An investigation into the interaction of X.

laevis telomeric proteins TRF1 and PinX1

A Thesis Presented to The Division of Mathematics and Natural Sciences Reed College

In Partial Fulfillment of the Requirements for the Degree Bachelor of Arts

Molly McCarthy King May 2009

Approved for the Division (Biology)

Janis Shampay

Acknowledgments
I would like to thank my advisor Janis Shampay for believing that one day, I would, in fact, actually make it into lab, and for your willingness to answer all of my stupid questions when I did. Janis, I am so grateful for your infinite patience, understanding, and encouragement that reinvigorated my love of science. Mom and Dad, you are the reasons I made it to Reed, and the reasons I made it out. Thank you for the incredible sacrifices you made to get and keep me here. Thank you for making me get back on the plane, especially that first time. Thank you for answering my calls at 2 am, and understanding when I failed to call for weeks. Words can never thank you enough for all you have done to help me be me. I would like to thank all of my friends at Reed for getting me through these long days, weeks, years. Knowing that you were in this with me made each day doable, even when I sometimes didnt see you for months at a time. Annie Miano, Taiga Christie (my other two Musketeers), Sarah Kemp, Pooja Bhaskar, Anna McGee, and Cori Savaiano: I am so blessed to have gotten to know you. You are incredibly special people, and incredibly special to me. I couldn't have made it through Reed without you girls, no way. I feel so honored to call you my best friends your unconditional love and support mean so much to me. Adarsh Pyarelal, thank you for putting up with my crazy, for giving me the support and understanding to endure this year, for sharing your love and contagious enthusiasm for life, and for making this past year happier than I thought possible. Thank you to my role models and friends who went before me, Christine Lewis, Allison Edgar, and Courtney von Bergen, who showed me the path to involvement, passion and balance, showed me it is possible, and helped keep me sane through the darkest of times. To my wonderful friends, Matt Jemielita, Rachel Cooper, Maeve Hooper, Andrew Betson, Nick Bradish, Kevin Lynagh, Ryan Gersovitz, Celia Hassan, Michael Reisor, Jeryl Hewey, Lee Lipton, Kailyn McCord, Sean Lerner, Dana Bublitz, Chris Williams, Amrita Rajasingham, Catherine Hinchliff, Advait Jukar, Javed Parkes: thank you all for your camraderie, love, and infinite understanding of my very human failings throughout the years I couldnt have done it without you, my Reed family, and I certainly would not have had this much fun.

To my mentors, thank you for taking me under your respective wings. Noelle Faricy, Kristin Holmberg, Kyle Webster and the SAO, Gabe Merrell and Amy Frey, thanks for all of your insight, patience, guidance and encouragement, for listening nonjudgmentally to my rants, and for the always-warm welcomes to a much-needed refuge from academia and everything else. Thank you Kjersten Whittington, for giving me direction and hope that there is something for me at the intersection of science and society, and for your belief in me as an individual and as an academic. Thank you Bob Kaplan, for always being there and for encouraging and supporting me, even in those times when I wasnt able to make academics priority one. To the mentors who got me to Reed, Donna Gordon and Mike Erikson, I can never thank you enough for all you did to help me grow in high school. Thank you all, I would have been lost without your guidance. To my lab-mates Dave Constant and Jen Jin: thank you for all of your help when I was utterly clueless, for your late-night solidarity, and for your friendship in and outside of lab. A huge thanks to Mark Amoruso for all your help and encouragement in lab. A bittersweet thanks to Senate, which was such a big part of my identity at Reed, for making me truly appreciate the moments when I got to be a student and for the invaluable lessons I learned outside of the classroom. I am grateful for having the opportunity to work with a group of people as dedicated to and passionate about Reed as my senators, and I never could have made it through a year of thesis with student body presidenting without you. Ajax/Overmind/Bradish, I couldnt have done it without you thanks for being such a super president of vice and partner in crime. And thank you to the administrators Mike Brody, Lily Copenagle, Barre Stoll, Colin Diver, Kathy Rose, Michael Leidecker, Towny Angell, and again, Kristin Holmberg who were willing to listen and collaborate, and who work together year after year to keep this institution the place I have grown to love. Also, a silly but genuine thanks to all the inanimate objects and ideals in my life that helped me through coffee, 3 am conversations about the Honor Principle, xkcd and PhD comics, the Senate Bylaws, and a belief that someday, all this will be worth it. And the realization that, because it is about the process and not the product, that day is already here. This research was supported in part by a grant from the Reed College Biology Undergraduate Research Project Program.

