M.Phil Thesis of Asma Sohail

GLUTATHIONE-S-TRANSFERASES (GSTT1 & GSTM1) GENE DELETIONS AND SUSCEPTIBILITY TO BREAST CANCER IN PAKISTAN
A THESIS SUBMITTED TO BAHAUDDIN ZAKARIYA UNIVERSITY IN PARTIAL FULFILLMENT OF THE REQUIREMNT FOR THE DEGREE OF
MASTER OF PHILOSOPHY
IN
BIOTECHNOLOGY
By ASMA SOHAIL
FEBRUARY - 2011
INSTITUTE OF BIOTECHNOLOGY BAHAUDDIN ZAKARIYA UNIVERSITY MULTAN, PAKISTAN
GLUTATHIONE-S-TRANSFERASES (GSTT1 & GSTM1) GENE DELETIONS AND SUSCEPTIBILITY TO BREAST CANCER IN PAKISTAN
A THESIS SUBMITTED TO BAHAUDDIN ZAKARIYA UNIVERSITY IN PARTIAL FULFILLMENT OF THE REQUIREMNT FOR THE DEGREE OF
MASTER OF PHILOSOPHY
IN
BIOTECHNOLOGY
By ASMA SOHAIL
SESSION 2008-10
INSTITUTE OF BIOTECHNOLOGY BAHAUDDIN ZAKARIYA UNIVERSITY MULTAN, PAKISTAN

Page | ii
READ IN THE NAME OF ALLAH
Page | iii
Page | iv
CERTIFICATE
It is certified that the research work described in this thesis is the original work of ASMA SOHAIL and has been carried out under my direct supervision. I have personally gone through all the data reported in the manuscript and certify their correctness/authenticity. It is further certified that the material included in this thesis have not been used in part or full in a manuscript already submitted or in the process of submission in partial/complete fulfillment of the award of any other degree from any other institution. It is also certified that the thesis has been prepared under my supervision according to the prescribed format and we endorse its evaluation for the award of M.Phil degree through the official procedures of the University. In accordance with the rules of the Institute, her data book is declared as unexpendable document that will be kept in the registry of the Institute for a minimum of three years from the date of the thesis defense examination.
SIGNATURE OF SUPERVISOR: NAME OF THE SUPERVISOR:
_________________ PROF. DR. MUHAMMAD ALI DIRECTOR, INSTITUTE OF BIOTECHNOLOGY BAHAUDDIN ZAKARIYA UNIVERSITY, MULTAN, PAKISTAN.
Page | v
The Controller of Examination, Bahauddin Zakariya University, Multan. We the supervisory committee, certify that the contents and form of thesis submitted by ASMA SOHAIL has been found satisfactory and recommend it for the award of degree of M.Phil Biotechnology.
Supervisory Board
Supervisor (Prof. Dr. Muhammad Ali)
External Examiner
(..........................)
Director
(Prof. Dr. Muhammad Ali)
Page | vi
INDEX
CERTIFICATE __________________________________________________________ v SUPERVISORY BOARD ________________________________________________ vi TABLE OF CONTENT __________________________________________________ vii LIST OF TABLES ______________________________________________________ ix LIST OF FIGURES ______________________________________________________ x ACKNOWLEDGMENT__________________________________________________ xi SUMMARY ___________________________________________________________ xii INTRODUCTION ............................................................................................................... 1 OVERVIEW OF CANCER DISEASE ............................................................................... 3 Normal Cells & Tissues ....................................................................................................... 3 Control of Growth in Normal Tissues ................................................................................. 4 The Cell Cycle ..................................................................................................................... 5 The Process Of Tumor Growth & Carcinogenesis .............................................................. 6 CLASSIFICATION OF TUMORS ..................................................................................... 8 ETIOLOGY OF CANCER (CAUSES OF CANCERS) ..................................................... 8 Chemical Carcinogens ......................................................................................................... 9 Physical Carcinogens ........................................................................................................... 9 Biological Carcinogens ...................................................................................................... 10 Endogenous Processes ....................................................................................................... 10 EPIDEMIOLOGY & TYPES OF CANCERS .................................................................. 11 Leukemia & Lymphomas .................................................................................................. 13 Colon Cancer ..................................................................................................................... 13 Wilms Tumor (Nephroblastoma) ....................................................................................... 13 Cancers of Skin .................................................................................................................. 13 Bladder Cancer................................................................................................................... 14 Renal Cell Carcinoma ........................................................................................................ 14 Liver Cancer....................................................................................................................... 14 Stomach Cancer ................................................................................................................. 14 Prostate Cancer .................................................................................................................. 15 BREAST CANCER ........................................................................................................... 15 ETIOLOGY OF BREAST CANCER ................................................................................ 17 Factors Under Our control ................................................................................................. 17 Factors Which cant Be controled ...................................................................................... 18 Page | vii
ROLE OF DIFFERENT GENES IN BREAST CARCINOGENESIS.............................. 18 Tumor Suppressor Genes ................................................................................................... 19 Proto-Oncogenes ................................................................................................................ 20 DNA Repair Gene .............................................................................................................. 20 Carcinogen Metabolism Genes .......................................................................................... 21 CELL PROTECTION MECHANISMS IN CANCER...................................................... 21 Enzyme Systems Involved in Detoxification ..................................................................... 21 Regulation of Detoxification Activities ............................................................................. 23 Induction ............................................................................................................................ 23 Inhibition ............................................................................................................................ 25 EFFECT OF POLYMORPHISMS .................................................................................... 25 GLUTATHIONE CONJUGATION .................................................................................. 26 GLUTATHIONE-S-TRANSFERASES ............................................................................ 26 GSTM ()........................................................................................................................... 28 GSTT () ........................................................................................................................... 28 GST GENOTYPES & CANCER RISK ............................................................................ 29 MATERIAL AND METHODS ......................................................................................... 31 FIELD WORK ................................................................................................................... 31 Institutional Review Board (IRB) ...................................................................................... 31 Enrolment Of Subjects ....................................................................................................... 31 Collection Of Blood Samples ............................................................................................ 31 BENCH WORK ................................................................................................................. 32 DNA Extraction ................................................................................................................. 32 Quantification Of DNA...................................................................................................... 32 GSTT1/GSTM1 Multiplex PCR & Analysis ..................................................................... 32 STATISTICAL ANALYSIS ............................................................................................. 34 RESULTS .......................................................................................................................... 35 DISCUSSION .................................................................................................................... 41 REFERENCES .................................................................................................................. 45
Page | viii
LIST OF TABLES Table 1: Types and Examples of Human Carcinogens ____________________________ 9 Table 2: Stages of Breast Cancer ___________________________________________ 16 Table 3: Tumor Suppressor Genes: Their Role and Chromosomal Location __________ 19 Table 4: Proto-Oncogene: Function and Chromosomal Location __________________ 20 Table 5: Functions and Chromosomal Location of DNA Repair Genes _____________ 20 Table 6: Carcinogen Metabolism Genes: Function and Chromosomal Location _______ 21 Table 7: Oligonucleotides Primers Used In Amplification________________________ 33 Table 8: Ingredients For Multiplex PCR Reaction Mixture _______________________ 34 Table 9: Selected Characteristic for Case & Controls Individuals __________________ 37 Table 10: Cross Tabulation of GSTM1 & GSTT1 with Breast Cancer _______________ 38 Table 11: Cross Tabulation of GSTM1 & GSTT1 Combination with Breast Cancer ____ 39 Table 12: Cross Tabulation of Gene Combinations of GSTM1, GSTT1 & Menopause with Breast Cancer __________________________________________________________ 40 Table 13: Cross Tabulation of Gene Combinations of GSTM1, GSTT1 & Pesticide Exposure with Breast Cancer ______________________________________________ 44 Table 14: Comparative frequency distribution of GSTM1 and GSTT1 in various populations ____________________________________________________________ 44
Page | ix
LIST OF FIGURES Figure 1: A typical tissue showing epithelial and mesenchymal components __________ 4 Figure 2: Cell Cycle ______________________________________________________ 6 Figure 3: Checkpoints control the ability of the cell to progress through the cycle ______ 7 Figure 4: Tumor development showing progression from normal to invasive tumor ____ 7 Figure 5: World Wide Incidence and Mortality Rate of Most Frequent Cancers _______ 12 Figure 6: Liver Detoxification Pathways & Supportive Nutrients __________________ 22 Figure 7: Cytochrome P450 in Human Liver __________________________________ 23 Figure 8: Major Phase II Detoxification Activities in Humans ____________________ 24 Figure 9: Mono & Multi Functional Inducers__________________________________ 25 Figure 10: 3D Structure of Glutathione S-Transferase ___________________________ 27 Figure 11: The GSTM1 gene cluster ________________________________________ 28 Figure 12: The GSTT1 gene cluster _________________________________________ 29 Figure 13: Profile of Multiplex PCR ________________________________________ 33 Figure 14: Ethidium bromide-stained electrophoresed PCR products samples ________ 35 Figure 15: Graph representing frequency of different age groups among affected and normal subjects _________________________________________________________ 39 Figure 16: Graph representing frequency of menopause in different age groups among affected and normal subjects _______________________________________________ 39
Page | x
ACKNOWLEDGEMENTS
In whatever state we are, whatever the consequences we facing, if we are true Muslims thank Allah. Definitely it will have to be compulsory for us to thank ALLAH, who gave us ability to explore the things in the universe .This is only the because of Allahs blessings that I successfully completed this project and PROPHET MUHAMMAD (P.B.U.H) is the source of all kinds of knowledge to me. I would like to express my acknowledgements to Prof. Dr. Muhammad Ali my supervisor and Director, IBT, who helped me a great for the completion of this project. I am very thankful to my supervisor for providing me all the facilities required and for sympathetic and encouraging behavior. I would like to express my deepest gratitude to my husband Dr. Rehan Sadiq Shaikh. It is well known to me that the completion of this project was not possible in any way without his continuous guideline, assistance and inspiration. I also express my gratitude to my teachers Dr. Zahid Mahmood, Dr. Babar, Mr. Shahzad Anjam who always encourage me and help me during lab work. I am thankful to my all class fellows especially Ms Sobia, Ms Nazia, Ms Farah, Ms Sadia, Mr Imran Maqsood for their assistance in the field work as well as in lab work. I am also thankful to my lab fellows for their co-operation. I am also thankful to all the staff members of IBT for their assistance. At the end, I am also thankful to all the volunteers who participate in this study by giving their blood samples. Last but not the least I am also thankful to all my family members especially my parents for their prayers and continuos support. I DEDICATE THIS WORK TO MY LOVELY FAMILY, ESPECIALLY TO MY BETTER HALF.
ASMA SOHAIL
Page | xi
SUMMARY
Breast, cervical and colorectal cancers are among the major health issues all over the world. According to GLOBOCAN 2008 cancer fact sheet it was found that breast cancer is the most common cancer found in the women. Epidemiological figures showed that most of human cancers are mainly caused by environmental exposure to genotoxic agents. Human body constitutes a special mechanism of detoxification against these carcinogens. Glutathione-S-transferases (GSTs), is a group of important enzymes having the basic function of detoxification of several known and assumed carcinogens, including probable breast carcinogens. Research has shown that a substantial proportion of different populations have shown a homozygous deletion (null) of the GSTM1 or GSTT1 gene, resulting in the less production of these isoenzyme. Pakistan being the agricultural and over populated country provides more chances of people to be exposed to the environmental carcinogens and hence there are more chances of them to be effected by diseases like cancer. Studies have shown that GSTM1 and GSTT1 null genotypes are involved in breast cancer so a case control study was conducted, constituting 204 controls and 100 patients of different age groups. A questionnaire was filled having different information of the patients and controls. DNA was collected from blood samples and analysis of the GSTT1 & GSTM1 was performed by using a standard multiplex PCR protocol with some changes to describe the presence or absence of GSTT1 and GSTM1. Results have shown that null genotypes of both the studied gene had no significant role towards breast cancer in our population. Only significant results are obtained with relation to menopause showing that women with menopause are more prone towards breast cancer. Our study also provided the frequency distribution of GSTM1 and GSTT1 in women of southern Punjab (45.7% and 25.98% respectively). This was the first study of its type to be conducted in Pakistan.
Page | xii
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk
INTRODUCTION
Human are exposed to the risk of several diseases and due to which the incidence and death rates are increasing rapidly. Attempts are being made to decrease the incidence of diseases, to minimize the death rates, to enhance the awareness of the people regarding the causes of these diseases and to suggest various types of treatments. With the help of medical research we are able to cure many major diseases but cancer is still considered to be one of the fatal diseases and has become a constant physical and mental agony to a great part of our population. The oncologist, statisticians, and medical research workers all of them are required for their combined effort in diagnosing and analyzing the etiology of cancer and to apply the results for the better health of mankind. Cancer is one of the leading causes of death in U.S. Breast, cervical and colorectal cancers are major health issues in all over the world. According to GLOBOCAN 2008 Cancer Fact Sheet it was found that breast cancer is the most common cancer found in the women. It is estimated that about 23% of all the cancer cases are of breast carcinoma and with this figure it ranks second among all the types. Breast cancer is most prevailing cancer in both the developing and developed regions of the world. Incidence rate fluctuate from 19.3 per 100,000women in Eastern Africa to 89.9 per 100,000 in Western Europe. It is high in developed regions of the world (except for Japan) and low (less than 40/100,000) in under developed regions. As per data of Karachi and Armed Forces Institute of Pathology (AFIP) tumor registries breast carcinoma is among one of the common type of cancer in women of southern and northern Pakistan. 26% and 42% of all malignancies reported during the last decade at AFIP tumor registry and Shaukat Khanum Memorial Cancer Hospital showed to be breast cancer, respectively (Jamal et al. 2006; Bhurgri et al. 2002; Cancer Registry and Data Management, Shaukat Cancer Hospital and Research Center). Breast cancer can be cured if detected at its earliest stage (Dollinger et al. 1991) and for early diagnosis and prevention from it, knowledge regarding its risk factors and genomic profiling is necessary. Major risk factors are categorized as family history of breast cancer, age, hormones (endogenous and exogenous), socio-demographics factors, and diet, biological and environmental factors (Hulka et al. 1995). But the total prevention from this disease is difficult because many associated factors are endogenous and thus difficult to control. Research and epidemiological data show that most of human cancers are mainly caused by the exposure to environmental genotoxic and carcinogenic agents such as Page | 1
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk polycyclic aromatic hydrocarbons (PAHs) found in tobacco, smoke, pesticide and urban air etc. Moreover, incomplete burning of fuels such as gasoline, wood and diesel produce PAHs which are known to form covalent adducts with DNA to cause permanent damage leading to cancer (Guengerich 2003; Peluso et al. 2004; Tariq et al. 2007). Nature has developed a cellular detoxifying system, comprised of Phase I and Phase II enzymes, which protects the cells from DNA damage from various reactive substances. Phase I enzymes (including cytochromeP450) are involved in the biotransformation of PAHs into electrophilic intermediates, which are further detoxified by phase II enzymes, including cytosolic glutathione S transferases (GSTs) (Guengerich 2000, Haydes & Pulford 1995). Glutathione S transferases (GSTs) and glutathione peroxidase (GPx) are cell protective enzymes that alter the action of different exogenous (xenobiotics) and endogenous agents. The conjugation of tripeptide glutathione (GSH) is catalyzed by GSTs to a wide range of endogenous and exogenous chemicals having the electrophilic functional groups (e.g. carcinogens, environmental pollutants and products of oxidative stress), they neutralize their electrophilic sites, and make the products more water-soluble (Haydes & Pulford 1995). On the basis of the immunological cross reactivity and sequence homology, human cytosolic GSTs have been categorized into eight gene families, with each family encoded by a separate gene (Mannervik et al. 1992; Pemble & Taylor 1992; Board et al. 2000). Single nucleotide polymorphisms (SNPs) affecting genes function are commonly observed but complete absence or deletion of a gene in form of a null allele is rarely observed. That is why GSTM1 and GSTT1 null allele (-/-) genotypes have attracted much consideration and over 500 publications on the subject have been published in recent years. Moreover, considering the significance of GSTs in detoxification mechanism of carcinogens, null genotypes of GSTM1 and GSTT1 are expected to weaken the ability to eliminate carcinogenic compounds and may therefore placing individuals with GSTM1 and/or GSTT1 null alleles at higher cancer risk. Previously, studies have shown relationship of GST genotypes with breast, lung, colon, brain, and various other types of cancer in different populations (Rebbeck 1997; Dunning et al. 1999; Landi 2000, Strange et al. 2000; Mohr et al. 2003; Bajpai et al. 2007; Hatagima et al. 2008). Keeping in view the vital role of GSTM1 and GSTT1 in detoxification of carcinogens and availability of no information on these null polymorphisms of GSTM1 and GSTT1 in Pakistani population in relation to breast cancer, we intended to analyze the effect of these null polymorphisms of GSTT1 and GSTM1 in our population. Further link between GSTT1 and GSTM1 null alleles and breast carcinoma have been stated with contradictory results. Therefore, in order to assess the influence of these GSTs genotypes in breast Page | 2
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk carcinoma, we planned to conduct this study for the first in Pakistan. Since Pakistan is a thickly populated agricultural country and Southern Punjab population is highly exposed to pesticides, so analysis of these deletion polymorphisms in GSTM1 and GSTT1 detoxifying enzymes are crucial for us as lack of a helpful detoxification system might prove to be a risk factor for breast carcinoma in our population.
OVERVIEW OF CANCER DISEASE

