Pesticide Biochemistry and Physiology 92 (2008) 2429

Contents lists available at ScienceDirect

Pesticide Biochemistry and Physiology

journal homepage: www.elsevier.com/locate/ypest

Self-EcoTILLING to identify single-nucleotide mutations in multigene family

Guang-Xi Wang a,*, Toshiyuki Imaizumi a, Wei Li b, Hiromasa Saitoh c, Ryohei Terauchi c, Takanori Ohsako d, Tohru Tominaga a
a

Laboratory of Weed Science, Graduate School of Agriculture, Kyoto University, Kyoto 606-8502, Japan Wuhan Botanical Garden, The Chinese Academy of Sciences, Hubei 430074, PR China c Iwate Biotechnology Research Center, Kitakami, Iwate 024-0003, Japan d Laboratory of Agroecology, Graduate School of Agriculture, Kyoto Prefectural University, Kyoto 619-0244, Japan
b

a r t i c l e

i n f o

a b s t r a c t
TILLING (Targeting Induced Local Lesions IN Genomes) is a low-cost, high-throughput reverse genetic technique that employs a mismatch-specic endonuclease CEL-1 to discover induced point mutations in the genes of interest. The use of the TILLING technique to survey natural variation in genes is called EcoTILLING. Here, we report a modied EcoTILLING method for the discovery of mutations in multigene family, which we coin Self-EcoTILLING by using an allotetraploid Monochoria vaginalis ALS multigene family as an example. The mutations could be detected by TILLING of PCR products resulting from the primers specic to both Als1 and Als3 without involving the experimental step of mixture of reference and query DNA. Either of the two co-amplied loci could serve as reference DNA to the other. We demonstrate with this example that Self-EcoTILLING is a fast, reliable and economical technique of detecting single-nucleotide mutations in polyploid plants containing multigene family. 2008 Elsevier Inc. All rights reserved.

Article history: Received 28 June 2007 Accepted 14 May 2008 Available online 28 May 2008 Keywords: EcoTILLING Multigene family Polyploid plant Self-EcoTILLING Single-nucleotide mutation

1. Introduction TILLING (Targeting Induced Local Lesions IN Genomes) is a lowcost, high-throughput reverse genetic technique that employs a mismatch-specic endonuclease CEL-1 to discover induced point mutations in the genes of interest [13]. A run of Li-Cor gel analyzerTM can study up to 1.5-kb region for 96 DNA samples, and by pooling of DNA samples one can probe over 2000 individuals per day. The use of the TILLING technique to survey natural variation in genes is called EcoTILLING [4]. Genomic DNA of an individual to be queried is mixed with a reference DNA and used to amplify the target region of DNA with the two primers that are labeled with different uorescent dyes. The amplied DNA is heat denatured and reannealed. If any DNA polymorphism present between the query and reference DNAs, heteroduplex fragments with mismatches are generated in half of the duplex molecules. These heteroduplexes are nicked at mismatched sites by the endonuclease CEL-1 and resulting fragments are separated in a denaturing PAGE gel. Finally these fragments are visualized by uorescent dyes attached to the primers. Putative polymorphisms detected as a band in one uorescence channel can be veried by the appearance of corresponding band in the other channel [4]. EcoTILLING should be the most efcient technique for screening hundreds to thou-

sands of individuals for rare single-nucleotide polymorphisms (SNPs)1, because screening $1.5-kb fragments by this method allows condent detection and mapping of polymorphisms in a DNA sample whereby DNAs from $10 individuals are pooled. This level of throughput cannot practically be achieved by full sequencing with conventional methods [5]. After the report of Comai et al. [4], EcoTILLING method has been applied as an efcient SNP discovery tool to survey genetic variation in wild populations of the western black cottonwood, Populus trichocarpa [6], wild and cultivated Oryza species [7] as well as to detect single-nucleotide mutations in acetolactate synthase (ALS, EC 4.1.3.18; also called acetohydroxyacid synthase) genes of a paddy weed, Monochoria vaginalis [8]. In all cases, EcoTILLING revealed useful information about SNPs in the studied populations. Here, we report a modied EcoTILLING method for the discovery of mutations in multigene family, which we coin Self-EcoTILLING by using an allotetraploid M. vaginalis ALS multigene family as an example. ALS is the rst common enzyme in the biosynthesis of the branched chain amino acids valine, leucine and isoleucine. Several classes of herbicides are known to inhibit ALS by binding to a relic
1 Abbreviations used: ALS, acetolactate synthase; ASPCR, allele-specic PCR; BSM, bensulfuron-methyl; DGGE, denaturing gradient gel electrophoresis; PASA, PCR amplication of specic alleles; PCR, polymerase chain reaction; R, resistant; S, susceptible; SNP, single-nucleotide polymorphisms; SSCP, single strand conformation polymorphism; SU, sulfonylurea.

