A Cholinergic Agonist Attenuates Endotoxin-Induced Uveitis in Rats

Zai-Long Chi, Seiji Hayasaka, Xue-Yun Zhang, Hu-Shan Cui, and Yoriko Hayasaka
PURPOSE. Investigation of physiological anti-inammatory mechanisms can contribute to the treatment of inammatory disorders. The purpose of the present study was to investigate the effect of nicotine, a selective cholinergic agonist, on endotoxin-induced uveitis (EIU) in rats and the underlying molecular mechanism. METHODS. Lipopolysaccharide (LPS; endotoxin) and nicotine were injected intraperitoneally. Clinical scores were evaluated by slit lamp. Intracameral protein content and the number of cells were determined. Immunohistochemical reactivity of 7 nicotine acetylcholine receptor ( 7nAChR) was examined in the iris and ciliary body (ICB). mRNA and protein levels of cytokines and chemokines were measured by real-time PCR and enzyme-linked immunosorbent assay. RESULTS. After LPS injection, clinical scores, as well as protein content and number of cells in the aqueous humor increased during 18 to 36 hours. Nicotine inhibited the endotoxin-induced elevation of these levels. mRNA and protein of 7nAChR expression levels were signicantly increased by LPS and/or nicotine injection. Nicotine showed no effects on endotoxin-induced elevation of mRNA levels in ICB. However, nicotine decreased the endotoxin-induced elevation of interleukin (IL)-6, IL-1 , tumor necrosis factor (TNF)- , cytokine-induced neutrophil chemoattractant (CINC)-1, and monocyte chemotactic protein (MCP)-1, but did not affect IL-10 in the serum and aqueous humor. CONCLUSIONS. Nicotine attenuated endotoxin-induced uveitis through directly decreasing the levels of multiple cytokines and chemokines in the aqueous humor, but did not affect the mRNA levels of these factors. The ndings suggest that the nicotinic anti-inammatory pathway may be involved in the pathogenesis of EIU. (Invest Ophthalmol Vis Sci. 2007;48: 2719 2725) DOI:10.1167/iovs.06-0644 veitis frequently leads to severe vision loss and blindness, with disruption of the blood ocular barrier and neighboring tissues associated with intraocular proliferation. Uveitis is commonly idiopathic, and treatment is difcult. Lipopolysaccharide (LPS, endotoxin)-induced uveitis (EIU) in rats is an animal model of human disease.1,2 Tumor necrosis factor (TNF)- and interleukin (IL)-6 have been reported to be involved in the pathogenesis of LPS-induced uveitis.35 TNF- , IL-6, and IL-1 , which are proinammatory cytokines, induce uveitis when injected intraocularly in animals.6 IL-8 (CXCL8) and monocyte chemotactic protein (MCP)-1 (CCL2) are members of chemotactic families (chemokines)7 and are present in the plasma of patients with active Behcets disease8 and in aqueous humor of patients with active uveitis.9 Rat cytokineinduced neutrophil chemoattractant (CINC)-1 is a counterpart of the human growth-regulated oncogene product and a member of the interleukin-8 family. CINC-1 plays a key role as a mediator of neutrophil inltration in rats during inammation.10,11 In various cell types, CINC-1 is produced in response to inammatory mediators such as TNF- , IL-1 , and LPS.10 13 Physiological anti-inammatory mechanisms provide a major advantage to the design of novel pharmacologic strategies against inammatory diseases. The central nervous system is a pivotal regulator of the immune response and controls inammation at various levels. Recent studies indicate that stimulation of the vagus nerve can control systemic inammation in rodents.14 19 Accordingly, surgical vagotomy increases the susceptibility of rodents to septic shock,19 suggesting that the vagus nerve can function as a physiological anti-inammatory system that modulates the immune response. Acetylcholine, the principal neurotransmitter of the vagus nerve, and selective nicotinic agonists can regulate inammation through a nicotinic anti-inammatory pathway dependent on the 7 nicotinic acetylcholine receptor ( 7nAChR).20 Van Dijk et al.21 reported that nicotine inhibits TNF- and IL-1 synthesis in mouse colonic mucosa. Borovikova et al.14 reported that vagus nerve stimulation attenuates the systemic inammatory response to endotoxin. Wang et al.17 reported that 7nAChR is an essential regulator of inammation. We therefore investigated the in vivo effect of nicotine, a selective cholinergic agonist, on EIU in rats.