Table of Contents
Introduction...................................................................................................................1 The problem with telomeres ........................................................................................1 Telomeres: the chromosome protection complex......................................................1 Telomere structure...................................................................................................1 Duplicating chromosomes: the end replication problem ...........................................2 The DNA damage response......................................................................................4 DNA repair pathways ..............................................................................................4 T-loops: distinguishing chromosome breaks from telomere ends..............................5 Telomerase maintains telomere length .....................................................................7 The shelterin complex and associated factors...............................................................8 TRF1 (Telomeric Repeat binding Factor 1)............................................................10 TRF2 (Telomeric Repeat binding Factor 2)............................................................12 POT1 (Protection of Telomeres 1) .........................................................................13 TPP1 (TINT1 / PTOP / PIP1).................................................................................14 TIN2 (TRF1-Interacting Nuclear protein 2)............................................................14 RAP1 (Repressor/Activator Protein 1) ...................................................................15 PinX1 is a TRF1-interacting telomerase inhibitor ......................................................15 The roles of telomeres, TRF1 and PinX1 in oncogenesis ...........................................18 The interaction of PinX1 and Trf1 .............................................................................18 Xenopus as a model organism....................................................................................19 Experimental goals and design...................................................................................20 Materials & Methods...................................................................................................23 Sequence alignment analysis .....................................................................................23 PCR construction of Myc-tagged xlTRF1dd ..............................................................23 Primer design.........................................................................................................23 Amplification of desired construct .........................................................................24 Subcloning of xlTRF1dd PCR product into intermediate vector.................................25 PCR product purification .......................................................................................25 Subcloning and transformation of E. coli ...............................................................25 Small plasmid DNA isolations ...............................................................................26 Analysis of isolated plasmid DNA .........................................................................26 Construction of pTNT in vitro translation clone .....................................................27 Ligation into pTNT vector .................................................................................27

Transformation of E. coli with pTNT-xlTRF1dd vector......................................... 28 pTNT-xlTRF1dd plasmid purification ................................................................... 28 Sequence analysis of plasmid DNA........................................................................... 29 In vitro expression of proteins ................................................................................... 29 Immunoprecipitation................................................................................................. 30 Coimmunoprecipitation............................................................................................. 30 Visualization of proteins ........................................................................................... 31 SDS-PAGE separation of protein products ............................................................ 31 Visualization of total protein ................................................................................. 31 Electroblotting....................................................................................................... 32 Detection of biotin labeled amino acids ................................................................. 32 Detection of His-tagged protein on western blot .................................................... 32 Results & Discussion................................................................................................... 35 Overview .................................................................................................................. 35 In silico protein sequence analyses ............................................................................ 35 TRF1 sequence analysis ........................................................................................ 35 PinX1 sequence analysis ....................................................................................... 37 Interaction with xTERT......................................................................................... 39 Design of experimental constructs............................................................................. 39 PinX1 construct design.......................................................................................... 39 Primers amplify dimerization domain from full-length xlTRF1 clone .................... 39 Intermediate subcloning of xlTRF1dd-Myc construct................................................ 40 Transformed bacteria contain intermediate vector with insert ................................ 41 Purified xlTRF1dd-Myc construct inserted into in vitro translation vector................. 42 Transformed bacteria contain expression vector with desired insert ....................... 43 Sequence analyses confirm no mutations in xlTRF1dd construct............................... 45 pTNT-xlTRF1dd clone j used for in vitro translation................................................. 45 Visualization of protein products............................................................................... 46 Immunoprecipitation................................................................................................. 48 Coimmunoprecipitation experimental design............................................................. 49 Coimmunoprecipitation attempt ............................................................................ 52 Conclusions and recommendations for further study ................................................. 52 Appendix A: Sequence of Myc-tagged xlTRF1dd protein construct ........................ 55 Bibliography................................................................................................................ 57

List of Tables
Table 2.1. PCR primers used to create Myc-tagged xlTRF1dd construct........................23 Table 2.2. Cycling program for amplification of xlTRF1dd. ..........................................24