* Corresponding author. Fax: +81 75 753 6062. E-mail address: WANG@weed.mbox.media.kyoto-u.ac.jp (G.-X. Wang). 0048-3575/$ - see front matter 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.pestbp.2008.05.001

G.-X. Wang et al. / Pesticide Biochemistry and Physiology 92 (2008) 2429

25

quinone-binding site, including sulfonylureas (SUs), imidazolinones, triazolopyrimidine sulfonanilides and pyrimidinyl oxybenzoates [9]. These highly selective ALS-inhibiting herbicides are very valuable for weed management in a wide range of crops worldwide. However, biotypes resistant (R) to the ALS-inhibiting herbicides have been reported in 95 plant species [10]. R biotypes in many cases have modied ALS genes with one or more point mutations causing reduced sensitivity to the ALS-inhibiting herbicides [9,1115]. Substitution in any of the six conserved amino acids (Ala122, Pro197, Ala205, Asp376, Trp574, or Ser653: numbering standardized to Arabidopsis sequence) is known to result in the resistance to ALS-inhibitor [16,17]. SU-herbicides are commonly used for weed control in rice elds in Japan. SU-R biotypes have been found in many weeds in the rice elds [1821]. The rst DNA analysis of SU-R biotype of M. vaginalis is that of Wang et al. [22]. They surveyed nucleotide sequences of a partial region of the ALS genes of two individuals, one R and the other susceptible (S) to SU, and found a mutation that changes Pro197 to Ser in the SU-R biotype. The second DNA study of SU-R biotypes of this species was carried out by Ohsako and Tominaga [23] who isolated four distinct classes of nucleotide sequences from each of the individuals investigated. These sequence classes are thought to be derived from an ALS multigene family consisting of four members named Als1, Als2, Als3 and Als4, among which Als1 and Als3 share extensive homology. In this research, the two loci Als1 and Als3 were analyzed for association with SU-R phenotype because no nucleotide substitution has been detected in loci Als2 and Als4 [23]. Previously Wang et al. [8] used EcoTILLING to detect causal mutations of Als1 and Als3 loci that confer SU resistance to M. vaginalis. M. vaginalis (Burm. f.) Kunth is often gregarious and typically found in inundated places or at the edges of pools, ditches and canals, or in swamps. It is particularly common and almost characteristic of rice elds [24]. Chromosome numbers of M. vaginalis are 2n = 4x = 52, which is an allotetraploid plant [25]. In that study, the authors treated Als1 and Als3 separately by employing genespecic primers. Query DNA of SU-R plant was mixed with reference DNA of SU-S plant in 1:1 ratio, and the region was polymerase chain reaction (PCR) amplied by Als1- or Als3-specic primers, and mismatch between query and reference DNA was detected separately for the two loci. This experiment identied mutations responsible for SU resistance in either Als1 or Als3. DNA changes causing amino acid changes in Pro197 in Als1 or Als3 indeed conferred SU resistance to M. vaginalis [8]. During the study, we came to know that Als1 and Als3 sequences are quite similar. This nding prompted us to test whether the mutations could be detected by TILLING of PCR products resulting from the primers specic to both Als1 and Als3 without involving the experimental step of mixture of reference and query DNA. We hypothesized that either of the two co-amplied loci will serve as reference DNA to the other. Indeed our experiment showed that this was possible, and we coined this method Self-EcoTILLING. We demonstrate with this example that Self-EcoTILLING is a fast, reliable and economical technique of detecting SNPs in polyploid plants containing multigene family.