The term cancer basically depicts disorder of cells and it usually appears as a tumor made up of a mass of cells, the tumor is visible after many years due to the chain of reactions that might have taken place for long. Cancer has been known since human societies first recorded their activities. It was well known to the ancient Egyptians and to succeeding civilizations but, as most cancers develops in the latter decades of life, until the expectation of life began to increase from the middle of the nineteenth century onwards, the number of people surviving to this age was relatively small. Now as infectious diseases, the major causes of death in the past have been controlled by improvements in public health and medical care, the proportion of the population at risk of cancer has increased significantly. Although diseases of the heart and blood vessels are still the main cause of death in our ageing population, cancer is now a major problem. For this reason, cancer avoidance and control are major health issues. History tells us that a German microscopist, Johannes Mueller, about 140 years ago, found that cancers were made up of cells, a discovery which began the search for changes which would help to identify the specific distinction between cancer and normal cells. In the intervening period a huge amount of information has been acquired about the cancer cells. Particularly in the past two decades, rapid scientific progress has allowed us to begin to dissect the cancer genome, transcriptome, and proteome in unparalleled detail and today there seems no limit to the amount of information that can be achieved.
NORMAL CELLS & TISSUES
The human body is comprised of four different main types of tissues: 1. The general supporting tissues jointly known as Mesenchyme. 2. The tissue-specific cells called as Epithelium. 3. The defense cells called as the Haemato-lymphoid system. 4. The Nervous system. The mesenchyme comprised of connective tissue (fibroblasts) which make collagen fibers and associated proteins, bone, cartilage, muscle, blood vessels, and lymphatics. The epithelial cells are the specific, specialized cells of the different organs, for example, liver glands skin, intestine, etc. The haemato-lymphoid system contains a wide group of cells, mostly derived from precursor cells in the bone marrow giving rise to all the red and Page | 3
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk white blood cells. The nervous system is comprised of the central nervous system (spinal cord and the brain) and the peripheral nervous system, which is comprised of nerves leading from these central structures. Thus, each tissue has its own specific cells, usually several different types, which maintain the structure and function of the individual tissue. The specific cells are grouped in organs which have a typical pattern (Fig: 1). There is a layer of epithelium, the tissuespecific cells, separated from the supporting mesenchyme by a semi-permeable basement membrane. The supporting tissues (or stroma) are made up of connective tissue (collagen fibers) and fibroblasts (which make collagen), which may be supported on a layer of muscle and/or bone depending on the organ. Blood vessels, nerves and lymphatic vessels go through the connective tissue and provide nutrients and nervous control among other things for the specific tissue cells.
Figure 1: A typical tissue showing epithelial and mesenchymal components. (Adopted from: Introduction to the cellular and molecular biology of cancer)
CONTROL OF GROWTH IN NORMAL TISSUES
One of the most intensively studied areas in biology is the research on mechanism of control of cell growth and proliferation. It is important to make the distinction between the terms growth and proliferation. Growth refers to an increase in size of a cell, organ, tissue, or tumor and by means of cell division the increase in number of cells is called proliferation. Growth is frequently used as a loose term for both of these processes but the difference is particularly important now that factors controlling both of these processes are becoming obvious. In normal development and growth there is a very defined mechanism that allows individual organs to reach a particular size, which for all practical purposes, is never exceeded. The surviving cells in most organs begin to divide to replace the damaged ones if the tissue gets injured. When normal position is achieved, the process stops, this is the normal control mechanism that persists throughout life. Although most cells in the Page | 4
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk embryo can proliferate, but not all of the adult cells preserve this ability. In most organs there are special stem cells, which have the ability to divide in response to a stimulus such as an injury to replace organ-specific cells. The highly differentiated cells like that of muscle or nerve cells are more likely to have lost their ability to divide. In some organs, particularly the brain, the nerve cells (highly differentiated), can only proliferate in the embryo; while the special supporting cells in the brain continue to be able to proliferate. That is why tumors of nerve cells are only found in the very young and tumors of the brain in adults are derived from the supporting cell Control of organ or tissue size is achieved by means of a fine balance between stimulatory and inhibitory stimuli. When the tissue is damaged and repair is needed, that is when the balance is shifted and a specific physiological stimulus is applied (for example, hormonal stimulation), the component cells may respond in one of two ways to attain these objectives. Either by hypertrophy, that is, an increase in size of individual components, usually of cells which do not normally divide (example is the increase in size of particular muscles in athletes) or by hyperplasia, that is, an increase in number of the cells. When the stimulus is removed, commonly the situation returns to the status quo as shown by the rapid loss of muscle mass in the lapsed athlete. Some of the stimuli resulting in these compensatory responses are well-known growth factors and hormones.
THE CELL CYCLE

All somatic cells increase in numbers in the same way which involves the growth of all cell components (increase in cell mass) followed by division to generate two daughter cells. The cell cycle is comprised of all the structural changes that take place during this process have been known for many years. Four stages are recognized: G1, S, G2, and M (Fig: 2). G1 is a gap or pause after proliferative stimulation where little action occurs. However, if the cell is defined to divide, there is much biochemical activity in G1 for DNA replication (preparation). The second phase S is of DNA synthesis, which is meant for chromosomes replication and increase. G2 is a second gap period following DNA synthesis and thirdly M is the stage of mitosis leading to the breakdown of nuclear membrane and as a result the condensed chromosomes can be visualized as they pair and divide prior to division of the cytoplasm to produce two daughter cells. The last cell cycle phase is recognized, G0, which is a resting phase in which non-cycling cells rest with a G1 DNA content.
Page | 5
Figure 2: Cell Cycle
Progression through the cell cycle is now known to be restricted at specific checkpoints, one in G1 and others in S and G2/M (Fig: 3). These provide a chance for cells to be diverted out of the cycle or to programmed cell death (apoptosis) if, for example, there is DNA damage or inappropriate expression of oncogenic proteins. In many of the cancers interruption of these cell cycle checkpoints or alterations to key cell cycle proteins are found.
THE PROCESS OF TUMOR GROWTH & CARCINOGENESIS

Carcinogenesis is a multistage process. In animals, the exposure to the carcinogen (cancer-producing agent) does not lead to the immediate production of a tumor. Cancers arise after a long latent period and after the multiple carcinogen effects. At least three major stages are involved: 1: The first stage known as initiation, involves mutagenic effects of the carcinogen on skin stem cells. 2: The second stage called promotion is stimulated by type of agents that are not directly carcinogenic in their own right.
Page | 6
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk 3: Finally in the third stage, progression, some of these benign tumors either spontaneously or following additional treatment with carcinogens, progress to malignant tumors. Ample time is required between the initiation and appearance of tumor. In man, it may take over 20 years before tumors develop after exposure to industrial carcinogens. Even in animals it may take up to a quarter or more of the total lifespan before tumors appear. In the tumor that finally observed, most of the genetic and epigenetic changes seen are clonal, that is they are present in the entire population of cells (Fig: 4).
Figure 3: Checkpoints control the ability of the cell to progress through the cycle by determining whether earlier stages have been completed successfully A horizontal red bar indicates the stage at which a checkpoint blocks the cycle.(Adopted from : Genes viii)
Figure 4: Tumor development showing progression from normal to invasive tumor via accumulation of heritable changes over a long period of time. The rate of acquisition of these changes will be influenced by environmental exposures and host response (Adopted from: Introduction to the cellular and molecular biology of cancer).
Page | 7
CLASSIFICATION OF TUMORS
The term tumor cannot be defined in absolute terms. Tumors have the quality that these cells in contrast to the normal cells lack the response to normal control mechanism and hence they show abnormal proliferation. As different factors are concerned with tumor formation, but the abnormal cells may respond to some but not to others. Another complication is that after transforming from normal cells, some of the tumor cells stop their division. So tumors can be classified into three main groups: 1: Benign Tumors which can arise in any tissue and grow locally. Damage is caused by exerting local pressure or obstruction. They have the common character that they dont spread to distant areas. 2: In Situ Tumors, they are usually but not always small in size. They develop in epithelium. Morphologically they resemble cancer cells but they remain in epithelium and do not invade the basement membrane and mesenchyma. 3: Malignant Tumors, they are fully developed cancer and have specific capacity to attack and destroy the underlying mesenchyma layer. These cells produce a range of proteins via the nutrients obtained from blood stream, which stimulate the growth of blood vessels into the tumor thus allowing the continuous growth. The new vessels are not well developed and are easily injured so the invading tumor cells may penetrate these and lymphatic vessels. Tumor fragments may be carried in the newly developed vessels to local lymph nodes or to distant organs where they may grow into secondary tumors. Cancers may arise in any tissue. Although benign tumors can develop into malignant, this is far from invariable. Many benign tumors never become malignant. In order to understand the confusion regarding these definitions we should have the knowledge of the whole process of tumor induction and development.
ETIOLOGY OF CANCER (CAUSES OF CANCERS)

The genetic makeup of mankind barely changes in hundred years and differs somewhat due to geographical locations between human populations. Environmental effects and geographical deviation are responsible for the changes in the individual cancers incidences over time. Mainly Cancers are caused by are chemical, physical, biological (exogenous) carcinogens and endogenous processes (Table 1). They act on every human but due to diversity in humans genetic makeup; differ in their ability to show their results. Secondly because of the social, economic and psychological conditions, different trends are shown by the human towards the exposure to carcinogens.
Page | 8
TABLE 1: TYPES AND EXAMPLES OF HUMAN CARCINOGENS
CHEMICAL CARCINOGENS
Human chemical carcinogenesis is a multistage process that results from exposures, usually in the form of complex chemical mixtures, often encountered in the environment or through our lifestyle and diet ( Poirier et al. 2000) Tobacco smoke is the major example, which causes cancers of the head, neck, lung, and bladder (Peto et al. 2000; Vineis et al. 2001). Most chemical carcinogens do not respond readily to nucleophilic biochemicals, but metabolic processes activate them to carcinogenic and mutagenic electrophiles. Electrophilic chemical species have natural attraction towards nucleophiles like DNA and protein, and they covalently get bonded to deoxyribonucleic acid (DNA) as a result genetic damage occurs. Once carcinogens become the part of the body they are subject to challenge the processes of metabolic activation and detoxification, although some chemical species can act directly. Variation among the human population in these metabolic processes, as well as the capacity for repair of DNA damage and cellular growth control results in inter individual distinction in cancer risk, and is an indication of gene-environment interactions, which embodies the concept the effects of chemical carcinogen exposure is modified due to genetic constitution of individuals (Shields & Harris 2000). For example, among the tobacco smokers only 10% develop lung cancer.
PHYSICAL CARCINOGENS
Energy-rich radiation having different dose and absorption rate, can work like a carcinogen. On the other hand visible light is can't behave carcinogenic, except if absorbed by photosensitizing agents, producing reactive oxygen species. Generally, physical carcinogens constitute: mechanical traumas, electromagnetic radiations of different kinds, low and high temperatures, alpha and beta radiations, solid and gel materials, hard and soft materials, fibrous & non fibrous particles. Physical carcinogens mainly produce effects not because of their chemical properties and actions, rather due to their physical properties and effects. It was found for the first time scientifically by
Page | 9
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk Turner that when Bakelite disks were set in rats, they motivated local fibro sarcomas (Turner 1942). UVA increases the effect of UVB irradiation which is a main carcinogen in the skin. Radiation from industrial, natural, and iatrogenic sources like that of used in X-ray diagnostics penetrates into the body. Its carcinogenicity depends on the amount absorbed, which damages the DNA and cells either directly or by producing reactive oxygen species The amount of radioactive isotopes distributed in the body, determines its effect on that body. For example, radioactive iodine causes only thyroid cancers because it is accumulated in the thyroid gland, while radioactive cesium isotopes deposit mostly the urinary bladder. The probable carcinogenicity caused by microwave and radio wavelength electromagnetic radiation of course is debatable.
BIOLOGICAL CARCINOGENS
Certain viruses and bacteria's are the main biological carcinogens in human. HPV16 and HPV18 are the particular strains of human papilloma viruses which are recognized as the cause of cervical and other genital cancers. Moreover they also manipulate the cancers of the head, neck and the skin. Epstein-Barr virus in lymphomas and Human herpes virus 8 in Kaposi sarcoma behave as carcinogens (Kieff & Rickinson 2001). The viral etiology of infectious hepatitis had been recognized as early as 1885. The hepatitis B virus and hepatitis C virus with their DNA and RNA genome, respectively, are certainly concerned with the cause of liver cancer. HIV the human retrovirus assists the growth of cancers most of the time by hindering the immune system, but on the other hand human T-cell leukemia virus (HTLV1) is the basis of a rare leukemia and it shows the effect by T cells' direct growth stimulation.
ENDOGENOUS PROCESSES
Endogenous processes can also be the main cause of cancers. Carcinogenic compounds such as aromatic amines, nitrosamines, reactive aldehydes and oxygen species and quinones are generated by normal metabolism. Factors like diet or physical activity vary the amount of these potential carcinogens. Several mechanisms like potent protective and detoxification are working for many of these compounds but not perfectly. The risk of cancer growth can be increased by some patho physiological conditions. In particular chronic inflammation in many organs like stomach and colon might be linked with increased risk of cancer. Numerous factors that favor the spread and growth of tumors include secretion of cytokines, growth factors and proteases by different cell types and raised production of reactive oxygen species (mutated) by inflammatory cells. So, regeneration of tissues is generally linked with an elevated risk of cancer. Few of the
Page | 10
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk carcinogens are supposed to act basically by provoking tissue growth and without being mutagenic, rebuild themselves. So we can conclude that both exogenous and endogenous factors are responsible for the development of human tumors. In most of the cancers, their interaction is so complicated that it is difficult to distinguish their contributions. Study of mutations can be helpful in diagnosing the part played by some of the carcinogens. It is estimated that 5% of all human cancers are because of occupational carcinogens.
EPIDEMIOLOGY & TYPES OF CANCERS