MATERIALS
Animals

AND

METHODS

From the Department of Ophthalmology, Graduate School of Medicine, University of Toyama, Toyama, Japan. Supported in part by Grant-in-Aid for Scientic Research 14571661 and by the 21st century COE (Centers of Excellence) program of the Ministry of Education, Science, Sports and Culture of Japan. Submitted for publication June 13, 2006; revised October 5 and 30, 2006; accepted April 19, 2007. Disclosure: Z.-L. Chi, None; S. Hayasaka, None; X.-Y. Zhang, None; H.-S. Cui, None; Y. Hayasaka, None The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked advertisement in accordance with 18 U.S.C. 1734 solely to indicate this fact. Corresponding author: Zai-Long Chi, Department of Ophthalmology, Graduate School of Medicine, University of Toyama, 2630 Sugitani, Toyama 930-0194, Japan; ophthal@med.u-toyama.ac.jp.
Investigative Ophthalmology & Visual Science, June 2007, Vol. 48, No. 6 Copyright Association for Research in Vision and Ophthalmology

Six- to eight-week-old Wistar rats (160 180 g) were obtained from Sankyo Labo Service Co. Inc. (Tokyo, Japan). The animals were housed in 12-hour dark and 12-hour light conditions, and were given food and water ad libitum during the experiment. All studies were conducted in compliance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The study was approved by the Institutional Committee for Ethical Animal Care and Treatment.

Injection of LPS and Nicotine

To induce uveitis, 150 g LPS (Escherichia coli, serotype 055: B5, from Sigma-Aldrich, Inc., St. Louis, MO), in 150 L of pyrogen-free 0.9% sodium chloride, was injected intraperitoneally. Rats treated with 0.9% sodium chloride served as the control. Nicotine (Sigma-Aldrich, Inc.) was dissolved in 0.9% sodium chloride just before use, and 0.2 to 2 mg/kg of nicotine was injected intraperitoneally at the same time as the LPS was administered. No repeated experiments of LPS injection in the same rats were performed. Multiple samples were used in a single experiment. The experiments were repeated at least twice to ensure reproducibility.

2719

2720

Chi et al.

IOVS, June 2007, Vol. 48, No. 6

formalin and 2.5% glutaraldehyde for 24 hours. Subsequently, the eyes were embedded in OCT compound. Sagittal sections (6- m-thick) were cut near the optic nerve head and stained with hematoxylin and eosin.

RNA Extraction and Real-Time Polymerase Chain Reaction

After intraperitoneal injection of pentobarbital (50 mg/kg body weight), the eye globe was enucleated and submerged in RNA stabilization reagent (RNAlater; Qiagen, Hilden, Germany), immediately followed by isolation of the iris ciliary body tissue from the stabilized eye globe. The dissected iris ciliary body tissue was homogenized with a rotostater in buffer (RLT; Qiagen). Total RNA was extracted (Rneasy Protect Mini kit, treated with an Rnase-free Dnase Set; Qiagen) to remove any residual genomic DNA. cDNA from each sample was obtained by reverse transcription with random hexamers and multiscribe reverse transcriptase (MultiScribe; Applied Biosystems [ABI], Foster City, CA). Based on the database, real-time PCR primers and probes were designed. Probes and primers are as follows: For 7nAChR (GenBank accession no. L31619): forward primer 5 -AGCTGAGTGCAGGTGCTGG-3 , reverse primer 5 -CAGGCCTCG-

FIGURE 1. Effects of nicotine on LPS-induced uveitis. Clinical scores (A) and protein content in the aqueous humor (B) after injection of nicotine and LPS at each time point are shown. Clinical score evaluation and aqueous sampling were performed at 0, 6, 12, 18, 24, 30, and 36 hours after injection of LPS. Nicotine was injected at the same time as LPS administration. Mean SD (n 4 pairs of eyes). *P 0.05; **P 0.01 compared with LPS injection.