List of Figures
Figure 1.1. Chromosome replication results in the end replication problem, gradually shortening successive daughter strands without the remediative action of telomerase. ................................................................................................................................3 Figure 1.2. The t-loop at the ends of chromosomes is theorized to form via the invasion of the G-rich strand into the internal complementary sequence of the C-rich strand......5 Figure 1.3. Domain diagrams of human shelterin and PinX1 proteins. .............................9 Figure 1.4. The protein components of the shelterin complex bound to the telomeric overhang................................................................................................................10 Figure 3.1. TRF1 amino acid sequence alignment among species.. ................................36 Figure 3.2. PinX1 amino acid sequence alignment among species. ................................37 Figure 3.3 Cross-species alignment of domain of PinX1 that interacts with TRF1dd......38 Figure 3.4. Myc-tagged xlTRF1dd construct resulting from amplification by designed primers. . ...............................................................................................................40 Figure 3.5. Insertion of xlTRF1dd-Myc construct in intermediate cloning vector...........41 Figure 3.6. Analytical gel to confirm restriction digests and estimate concentration of purified TOPO-xlTRF1dd DNA.............................................................................42 Figure 3.7. Desired pTNT-xlTRF1dd-Myc in vitro translation construct.. .....................43 Figure 3.8. Restriction enzyme analysis of clones obtained from plasmid purification of pTNT-xlTRF1dd samples. .....................................................................................44 Figure 3.9. Sequenced 5 and 3 terminal fragments of xlTRF1dd-Myc construct. .........45 Figure 3.10. Visualizations of protein products from in vitro transcription/translation reactions of xlTRF1dd-Myc and xlTRF1full-Flag. .................................................47 Figure 3.11. Biotin labeled amino acids obtained from immunoprecipitation. ................49 Figure 3.12. Schema of experimental design for IP and co-IP reactions. ........................51

Abstract
The chromosome replication process causes the ends of chromosomes to slowly degrade without the remediative action of the enzyme telomerase. Telomeres are repetitive sequences at the ends of chromosomes that protect them from inappropriate DNA repair and cellular responses to DNA damage. Telomerase and other telomereassociated proteins are essential for end protection, chromosome maintenance and telomere regeneration. Two telomere protection complex proteins, TRF1 and PinX1, have been found to interact and to negatively regulate telomere length in humans. Human PinX1 is a direct inhibitor of telomerase enzymatic activity, while TRF1 indirectly regulates telomerase by preventing access to the telomeric overhang. Xenopus laevis has previously been shown to have constitutive telomerase activity in somatic cells, making it an excellent model organism for research on telomerase and telomere length regulation. This study sought to investigate the interaction of the telomeric proteins TRF1 and PinX1 in Xenopus laevis. An in vitro expression construct for a Mycepitope tagged TRF1 dimerization domain was created to aid in the study of this interaction. This construct can be used in future studies for more specific identification of interacting domains, should PinX1 and full-length TRF1 be found to interact in X. laevis. The interaction of X. laevis PinX1 and full-length TRF1 was investigated using previously cloned constructs. Immunoprecipitation and coimmunoprecipitation studies were performed to investigate in vitro interaction. While no conclusive evidence was found either for or against interaction, progress was made towards a rigorous experimental design to test this interaction.

Dedication
For my parents, who were right all along.

Introduction
The problem with telomeres
Telomeres: the chromosome protection complex Chromosomes are long molecules of DNA and histone proteins that contain an organisms genetic material. The ends of eukaryotic chromosomes are protected by telomeres, nucleoprotein structures that regulate telomere replication and safeguard against degradation. Since eukaryotic chromosomes are linear, their ends are especially vulnerable to degradation by enzymes (Palm and de Lange, 2008). Their linearity poses particular challenges in chromosome replication processes, an issue known as the end replication problem. Normal telomere function is essential for cell viability. Without sufficient telomere protection, shortening of telomeres can result in chromosome loss and end-to-end fusions (Evans and Lundblad, 2000). Most eukaryotes have telomeres composed of double-stranded short tandem DNA repeats. In vertebrates, this sequence is TTAGGG (Meyne et al., 1989; Blasco, 2005). Telomere-associated proteins consist of the shelterin complex and the accessory factors it recruits, to be described in more detail below. Telomeres and their associated proteins serve four capping functions for chromosomes: regulation of telomere length; prevention of the DNA damage response to telomere presence; prevention of the fusion of chromosome ends; and prevention of homologous recombination between telomeric DNA (Chan and Blackburn, 2004). These roles are vital for chromosome stability and cell survival and proliferation. Telomere structure The telomere length necessary to adequately protect chromosomes varies among organisms. Human telomeres are usually 10-15 kb (kilobases), but also contain additional TTAGGG repeats in subtelomeric regions (Palm and de Lange, 2008). Telomeres in the model organism for this study, Xenopus laevis, range from 10-50 kb in length and can vary among tissues in the same individual (Bassham et al., 1998). Due to their composition of TTAGGG repeats, telomeres have a 3 strand rich in guanosine and lacking in cytosine. The two complementary strands of the telomere are thus referred to as the G-strand and the C-strand (Palm and de Lange, 2008). The Gstrand of eukaryotes typically ends in a 100-200 nucleotide single-stranded overhang