Cancer is one of the basic threats to people's health and life, resulting in 13% of all disease-causing deaths in the world (WHO Data & Statistics 2006). In 2007 about 7.6 million people expired of cancer in the world and over 1.4 million new cancer cases each year were accounted in U.S in past years, hence it is reported to be the second leading fatal disease after cardio vascular diseases. According to the records of GLOBOCAN 2008 it was suggested that higher ratio of cancer occurs in under developed regions, both in terms of cancer mortality (63% of cancer casualties) and cancer incidence (56% of new cancer cases diagnosed in low developed areas in 2008) The majority of the prevailing cancers worldwide are lung (12.7% of the total), breast (10.9% of total) and colorectal cancers (9.7% of total). The most fatal cancers are lung (18.2% of the total), stomach (9.7% of total) and liver cancers (9.2% of total). Remarkable differences in the prototype of cancer from area to area are found, like liver and cervix are frequent in under developed regions of the world, on the other hand prostate and colorectal cancers are more reported in developed areas. Cancers can be categorized into three large groups. Those originating from epithelia are known as carcinomas. These are among the widespread cancers overall (Fig: 5). Four carcinomas are worth mentioning with reference to their occurrence as well as mortality i.e. cancers of the lung and the large intestine (both genders), breast cancer in females and prostate cancer in males. Second category of cancers is not as widespread as the above mentioned cancers it includes carcinomas of the stomach, bladder, liver, pancreas, kidney, ovary, cervix and esophagus. They contribute to the less percent of total mortality and incidence of cancers. The most widespread cancers are of the skin. Only melanoma is fatal among them. The third group is of rare cancers including tumors of brain, soft tissues, bone, testes and other organs. They can direct to a noteworthy disease in specific regions and age groups. Example is that of testicular cancer which affects the young adult males having a rate of >1% in Switzerland Page | 11
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk Here are some main types of cancer which lead to overall cancer mortality each year:
Figure 5: World Wide Incidence and Mortality Rate of Most Frequent Cancers among Both Sexes
Page | 12
LEUKEMIA & LYMPHOMAS
These cancers are termed as hematological cancers because they arise from hematopoetic lineage cells. Leukemias initiate from hematopoetic stem cells and spread in the whole body. On the other hand Lymphomas arise from lymphoid cells in lymphoid system and observed as localized cell masses. Hematological cancers can be categorized according to their origin either from erythroid, myeloid, or lymphoid cells or they can be only evident genetic aberration (comprising of chromosome gains and losses, but distinctly translocations).
COLON CANCER
Carcinomas of the rectum and colon are most common cancers in Western industrialized countries. They are one of the lethal cancers and major health problem to the population. Life style factors play an important role in the cause of the disease. Dietary factors are one of the main reasons of disease. The cancer development ranges from hyperplasia, benign adenomas and locally invasive carcinoma to systemic metastatic disease. Colon cancer also spreads as a result of the chronic inflammatory bowel diseases like that of ulcerative colitis.
WILMS TUMOR (NEPHROBLASTOMA)
Wilms' tumor is also known as nephroblastoma. It is the most common kidney tumor in children and is linked to various syndromes and hereditary anomalies. A lot of research done in molecular biology and genetics has helped to increase our knowledge about this disease, and side by side paving the way to discover the genes playing critical role in cancerous process. Genetically the disease is heterogeneous and occurs rarely in 1:10,000 children, but it occurs more in patients with syndromes disturbing genitourinary tract development such as the WAGR, Denys-Drash, and Beckwith- Wiedemann syndromes.
CANCERS OF SKIN
The skin being the largest organ is the most common site for cancers development in humans. Fair-skinned individuals are at about 40% of more risk to develop skin cancer. Epidermis of the skin is an actively proliferating tissue due to which apoptosis-like event are often found, as seen in the falling off of hair follicles (Sieberg et al. 1995; Lindner et al. 1997) and in terminal differentiation (McCall & Cohen 1991; Haake & Polakowska 1993; Polakowska et al. 1994). When the epidermis is exposed to UVB, sun burn cells are frequently observed. They have apoptotic quality of condensed nuclei (Young 1987; Schwarz et al. 1995). When the body fails to repair this DNA damage, or fails to remove the damaged cells by apoptosis, toxic mutations are replicated as a consequence and it may lead to skin carcinogenesis (Griffiths et al. 1998). Other factors involved are genetic disposition, immune response and viral infections such as HPV (Proby et al. 1996). Types Page | 13
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk of the skin cancers are squamous cell carcinoma, basal cell carcinoma (both are rarely life threatening and common) and melanoma which is rare but increasing alarmingly.
BLADDER CANCER
Another name for bladder cancer is urothelial cancer. Factors often involved are chemical carcinogens (mainly aromatic amines). Genetic polymorphisms in carcinogen metabolism genes alter risk of bladder cancer depending on exposure, while no high-risk is evaluated showing it heritable predisposition. Urothelial cancers grow successively at different sites. Important factors involved are true oligoclonality, spreading through urine and migration of cancer cells within the epithelium.
RENAL CELL CARCINOMA
Renal cell cancer (RCC) consists of highly heterogeneous epithelial tumors both clinically and morphologically. They have the same origin of the renal tubule, having similar antigenic phenotype, but they differ in genetic mutations. A number of factors are reported and associated with elevated risk for example cellular, genetic, dietary, hormonal and environmental factors while etiology of RCC is still not known. It is the most widespread malignant tumor of the kidney, representing 85% all primary renal neoplasm in elders. RCC is diagnosed more in males than in females and rarely it occurs in adolescents and children. Geographical or ethnic preference is not observed (Muphy et al. 1994; Motzer et al. 1996).
LIVER CANCER
Liver cancer is one of the major fatal malignancies all over the world. Hepatocellular carcinoma is its subtype which is derived from hepatocytes which are the predominant epithelial type of cells in the liver. It is due to the chronic inflammation and liver cirrhosis caused by the hepatitis viruses HCV or HBV, by chronic alcohol use, or rarely by hereditary diseases like hemochromatosis. Chemical carcinogens like aflatoxin B1 obtained from the mold Aspergillus flavus which activate the causes of inflammation, in particular with chronic HBV infection is also one of the factors.
STOMACH CANCER
Stomach cancer due to its low healing tendency and severe effect on quality of life, causes a serious health problem. For several decades its incidence is decreasing in many industrialized states fortunately. Altered diet, improved hygiene and extensive use of antibiotics reducing the prevalence of Helicobacter pylori infection are responsible for the reduction of this dilemma. Most of the cases of stomach cancer are associated with Helicobacter Pylori infection. About 50% of the world population hold strains of the bacterium, but <10% grow inflammatory disease and ulcers, and even fewer stomach cancer. Page | 14
PROSTATE CANCER
Prostate cancer is clinically noteworthy in about 10% of males in Western countries. It is age related, rare in younger males, and its incidence increases with age. Clinically it varies from minor tumors growing slowly for many years to chronic cancers spreading locally and effecting the bones and organs leading to the death in few years. Androgens and the androgen receptor (AR) have represented as major tool for treatment purposes. Prostate cancers when treated with androgen receptor and depletion respond well. Genes involved in ancestral prostate cancer are not same as classical tumor suppressors. Risk of the prostate cancer is altered by the polymorphisms of the genes which are involved in nucleotide metabolism, to hormone metabolism and action and cell protection.
BREAST CANCER
Breast cancer is one of the frequent ailment in women of developed and under developed countries and it deals with the malignant tumor developed from cells in the breast (Parkin et al. 2005). Besides being fatal disease, it affects the womens quality of life and society at large with reference to economic burden, such as premature death and reduced productivity. The usual 5-year rate of survival for breast cancer in developing and developed countries is 57% and 73% respectively (IARC Handbook on Cancer Prevention). As a result of better techniques and awareness regarding the diagnosis and treatment, in developed countries the breast cancer (age adjusted) death rate has declined and unluckily due to lack of public and professional knowledge, attitudes and practice, it is higher in under developed countries (Wilson et al. 2004). Studies have shown that most cases are found in postmenopausal women, but a large number of younger women are also seen affected, mostly in families having hereditary tendency. The risk of breast cancer is about 10% for females, and almost 30% of all the cases prove to be fatal. When talking about the Western countries, 50 yrs is the mean age at menopause, all women between 45 and 55 have to face menopause. In women between 40-60 years of age, breast cancer is the common fatal disease. Its incidence rate is rising in many countries. Incidence rate of breast cancer ranges from 19.3/100,000 females belonging to Eastern Africa to 89.9/100,000 in Western Europe and except for Japan its high in other developed areas and its rate is low in less developed areas about 40/100,000 women. Due to the survival of breast cancer patients in developed regions because of early diagnosis and public awareness, the range of mortality rates is much less (Fig: 5). Among the Asian populations, Pakistan has the highest rate of breast cancer accounting to 40,000 deaths per year. It is estimated that 1 in 9 of Pakistani women will Page | 15
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk suffer from this disease at age in their lives. In Pakistan due to the lack of awareness most of the times the cases are reported at a very complex stage (Sadiqui 2006). If breast cancer is diagnosed at early stage than the chances of survival of patient are almost 90%. Its incidence has been increasing alarmingly, due to the area, community, socio-economic conditions, life-style, hereditary factors, especially eating habits. In Pakistan the peak age range of breast cancer onset is between 35- 50 years, about 10 years earlier than in Western populations. 20% of all breast cancer cases are diagnosed in women less than 40 years of age in Pakistan (Bhurgri et al. 2007). Hence it is important to screen the young women for breast as a prime need of time. The studies reported that Asian women are highly at risk to breast cancer, and therefore the genetic constitution that may influence young Pakistanis women towards breast cancer needs to be explored The types of breast cancer include invasive ductal carcinoma (IDC), ductal carcinoma in situ (DCIS), invasive lobular carcinoma (ILC), male breast cancer, inflammatory breast cancer, metastatic breast cancer, recurrent breast cancer, and more. Generally breast cancer either initiates in the lobular cells, which are the milk-producing glands, or the passages that drain milk from the lobules to the nipple. Rarely it can initiate in the stromal tissues, including the fatty and fibrous connective tissues of the breast. As the time passes, cancer cells attack healthy breast tissue making their way into the underarm lymph nodes. Once they enter the lymph nodes, then they can extend into other parts of the body. The stages of breast cancer refer to how far the cancer cells have spread beyond the original tumor (Table 2).
TABLE 2: STAGES OF BREAST CANCER
STAGE
STAGE 0 STAGE I STAGE IIA
DEFINITION
STAGE IIB
STAGE IIIA
Cancer cells remain within the breast duct, it is not spread to normal adjacent breast tissue. Cancer is 2 cm or less and is restricted to the breast (lymph nodes are not affected). Cancer cells are diagnosed in axillary lymph nodes (under arm), tumor is not found in breast. OR the tumor size is less than or equal to 2cm and has spread to the axillary lymph nodes. OR the tumor size is 2-5cm and has not spread to the axillary lymph nodes. The tumor is 2-5cm big and has spread to the axillary lymph nodes. OR the tumor size is greater than 5 centimeters but has not spread to the axillary lymph nodes. No tumor is found in the breast. Cancer is found in axillary lymph nodes that are sticking together or to other structures, or cancer may be found in lymph nodes near the breastbone. OR the tumor is any size. Cancer has spread to the axillary lymph nodes, which are sticking together or to other structures, or cancer may be found in lymph nodes near the breastbone. Page | 16
STAGE IIIB
STAGE IIIC
STAGE IV
The tumor may be any size and has spread to the chest wall and/or skin of the breast. AND may have spread to axillary lymph nodes that are clumped together or sticking to other structures or cancer may have spread to lymph nodes near the breastbone. Inflammatory breast cancer is considered at least stage IIIB. There may either be no sign of cancer in the breast or a tumor may be any size and may have spread to the chest wall and/or the skin of the breast. AND the cancer has spread to lymph nodes either above or below the collarbone. AND the cancer may have spread to axillary lymph nodes or to lymph nodes near the breastbone. The cancer has spread or metastasized to other parts of the body.
ETIOLOGY OF BREAST CANCER