Table 1 Plant materials used in the present research and the sequence context of singlenucleotide mutations Location of population Sample Resistance code to SU A SUsusceptible SUsusceptible SU-resistant Pro197 codon in ALS genea Als1 CCT (Pro)b (AB266530) Maizuru, Kyoto Prefecture, Japan Kasai, Hyogo Prefecture, Japan Kyotango, Kyoto Prefecture, Japan Daisen, Akita Prefecture, Japan
a c

Als3 CCT (Pro) (AB266526) CCT (Pro) (AB266524) CCT (Pro) (AB266522) TCT (Ser) (AB266520) CCT (Pro) (AB266518)

Miyazu, Kyoto Prefecture, Japan

CCT (Pro) (AB266529)

CTT (Leu) (AB266521)

SU-resistant

CCT (Pro) (AB266528)

SU-resistant

CAT (His) (AB266527)

Number is standardized to Arabidopsis sequence. b Nucleotide substitutions and the resulting amino acid changes are shown with boldface letters, which were obtained from sequencing done in this study. c Numbers in parentheses are DDBJ Accession numbers.

by pot experiments by applying SU-herbicide: bensulfuron-methyl [methyl-a-(4,6-dimethoxypyrimidin-2-yl-carbamoylsulfamoyl)-otoluate](BSM), the rst SU-herbicide used in Japan. BSM was applied at a concentration of 150 g a.i. ha1 as granules, twice the recommended eld dose, to two- to three-leaf seedlings. These plants that survived the bensulfuron-methyl treatment were used for molecular analysis as R plants. 2.2. Self-EcoTILLING A owchart of the Self-EcoTILLING experiment is summarized in Fig. 1. Total DNA was isolated from 40 mg of young leaves obtained from a single plant by a modied CTAB method [26], and its concentration determined on a 1% agarose gel using lambda DNA (Invitrogen) as a reference. DNAs from all samples were normalized to a nal concentration of 20 ng ll1. The target regions of the two loci (Als1 and Als3) of Als multigene family in M. vaginalis were simultaneously amplied using a set of loci-specic primers, designed based on Ohsako and Tominaga [23] (DDBJ/EMBL/GenBank Accession Nos.: AB243606AB243639) (Table 2), The forward and reverse primer sequence (upper case in Table 2) is tagged at the 50 end with the sequence, gctacggactgacctcggac and ctgacgtg atgctcctgacg, respectively, to serve for the annealing site of the common labeled primers used in the second PCR. PCR and CEL-1 (Transgenomics SurveyorTM) reactions were carried out according to Rakshit et al. [7] with some modications. PCR amplication was performed in a 20 ll volume containing 1.5 ng genomic DNA, 1 Ex-Taq buffer (2.0 mM Mg2+ plus, TaKaRa), 0.2 mM dNTPs, 0.3 lM primers, 0.02 U Ex-Taq DNA polymerase (TaKaRa). PCR was conducted using a thermal cycler (MJ Research) as follows: heat denaturation at 95 C for 2 min, followed by 35 cycles of PCR (95 C for 1 min, 60 C for 1 min, 72 C for 1 min), and an additional extension step (72 C for 7 min). The PCR products from the rst amplication were puried with MILLPORE multi screen system and diluted 20-fold (5 ll puried products +95 ll sterilized water) and used as template for the second PCR. The common tag sequence (lower case in Table 2) for the forward and reverse primers were labeled with IRD700 dye and IRD800 dye (LI-COR), respectively, and used in the second PCR using the diluted DNA from the rst PCR as template. PCR amplication was performed in a

2. Materials and methods 2.1. Plant lines Sulfonylurea-resistant and -susceptible biotypes of M. vaginalis used in this research are shown in Table 1. Samples A and B were collected from non-R populations from elds in Miyazu City and Maizuru City, Kyoto Prefecture, respectively. In addition, Samples C, D and E were from Kasai City of Hyogo Prefecture, Kyotango City of Kyoto Prefecture and Daisen City of Akita Prefecture, respectively, which both non-resistance and resistance were conrmed

26

G.-X. Wang et al. / Pesticide Biochemistry and Physiology 92 (2008) 2429

Total DNA

Two of four genes, ALS1 and ALS3, were amplified by PCR using fluorescently tagged two-loci-specific primers.

5 3

C G
PCR products of ALS1

3 5 5 3

T A
PCR products of ALS3

3 5

Heat, Anneal
5 3

C G
Homoduplexes

C
3 5 5 3 3 5

5 3

T A

A T
3 5 5 3

Heteroduplexes
3 5

CEL-1 reaction
5 3

G 121 bp C A T
3 5 5 3 3 5

C G

3 5 5 3

CEL-1 Cut upper strand CEL-

3 5

5 3

T A

CEL-1 CEL-

Denaturing electrophoresis
No SNP SNP

G 300 bp Cut lower strand

No SNP

SNP

421 bp 300 bp

Uncut strands Cut lower strand

Cut upper strand

121 bp
Primer dimers IR DYE 700 IR DYE 800

Fig. 1. Flowchart of Self-EcoTILLING. For details see Section 2.