2 (Blasco, 2005; De Boeck et al., 2009), a protrusion that is generally longer but more variable (50-500 nt) in mammals (Palm and de Lange, 2008). Duplicating chromosomes: the end replication problem The linear nature of eukaryotic chromosomes presents a grave problem for the maintenance of these genetic-programming structures. The chromosome replication machinery necessarily leaves a single-stranded overhang at each end after replicating the linear DNA (Figure 1.1). DNA is replicated by a process described by Watson and Cricks semiconservative model, meaning that during each replication cycle, the two copies of DNA will each contain one strand from the original chromosome and one daughter strand. Replication occurs continuously for one strand the leading strand and discontinuously for the other the lagging strand (Lander, 2005). The progressing replication fork is supported by telomere proteins, permitting efficient telomere synthesis (Verdun and Kalseder, 2007). During DNA replication processes, the enzyme primase synthesizes a singlestranded RNA primer at the 5 end of replication. DNA polymerases then extend the strands initiated by RNA primers in the 5' to 3' direction. But DNA polymerase can only synthesize the daughter strand in the 5 to 3 direction. When the leading RNA primers at the 5 end of the newly replicated chromosome are removed, this leaves a single-stranded overhang that cannot be filled by DNA polymerase. Without the action of telomerase to lengthen the telomeric regions, the process of DNA replication results in progressively shorter and shorter daughter molecules (Lander, 2005). At the end of replication, the other end of the chromosome, resulting from leading-strand synthesis, will theoretically be blunt. The formation of a functional telomere structure and the binding of the necessary proteins require a single-stranded overhang (Verdun and Kalseder, 2007). The sequence loss observed during cell replication is greater than that predicted by the end replication problem alone (Harley et al., 1990). Detection of such long overhangs at both ends of a chromosome suggests that there are regulated processing methods for single-stranded overhang generation, in addition to the overhang resulting from the end replication problem. It is proposed that the G-rich daughter strand overhang may be generated at the blunt end by nucleolytic digestion in the 5' to 3' direction, though no nuclease candidates have yet been identified (Verdun and Kalseder, 2007).

Figure 1.1. Chromosome replication results in the end replication problem, gradually shortening successive daughter strands without the remediative action of telomerase.

4 The DNA damage response The average lengths of telomeres are far in excess of those needed merely to protect chromosome function. In humans, a minimum of 78 bp (13 repeats) of TTAGGG sequence is required to prevent fusions of telomeres. A fully functional telomere can be developed from as few as 400 bp of TTAGGG repeats. Telomere length must be reduced to less than 1000 bp to cause senescence in human tumor cell lines (Palm and de Lange, 2008). Because of this length requirement for functional protection, embryonic-tissue derived human cells can only divide about 50 times before shortened telomeres cause the cell to permanently arrest division or die. This division boundary, known as the Hayflick limit, is determined by the rate of shortening and the initial telomere length (Verdun and Kalseder, 2007). Telomeres that become too short are detected by the cells damage response pathway as a double-strand break. The pathways of cell senescence and apoptosis are associated with shortened telomeres (Lechel et al., 2005). As discussed above, during each cell replication, telomeres are shortened as a result of the end replication problem. In the absence of corrective telomerase action, telomere erosion limits the proliferative potential of cells through either apoptosis or senescence (Palm and de Lange, 2008). When telomeres are dysfunctional, the DNA damage response is initiated through one of two pathways dependent on one of the protein kinases, ATM or ATR. Double strand breaks activate the ATM pathway, while the ATR pathway responds to the formation of single stranded DNA. Activation of DNA damage response pathways results in an arrest of cell proliferation (Palm and de Lange, 2008). This leaves telomeres susceptible to inappropriate DNA repair or cells vulnerable to senescence. DNA repair pathways Double strand DNA breaks in mammals are repaired by either nonhomologous end joining (NHEJ) or homology directed repair / homologous recombination (HR) (Palm and de Lange, 2008). When telomeres are left unprotected, or the telomere protection complex malfunctions, chromosomes are threatened by these repair mechanisms. Homologous repair occurs when the homologous region of a sister chromosome acts as a template to guide repair of the broken strand. Repair begins with the creation of a single-stranded overhang which then invades a homologous sequence to form a hybrid heteroduplex (De Boeck et al., 2009). The protein complex shelterin that localizes to telomeres helps protect against the three kinds of HR: t-loop HR, HR between sister telomeres, and HR between a telomere and interstitial telomeric DNA (de Lange, 2005).