A risk factor is anything that increases your risk of developing breast cancer. Many of the most important risk factors for breast cancer are beyond your control, such as age, family history, and medical history. However, there are some risk factors you can control, such as weight, physical activity, and alcohol consumption.
FACTORS UNDER OUR CONTROL
Weight: Increased weight is linked with elevated risk of breast cancer especially on post menopausal women. The ovaries discontinue the production of estrogen hormone after menopause, so the fatty tissues are the only source of that hormone. Increased deposition of fatty tissues means higher level of estrogen and hence increased risk of breast cancer. Diet: Although diet is known to be involved in several cancer types including breast cancer, but still research has not proved the type of the risky food involved in the occurrence of cancer. We should control the usage of red meat, animal fats including dairy fats in milk, ice cream and cheese, as they may have certain hormones or other growth factors which influence cancer. Some studies have reported that increased consumption of cholesterol and other fats have proved to be the risk factors for cancer, while few researchers have shown that too much use of red/processed meats is linked with elevated breast cancer risk. Exercise: It has been proven that exercise can play a vital role in reducing the risk of breast cancer. The American Cancer Society recommends that one should engage him/herself in 45-60 minutes of physical exercise for at least 5 or more days a week. Alcohol Consumption: It has been reported in studies that alcohol consumption is associated with increased breast cancer risk in women. As alcohol has the ability to Alcohol can limit your livers ability to control blood levels of the hormone estrogen, which in turn can increase risk.
Page | 17
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk Smoking: Few studies have shown the association of smoking with the increased breast cancer risk. Exposure to Estrogen and Oral Contraceptives: Breast cell growth is stimulated by the estrogen hormone; more exposure to estrogen for long periods increases the risk of having breast cancer. When oral contraceptives are used by the women the risk is slightly increased but if she has stopped taking the pills for more than 10 years the risk is almost diminished.
FACTORS WHICH CANT BE CONTROLED
Gender: Among the most significant risk factors linked with breast cancer is being a female. Though we can also find a minute ratio of breast cancer in males also but due to the activity of estrogen and progesterone hormones in women, the breast cell are under constant change, this leads them towards the higher risk of having the breast carcinoma. Age: Aging is another uncontrollable risk factor for mammary tumor. The risk is 0.43% in the age ranging between 30-39 years, while it increases to almost 4% when the age reaches 60. Family History of Breast Cancer: A woman is at higher risk of breast cancer if she has a first degree relative (mother, daughter, sister) or multiple relatives suffering from either breast or ovarian cancer. Race: Fair women are slightly more likely to develop breast cancer than are African American women. Hispanic, Native American and Asian women have a lower risk of developing and dying from breast cancer. Radiation Therapy: If someone has exposed to radiations especially to the chest area as a child or adolescent, is more prone towards breast cancer. The risk increases when the developing breasts are exposed to radiations for any other treatment. Pregnancy and Breast Feeding: Breast feeding and pregnancy is known to be negatively associated with breast carcinoma risk. Women getting pregnant after 30 years of age or never having any pregnancy are at higher risk for breast cancer. Breast feeding for 1.5-2years lowers the chances of getting breast cancer.
ROLE OF DIFFERENT GENES IN BREAST CARCINOGENESIS

A cycle of genetic mutational actions that begin in a single cell are supposed to be responsible for the development of breast cancer. Initially the number of normal cell is increased by increased cell proliferation, then it is followed by additional mutations which allow development of hyperplasia, dysplasia, carcinoma and ultimately, metastatic disease. It is anticipated that 510% of all mammary tumor cases are inherited, and the possibly associated genes i.e. BRCA1 and BRCA2 are responsible for about 21-40% of the cases. Rests of the cases are sporadic and among them 70% of breast tumors are PR, ER Page | 18
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk and/or HER /neu positive. Genetic composition of every individual is responsible for the wide variation in behavior and growth of cancer cells. The genes involved in the breast carcinogenesis can be divided into four classes. These are: (1) DNA repair genes (2) carcinogen metabolism genes (3) tumor suppressor genes and (4) Proto-oncogenes
TUMOR SUPPRESSOR GENES
Tumor Suppressor Genes are highly diverse and categorized as gate keepers because they directly regulate the cell growth (RB1) or can be called as care takers as they are responsible for the repair of DNA damage and maintenance of cell integrity (BRCA1/2). When both alleles of the gene loss their function, the risk of cancer is increased. Breast cancer is basically due to the genetic changes of normal cells which include either the loss of heterzygosity or the point mutations. On the other hand not only the mutations but the mechanisms such as methylation also interfere with the normal functioning of cell. Mechanism of methylation is supposed to be the first step in carcinogenesis process resulting in the silencing and activation of tumor suppressor genes and oncogenes respectively and promoting the growth of abnormal cells. Inherited genetic mutations of tumor suppressor genes involved in most common hereditary cancer syndromes which are also associated in breast cancer are described in the Table 3.
TABLE 3: TUMOR SUPPRESSOR GENES: THEIR ROLE AND CHROMOSOMAL LOCATION
Page | 19
PROTO-ONCOGENES
Proto-oncogenes basically promote cell division. Any genetic modification in them can cause the proliferation of cells resulting in the growth of tumor. These mutant forms of proto-oncogenes are known as oncogenes which are responsible for the induced or continued uncontrolled cell division. Some of these genes are given in Table 4.
DNA REPAIR GENE
The process by which a cell identifies and corrects damage to the DNA molecules is referred to as DNA repair. Deficient function of DNA repair enzymes as a result of the polymorphism of the DNA repair genes has been inconsistently associated with the risk of familial breast cancer. Some the genes involved in DNA repair are listed in the Table 5.
TABLE 4: PROTO-ONCOGENE: FUNCTION AND CHROMOSOMAL LOCATION
TABLE 5: FUNCTIONS AND CHROMOSOMAL LOCATION OF DNA REPAIR GENES.
Page | 20
CARCINOGEN METABOLISM GENES
These are of two types, firstly that who activate the carcinogens efficiently and gets them into the cell like that of genes of phase I enzymes and secondly the ones which are involved in the detoxification of carcinogens such as the genes for phase II enzymes some of them are described in Table 6.
CELL PROTECTION MECHANISMS IN CANCER

Specific cellular protections mechanisms (complex system of detoxification enzymes) are involved in preventing the DNA from encountering the exogenous carcinogens (xenobiotics) and potential mutagens arising from endogenous processes. These highly diverse mechanisms serve as a further stage of cancer avoidance in addition to DNA repair and apoptosis. They not only protect DNA, but cells in general from damage. When talking about cancer, they are particularly important during carcinogenesis and cancer therapy. This system is very complex showing variability in different individuals and is extremely responsive to the individual's lifestyle, environment and the genetic makeup. Detoxification is a chain of reactions involving methylation, conjugation and sulfonation.
TABLE 6: CARCINOGEN METABOLISM GENES: FUNCTION AND CHROMOSOMAL LOCATION
ENZYME SYSTEMS INVOLVED IN DETOXIFICATION
A set of enzymes is being used by the body having broad specificity to meet the challenge of detoxification. At present, about 10 families of Phase I enzymes have been
Page | 21
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk discovered including at least 35 different genes. Phase II reactions also involve multiple gene families and are equally difficult to understand (Fig: 6). The Phase I Detoxification System: Cytochrome P450 supergene family of enzymes is the basic member of this system, and the first enzymatic defense against foreign compounds. Most of the medications and carcinogens are metabolized by the process of Phase I biotransformation. Oxygen and NADH is being used as a cofactor by cytochrome P450 in a typical phase I reaction, to add a reactive group, such as a hydroxyl radical. This step leads to the production of those reactive molecules which are more toxic than the parent compound, and if these are not further treated by the phase II conjugation can cause damage to DNA, RNA and proteins within the cell (Vermeulen 1996). Cyp1A1, Cyp3A4, Cyp1A2, Cyp2C and Cyp2D6 are the main P450 enzymes involved in metabolism of drugs or exogenous toxins (Fig: 7). The amount of these enzymes presents in liver show the importance in the metabolism of different drugs (Vermeulen 1996; Iarbovic et al. 1997; Benet et al. 1996)
Figure 6: Liver Detoxification Pathways & Supportive Nutrients
It has been proved by several studies that there lies an association between the induced phase I and/or decreased Phase II activities and elevated risk of ailments such as Parkinson's disease, cancer and systemic lupus erythematosus (Meyer et al. 1990; Ritchie et al. 1980; Daly et al. 1993; Kawajiri et al. 1990; Nebert et al. 1991; Bandmann et al. Page | 22
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk 1997). Adverse drug responses have also been reported due to compromised Phase I and/or PhaseII activity (Meyer et al. 1990; Iarbovic et al. 1997; Lee. 1995). The Phase II Detoxification System: Phase I activation is followed by the phase II conjugation reactions, which converts the reactive molecule formed in phase I reaction to a water-soluble compound which can be excreted out of body through urine or bile. Sulfation, glucuronidation, glutathione and amino acid conjugation are among the types of conjugation reactions which are present in the body (Fig: 8). Cofactors are required for these reactions which must be replenished through dietary sources.
REGULATION OF DETOXIFICATION ACTIVITIES
Specific detoxification pathways may be induced or inhibited depending on various factors including the genetic polymorphisms, age, gender, dietary habits, and life style habits like smoking, environment and diseases (Meyer et al. 1990; Benet et al. 1996; Park et al. 1996; Vesell 1979; Goldberg 1996; Guengerich 1995).
Figure 7: Cytochrome P450 in Human Liver
INDUCTION
When a high xenobiotic load is faced by the body, the detoxification mechanism can be fastened by the induction of phase I and/or phase II enzymes. Inducers can be monofunctional or multi-functional (Fig: 9). Mono-functional inducers only affect one enzyme or one phase of detoxification while a multi-functional inducer affects multiple activities (Park et al. 1996). Page | 23
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk Induction of the Cyp1A1 and Cyp1A2 enzymes is done by mono-functional inducers, leading to a substantial increase in phase I action such as polycyclic hydrocarbons from cigarette smoke and aryl amines from charbroiled meats, and with little or no effect on phase II activity (Kall & Clausen 1995; Joeres et al. 1988; Parsons & Neims 1978; Smith & Yang 1994; Guengerich 1984). Initiation of Phase I enzymes activities without coinduction of Phase II enzymes activities results in the disconnection of the Phase I and Phase II balance of activity. As a result, reactive intermediates are produced in large amounts, leading to the injury to DNA, RNA, and proteins (Elangovan et al. 1994). Multifunctional inducers can be produced by the flavonoid molecules found in fruits and vegetables. For example, ellagic acid present in garlic oil, red grape skin, rosemary, cabbage, soy and brussels sprouts all contain compounds responsible for the induction several Phase II enzymes and reduction of Phase I activity (Manson et al. 1997; Barch et al. 1994; Barch et al. 1995; Pantuck et al. 1979; Offord et al. 1995; Ip & Lisk 1997; Appelt & Reicks 1997). The enzymes glutathione S-transferase and glucuronyl transferases are commonly stimulated by multi-functional inducers. The increase n the amount of these enzymes is a healthy sign for better detoxification in an individual and this increase also helps in maintainence of a balance among the activities of both phases. That is why it is reported in several studies that fruits and vegetables can perform the specific role to protect various cancers.
Figure 8: Major Phase II Detoxification Activities in Humans
Page | 24
Figure 9: Mono & Multi Functional Inducers
INHIBITION
Whenever a competition is arose between two or more compounds for the same enzyme for detoxification, inhibition can take place. Increased noxious load leads to inhibition of detoxification of a number of compounds by devastating the systems and competing for detoxification enzyme activities. Moreover, a few compounds selectively inhibit only one detoxifying activity; for example Cimetidine is a compound that attaches directly to the heme iron of the cytochrome P450 reactive site and slows down all cytochrome- dependent Phase I enzyme activities (Benet et al. 1996). The reduction of necessary cofactors is a common mechanism of inhibition for phase II enzymes. Sulfation is more prone towards inhibition due to compromised cofactor status in humans. Concentration of serum sulfate in the body is maintained by the balance between absorption of inorganic sulfate and its production from cysteine, and its excretion by urination and insertion into low molecular weight substrates of sulfation. Its amount varies in humans throughout 24 hours (Levy & Yamada 1971; Slattery et al. 1987). Humans excrete about 20-25 mm of sulfate in 24 hours; so balance of sulfate reserves should be maintained through dietary intake of sulfur containing amino acids or inorganic sulfate.
EFFECT OF POLYMORPHISMS
Variations in the genetic makeup of an individual to metabolize the toxic compounds are associated with the presence of genetic polymorphisms. Cyp2D6 is the key example showing the effect of genetic polymorphism on phenotype. This gene exists in several forms in different populations. Some people have slow Cyp2D6 activity and hence are Page | 25
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk slow metabolizer and don't detoxify the carcinogens as fast as the persons with faster acting enzyme. Another example is of polymorphism in N-acetyltranferases leading to slow metabolism through its pathway and hence proved to be a risk factor for some types of cancers and parkinson's disease (Meyer et al. 1990; Daly et al. 1993; Bandmann et al. 1997). Detoxification enzyme's activity and expression are also affected by other factors like that of age, sex and hormones. Examples related to influence of hormones on detoxifying enzymes is of Cyp3A, which is sensitive to hormones, similarly 30-40% more Cyp3A activity is shown by premenopausal women than postmenopausal or men (Wacher et al. 1995; Gustavson & Benet 1994; Maurel 1996). Health status of an individual also influences the detoxification mechanism. Liver is an organ responsible for major detoxification activities, so if it is not functioning properly due to any liver disease such as biliary cirrhosis, hepatocellular carcinoma etc, the detoxification activity is slowed down (Lee 1995; Benet et al. 1996).
GLUTATHIONE CONJUGATION
Glutathione is known as a defensive compound within the body for the elimination of potentially toxic electrophillic compounds. Many pharmaceuticals either are, or can be metabolized by phase I reactions to, strong electrophiles, and these in turn react with glutathione to form non-toxic conjugates generally. The compounds conjugated to glutathione include epoxides, haloalkanes, nitroalkanes, alkenes, and aromatic halo-and nitro-compounds. The enzymes working as catalysts of above reactions are the glutathione-S-transferases which are found in the cytosol of liver, kidney, gut and other tissues. The glutathione conjugates may be excreted directly in urine, or more usually bile. The tripeptide glutathione (GlyCysGlu), when attached to the acceptor molecule, is attacked by a glutamyl transpeptidase & peptidase, which helps in removing the glutamate and glycine respectively, and as a result the cysteine conjugate of xenobiotic is formed. Afterwards the N-Acetylation of the cysteine conjugate occurs by the normal Nacetylation pathway to produce the N-acetylcysteine conjugate or mercapturic acid. The glycylcysteine and cysteine conjugates and the mercapturic acids all are found in excretion products.
GLUTATHIONE-S-TRANSFERASES
Glutathione S-transferases (GSTs) constitute a super family of omnipresent, multifunctional enzymes, which play a vital role in cellular detoxification mechanisms, and protect macromolecules from attack by reactive electrophiles (Strange et al. 2001). Page | 26
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk Glutathione S transferases (GSTs) and glutathione peroxidase (GPx) are cell protective enzymes that alter the action of different exogenous (xenobiotics) and endogenous agents (Fig: 10). The conjugation of tripeptide glutathione (GSH) is catalyzed by GSTs to a wide range of endogenous and exogenous chemicals having the electrophilic functional groups (e.g. carcinogens, environmental pollutants and products of oxidative stress), they neutralize their electrophilic sites, and make the products more water-soluble (Haydes & Pulford 1995). Human cytosolic GSTs have been grouped into eight gene families: GST- alpha (GST), GST-mu (GST- or GSTM),GST- pi (GST-), GST-theta (GST- or GSTT), GSTzeta (GST-),GST-sigma (GST-), GST-kappa (GST-) and GST- omega (GST-) , with each family encoded by a separate gene based on sequence homology and immunological cross reactivity (Mannervik et al. 1992; Pemble & Taylor 1992; Board et al. 2000).
Figure 10: 3D Structure of Glutathione S-Transferase
All the genes present in GSTs super family have probably begun from the same precursor. On the other hand all the forms are diverse and specified from each other due to the gene recombination, duplication and accumulation of mutations. As the GSTs have a very vital role in the process of detoxification of xenobiotics, therefore because of their genetic variation the scientist have been attracted towards them and several studies have been conducted to observe their association with cancer risk. Various studies have shown relationship of GST genotypes with lung, breast, brain, colon and various other types of cancer (Rebbeck 1997; Dunning et al. 1999; Landi 2000). GSTM1 and GSTT1 are the most commonly examined genes so we will discuss them in detail only.
Page | 27
GSTM ()
The sub family GSTM is subfamily is represented by a 100Kb gene cluster at chromosomal site 1p13.3 arranged as 5'-GSTM4-GSTM2-GSTM1-GSTM5- GSTM3-3' (Pearson et al. 1993; Xu et al. 1998). Both the allels are affected when the gene is deleted, which results in the null genotype, GSTM1-/-. When the detailed mapping is studied, it was found that GSTM gene is flanked by two almost alike 4.2-kb regions (Fig: 11). Homologous recombination involving the left and right 4.2-kb repeats is responsible for the GSTM1 null genotype (Xu et al. 1998). Similarly a missense SNP also occurs in the GSTM1 gene, i.e. nucleotide 534 G/C (172 Lys/ Asn, resulting to GSTM1*A and GSTM1*B, respectively), which does not appear to affect the enzyme function (Widersten et al. 1991). Numerous studies have analyzed the GSTM1 genotype using a PCR-based assay designed to identify the wild-type allele of GSTM1 (Seidegard et al. 1988).
Figure 11: The GSTM1 gene is part of the Mu-class GST gene cluster at 1p13.3, which is arranged as 5`-GSTM4-GSTM2-GSTM1-GSTM5-GSTM3-3` (top of diagram). The GSTM1 gene (black box) consists of 8 exons, which range in size from 36 to 112 bp, while the introns vary from 87 to 2641 bp. GSTM1 is embedded in a region with extensive homologies and flanked by two almost identical 4.2-kb regions (gray boxes). The GSTM1 null allele arises by homologous recombination of the left and right 4.2-kb repeats, which results in a 16-kb deletion containing the entire GSTM1 gene (bottom of diagram). The point of deletion cannot be precisely localized because of the high sequence identity between the repeats. (Adopted from: Mini review on GST genotypes and cancer risk by Fritz F.Parl)
GSTT ()
Two genes GSTT1 and GSTT2 are present in GSTT subfamily, which are positioned at chromosomal site 22q11.2 and distance between them is about 50 kb (Landi et al. 2000; Coggan et al. 1998; Whittington et al. 1999). Both genes consist of five exons with the same intron/exon boundaries but share only 55% amino acid identity (Fig: 12). It has been reported that about 20% of Caucasians are homozygous for a GSTT1 null allele (GSTT1-/). The GSTT1 null genotype is more common in Asians, with frequencies 47-64% (Grate et al. 2001; Nelson et al. 1995).
Page | 28
Figure 12: The GSTT1 gene is part of the Theta-class GST gene cluster at 22q11.2 (top of diagram). GSTT1 and GSTT2 are separated by approximately 50 kb. GSTT2 lies head-to-head with a gene encoding the D-dopachrome tautomerase (DDCT). The GSTT2 and DDCT genes have been duplicated in an inverted repeat. The duplicated GSTT2 is a pseudogene (named GSTT2P) because an abnormal exon 2/intron 2 splice site causes a premature translation stop. The GSTT1 gene (black box) consists of five exons, which range in size from 88 to 195 bp, while the introns vary from 205 to 2363 bp. The GSTT1 gene is embedded in a region with extensive homologies and flanked by two 18 kb regions, HA3 and HA5 (gray boxes), which are more than 90% homologous. In their central portions HA3 and HA5 share a 403-bp sequence with 100%identity. (Adopted from: Mini review on GST genotypes and cancer risk by Fritz F.Parl)
The GSTT1-/- deletion similar to GSTM1-/- is probably due to a homologous recombination event involving the left and right 403-bp repeats. Similar to GSTM1, numerous studies of the GSTT1 genotype employed a PCR-based analysis that identified the wild-type allele (Pemble et al. 1994).
GST GENOTYPES & CANCER RISK