10 ll volume containing 2 ll puried and diluted product of rst PCR, 1 Ex-Taq buffer (2.0 mM Mg2+ plus, TaKaRa), 0.2 mM dNTPs, 0.02 lM primers, 0.02 U Ex-Taq DNA polymerase. PCR was conducted using a thermal cycler (MJ Research) as follows: heat denaturation at 95 C for 2 min, followed by 35 cycles of PCR (95 C for 1 min, 60 C for 1 min, 72 C for 1 min), and an additional extension step (72 C for 7 min). Heteroduplex formation was then performed by incubating at 99 C for 10 min, followed by 70 cycles of 70 C for 20 s with decreasing the temperature 0.3 C each cy-

cle). Next, 10 ll of PCR was incubated with 0.0375 ll of CEL-1 enzyme solution in a total volume of 20 ll (buffered in 10 mM Hepes at pH 7.5, 10 mM MgSO4, 10 mM KCl, 0.002% Triton X-100, 0.2 lg/ ml BSA) at 45 C for 15 min. Reaction was stopped by the addition of stop solution (5 ll of 0.15 M EDTA, pH 8.0). Fragments were puried using Sephadex G50 (medium coarse) minicolumns in 96-well lter plates (Multiscreen HV; Millipore) and eluted into plates prelled with 5 ll of 1 TILLING loading buffer per well. Samples were concentrated to about 1.5 ll by heating at 85 C

G.-X. Wang et al. / Pesticide Biochemistry and Physiology 92 (2008) 2429 Table 2 Two-loci-specic primers designed for the PCR amplication of partial regions of Als1 and Als3 of M. vaginalis Primer name DNA sequencea Reference position (AB266521) (AB266527) (AB266528) (AB266529) (AB266530) ALS1 + 3fw ALS1 + 3rv gctacggactgacctcggac TCTGCATCGCCACCTCG ctgacgtgatgctcctgacg TGAAGCAGATGGAGGGCAGG Nt. 117
AB CD E

27

421 bp
400

(AB266522) (AB266518) (AB266520) (AB266524) (AB266526)

364 350

Nt. 402421

300

C & E: 299 bp D: 300 bp

a DNA sequence in lower case is a common tag sequence for the second PCR and nucleotide positions were referenced for the DNA sequence in upper case. b Numbers in parentheses are DDBJ Accession numbers.

255

for 5060 min without cover. A total of 0.75 ll was applied to a 100-tooth membrane comb (The Gel Company) and loaded on 6.5% KBplus Gel (20 ml of 6.5% KBplus, 150 ll of 10% ammonium persulfate (APS) and 15 ll of TEMED). Electrophoresis was done in 1 TBE running buffer at 1500 V, 40 mA and 40 W settings on a LI-COR Model 4300 DNA Analyzer (LI-COR). Images were analyzed visually for the presence of cleavage products using Adobe Photoshop software (Adobe Systems Inc.). 2.3. DNA sequencing Fragments of ALS genes were amplied from the extracted genomic DNA of Samples AE, respectively, by PCR with gene-specic primers for locus Als1 (ALS1fw: 50 -TCTGCCCTGGCTGACGCCCT30 , ALS1rv: 50 -ACCCATCAATGTACTCGC-30 ; according to Wang et al. [8] or Als3 (ALS3fw: 50 -TCTGCATCGCCACCTCG-30 , ALS3rv: 50 -GACCCATTAGTGTACTCGC-30 ; according to Wang et al. [8]. The genomic sequences were determined directly from the amplied PCR fragments after purication of the fragments using a centrifuge lter device (Montage PCR, Millipore Corp. Bedford, USA). ABI PRISM 3100 Genetic Analyzer (Applied Biosystems) was used for the sequence analysis. 3. Results 3.1. Mutation detection using Self-EcoTILLING Assay using primer pairs that target both loci Als1 and Als3 detected mutations in Domain A of Samples C, D and E. This is indicated by the cleavage at the mismatch nucleotide by the CEL-1 enzyme giving rise to 2 fragments, 122 bp and 299 bp in Samples C and E, and 121 bp and 300 bp in Sample D, respectively (Fig. 2). The sizes of the 2 fragments indicate the accurate position of the mismatch and thus the site of the mutation or nucleotide change. 3.2. ALS sequence of M. vaginalis Two distinct Als loci, Als1 and Als3, from a section of the mature, protein-coding region of Samples AE of M. vaginalis were sequenced. As shown in Table 1, amino acid substitutions were detected in SU-R biotypes at Pro197 in either Als1 or Als3. The biotypes from Kasai City, Hyogo Prefecture, Japan (Sample C, DDBJ/EMBL/GenBank Accession Nos.: AB266521 and AB266522) showed a leucine codon replacing Pro197 in Als1, Kyotango City, Kyoto Prefecture, Japan (Sample D, DDBJ/EMBL/GenBank Accession Nos.: AB266528 and AB266520) showed a serine codon replacing Pro197 in Als3 and Daisen City, Akita Prefecture, Japan (Sample E, DDBJ/EMBL/GenBank Accession Nos.: AB266527 and AB266518) showed a histidine codon replacing Pro197 in Als1, respectively.

