QH, Wu H, Fujihara T and Fang SG (2004). Which genetic marker for which conservation genetics issue? Electrophoresis 25, 000-000 (DOI 10.1002/elps.200305922) Useful web resources GenBank (http://www.ncbi.nlm.nih.gov/Genbank/index.html) biggest online repository for sequences BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) online program for finding matches of any query sequence with entire available sequences at GenBank repository Primer 3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) online software for PCR primer design