Carcinogen metabolism genes are commonly affected by the single nucleotide polymorphisms (SNPs). The complete deletion of a gene in form of a null genotype is rare. That is why GSTM1 and GSTT1 null genotypes have attracted so many concerns of scientists and become the spotlight in more than 500 publications in the field molecular epidemiology. Basically all the studies are conducted on the hypothesis that the activity of GST enzymes either normal or increased is responsible for defending the susceptible cells from DNA mutations by the attack of electrophilic carcinogens with the help of detoxification mechanism. So because of their active role in the detoxification mechanism, the homozygous deletions of both GSTT1 and GSTM1 are expected to have disability to eliminate the carcinogens from the body therefore placing the persons with GSTM1 and GSTT1 Null genotypes at higher cancer risk. It is well known that GSTs have overlapping substrate specificities therefore deficiency of an individual GST iso enzyme is supposed to be compensated by other isoforms. This is the reason that assessment of all GST genotypes is a basic requisite for reliable analysis of the role of the GSTs in cancer growth. A number of molecular studies Page | 29
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk have reported the association between genotypes of one, two, or three GST subtypes and breast carcinoma risk (Dunning et al. 1999; Mitrunen et al. 2001,). Nothing can be concluded on the results obtained. An association among GSTs and cancer if found in one study is negated by the other studies (Ambrosone et al. 1995; Kelsey et al. 1997; Bailey et al. 1998; Coughlin et al. 1999; Garcia-Closas et al. 1999; Zhao et al. 2001). The differences in results of these studies may be because of the variations among the studied populations and the exposure of the individuals to different environmental and dietary factors. GSTM1 and GSTT1 are not truly genotyped in any of the previous studies. Roodi et al. and Sprenger et al. described the positive identification of the wild-type and null alleles for GSTM1 and GSTT1 respectively, which allowed the exact explanation of the -/, +/+ and +/- genotypes and diversity among low, high and none conjugator phenotypes. Associations between GSTM1 and GSTT1 null genotypes and breast cancer have been reported with inconsistent results (Gudmundsdottir et al. 2001; Helzlsouer et al. 1998; Mitrunen et al. 2001, Millikan et al. 2000) Therefore; we planned to conduct this study for the first time in Pakistan to evaluate the influence of these GST genotypes in breast cancer susceptibility in Pakistani population.
Page | 30
MATERIAL AND METHODS