200

145

C & E: 122 bp D: 121 bp

AB C D E

100

50

Fig. 2. Electrophoresis on a 6.5% KBplus Gel of CEL-1-digested products of a PCR fragment of 421 bp in a Li-Cor model 4300 DNA Analyzer (LI-COR). The sample in each lane is indicated by its code (Table 1). The IR Dye 700 and IR Dye 800 channels are shown at left and right, respectively. CEL-1-cleaved heteroduplexes appear as intense bands [arrowed in blue (IR Dye 700 channel) and in red (IR Dye 800 channel)]. The sizes of the IR700 labeled and the IR800 labeled cleaved fragments add up to the size of the PCR fragment. The fragment sizes also indicate the position of the single-nucleotide mutation present in the locus Als1 or locus Als3 of SU-R plant samples of M. vaginalis collected from Kasai City, Hyogo Prefecture, Japan (Sample C), Kyotango City, Kyoto Prefecture, Japan (Sample D) and Daisen City, Akita Prefecture, Japan (Sample E). This is illustrated by the arrows on the doublestranded fragment above the gel. No cleavage was detected in the SU-S plant samples (Samples A and B).

No mutation was detected in both loci in both non-R populations collected from Miyazu (Sample A, DDBJ/EMBL/GenBank Accession Nos.: AB266530, AB266526) and Maizuru (Sample B, DDBJ/EMBL/ GenBank Accession Nos.: AB266529, AB266524). 4. Discussion Single-nucleotide mutations in ALS genes of SU-R M. vaginalis has previously been studied by conventional EcoTILLING in which genomic DNA of an SU-R plant (target DNA) was mixed with the DNA of an SU-S plant (reference DNA). The EcoTILLING has been demonstrated to be a fast, reliable, economical method for detecting single-nucleotide mutations in genes arising from herbicide selection [8]. However, it needs both DNAs (query and reference) for EcoTILLING to be done by mixing them so that discovery of single-nucleotide mutations was difcult when only having one type of the plant material, wild type or mutation type. In Japan, several paddy weeds have rapidly diminished those distributional ranges and are now listed as vulnerable species. SU-R biotypes are found in some of those vulnerable species, such as Monochoria korsakowii

28

G.-X. Wang et al. / Pesticide Biochemistry and Physiology 92 (2008) 2429

and Limnophila sessiliora, and collecting wild type of the plant materials may be difcult in these cases. Self-EcoTILLING, on the other hand, uses the two-loci-specic primers that precisely match two genes of multigene family and the DNA of an only SU-R plant, for example Als1 and Als3 in only one individual (SU-R biotype or SU-S biotype) of the allotetraploid M. vaginalis used in this research. Moreover, it is sometimes difcult to nding primers and PCR conditions that can amplify particular locus specically in a multigene family. Although nding these primers and PCR conditions may be easy to do using anking non-coding region, a run

of Li-Cor gel analyzerTM cannot study more than 1.5-kb of PCR fragments. Therefore, anking non-coding region will not be used for nding primers of EcoTILLING. Self-EcoTILLING does not need the locus-specic-primers. SU-R biotypes with a multigene family have been found extensively in paddy elds in Japan, especially in Lindernia spp. [21], Schoenoplectus juncoides [27] and M. vaginalis [8,23] in which the mutations in either Als1 or Als2 (or Als3) conferred resistance to herbicides suggesting that both genes are functional. Therefore, as a method, two genes in the multigene family can be used as the query or the reference each other.