Clinical Evaluation of EIU

Clinical scoring of EIU was performed as described by Behar-Cohen et al.22 The eyes were examined by slit-lamp after LPS injection and nicotine treatment. The severity of EIU was graded from 0 to 4, by a masked investigator, as follows: 0, no inammatory reaction; 1, discrete dilation of the iris and conjunctival vessels; 2, moderate dilation of the iris and conjunctival vessels with moderate are in the anterior chamber; 3, intense iridial hyperemia with are in the anterior chamber; and 4, same clinical signs as 3 plus the presence of brinous exudates in the pupillary area and miosis.

Measurement of Intracameral Protein and Number of Cells

Aqueous humor was sampled at 0, 6, 12, 18, 24, 30, and 36 hours after injection of LPS. After intraperitoneal injection of pentobarbital (50 mg/kg body weight), aqueous humor was aspirated with a 30-gauge needle under visualization with a microscope. Aspirated samples were centrifuged at 2500 rpm for 5 minutes at 4C to obtain the supernatant. Protein concentration in the supernatant was measured by a protein dye binding assay described by Bradford23 and was expressed as relative values to a bovine serum albumin standard. To 5 L of aspirated aqueous humor, the same volume of 0.4% trypan blue was added, and then the stained cells were counted with a hemocytometer.

Histopathology
Twenty-four hours after LPS administration, rats were euthanatized. The eyes were enucleated immediately and stored in a mixture of 10%

FIGURE 2. Effects of different doses of nicotine on LPS-induced uveitis. Clinical scores (A), protein content (B), and number of cells (C) in the aqueous humor after injection of nicotine and LPS are shown. Clinical score evaluation and aqueous sampling were performed at 24 hours after injection of LPS. Nicotine was injected at the same time as LPS was administered. Means SD (n 6 pairs of eyes). *P 0.05; **P 0.01 compared with LPS injection.

IOVS, June 2007, Vol. 48, No. 6

Cholinergic Agonists and Uveitis

2721

FIGURE 3. Histopathology of the anterior segment of the eye at 24 hours after injection of LPS. Rats without LPS injection (A) or with nicotine injection alone (B) showed no inammation in the anterior and posterior chamber. Severe inammatory cell inltration was observed in LPSinjected rats (C). A signicant attenuation of inammation was observed in rats treated with nicotine (2 mg/ kg) and LPS simultaneously (D). Results are representative of those in four pairs of eyes. Hematoxylin and eosin; original magnication, 200.