The proposed study was conducted according to the work plan essentially divided into two phases and further sub divided as depicted below:
ANALYSIS OF GSTT1 AND GSTM1 NULL ALLELES FIELD WORK A)APPROVAL OF STUDY FROM INSTITUTIONAL REVIEW BOARD. B)IDENTIFICATION AND ENROLLMENT OF SUBJECTS C)COLLECTION OF BLOOD SAMPLES BENCH WORK A) DNA EXTRACTION B)QUANTIFICATION OF DNA C)ANALYSIS OF GSTT1 AND GSTM1 NULL ALLELES BY MULTIPLEX PCR
FIELD WORK
INSTITUTIONAL REVIEW BOARD (IRB)
Approval for this study was obtained from the Institutional Review Board (IRB) of Institute of Biotechnology, Bahauddin Zakariya University, Multan. Informed consent forms had been designed containing risks, facts and discomforts that might be anticipated to influence an individuals willingness to participate as a volunteer in a research project.
ENROLMENT OF SUBJECTS
The present study consisted of 100 case subjects (females) with pathologically confirmed breast cancer that were recruited from Department of Radiology and Oncology, Nishter Hospital, Multan. A total of 204 healthy volunteer females were included in the study as controls samples. The volunteers that took part in this study belong to Multan, Layyah, and D. G Khan and Rajanpur areas of Southern Punjab (Pakistan) belonging to different ethnic groups, and age ranges. The nature and purposes of this study were presented to all the subjects and a proper informed consent was obtained from them. Each subject (patients and controls) was asked to provide information regarding age, marital status, menopause, age at menopause, smoking status, family history of cancer, pregnancies, nature of work etc.
COLLECTION OF BLOOD SAMPLES
Blood sampling of controls samples was performed during May to August, 2009 and that of case samples from May, 2009 to March, 2010 visiting Department of Radiotherapy and Oncology, Nishter Hospital, from different areas of the Southern Punjab. 5ml of blood from all subjects was collected using sterilized disposable syringes in 15 ml Sterilin falcon tubes having 400l EDTA (Ethylene Diamine Tetra Acetic Acid) as anticoagulant, stored at -70C till further processing.
Page | 31
BENCH WORK
DNA EXTRACTION
The genomic DNA was extracted by using a standardized non organic method (Grimberg et al. 1989). With this method, DNA was extracted from white blood cells (WBC) because the white blood cells are the only blood cells which are nucleated. The protocol for DNA extraction is as follows: In 15 ml Sterilin falcon tubes, 3-5 ml blood samples were collected containing 400l of 0.5 M EDTA. Samples were freezed at -70C for at least 20-30 minutes before processing. Samples can also be stored at -20C for long duration. The blood samples were thawed before processing to lyses the red blood cells (RBC). TE buffer (10 mM Tris Hcl, 2mM EDTA, pH8.0) was added to fill the falcon tubes volume for washing of blood samples. Samples were centrifuged at 3000 rpm for 20 minutes and supernatant was discarded for washing out lysed RBCs. Washing was repeated three to four times till the white blood cells are free of hemoglobin and pellet appears whitish . Proteins in the pellets of WBC were digested by adding the 0.5 mg of proteinase k along with 200l of SDS buffer in the presence of 6 ml TNE buffer (10mM Tris HCl, 2mM EDTA, 400mM NaCl). Samples were left in shaking water bath for overnight at 37C and at a speed of 250rpm. By this, mixing takes place and ultimately proteins digested. These digested proteins can be precipitated by adding 1ml of supersaturated NaCl, followed by vigorous shaking and chilling on ice for 15 minutes and then centrifuged at 2400 rpm. Supernatant is shifted to another Sterilin falcon tube and DNA was extracted from the supernatant by adding equal volume of Isopropanol. Wash the DNA pellet with freshly prepared 70% ethanol. Dissolved the DNA in TE (10mM Tris HCl, 2m M EDTA) buffer and heat it on 70C for one hour in water bath. By this any remaining nucleases and proteins inactivated. DNA can be stored at-20C for long time.
QUANTIFICATION OF DNA
Concentration of DNA was measured using Spectrophotometer by following method: The optical Density (OD) was measured by spectrophotometer (Perklin Elmer Ltd, UK) at 260nm.
50G /ML X OD 260NMX200
After calculation of DNA concentration, working dilutions were prepared with final concentration of 25ng/ul conc. and 2-4ul of each DNA dilution was used for setting up a PCR reaction.
GSTT1/GSTM1 MULTIPLEX PCR & ANALYSIS
Analysis of the GSTT1 & GSTM1 was performed by using a standard multiplex PCR protocol with some changes to describe the presence or absence of GSTT1 and GSTM1 (Shaikh et al. 2010). This technique does not distinguish between the heterozygosity or Page | 32
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk homozygosity in genotypes of GSTT1 and GSTM1, but identifies the null genotypes i. e. homozygous deletion. -globin used as internal control to confirm the PCR amplification. 100ng of DNA was amplified in a total volume of 25 l reaction mixture containing 8pmol of each primer (Table 7). Primers of GSTT1, GSTM1 and -globin were got synthesized commercially from Centre for Applied Molecular Biology (CAMB) Lahore, Pakistan (Table 8). Multiplex PCR was performed with initial denaturation at 95C for 5 minutes followed by 40 cycles of 94C for 45 sec, annealing at 60C for 45 sec and extension at 72C for 45 sec. Final extension was at 72C for 7 mins (Fig: 13). PCR products were electrophoresed on 2% agarose gel, stained with ethidium bromide and visualized it on UV light. Presence and absence of bands represent the presence or absence of null alleles of GSTT1and GSTM1. GSTT1 has a product size 473bp, -globin has 260bp product while the third GSTM1 has 210bp size. If -globin band is absent it means PCR reaction has failed.
TABLE 7: OLIGONUCLEOTIDES PRIMERS USED IN AMPLIFICATION GENES
GSTT1
PRIMER TYPE
FORWARD REVERSE
SEQUENCE
5TTCCTTACTGGTCCTCACATCTC3 5 TCACCGGATCATGGCCAGCA 3 5GAACTCCCTGAAAAGCTAAAGC3 5GTTGGGCTCAAATATACGGTGG3 5 CAACTTCATCCACGTTCACC3 5 GAAGAGCCAAGGACAGGTAC3
PRODUCT SIZE
473BP
GSTM1
FORWARD REVERSE
210BP
B-GLOBINS
FORWARD REVERSE
260BP
Figure 13: Profile of Multiplex PCR
Page | 33
TABLE 8: INGREDIENTS FOR MULTIPLEX PCR REACTION MIXTURE INGREDIENTS CONCENTRATION VOLUME TAKEN FOR MULTIPLEX PCR REACTION (L)
2. 5 1.25 0. 8 0. 5 0. 5 0. 5 0. 5 0. 5 0. 5 25NG 5U 4.0 0. 4 13.05 25
10X PCR BUFFER MAGNESIUM CHLORIDE DNTPS PRIMERS GSTT1 FORWARD REVERSE GSTM1 FORWARD REVERSE GLOBIN FORWARD REVERSE TEMPLATE DNA TAQ DNA POLYMERASE DISTILLED WATER TOTAL REACTION MIX
10MM 50MM 2. 5MM 8M
STATISTICAL ANALYSIS
Null allele frequency of GSTM1and GSTT1 in case and control subjects from Southern Punjab was determined according to the HardyWeinberg equilibrium. Chi-Square test was applied to evaluate the relation between null alleles of GSTM1 and GSTT1 with disease, smoking, and age groups, pesticide, menopause etc using the SPSS 17 statistical package for Windows.
Page | 34
RESULTS
For the present study 204 healthy individual and 100 female patients of breast cancer were enrolled. GSTM1 and GSTT1 genetic polymorphisms were analyzed using a multiplex PCR procedure. The presence or absence of the genes was detected by the presence or absence of 473 bp, 260bp and 210 bp bands corresponding to GSTT1, globin and GSTM1 genes respectively. -globin was used as internal control to document the successful PCR amplification. A picture of multiplex PCR products run on 2% agarose gel stained with ethidium bromide is given below (Fig: 14).
Figure 14: Ethidium bromide-stained electrophoresed PCR products samples: 1 kb ladder (lane 9); GSTM1 and GSTT1 wild type (lanes 3, 4, 12 and 13, representing individuals BC 04, 06, 10, 12); GSTM1 null (lanes 5, 6, 14 and 15, representing individuals BC 07, 08, 11 ,25); GSTT1 null genotype (lanes 7, 8, 16 and 17, representing individuals BC 14, 15, 16, 17); concomitant deletion of both GSTM1 and GSTT1 (lanes 1, 2, 10 and 11, representing individuals BC 21, 30, 40, 49).
Different biological/physiological and environmental factors, thought to play some role in breast cancer predisposition were considered and analyzed during the study (Table 9). Among the biological factors, age was firstly considered and individuals were distributed in five age groups. It was observed that females belonging to the age group 36-45 years are more prone towards the breast cancer. Although age is significantly related to breast cancer (p=0.00, Table 9, Fig: 15) but we cannot conclude any strong association between age and disease as random sampling was done. Results have shown that 49% of the patients had menopause, which are almost three folds that of controls samples with menopause (11.3%, p=0.00). It was also observed that more breast cancer patients (24%) belonged to same age group (36-45years) as mentioned above (Table 9, Fig: 16). 20% of the patients reported a history of cancer in their family. Our data suggest that individuals who have more than 3 pregnancies are exposed to a higher risk of getting breast cancer (p=0.018, Table 9). Statistics show that marriage, breast feeding, etc has no significant association with the genes and breast cancer. However a weak association of breast cancer was observed with environmental factor like smoking (p=0.078) and a significant association with pesticides exposure (p=0.042), Page | 35
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk though on further analysis of pesticides exposure along with GSTM1, GSTT1 genes and breast cancer no significant evidence was observed (p=0.559, Table 13). It was observed that null genotype of GSTT1 is present in 25.98 % (79) of individuals while 225 of the total 304 individuals (74.01%) carry the wild type genotype. GSTT1 wild genotype was present almost in the same ratio in normal and affected persons i.e. 74.5% and 73% respectively, while its null genotype was found at a little higher percentage (27%) in breast cancer patients as compared to (25. 5 %) in control individuals (Table 10). Above allele frequencies and statistical analysis clearly depicts that GSTT1 is not associated with breast cancer (p=0.08, Table 10). GSTM1 wild type allele was present in 54.27% (165) individuals while its null allele was found in 45.7% (139) individuals. Presence of the GSTM1 wild type allele among the control and case was found to be 52.9% and 57% respectively, while 46.1% and 43% of normal and affected individuals, respectively, carry null allele of GSTM1 (Table 10). Statistically no significant relationship was found between the patients phenotype and different categories of GSTM1 (p=0.445) and hence we may conclude that distribution of GSTM1 null genotype remains the same for normal as well as affected individuals. Cross tabulation of GSTT1 and GSTM1 with the disease represents that 9.86% (30) of the all the individuals showed null mutation for both GSTM1 and GSTT1 genes and 38.15% of the individuals had both the wild type GSTT1 and GSTM1 genes, while 51.97% of individuals have either any one of the both genes deleted. As frequency of null alleles of GSTM1 and GSTT1 genes is almost similar in patients and control so no significant association of these genes was detected with the breast cancer, moreover, it is proved that presence and absence of one gene has no effect on the occurrence of other gene (Table 11). Statistical analysis between the two genes (GSTM1 & GSTT1), menopause and the breast cancer show significant results, that with null mutation of both the genes the percentages of patients either having menopause or no menopause was similar i.e. 50%. On the contrary, percentage of null mutations of both the genes in normal individuals having menopause or no menopause are 10% and 90%, respectively, showing a significant association with the disease either due to genes deletion or combination with menopause. While when only GSTM1 or GSTT1 was deleted the percentage of patients having menopause is 54.5% and 58.5%, respectively, which is more than those without menopause, 45.5% and 41.2%, respectively (Table 12).
Page | 36
TABLE 9: SELECTED CHARACTERISTIC FOR CASE & CONTROLS INDIVIDUALS OF SOUTHERN PUNJAB, PAKISTAN. CHARACTERISTICS AGE CATEGORY NORMAL N=204 65 (31.9%) 68 (33.3%) 8 (3.9%) 15 (7.4%) 1 (0.5%) 181 (88.7%) 23 (11.3%) 181 (88.7%) 0 (0) 8 (3.9%) 15 (7.4%) 40 (19.6%) 164 (80.4%) 41 (20.1%) 119 (58.3%) 42 (20.6%) 2 (1%) 204 (100%) AFFECTED N=100 1 (1%) 19 (19%) 24 (24%) 20 (20%) 5 (5%) 51 (51%) 49 (49%) 52 (52%) 4 (4%) 24 (24%) 20 (20%) 3 (3%) 97 (97%) 4 (4%) 60 (60%) 34 (34%) 2 (2%) 0 (0%) 3 (3%) 23 (23%) 43 (43%) 22 (22%) 9 (9%) 20 (20%) 80 (80%) 13 (13.0%) 3 (3%) 32 (32%) 48 (48%) 14 (14%) 22 (22%) 44 (44%) 16 (16%) 3 (3%) 18 (18%) 82 (82%) 16 (16%) 8 (8%) 52 (52%) 24 (24%) 96 (96%) 4 (4%) 62 (62%) 17 (17%) CHI SQUARE TEST /P-VALUE 65.27/P<0.001***
15-25Y 26-35Y 36-45Y 46-55Y 60+Y NO 52.839/ P<0.001*** MENOPAUSE YES N/A 54.992/ P<0.001*** AGE AT 26-35 MENOPAUSE 36-45 46-55 NO 15.241/ P<0.001*** MARRIAGE YES NO 17.138/ P=0.001*** MARRIAGE AGE 10-20Y 21-30Y 31-40Y NO 304.0/ P<0.001*** BREAST CANCER 15-25Y AGE 26-35Y 36-45Y 46-55Y 56+ Y YES 0 (0%) 43.673/ P<0.001*** HISTORY OF NO 100 (100%) BREAST CANCER NO 53 (26.0%) 12.573/P=0.014*** AGE AT FIRST 10-15Y 10 (4.9%) PREGNANCY 16-20Y 74 (36.3%) 21-30Y 63 (30.95%) NO 53 (26%) 13.169/P=0.018** TOTAL NUMBER 1-3 TIMES 62 (30.4%) OF PREGNANCIES 4-6TIMES 52 (25.5%) 7-9TIMES 28 (13.7%) 10-12TIMES 7 (3.4%) NO 78 (38.2%) 12.717/P<0.001*** BREAST FEEDING YES 126 (61.8%) NO 57 (27.9%) 12.897/P=0.005*** LAST BREAST 15-25Y 35 (17.2%) FEEDING AGE 26-35Y 79 (38.7%) 36-45Y 33 (16.2%) NO 184 (90.2%) 3.109/P=0.078NS SMOKING YES 20 (9.8%) NO 94 (46.1%) 7.071/P=0.132NS EDUCATION UP TO 52 (25.5%) MIDDLE UP TO 10TH 38 (18.6%) 13 (13%) UP TO 12TH 9 (4.4%) 3 (3%) NO 150 (73.5%) 84 (84%) 4.151/P=0.042* PESTICIDES YES 54 (26.5%) 16 (16%) ***: Highly Significant, **: Significant, *: Marginally Significant, NS: Non Significant
Hence collectively we can say that though data has shown that the percentage of women having GSTM1 null mutation (43%) are more sufferers of breast carcinoma than those with the GSTT1 null mutation (27%) but due to non significant results obtained it Page | 37
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk cannot be concluded that deletion of these genes is associated with breast cancer in our population (Table 10). Although it can be concluded that menopause and gene deletions are collectively increasing the tendency of women to be exposed to breast cancer (Table 12).
TABLE 10: CROSS TABULATION OF GSTM1 & GSTT1 WITH BREAST CANCER
GENES
NORMAL N=204
AFFECTED N=100
TOTAL N=304
STATISTICAL TESTS CHI SQUARE STATISTIC/PVALUE LIKELIHOOD RATIO STATISTIC/PVALUE 0.778/0.079
GSTT1 (+/+ , +/-) GSTT1 (-/-) GSTM1 (+/+ , +/-) GSTT1 (-/-)
152 (74.5%) 52 (25.5%) 108 (52.9%) 96 (46.1%)
73 (73%) 27 (27%) 57 (57%) 43 (43%)
225 (74.01%) 79 (25.98%) 165 (54.27%) 139 (45.7%)
0.782/P=0.080NS
0.541/P=0.445NS
0.504/0.446
TABLE 11: CROSS TABULATION OF GSTM1 & GSTT1 COMBINATION WITH BREAST CANCER GENES NORMAL N=204 AFFECTED N=100 TOTAL N=304
GSTM1-/GSTT1GSTM1-/GSTT1+ GSTM1+/GSTT1GSTM1+/GSTT1+
20 (9.8%) 76 (37.25%) 32 (15.68%) 76 (37.25%)
10 (10%) 33 (33%) 17 (17%) 40 (40%)
30 (9.86%) 109 (35.85%) 49 (16.11%) 116 (38.15%)
***: Highly Significant, **: Significant, *: Marginally Significant, NS: Non Significant
Page | 38
Figure 15: Graph representing frequency of different age groups among affected and normal subjects
Figure 16: Graph representing frequency of menopause in different age groups among affected and normal subjects
Page | 39
TABLE 12: CROSS TABULATION OF GENE COMBINATIONS OF GSTM1, GSTT1 & MENOPAUSE WITH BREAST CANCER GENE COMBINATION NORMAL GSTM1-/GSTT1GSTM1-/GSTT1+ GSTM1+/GSTT1GSTM1+/GSTT1+ 2(10%) 7(9.2%) 5(15.6%) 9(11.8%) AFFECTED 5(50%) 18(54.5%) 10(58.8%) 16(40%) NORMAL 18(90%) 69(90.8%) 27(84.4%) 67(88.2%) AFFECTED 5(50%) 15(45.5%) 7(41.2%) 24(60%) 30(9.86) 109(35.8) 49(16.11) 116(38.15) POST MENOPAUSE PRE MENOPAUSE TOTAL STATISTICAL TESTS LIKELIHOOD CHI-SQUARE RATIO STATISTIC/PSTATISTIC/PVALUE VALUE 5.963/P=0.015** 26.755/P=0.00 12.29/P=0.00
*** ***
5.73/0.017 25.196/0.00 9.592/0.002 11.779/0.001
9.754/P=0.002
***
TABLE 13: CROSS TABULATION OF GENE COMBINATIONS OF GSTM1, GSTT1 & PESTICIDE EXPOSURE WITH BREAST CANCER
GENE COMBINATION
PESTICIDE EXPOSED
PESTICIDE NOT EXPOSED
TOTAL
NORMAL GSTM1-/GSTT1GSTM1-/GSTT1+ GSTM1+/GSTT1GSTM1+/GSTT1+ 6(20%) 17(15.6%) 10(20.4%) 21(18.1%)
AFFECTED 2(6.7%) 5(4.6%) 4(8.2%) 5(4.3%)
NORMAL 14(46.7%) 59(54.1%) 22(44.9%) 55(47.4%)
AFFECTED 8(26.7%) 28(25.7%) 13(26.5%) 35(30.2%) 30(9.86) 109(35.8) 49(16.11) 116(38.15)
STATISTICAL TESTS LIKELIHOOD CHI-SQUARE RATIO STATISTIC/PSTATISTIC/PVALUE VALUE 0.341/P=0.559NS 0.744/P=0.388 NS 0.342/P=0.569
NS *
0.330/0.566 0.775/0.379 0.331/0.569 3.71/0.054
3.451/P=0.063
***: Highly Significant, **: Significant, *: Marginally Significant, NS: Non Significant
DISCUSSION
We know that GSTs (GSTT1 & GSTM1) belong to the group of low penetrance genes, which might be involved in the process of carcinogenesis. Primary reason to study GSTM1 and GSTT1 polymorphisms and their possible correlation to breast cancer is based on the fact that Southern Punjab is an agricultural and highly populated areas and lack of an efficient detoxification system might increase the risk of getting breast cancer in this population. The GST family catalyzes reactive carcinogenic intermediates, produced through the phase I metabolism of environmental toxins. The genes of the GST families are under the control of the aryl hydrocarbon receptor, which binds toxic chemicals such as dioxin, an environmental pollutant thought to be involved in breast cancer development (Perera et al. 1995). The influence of these deletion polymorphisms has already been determined in other cancers such as lung cancer, ovarian cancer (Perera et al. 1995), bladder cancer (Song et al. 2009), Colon cancer (Huang et al. 2006), oral cancer (Sreelekha et al. 2001), Acute Lymphoblastic Leukemia (Chacko et al. 2004), lung cancer (Sreeja et al. 2005) in various populations, which lead us to hypothesize that GSTM1 and GSTT1 null mutations may also contribute to the origin of breast cancer in our population. In the present study, it is found that frequency of GSTM1 null genotype in Southern Punjab women of Pakistan is 45.7%, which is significantly higher than all Indian populations (Table 14). Similarly, GSTT1 null genotype frequency (25.98%) is also higher than North and South Indian populations, whereas it is lower than that of Delhi population (Table 14). While our results are found to be in line with the results of a previous study on frequency distribution of GSTT1 and GSTM1 in Pakistani Population (Shaikh et al. 2010). From these results, it is suggested that Population of Southern Punjab is distinctive and are not descendant of migrants from India during 18901947. These opinions are further supported by some previous studies in which researchers compared Indian populations and some populations of Singapore based on frequencies of GSTM1 and GSTT1 null genotypes, suggesting that Singapore populations were descendants of migratory Indian population (Lee et al. 1995; Zhao et al. 1995). Similar results were also observed in frequency distribution of CYP2D6 gene in Malaysian Indians and South Indians (Adithan et al. 2003). However, to confirm this hypothesis genotyping of more individuals is necessary. In addition, frequency of GSTM1 and GSTT1 null allele is higher in Chinese and Japanese populations than that in population from Southern Punjab indicating that population from Southern Punjab is distinct from Page | 41