10 20 30 40 50 60 70 80 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

ALS1_A ALS3_A ALS1_B ALS3_B ALS1_C ALS3_C ALS1_D ALS3_D ALS1_E ALS3_E

tctgcatcgccacctcgggccccggagctaccaacctcgtctctgccctggctgacgccctcctcgattctatacccatg ..........................................................a..................... ................................................................................ ..........................................................a..................... ................................................................................ ..........................................................a..................... ................................................................................ ..........................................................a..................... ................................................................................ ..........................................................a.....................

Domain A
ALS1_A ALS3_A ALS1_B ALS3_B ALS1_C ALS3_C ALS1_D ALS3_D ALS1_E ALS3_E

Domain D

90 100 110 120 130 140 150 160 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

gtcgccatcaccggccaggtccctcgccgcatgatcggcactgacgccttccaggagacgcccatcgtcgaggtcacgcg ................................................................................ ................................................................................ ................................................................................ ......................t......................................................... ................................................................................ ................................................................................ .....................t.......................................................... ......................a......................................................... ................................................................................
170 180 190 200 210 220 230 240 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

ALS1_A ALS3_A ALS1_B ALS3_B ALS1_C ALS3_C ALS1_D ALS3_D ALS1_E ALS3_E

ctccatcaccaagcacaactaccttgtcctcgacgtcgatgacattcccaggataataaaggaggcatttttcatcgcca ...........................t.................................................... ................................................................................ ...........................t.................................................... ................................................................................ ...........................t.................................................... ................................................................................ ...........................t.................................................... ................................................................................ ...........................t....................................................
250 260 270 280 290 300 310 320 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

ALS1_A ALS3_A ALS1_B ALS3_B ALS1_C ALS3_C ALS1_D ALS3_D ALS1_E ALS3_E

ccagcggccgtcccggtccagtgctcgtggacatcccgaaagacatccaacagcagctcgcggtgcccgtctggaatcca ....t.................t........t.....a..g...........a........a............g..... ................................................................................ ....t.................t........t.....a..g...........a........a............g..... ........................................g....................................... ....t.................t........t.....a..g...........a........a............g..... ................................................................................ ....t.................t........t.....a..g...........a........a............g..... ........................................g....................................... ....t.................t........t.....a..g...........a........a............g.....
330 340 350 360 370 380 ....|....|....|....|....|....|....|....|....|....|....|....|..

ALS1_A ALS3_A ALS1_B ALS3_B ALS1_C ALS3_C ALS1_D ALS3_D ALS1_E ALS3_E

ccagttcgtttgcctggttatgtctcccgcctccccaagccgcctgccctccatctgcttca ........c..................................................... .............................................................. ........c..................................................... .............................................................. ........c..................................................... .............................................................. ........c..................................................... .............................................................. ........c.....................................................

Fig. 3. Alignment of partial DNA sequences from Samples AE. Dots indicate the nucleic acids are the same as ALS1_A. The numbers on the top line showed the size of fragments, and the size of tag sequence labeled in primers (40 bp) should be added on when collating this gure with Fig. 2.