GAAGCCAA-3 , and TaqMan (ABI) probe 5 -(FAM)CCCACCAGCAATGGCAACCTGC(TAMRA)-3 ; for TNF- (accession no. NM_012675): forward primer 5 -ACA AGGCTGCCCCGACTAC-3 , reverse primer 5 TCCTGGTATGAAATGGCA AACC-3 , and TaqMan probe 5 (FAM)TGCTCCTCACCCACACCGTCAGC(TAMRA)-3 ; for IL-6 (accession no. NM_012509), forward primer 5 - TCAACTCCATCTGCCCTTCAG-3 , reverse primer 5 -AAGGCAACTGGCTGGAAGTCT-3 , and TaqMan probe 5 -(FAM)AACAGCTATGAAGTTTCTCTCCGCA(TAMRA)-3 ; for IL-1 (accession no. NM_031512), forward primer 5 AACAGCAATGGTCGGGACATA-3 , reverse primer 5 -CATTAGGAATAGTGCAGCCATCTTTA -3 , and TaqMan probe 5 -(FAM) TTGACTTCACCATGGAACCCGTGTCTT(TAMRA)-3 ; for MCP-1 (accession no. M57441), forward primer 5 -CAGATCTCTCTTCCTCCACCACTAT-3 , reverse primer 5 -ACAGGCAGCAACTGTGAACAA-3 , and TaqMan probe 5 -(FAM)CAGGTCTCTGTCACGCTTCTGGGCC(TAMRA)-3 ; and for glyceraldehyde 3-phosphate dehydrogenase (GAPDH, accession no. AF106860): forward primer 5 -CCGAGGGCCCACTAAAGG-3 , reverse primer 5 -GCTGTTGAAGTCACAGGAGACAA-3 , and TaqMan probe 5 (FAM)CATCCTGGGCTACACTGAGGACCA (TAMRA)-3 . cDNA was used to detect real-time PCR products (TaqMan Universal Master Mix and PRISM 7700 sequence detection system; ABI) with specic primers and probes. The thermal prole for each primer consisted of 2 minutes at 50C and 10 minutes at 95C followed by 40 cycles for 15 seconds at 95C and 1 minute at 60C. The expression levels of 7nAChR, IL-6, IL-1 , TNF- , and MCP-1 mRNAs were normalized by the mRNA level of GAPDH in each sample, and the relative changes in expression were shown as an n-fold increase relative to value of rats treated with 0.9% NaCl.

antibody (Santa Cruz Biotechnology, Santa Cruz, CA) for 1 hour and immunolabeled with FITC-conjugated bovine anti-rabbit IgG (Santa Cruz Biotechnology) for 30 minutes. Negative control samples were incubated with normal bovine IgG or primary antibody.

Enzyme-Linked-Immunosorbent Assay
After intraperitoneal injection of pentobarbital (50 mg/kg body weight), aqueous humor was aspirated with a 30-gauge needle under microscopic visualization. Aspirated samples were centrifuged at 2500 rpm for 20 minutes at 4C, to obtain the supernatant. The aqueous humor from both eyes of a rat was diluted up to 30 to 40 L for the assay. Serum samples were collected and pooled. Protein levels of TNF- , IL-6, IL-1 , IL-10 (Pierce Biotechnology, Inc. Rockford, IL), CINC-1, and MCP-1 (IBL Co., Ltd., Gunma, Japan) were determined by enzyme-linked immunosorbent assay.

Statistics
All data are expressed as the mean SD. Statistical analysis was performed using the Scheffe procedure after the ANOVA test for multiple comparison of means. P 0.05 was considered as statistically signicant.

RESULTS
Animal Behavior
No abnormal behavior, including diarrhea and vomiting, was noted in rats treated with LPS or nicotine. No deaths occurred during the experiment.

Immunohistochemistry
At 0, 12, 18, 24, 36, and 48 hours after LPS injection, the rat was anesthetized. The blood was washed out with phosphate-buffered saline (PBS), and the animals were perfusion xed with 4% cold paraformaldehyde in PBS. The eyes were enucleated, cut in half, and xed with 4% paraformaldehyde in PBS for 20 minutes at 4C. Specimens were OCT embedded, frozen, and cryosectioned at a thickness of 10 m. After they were blocked with 10% normal bovine serum in PBS, the slides were incubated with rabbit anti-rat 7nAChR

Clinical scores, Protein Content, and Number of Cells in the Aqueous Humor after Injection of Nicotine and LPS
After LPS injection, clinical scores, protein content, and number of cells in the aqueous humor increased at 6 hours; reached maximum levels (score, 3.8; protein, 12.6 mg/mL; cells, 18.2 105/mL) at 24 hours; maintained high level until 36 hours; and

2722

Chi et al.

IOVS, June 2007, Vol. 48, No. 6 anterior and posterior chamber 24 hours after LPS administration (Fig. 3C). Signicant reductions of inammation were observed in eyes of rats treated with nicotine (2 mg/kg) simultaneously with the LPS injection (Fig. 3D).