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk both these racial groups (Table 14). Although Polish and Italian populations are comparable in frequency distribution of GSTM1 null allele but Southern Punjab population has a significantly higher frequency of GSTT1 null allele, suggesting that Southern Punjab population is distinct from both Polish and Italian populations (Table 14). Our case control study of South Punjab population showed that GSTM1 and GSTT1 null genotypes were not associated with breast cancer among the Pakistani women. But a higher risk was observed for either the deletions of both GSTT1 and GSTM1 or only one of them, with menopause, depicting that the post menopausal women are more prone towards the breast cancer either due to gene deletions or any hormonal effect. Previous studies conducted on post menopausal women of Iowa showed that the null genotypes of GSTM1 or GSTT1 are associated with an elevated risk of breast cancer compared with women who had both genes (Zheng et al. 2001). Previous studies on the role of these genotypes in breast carcinoma had shown discrepant results (Ambrosone et al. 1995; Chacko et al. 2005; Curran et al. 2000; Egan et al. 2004; Garcia et al. 1999; Gudmundsdottir et al. 2001; Helzlsouer et al. 1998; Mitrunen et al.2001). The first possible link between GSTM1 deletion and breast cancer risk was suggested from a hospital based case-control study, in which 47.7% of cases and 41.8% of controls were found to have the null GSTM1 genotype (Zhong et al.1993). Several successive case-control studies (Charrier et al.1999; Ambrosone et al.1995; Zheng et al.2001) also found a weak to moderate positive association. The strongest association was reported by Helzlsouer et al.1998 they found a 2.5-fold elevated breast cancer risk among postmenopausal women with the null GSTM1 genotype. In another study done on Southern Taiwan's women, poor detoxification ability in the GST group was hypothesized to contribute to an increased risk of breast cancer, and women harboring putative high-risk alleles ( GSTM1 and GSTT1 deletion alleles) were considered to be at higher risk of cancer (Wang et al. 2006). In contrast to above findings and analogous to our results, several other studies including the nurses' health study (Bailey et al. 1998; Milikan et al.2000; Garcia et al. 1999) showed no association between the GSTM1 genotype and breast cancer risk. Another report based on a study in breast cancer cases irrespective of family history in South Indian population also showed no significant role for GSTM1 in breast carcinogenesis (Samson et al.2007). Although not as extensively investigated as the GSTM1 polymorphism, GSTT1 deletion has also been evaluated in relation to the risk of breast cancers in five Page | 42
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk epidemiologic studies with conflicting results. A positive association between GSTT1 polymorphism and breast cancer was found by two previous studies (Gudmundsdottir et al. 2001; Helzlsouer et al. 1998). While our findings were supported by the three other studies, in which, GSTT1 deletion was not related to the risk of breast cancer (Garcia et al. 1999; Curran et al. 2000; Milikan et al. 2000). In fact, the risk was even reduced in certain subgroups of women who had the GSTT1 null genotype (Garcia et al. 1999; Curran et al. 2000). Thus our results are in line with the results of the previous studies on South Indian populations (Samson et al.2007) as well as that of another case-control study conducted on women in urban Shanghai which was the largest and most comprehensive examination of GST polymorphisms in relation to breast cancer risk which also indicated no overall relationship of the GSTM1 or GSTT1 deletion variants with breast cancer risk in premenopausal or in postmenopausal women (Kathleen et al.2004). To end with we can conclude that the frequency of GSTM1 and GSTT1 null genotype in Southern Punjab population is different from those found in other populations as well as the deletion of these genes is not associated with breast cancer in our population. The reason behind can be postulated as, because Southern Punjab population differs considerably in the rate of metabolism, activation/deactivation of xenobiotics than other populations of the world. We suppose that this data will provide a basic record for the future clinical and genetic studies related to variability in the response or toxicity to xenobiotics/drugs known to be substrates of glutathione-S-transferases. It is suggested that comprehensive and vast studies are highly recommended in order to expose the genetic as well as environmental factors in cancer disposition.
Page | 43
TABLE 14: COMPARATIVE FREQUENCY DISTRIBUTION OF GSTM1 AND GSTT1 IN VARIOUS POPULATIONS
Population/Country Pakistan Southern, Pakistan North India South India Delhi, India Newcastle, England Turkish Italians Polish Chinese Caucasian Japanese Slovenia Spain Greek Finnish Caucasians African Americans Whites (USA) Brazilian non Whites Brazilian Whites Ovambos (Namibia) Mongolians (Ulaanbaatar)
N 304 111 370 517 309 178 133 273 233 477 166 150 102 312 165 478 271 392 272 319 134 207
GSTM1 Null % 45.7 45 33 30.4 21 50.8 51.9 46.9 47.6 51 48.8 51.3 52 49.7 38.8 41.8 28 52 34.2 48.9 11.2 46.6
GSTT1 Null % 25.98 23 18.4 16.8 27.4 16.9 17.3 19 16.3 46 19.9 54 25.5 20.5 18.8 13.2 17 16 25.7 25.1 35.8 25.6
Reference Present Study Shaikh et al. 2010 Mishra et al. 2004 Naveen et al. 2004 Singh et al. 2009 Welfare et al. 1999 Ada et al. 2004 DAlo et al. 2004 Kargas et al. 2003 Setiawan et al. 2000 Gsur et al. 2001 Naoe et al. 2000 Garte et al. 2001 Garte et al. 2001 Stavropoulou et al. 2007 Mitrunen et al. 2001 Millikan et al. 2000 Millikan et al. 2000 Rossini et al. 2002 Rossini et al. 2002 Fujihara et al. 2009 Fujihara et al. 2009
Page | 44
REFERENCES
Ambrosone CB, Freudenheim JL, Graham S, Marshall JS, Vena JE, Brasure JR et al (1995) Cytochrome P4501A1 and glutathione S-transferase (M1) genetic polymorphisms and postmenopausal breast cancer risk. Cancer Res 55: 34833485 Appelt LC, Reicks MM Soy feeding induces Phase II enzymes in rat tissues. Nutr Cancer 28(3): 270-275 Bailey LR, Roodi N, Verrier CS, Yee CJ, Dupont WD, Parl FF (1998) Breast cancer and CYP1A1, GSTM1, and GSTT1 polymorphisms: evidence of a lack of association in Caucasians and African Americans. Cancer Res 58: 6570 Bandmann O, Vaughan J, Holmans P et al (1997) Association of slow acetylator genotype for Nacetyltransferase 2 with familial Parkinsons disease. Lancet 350:11361139 Barch DH, Rundhaugen LM (1994) Ellagic acid induces NAD(P)H:quinone reductase through activation of the antioxidant responsive element of the rat NAD(P)H:quinone reductase gene. Carcinogenesis 15:2065-2068 Barch DH, Rundhaugen LM, Pillay N (1995) Ellagic acid induces transcription of the rat glutathione S-transferase-Ya gene. Carcinogenesis 16:665-668 Benet LZ, Kroetz DL, Sheiner LB (1996) Pharmacokinetics: The dynamics of drug absorption, distribution, and elimination. In: Molinoff PB, Ruddon RW, Goodman Gilman A (eds) The Pharmacological Basis Of Therapeutics. 9thedn. New York, McGraw-Hill, pp 3-27 Bhurgri Y, Bhurgri A, Hasan SH, Usman A, Faridi N, Malik J et al (2002) Cancer pattern in Karachi division (1998-1999). J Pak Med Assoc 52: 244-6 Board PG, Coggan M, Chelvanayagam G, Easteal S, Jermiin LS, Schulte GK et al (2000) Identification, characterization and crystal structure of the omega class glutathione transferases. J Biol Chem 275: 2479824806 Chacko P, Joseph T, Mathew BS et al (2005) Role of xenobiotic metabolizing gene polymorphisms in breast cancer susceptibility and treatment outcome. Mutat Res 581: 153163 Chang TW, Wang SM, Guo YL, Tsai PC, Huang CJ, Huang W. (2006) Glutathione Stransferase polymorphisms associated with risk of breast cancer in southern Taiwan. Breast 15 (16): 754761
Page | 45
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk Charrier J, Maugard CM, LeMevel B, Bignon YJ (1999) Allelotype influence at glutathione S-transferase M1 locus on breast cancer susceptibility. Br J Cancer 79: 346 353 Coggan M, Whitbread L, Whittington A, Board P (1998) Structure and organization of the human theta-class glutathione Stransferase and D-dopachrome tautomerase gene complex. Biochem J 334: 617623 Coughlin SS, Piper M (1999) Genetic polymorphisms and risk of breast cancer. Cancer Epidemiol Biomark Prev 8: 10231032 Curran JE, Weinstein SR, Griffiths LR (2000) Polymorphisms of glutathione Stransferase genes (GSTM1, GSTP1 and GSTT1) and breast cancer susceptibility. Cancer Lett 153: 113120 Daly AK, Cholerton S, Gregory W, Idle J (1993) Metabolic polymorphisms. Pharmac Ther 57:129-160 Dunning AM, Healey CS, Pharoah PDP, Teare MD, Ponder BAJ, Easton DF (1999) A systematic review of genetic polymorphisms and breast cancer risk. Cancer Epidemiol Biomark Prev 8: 843854 Egan KM, Cai Q, Shu XO et al (2004) Genetic polymorphisms in GSTM1, GSTP1, and GSTT1 and the risk for breast cancer: results from the Shanghai Breast Cancer Study and meta-analysis. Cancer Epidemiol Biomarkers Prev 13: 197204 Egan KM, Cai Q, Shu XO, Jin F, Zhu TL, Dai Q, Gao YT, Zheng W. (2004) Genetic Polymorphisms in GSTM1, GSTP1, and GSTT1 and the Risk for Breast Cancer: Results from the Shanghai Breast Cancer Study and Meta-Analysis Cancer Epidemiology Biomarkers & Prevention 13(2): 197204 Elangovan V, Sekar N, Govindasamy S (1994) Chemopreventive potential of dietary bioflavonoids against 20-methylcholanthreneinduced tumorigenesis. Cancer Lett 87:107113 Garcia CM, Kelsey KT, Hankinson SE, Spiegelman D, Springer K, Willett WC et al (1999) Glutathione S-transferase mu and theta polymorphisms and breast cancer susceptibility. J Natl Cancer Inst 91: 19601964 Garte S, Gaspari L, Alexandrie, Ambrosone C, Autrup H, Aurup JL et al (2001) Metabolic gene polymorphism frequencies in control populations. Cancer Epidemiol Biomark Prev 10: 12391248 Goldberg RJ (1996) The P-450 System: Definition and relevance to the use of antidepressants in medical practice. Arch Fam Med 5: 406-412
Page | 46
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk Gudmundsdottir K, Tryggvadottir L, Eyfjord JE (2001) GSTM1, GSTT1, and GSTP1 genotypes in relation to breast cancer risk and frequency of mutations in the p53 gene. Cancer Epidemiol Biomarkers Prev 10: 11691173 Guengerich FP (1984) Effects of nutritive factors on metabolic processes involving bioactivation and detoxification of chemicals. Ann Rev Nutr 4:207-231 Guengerich FP (1995) Influence of nutrients and other dietary materials on cytochrome P450 enzymes. Am J Clin Nutr 61 (3 Suppl): 651S-658S. Gustavson LE, Benet LZ (1994) Menopause: Pharmacodynamics and pharmacokinetics. Exp Gerontol 29: 437-444 Haydes JD, Pulford DJ (1995) The glutathione S-transferase supergene family: regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit Rev Biochem Mol Biol 30: 445600 Helzlsouer KJ, Selmin O, Huang H, Strickland PT, Hoffman S, Alberg AJ, Watson M, Comstock GW, Bell D (1998) Association between glutathione S-transferase M1, P1, and T1 genetic polymorphisms and development of breast cancer. J Natl Cancer Inst 90: 512 518 Huang K, Sandler RS, Milikan RS, Schroeder JC, North KE (2006) GSTM1 and GSTT1 polymorphisms, cigarette smoking, and risk of colon cancer: a population-based case-control study in North Carolina (United States). Cancer Causes Control 17: 385394 Hulka BS, Stark AT (1995) Breast cancer: Causes and Prevention. Lancet 346:883887 Iarbovici D (1997) Single blood test might predict drugs effects on patients. J NIH Res 9: 34-45 International Agency for Research on Cancer (IARC) (2002) IARC Handbook on Cancer Prevention No. 7: Breast Cancer Screening. Lyon, France: IARC Press. Ip C, Lisk DJ (1997) Modulation of Phase I and Phase II xenobiotic-metabolizing enzymes by selenium-enriched garlic in rats. Nutr Cancer 28: 184-188 Jamal S, Moghal S, Mamoon N, Mushtaq S, Luqman M, Anwar M (2006) The pattern of malignant tumours: Tumour registry data analysis, AFIP, Rawalpindi Pakistan. J Pak Med Assoc 56: 359-62 Joeres R, Klinker H, Heusler H et al (1988) Influence of smoking on caffeine elimination in healthy volunteers and in patients with alcoholic liver cirrhosis. Hepatology 8: 575-579
Page | 47
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk Joseph T, Kusumakumary P, Chacko P et al (2004) Genetic polymorphism of CYP1A1, CYP2D6, GSTM1 and GSTT1 and susceptibility to acute lymphoblastic leukaemia in Indian children. Pediatr Blood Cancer 43: 560567 Kall MA, Clausen J (1995) Dietary effect on mixed function P450 1A2 activity assayed by estimation of caffeine metabolism in man. Hum ExpToxicol 14: 801-807 Kawajiri K, Nakachi K, Imai K et al (1990) Identification of genetically high risk individuals to lung cancer by DNA polymorphisms of the cytochrome P4501A1 gene. FEBS Lett 263: 131-133 Kelsey KT, Hankinson SE, Colditz GA, Springer K, Garcia-Closas M, Spiegelman D et a (1997) Glutathione S-transferase class m deletion polymorphism and breast cancer: results from prevalent versus incident cases. Cancer Epidemiol Biomark Prev 6: 511515 Kieff E, Rickinson AB (2001) Epstein-Barr virus and its replication. In: Knipe DM, Howley PM (ed) Fields virology. Philadelphia: Lippincott Williams & Wilkins. pp 251173 Landi S (2000) Mammalian class theta GST and differential susceptibility to carcinogens: a review. Mutation Res 463: 247283 Lee WM (1995) Drug-induced hepatotoxicity. N Engl J Med 333: 1118-1127 Levy G, Yamada H (1971) Drug biotransformation interactions in man III: Acetaminophen and salicylamide. J Pharmaceut Sci 60: 215- 221 Mannervik B, Awasthi YC, Board PG, Hayes JD, Ilio CD, Ketterer B et al (1992) Nomenclature for human glutathione transferases. Biochem J 282: 305308 Manson MM, Ball HWL, Barrett MC et al (1997) Mechanism of action of dietary chemoprotective agents in rat liver: induction of phase I and II drug metabolizing enzymes and aflatoxin B1 metabolism. Carcinogenesis 18: 1729-1738 Maurel P (1996) The CYP3 Family. In: Ioannides C (ed) Cytochromes P450: Metabolic And Toxicological Aspects. Boca Raton, FL: CRC Press, Inc, pp: 241-270 Meyer UA, Zanger UM, Skoda RC et al (1990) Genetic polymorphisms of drug metabolism. Prog Liver Dis 9:307-323 Millikan R, Pittman G, Tse C-K, Savitz DA, Newman B, Bell D (2000) Glutathione Stransferases M1, T1, and P1, and breast cancer. Cancer Epidemiol Biomark Prev 9: 567 573 Mitrunen K, Jourenkova N, Kataja V, Eskelinen M, Losma V-M, Benhamou S, Vainio H, Uusitupa M, Hirvonen A, GlutaW Zheng et al (2001) thione S- transferase M1, M3, P1, and T1 genetic polymorphisms and susceptibility to breast cancer. Cancer Epidemiol Biomark Prev 10: 229236 Page | 48
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk Monks TJ, Anders MW, Dekant W, Stevens JL, Lau SS, van Bladeren PJ (1990) Glutathione conjugate mediated toxicities. Toxicol Appl Pharmacol 106: 119 Motzer RJ, Bander NH, Nanus DM (1996) Renal-cell carcinoma. The New England journal of medicine 335 (12): 865-875 Murphy WM, Beckwith JB, Farrow GM (1994) Tumors of the kidney, bladder, and related urinary structures. Armed Forces Institute of Pathology, Washington, DC. Nebert DW, Petersen DD, Puga A (1991) Human AH locus polymorphism and cancer: inducibility of CYP1A1 and other genes by combustion products and dioxin. Pharmacogenetics 1: 68-78 Nelson HH, Wiencke JK, Christiani DC, Cheng TJ, Zuo ZF, Schwartz BS et al (1995) Ethnic differences in the prevalence of the homozygous deleted genotype of glutathione S-transferase theta. Carcinogenesis 16: 1243 1245 Offord EA, Mace K, Ruffieux C et al (1995) Rosemary components inhibit benzopyrene induced genotoxicity in human bronchial cells. Carcinogenesis 16: 20572062 Pantuck EJ, Pantuck CB, Garland WA et al (1979) Stimulatory effect of brussels sprouts and cabbage on human drug metabolism. Clin Pharm Ther 25: 88-95 Park BK, Kitteringham NR, Pirmohamed M, Tucker GT (1996) Relevance of induction of human drug-metabolizing enzymes: pharmacological and toxicological implications. Br J Clin Pharmacol 41: 477-491 Parkin, DM, Bray F, Ferlay J, Pisani P (2005) Global cancer statistics, 2002. CA: A Cancer Journal for Clinicians 55(2): 74-108 Parsons WD, Neims AH (1978) Effect of smoking on caffeine clearance. Clin Pharmacol Ther 24: 40-45 Pearson WR, Vorachek WR, Xu SJ, Berger R, Hart J, Vannais D, Patterson D (1993) Identification of class-mu glutathione transferase genes GSTM1GSTM5 on human chromosome 1p13. Am J Hum Genet 53: 220233 Pemble S, Schroeder KR, Spencer SR, Meyer DJ, Hallier E, Bolt HM et al (1994) Human glutathione Stransferase theta (GSTT1): cDNA cloning and the characterization of a genetic polymorphism. Biochem J 300: 271276 Pemble SE, Taylor JB (1992) An evolutionary perspective on glutathione transferases inferred from class-theta glutathione transferase cDNA sequences. Biochem J 287: 957 963
Page | 49
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk Perera FP, Estabrook A, Hewer A, Channing K, Rundle A, Mooney LA, Whyatt R, Phillips DH (1995) Carcinogen-DNA adducts in human breast tissue. Cancer epidemiol Biomarkers and Prevention 4: 233-238 Peto R, Darby S, Deo H et al (2000) Smoking, smoking cessation, and lung cancer in the UK since 1950: combination of national statistics with two case-control studies. BMJ 321: 3239 Poirier MC, Santella RM, Weston A (2000) Carcinogen macromolecular adducts and their measurement.Carcinogenesis 21: 3539 Rebbeck TR (1997) Molecular epidemiology of the human glutathione S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibility. Cancer Epidemiol Biomark Prev 6: 733743 Ritchie JC, Cloan TP, Idle JR, Smith RL (1980) Ciba Foundation Symposium 76: Toxicological implications of polymorphic drug metabolism. Excerpta Medica 219-244. Roodi N, Dupont WD, Moore JH, Parl FF (2004) Association of homozygous wildtype glutathione S-transferase M1 (GSTM1) genotype with increased breast cancer risk, Cancer Res 64: 12331236 Samson M, Swaminathan R, Rama R et al (2007) Role of GSTM1 (Null/Present), GSTP1 (Ile105Val) and P53 (Arg72Pro) genetic polymorphisms and the risk of breast cancer: a case control study from South India. Asian Pac J Cancer Prev 8(2): 253257 Seidegard J, Vorachek WR, Pero RW, Pearson WR (1988) Hereditary differences in the expression of the human glutathione transferase active on trans-stilbene oxide are due to a gene deletion. Proc Natl Acad Sci USA 85: 72937297 Shields PG, Harris CC (2000) Cancer risk and low-penetrance susceptibility genes in gene-environment interactions. J Clin Oncol 18: 230915 Slattery JT, Wilson JM, Kalhorn TF, Nelson SD (1987) Dose-dependent pharmacokinetics of acetaminophen: Evidence of glutathione depletion in humans. Clin Pharmacol Ther 41: 413-418 Smith TJ, Yang CS (1994) Effects of food phytochemicals on xenobiotic metabolism and tumorigenesis. In: Food Phytochemicals I: Fruits and Vegetables. Washington, DC. American Chemical Society Press 17-48 Sprenger R, Schlagenhaufer R, Kerb R, Bruhn C, Brockmoller J, Roots T, Brinkmann U (2000) Characterization of the glutathione S-transferase GSTT1 deletion: discrimination of all genotypes by polymerase chain reaction indicates a trimodular genotypephenotype correlation. Pharmacogenetics 557565
Page | 50
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk Sreeja L, Syamala V, Hariharan S et al (2005) Possible risk modification by CYP1A1, GSTM1 and GSTT1 gene polymorphisms in lung cancer susceptibility in a South Indian population. J Hum Genet 50: 618627 Sreelekha TT, Ramadas K, Pandey M et al (2001) Genetic polymorphism of CYP1A1, GSTM1 and GSTT1 genes in Indian oral cancer. Oral Oncol 37: 593598 Strange RC, Spiteri MA, Ramachandran S, Fryer A (2001) Glutathione-S-transferase family of enzymes. Mutat Res 482: 2126 Turner FC (1941) Sarcomas at sites of subcutaneous implanted Bakelite disks in rats. J Natl Cancer Inst 2: 81 Vermeulen NPE (1996) Role of metabolism in chemical toxicity. In: Ioannides C (ed). Cytochromes P450: Metabolic And Toxicological Aspects. Boca Raton, FL: CRC Press, Inc. pp 29-53 Vesell ES (1979) Pharmacogenetics: Multiple interactions between genes and environment as determinants of drug response. Am J Med 66: 183-187 Vineis P, Marinelli D, Autrup H et al (2001) Current smoking, occupation, Nacetyltransferase-2 and bladder cancer: a pooled analysis of genotype-based studies. Cancer Epidemiol Biomarkers Prev 10: 124952 Wacher VJ, Wu C-Y, Benet LZ (1995) Overlapping substrate specificities and tissue distribution of cytochrome P450 3A and P-glycoprotein: Implications for drug delivery and activity in cancer chemotherapy. Mol Carcinog 13: 129-134 Whittington A, Vichai V, Webb G, Baker R, Pearson W, Board P (1999) Gene structure, expression and chromosomal localization of murine theta class glutathione transferase mGSTT1-1. Biochem J 337: 141151 Widersten M, Pearson WR, Engstrom A, Mannervik B (1991) Heterologous expression of the allelic variant mu-class glutathione transferases mu and psi. Biochem J 276: 519524 Wilson CM, Tobin S, Young RC (2004) The exploding worldwide cancer burden: the impact of cancer on women. International Journal of Gynecological Cancer 14: 1-11 Xu SJ, Wang YP, Roe R, Pearson WR (1998) Characterization of the human class mu glutathione S-transferase gene cluster and the GSTM1 deletion. J Biol Chem 273: 3517 3527 Zhao M, Lewis R, Gustafson DR, Wen WQ, Cerhan JR, Zheng W (2001) No apparent association of GSTP1 A313 G polymorphism with breast cancer risk among postmenopausal Iowa women. Cancer Epidemiol Biomark Prev 10: 13011302. 3439
Page | 51
GlutathioneSTransferasesGeneDeletion&BreastCancerRisk Zhong S, Wyllie AH, Barnes D, Wolf CR, Spurr NK (1993) Relationship between the GSTM1 genetic polymorphism and susceptibility to bladder, breast and colon cancer. Carcinogenesis 14: 18211824
Web Resources: Cancer Registry and Data Management (CRCDM). Shaukat Khanum Memorial Cancer Hospital and Research Center (SKMCH & RC) Report based on cancer cases registered at SKMCH &RC in 2004 and from Dec 1994- Dec 2004. Available from URL: http://www.shukatkhanum.org.pk/research.html. WHO.Data and statistics. World Health Organization; 2006. Globocan 2008 IARC Books:
Page | 52