G.-X. Wang et al. / Pesticide Biochemistry and Physiology 92 (2008) 2429

29

Self-EcoTILLING using the two-loci-specic primers that precisely match two genes of multigene family has detected the presence of mutations (Fig. 2) without reference DNA. The nucleotide change in each of the two loci was determined by sequencing the amplied target fragments. The changes resulted in the disruption of the Pro197 codon in the conserved Domain A of the ALS gene. Although there are the other mismatches between ALS1 and ALS3, which also cause shorter fragments (see Figs. 2 and 3), they can be ignored because they are not in the conserved regions: Domain A and D, the target sites. This method can be applied to any species as long as the organism has a multigene family. But more mismatches might make the bands fainter under the incomplete nick recognition condition. Herbicide resistance in many cases has been attributed to single point mutations, which can occur at multiple sites in the ALS gene, resulting in a variable pattern of cross-resistance between the classes of ALS-inhibitors. Base changes in at least four protein domains have been associated with in vivo resistance in eld plants. The most common in biotypes selected by SUs is in the highly conserved Domain A site that codes for 13 amino acids, where any alteration of the codon for Pro confers resistance, primarily to the SUs and triazolopyrimidines [9]. The Pro in Domain A of ALS is conserved in SU-S plants, bacteria and yeast [28]. The deduced amino acid encoded by the Als1 and Als3 clones of the S biotypes of M. vaginalis plants found the Pro residue in Domain A to be similarly conserved (Table 1). The Pro residue in Domain A was substituted by Leu (CTT) in the SU-R biotype collected from Kasai City, Hyogo Prefecture, by Ser (TCT) in the SU-R biotype collected from Kyotango City, Kyoto Prefecture and by His (CAT) in the SU-R biotype collected from Daisen City, Akita Prefecture. A number of techniques for detecting base mutations have been developed. Assays based on gel mobility, like denaturing gradient gel electrophoresis (DGGE) and single strand conformation polymorphism (SSCP), detect possible base changes but do not indicate the location or type of polymorphism in the DNA fragment [29]. Techniques that rely on denaturation kinetics and quantitative PCR only work for small fragments of DNA [30]. Sequencing of candidate genes from multiple genotypes is an accurate alternative to these methods, but is relatively expensive and laborious when applied to multiple loci in large numbers of individuals [6]. Since the rst publication describing the technique of TILLING in 2001, this method of reverse genetics is now underway in diverse plant species. As the extension of TILLING, EcoTILLING allows natural alleles at a locus to be characterized across many germplasm accessions, enabling both SNP discovery and haplotyping at these loci [4]. PCR amplication of specic alleles (PASA) is another mutation detection method. This technique thus detects mutation without prior sequence information whereas the allele-specic PCR method (ASPCR) [31] is based on the use of available sequence information to design allele-specic primers that will anneal with the R biotype and not the wild type. We think EcoTILLING can be used in single-nucleotide mutation detection of herbicide-R genes as a powerful, lowcost and high-throughput reverse genetic method that cannot be practically achieved by full sequencing [8] but we demonstrate with this example that Self-EcoTILLING is a faster, more reliable and economical method detecting single-nucleotide mutations in polyploidy plants with a multigene system. Acknowledgments R. Terauchi thanks B. Till, L. Comai and S. Henikoff, Washington University, Seattle, USA for training him with TILLING technique. The authors are grateful to Yukako Kuriyama of Water Plant Society, Japan for drawing the graph of the plant in Fig. 1, and Hiroe Utsushi and Chikako Mitsuoka at Iwate Biotechnology Research Center for their excellent technical assistance and advice.