Changes in 7nAChR mRNA and Protein Levels in the Iris and Ciliary Body
7nAChR mRNA was expressed in the iris and ciliary body of rats untreated with LPS. The level increased to its maximum at 9 hours after LPS injection (Fig. 4A). Therefore, we observed the effect of nicotine on 7nAChR mRNA level at this time point. The result showed that the 7nAChR mRNA level was elevated by injection of nicotine alone or of both LPS and nicotine (Fig. 4B). Immunouorescent staining for 7nAChR in the iris and ciliary body was negative after injection of saline (Fig. 5A). After injection of LPS alone, 7nAChR proteins were present (Fig. 5B, after 18 hours; Fig. 5C, after 24 hours). Twenty-four hours after injection of nicotine alone, 7nAChR proteins were observed (Fig. 5D). After injection of both nicotine and LPS, 7nAChR proteins increased in the iris and ciliary body (Fig. 5E, after 18 hours; 5F, after 24 hours). The negative control (normal IgG) showed no autouorescence or nonspecic staining.

FIGURE 4. Changes in 7nAChR mRNA levels in the iris and ciliary body. 7nAChR mRNA levels at various times after LPS (150 g) injection are shown (A). The mRNA level reached its maximum at 9 hours after injection of LPS. Therefore, the effect of nicotine (2 mg/kg) on the mRNA level of 7nAChR in LPS-injected rat was investigated at 9 hours after LPS injection (B). Mean SD (n 6 pairs of eyes). **P 0.01 compared with the value in rats treated with saline.

Changes in mRNA Levels of Cytokines and Chemokines in the Iris and Ciliary Body
After injection of LPS, mRNAs of IL-6, IL-1 , TNF- , and MCP-1 in the iris and ciliary body increased at 1.5 hours, reached maximum levels at 3 hours, and then gradually decreased (data not shown). Nicotine did not change the elevated levels of IL-6 mRNA (Fig. 6A), IL-1 mRNA (Fig. 6B), TNF- mRNA (Fig. 6C), and MCP-1 mRNA (Fig. 6D) at 3 hours after injection of LPS.

decreased at 48 hours (data not shown). However, injection of nicotine (2 mg/kg) improved clinical scores, decreased protein levels in the aqueous humor from 12 to 36 hours (Fig. 1). Nicotine decreased the elevation of these levels in a dosedependent manner (Fig. 2). By intraperitoneal injection of 2 mg/kg nicotine, signicant inhibition effects (score, 2.2; protein, 7.3 mg/mL; cells, 6.8 105 /mL) were observed (Fig. 2). Meanwhile, nicotine treatment alone did not affect the scores, the protein content, or the number of cells in the aqueous humor in the rats untreated with LPS. No inammation was observed histopathologically in rats treated with nicotine alone (Fig. 3B). However, severe inammation was found in the

Changes in Cytokines and Chemokines in the Serum and Aqueous Humor

High levels of IL-6, CINC-1, MCP-1, and IL-10 were detected in the serum at 24 hours after LPS administration. Treatment with 2 mg/kg of nicotine signicantly reduced the levels of serum IL-6, CINC-1, and MCP-1, but did not suppress release of the anti-inammatory cytokine IL-10 (Fig. 7). After LPS injection, TNF- and IL-1 serum levels were below the detection sensitivities of the assays in rats (Fig. 7). All the cytokines and chemokines tested were below detection levels in control rats injected with saline or nicotine alone.

FIGURE 5. Immunohistochemistry of 7nAChR in the iris and ciliary body. Rats without LPS injection (A), 18 hours (B) and 24 hours (C) after LPS injection, treated with nicotine alone (D), and 18 hours (E) and 24 hours (F) after injection of 2 mg/kg nicotine together with LPS. Fluorescein indicates localization of 7nAChR in the iris and ciliary body. Results are representative of those in four pairs of eyes. Original magnication, 200.