M.Phil Thesis of Asma Sohail

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

M.Phil Thesis of Asma Sohail

Uploaded by

Copyright:

Available Formats

GLUTATHIONE-S-TRANSFERASES (GSTT1 & GSTM1) GENE DELETIONS AND SUSCEPTIBILITY TO BREAST CANCER IN PAKISTAN

INSTITUTE OF BIOTECHNOLOGY BAHAUDDIN ZAKARIYA UNIVERSITY MULTAN, PAKISTAN

INSTITUTE OF BIOTECHNOLOGY BAHAUDDIN ZAKARIYA UNIVERSITY MULTAN, PAKISTAN

READ IN THE NAME OF ALLAH

SIGNATURE OF SUPERVISOR: NAME OF THE SUPERVISOR:

(Prof. Dr. Muhammad Ali)

OVERVIEW OF CANCER DISEASE

CONTROL OF GROWTH IN NORMAL TISSUES

THE CELL CYCLE

Figure 2: Cell Cycle

THE PROCESS OF TUMOR GROWTH & CARCINOGENESIS

ETIOLOGY OF CANCER (CAUSES OF CANCERS)

EPIDEMIOLOGY & TYPES OF CANCERS

ETIOLOGY OF BREAST CANCER

ROLE OF DIFFERENT GENES IN BREAST CARCINOGENESIS

TABLE 5: FUNCTIONS AND CHROMOSOMAL LOCATION OF DNA REPAIR GENES.

CARCINOGEN METABOLISM GENES

CELL PROTECTION MECHANISMS IN CANCER

ENZYME SYSTEMS INVOLVED IN DETOXIFICATION

Figure 9: Mono & Multi Functional Inducers

Figure 10: 3D Structure of Glutathione S-Transferase

GST GENOTYPES & CANCER RISK

MATERIAL AND METHODS

Figure 13: Profile of Multiplex PCR

10MM 50MM 2. 5MM 8M

STATISTICAL TESTS CHI SQUARE STATISTIC/PVALUE LIKELIHOOD RATIO STATISTIC/PVALUE 0.778/0.079

152 (74.5%) 52 (25.5%) 108 (52.9%) 96 (46.1%)

73 (73%) 27 (27%) 57 (57%) 43 (43%)

225 (74.01%) 79 (25.98%) 165 (54.27%) 139 (45.7%)

20 (9.8%) 76 (37.25%) 32 (15.68%) 76 (37.25%)

10 (10%) 33 (33%) 17 (17%) 40 (40%)

30 (9.86%) 109 (35.85%) 49 (16.11%) 116 (38.15%)

5.73/0.017 25.196/0.00 9.592/0.002 11.779/0.001

PESTICIDE NOT EXPOSED

NORMAL GSTM1-/GSTT1GSTM1-/GSTT1+ GSTM1+/GSTT1GSTM1+/GSTT1+ 6(20%) 17(15.6%) 10(20.4%) 21(18.1%)

AFFECTED 2(6.7%) 5(4.6%) 4(8.2%) 5(4.3%)

NORMAL 14(46.7%) 59(54.1%) 22(44.9%) 55(47.4%)

AFFECTED 8(26.7%) 28(25.7%) 13(26.5%) 35(30.2%) 30(9.86) 109(35.8) 49(16.11) 116(38.15)

0.330/0.566 0.775/0.379 0.331/0.569 3.71/0.054

You might also like