References
[1] T. Colbert, B.J. Till, R. Tompa, et al., High-throughput screening for induced point mutations, Plant Physiol. 126 (2001) 480484. [2] C.M. McCallum, L. Comai, E.A. Greene, S. Henikoff, Targeting Induced Local Lesions IN Genomes (TILLING) for plant functional genomics, Plant Physiol. 123 (2000) 439442. [3] C.M. McCallum, L. Comai, E.A. Greene, S. Henikoff, Targeted screening for induced mutations, Nat. Biotech. 18 (2000) 455457. [4] L. Comai, K. Young, B.J. Till, et al., Efcient discovery of DNA polymorphisms in natural populations by Ecotilling, Plant J. 37 (2004) 778786. [5] L. Comai, S. Henikoff, TILLING: practical single-nucleotide mutation discovery, Plant J. 45 (2006) 684694. [6] E.J. Gilchrist, G.W. Haughn, C.C. Ying, et al., Use of Ecotilling as an efcient SNP discovery tool to survey genetic variation in wild populations of Populus trichocarpa, Mol. Ecol. 15 (2006) 12501261. [7] S. Rakshit, A. Rakshit, H. Matsumura, et al., Large-scale DNA polymorphism study of Oryza sativa and O. rupogon reveals the origin and divergence of Asian rice, Theor. Appl. Genet. 114 (2007) 731743. [8] G.-X. Wang, M.-K. Tan, S. Rakshit, et al., Discovery of single-nucleotide mutations in acetolactate synthase genes by Ecotilling, Pestic. Biochem. Physiol. 88 (2007) 143148. [9] M.-K. Tan, R.W. Medd, Characterisation of the acetolactate synthase (ALS) gene of Raphanus raphanistrum L. and the molecular assay of mutations associated with herbicide resistance, Plant Sci. 163 (2002) 195205. [10] I. Heap, International survey of herbicide-resistant weeds. 2007. Available from: <http://www.weedscience.com>. [11] P.J. Tranel, T.R. Wright, I. M. Heap, ALS mutations from herbicide-resistant weeds. September 29, 2006. Available from: <http://www.weedscience.org/ mutations/MutDisplay.aspx>. [12] M.J. Guttieri, C.V. Eberlein, D.C. Thill, Diverse mutations in the acetolactate synthase gene confer chlorsulfuron resistance in kochia (Kochia scoparia) biotypes, Weed Sci. 43 (1995) 175178. [13] T.R. Wright, N.F. Bascomb, S.F. Sturner, D. Penner, Biochemical mechanism and molecular basis for ALS-inhibition herbicide resistance in sugarbeet (Beta vulgaris) somatic cell selections, Weed Sci. 46 (1998) 1323. [14] P. Boutsalis, J. Karotam, S.B. Powles, Molecular basis of resistance to acetolactate synthase-inhibiting herbicides in Sisymbrium orientale and Brassica tournefortii, Pestic. Sci. 55 (1999) 507516. [15] C.V. Eberlein, M.J. Guttieri, P.H. Berger, et al., Physiological consequences of mutation for ALS-inhibitor resistance, Weed Sci. 47 (1999) 383392. [16] P.J. Tranel, T.R. Wright, Resistance of weeds to ALS-inhibiting herbicides: what have we learned? Weed Sci. 50 (2002) 700712. [17] C.M. Whaley, H.P. Wilson, J.H. Westwood, A new mutation in plant ALS confers resistance to ve classes of ALS-inhibiting herbicides, Weed Sci. 55 (2007) 8390. [18] G.-X. Wang, H. Kohara, K. Itoh, Sulfonylurea resistance in a biotype of Monochoria korsakowii, an annual paddy weed in Japan, The 1997 Brighton Crop Prot. Conf.: Weeds 1 (1997) 311318. [19] K. Itoh, G.-X. Wang, S. Ohba, Sulfonylurea resistance in Lindernia micrantha, an annual paddy weed in Japan, Weed Res. 39 (1999) 413423. [20] G.-X. Wang, H. Watanabe, A. Uchino, K. Itoh, Response of a sulfonylurea (SU)resistant biotype of Limnophila sessiliora to selected SU and alternative herbicides, Pestic. Biochem. Physiol. 68 (2000) 5966. [21] A. Uchino, H. Watanabe, Mutations in the acetolactate synthase genes of sulfonylurea-resistant biotypes of Lindernia spp., Weed Biol. Manag. 2 (2002) 104109. [22] G.-X. Wang, Y. Lin, W. Li, M. Ito, K. Itoh, A mutation confers Monochoria vaginalis resistance to sulfonylureas that target acetolactate synthase, Pestic. Biochem. Physiol. 80 (2004) 4346. [23] T. Ohsako, T. Tominaga, Nucleotide substitutions in the acetolactate synthase genes of sulfonylurea-resistant biotypes of Monochoria vaginalis (Pontederiaceae), Genes Genet. Syst. 82 (2007) 207215. [24] C.D.K. Cook, A revision of the genus Monochoria, in: K. Tan, R.R. Mill, T.S. Elias (Eds.), Plant Taxonomy, Phytogeography and Related Subjects, Edinburgh University Press, Edinburgh, 1989, pp. 149184. [25] G.-X. Wang, T. Kusanagi, Cytotaxonomic analyses of the genus Monochoria in Asia, Acta Phytotax. Geobot. 47 (1996) 105111. [26] N. Escaravage, S. Questiau, A. Pornon, B. Doche, P. Taberlet, Clonal diversity in a Rhododendron ferrugineum L. (Ericaceae) population inferred from AFLP markers, Mol. Ecol. 7 (1998) 975982. [27] A. Uchino, S. Ogata, H. Kohara, S. Yoshida, T. Yoshioka, H. Watanabe, Molecular basis of diverse responses to acetolactate synthase (ALS)-inhibiting herbicides in sulfonylurea-resistant biotypes of Schoenoplectus juncoides, Weed Biol. Manag. 7 (2007) 8996. [28] L.L. Saari, J.C. Cotterman, D.C. Thill, Resistance to acetolactate synthase inhibiting herbicides, in: S.B. Powles, J.A.M. Holtum (Eds.), Herbicide Resistance in Plants: Biology and Biochemistry, Lewis Publishers, Boca Raton, 1994, pp. 83139. [29] L. DeFrancesco, J.M. Perkel, In search of genomic variation: a wealth of technologies exists to nd elusive genetic polymorphisms, Scientist 15 (2001) 24. [30] C.N. Gundry, J.G. Vandersteen, G.H. Reed, et al., Amplicon melting analysis with labeled primers: a closed-tube method for differentiating homozygotes and heterozygotes, Clin. Chem. 49 (2003) 396406. [31] C.L. Corbett, F.J. Tardif, Detection of resistance to acetolactate synthase inhibitors in weeds with emphasis on DNA-based techniques: a review, Pest Manag. Sci. 62 (2006) 584597.