IOVS, June 2007, Vol. 48, No. 6

Cholinergic Agonists and Uveitis

2723

FIGURE 6. Changes in mRNA levels of cytokines and chemokines in the iris and ciliary body. The globes were enucleated 3 hours after injection of saline, nicotine, and/or LPS. Levels of IL-6 mRNA (A), IL-1 mRNA (B), TNF- mRNA (C), and MCP-1 mRNA (D) were measured in the tissues. Mean SD (n 6 pairs of eyes).

After injection of LPS, IL-6, IL-1 , TNF- , CINC-1, MCP-1, and IL-10 reached maximum levels at 24 hours in the aqueous humor. Nicotine (12 mg/kg) decreased the elevated levels of proinammatory cytokines and chemokines in the aqueous humor 24 hours after LPS administration in a dose-dependent manner, but failed to prevent the constitutive release of the anti-inammatory cytokine IL-10 (Fig. 8).

DISCUSSION
Physiological anti-inammatory mechanisms represent efcient systems that have been selected by evolution to control inammation. These mechanisms may provide advantages that can be exploited for the treatment of inammatory disorders. Previous studies have shown that nicotine, a more selective cholinergic agonist, prevents endotoxin-induced TNF- production in macrophage cultures and microvascular endothelial cells.14,17,18,24 It is still unclear whether this pharmacological strategy can be applied in vivo to improve EIU. In the current study, nicotine improved clinical scores and decreased protein content and the number of cells in rats with EIU (Figs. 1, 2, 3). The LD50 (median lethal dose) of nicotine in mice was reported to be 3 to 9 mg/kg.24 In the present study, we used intraperi-

FIGURE 7. Cytokines and chemokines in serum. Levels of IL-6, TNF- , IL-1 , CINC-1, MCP-1, and IL-10 in pooled serum obtained from LPS injection (f) and both nicotine (2 mg/kg) and LPS injection ( ) of rats at 24 hours. Mean SD (n 4 pairs of eyes). *P 0.05; **P 0.01 compared with the LPS-treated group.

toneal injection of nicotine (0.22 mg/kg), and the effective doses (12 mg/kg) were similar to those described by Saeed et al.,24 in which nicotine (2 mg/kg) inhibits endothelial cell adhesion molecule expression in mice. To examine whether the 7nAChR is essential for the cholinergic anti-inammatory pathway in vivo, Wang et al.17 measured TNF- production in 7nAChR-decient mice. The serum TNF- level in 7nAChR-decient mice after administration of endotoxin was signicantly higher than that in wildtype endotoxemic mice, indicating a critical function of the 7nAChR in the normal regulation of systemic inammatory responses in vivo. 7nAChR is expressed in macrophages17,20,24 and endothelial cells.15,2527 7nAChR mRNA and protein in the iris and ciliary body (Figs 4, 5) in the present study may exist in inammatory cells and vascular endothelial cells in the tissues. Nicotine alone or both nicotine and LPS injection elevated the expression of 7nAChR in the iris and ciliary body. Nicotine inhibited LPS-induced elevation of serum IL-6, CINC-1, and MCP-1 (Fig. 7). It reduced the LPS-induced release of proinammatory cytokines and chemokines, such as IL-6, TNF- , IL-1 , CINC-1, and MCP-1, but not anti-inammatory cytokine IL-10 in a dosedependent way in the aqueous humor (Fig. 8). It is possible that nicotinic anti-inammatory pathways are involved in the pathogenesis of EIU in rats. Nicotine inhibited the expression of cytokines and chemokines in aqueous humor, but did not inuence the mRNA levels of these cytokines and chemokines (Fig. 6), indicating that activation of the cholinergic receptor transduces intracellular signals that inhibit synthesis of cytokines and chemokines at a posttranscriptional stage, as stated by Tracey18 and Ulloa.20 Also, Wang et al.15 have reported that nicotine may affect macrophage activation by modulating HMGB1 acetylation or phosphorylation as a posttranslational regulation. The NF- B pathway is crucial for macrophage activation and the production of proinammatory cytokines.28 In an earlier study,5 we reported that NF- B translocation is involved in the pathogenesis of LPS-induced uveitis. Wang et al.15 and Saeed et al.24 reported that nicotine suppresses the production of proinammatory cytokines from macrophages and microvascular endothelial cells by inhibiting the NF- B pathway through an 7nAChR-dependent anti-inammatory pathway.

2724

Chi et al.

IOVS, June 2007, Vol. 48, No. 6

FIGURE 8. Cytokines and chemokines in aqueous humor. Aqueous samples were aspirated at 24 hours after injection of saline, nicotine, and/or LPS. Expression levels of IL-6 (A), IL-1 (B), TNF- (C), CINC-1 (D), MCP-1 (E), and IL-10 (F) are shown. Mean SD (n 12 pairs of eyes). *P 0.05; **P 0.01 compared with the LPS-treated group.

Because 7nAChR can control the NF- B pathway, a pharmacological target for several inammatory disorders, nicotine and selective nicotinic agonists could provide a therapeutic potential target for the treatment of a variety of inammatory disorders. The clinical therapeutic use of nicotine has been suggested for the treatment of a large number of human diseases, including depression, Parkinsons disease, and inammatory disorders such as Crohns disease and ulcerative colitis.29 31 Our results indicate that cholinergic agonists suppress cytokine and chemokine release through a novel nicotinic antiinammatory pathway depending on 7nAChR. These results support 7nAChR as a potential pharmacological target for EIU and systemic inammation, and further investigation is warranted to determine its potentially clinical translation.

6. 7. 8.

9. 10.

References
1. Rosenbaum JT, McDevitt HO, Guss RB, Egbert PR. Endotoxininduced uveitis in rats as a model for human disease. Nature. 1980;286:611 613. 2. Bhattacherjee P, Williams RN, Eakins KE. An evaluation of ocular inammation following the injection of bacterial endotoxin into the rat foot pad. Invest Ophthalmol Vis Sci. 1983;24:196 202. 3. Hoekzema R, Verhagen C, van Haren M, Kijlstra A. Endotoxininduced uveitis in the rat: signicance of intraocular interleukin-6. Invest Ophthalmol Vis Sci. 1982;33:532539. 4. de Vos AF, van Haren MA, Verhagen C, Hoekzema R, Kijlstra A. Kinetics of intraocular tumor necrosis factor and interleukin-6 in endotoxin-induced uveitis in the rat. Invest Ophthalmol Vis Sci. 1994;35:1100 1106. 5. Chi ZL, Hayasaka S, Zhang XY, Hayasaka Y, Cui HS. Effects of rolipram, a selective inhibitor of type 4 phosphodiesterase, on

11.

12.

13.

14.

15.

lipopolysaccharide-induced uveitis in rats. Invest Ophthalmol Vis Sci. 2004;45:24972502. de Vos AF, Hoekzema R, Kijlstra A. Cytokines and uveitis. Curr Eye Res. 1992;6:581597. Zlotnik A, Yoshie O. A new classication system and their role in immunity. Immunity. 2000;12:121127. Kaburaki T, Fujino Y, Kawashima H, et al. Plasma and whole-blood chemokine levels in patients with Behcets disease. Graefes Arch Clin Exp Ophthalmol. 2003;241:353358. Verma MJ, Lloyd A, Roger H, et al. Chemokines in acute anterior uveitis. Curr Eye Res. 1997;16:12021208. Watanabe K, Kinoshita S, Nakagawa H. Purication and characterization of cytokine-induced neutrophil chemoattractant produced by epithelioid cell line of normal rat kidney (NRK-52E cell). Biochem Biophys Res Commun. 1989;161:10931099. Handa O, Naito Y, Takagi T, et al. Tumor necrosis factor- induced cytokine- induced neutrophil chemoattractant-1 (CINC-1) production by rat gastric epithelial cells: role of reactive oxygen species and nuclear factor-kB. J Pharmacol Exp Ther. 2004;309:670 676. Seino Y, Ikeda U, Minezaki KK, et al. Expression of cytokineinduced neutrophil chemoattractant in rat cardiac myocytes. J Mol Cell Cardiol. 1995;27:20432051. Yoshida H, Miura S, Kishikawa H, et al. Fatty acids enhance GRO/ CINC-1 and interleukin-6 production in rat intestinal epithelial cells. J Nutr. 2001;131:29432950. Borovikova LV, Ivanova S, Zhang M, et al. Vagus nerve stimulation attenuates the systemic inammatory response to endotoxin. Nature. 2000;405:458 462. Wang H, Liao H, Ochani M, et al. Cholinergic agonists inhibit HMGB1 release and improve survival in experimental sepsis. Nat Med. 2004;10:1216 1221.

IOVS, June 2007, Vol. 48, No. 6

16. Matthay MA, Ware LB. Can nicotine treat sepsis? Nat Med. 2004; 10:11611162. 17. Wang H, Yu M, Ochani M, et al. Nicotinic acetylcholine receptor 7 subunit is an essential regulator of inammation. Nature. 2003; 421:384 388. 18. Tracey KJ. The inammatory reex. Nature. 2002;420:853 859. 19. Bernik TR, Friedman SG, Ochani M, et al. Pharmacological stimulation of the cholinergic anti-inammatory pathway. J Exp Med. 2002;195:781788. 20. Ulloa L. The vagus nerve and the nicotinic anti-inammatory pathway. Nat Rev Drug Discov. 2005;4:673 684. 21. Van Dijk JPM, Madretsma GS, Keuskamp ZJ, Zijlstra FJ. Nicotine inhibits cytokine synthesis by mouse colonic mucosa. Eur J Pharmacol. 1995;278:R11R12. 22. Behar-Cohen FF, Savoldelli M, Parel JM, et al. Regulation of corneal edema in endotoxin-induced uveitis after application of L-NAME and nitric oxide synthase inhibitor in rats by iontophoresis. Invest Ophthalmol Vis Sci. 1998;39:897904. 23. Bradford MM. A rapid and sensitive method for quantication of microgram quantities of protein utilizing the principle of proteindye binding. Anal Biochem. 1976;72:248 254.

Cholinergic Agonists and Uveitis

2725

24. Saeed RW, Varma S, Peng-Nemeroff T, et al. Cholinergic stimulation blocks endothelial cell activation and leukocyte recruitment during inammation. J Exp Med. 2005;201:11131123. 25. Macklin KD, Maus AD, Pereira EFR, Albuquerque EX, Conti-Fine BM. Human vascular endothelial cells express functional nicotinic acetylcholine receptors. J Pharmacol Exp Ther. 1998;287:435 439. 26. Wang Y, Pereira EFR, Maus ADJ, et al. Human bronchial epithelial and endothelial cells express 7 nicotinic acetylcholine receptors. Mol Pharmacol. 2001;60:12011209. 27. Abbruscato TJ, Lopez SP, Mark KS, Hawkins BT, Davis TP. Nicotine and cotinine modulate cerebral microvascular permeability and protein expression of ZO-1 through nicotinic acetylcholine receptors expressed on brain endothelial cells. J Pharmacol Sci. 2002; 91:25252538. 28. Baeuerle PA, Henkel T. Function and activation of NF-kB in the immune system. Annu Rev Immunol. 1994;12:141179. 29. Mandavilli A. Nicotine x. Nat Med. 2004;10:660 661. 30. Libert C. Inammation: a nervous connection. Nature. 2003;421: 328 329. 31. Pullan RD, Rhodes J, Ganesh S, et al. Transdermal nicotine for active ulcerative colitis. N Engl J Med. 1994;330:811 815.