5 In NHEJ, two double strand breaks are joined directly without regard for sequence homology (De Boeck et al., 2009). ATM/ATR signaling is required for NHEJ to fuse chromosome ends (Palm and de Lange, 2008). Double-strand breaks are recognized by the binding of the Ku70 and Ku80 proteins and the MRN complex. The association of these factors recruits the catalytic subunit of DNA protein kinase (DNAPK), which then initiates a pathway leading to repair of the break by DNA ligase (De Boeck et al., 2009). The double-strand break repair protein DNA-PK has a dual function in capping telomere ends. Cells lacking the catalytic subunit of the DNA-PK protein exhibited substantial numbers of inappropriate end-to-end fusions, implicating this protein in telomeric end-capping, an additional function to its role in repairing incidental DNA damage (Bailey et al., 1999). Inhibition of ATM kinase activity led to telomere dysfunction, suggesting that the formation of the chromosome end protection complex actually depends upon the post-replication DNA damage response at telomeres (Verdun et al., 2005). The structure of telomeres leaves them vulnerable to these reactions to damage, resulting in inappropriate DNA repair or cell senescence. This necessitates some means by which to distinguish telomeric DNA from damaged DNA. T-loops: distinguishing chromosome breaks from telomere ends One possible mechanism by which the DNA damage response machinery distinguishes telomere ends from chromosome breaks in mammals is via telomere formation into the telomeric loop (t-loop), structure. The t-loop structure forms both in vivo and in vitro by invasion of the 3 overhang into the double-stranded segment of telomeric repeats. The invading 3 G-strand overhang supplants the G-strand in that area to form the displacement loop, or D loop (Figure 1.2).

Figure 1.2. The t-loop at the ends of chromosomes is theorized to form via the invasion of the G-rich strand into the internal complementary sequence of the C-rich strand. This structure may be responsible for telomere protection from both telomerase extension and enzymatic degradation.

6 Although this structure has been observed in vivo, there is no conclusive experimental evidence that it is necessary for protecting telomeres from the DNA damage response. T-loop structure formation is mediated by the shelterin protein TRF2 (Griffith et al., 1999). TRF2 is found at the loop junction, preferentially binding to the area between the single-stranded overhang and the duplex loop (Stansel et al., 2001). However, the role of TRF2 in forming t-loops is unlikely due to its DNA binding function alone; crystal studies of TRF2-DNA complexes indicate that the DNA binding domain of TRF2 binds double-stranded DNA without any major distortions of the DNA (Court et al., 2004). TRF2 mediates DNA loop formation at any point in the telomeric repeat sequence by forming a tetramer at the branching point of the loop. Though in vitro TRF2-dependent loop formation does not require the 3 overhang that characterizes telomeres, the formation of an end-loop (as opposed to a loop at any point in the repeat tract) requires the specific sequence of the overhang (Yoshimura et al., 2004). The tumor suppressor protein p53 also plays a role in in vitro t-loop formation, increasing the efficiency of TRF2 t-loop formation by two fold when it is present at the t-loop junction (Stansel et al., 2002). Random breaks in the chromosome will be less capable of forming protective tloop structures, as they lack the highly repetitive sequences that promote the invasion of one strand by another. Furthermore, short telomeres will be less able to form t-loops, and thus cells with highly degraded chromosomes will not be inappropriately protected from the natural course of the DNA damage response pathways (Griffith et al., 1999). However, t-loops can form from as little as 500 bp and range up to 18 kb in length in mammals (Wei and Price, 2003). The size of the loop varies by species and is correlated with overall telomere length, with t-loops being generally a few kb shorter than the total telomeric DNA (Wei and Price, 2003). Griffith et al. (1999) suggest that the t-loop may be responsible for protection from telomerase extension and enzymatic degradation in vivo. This speculation is corroborated by findings that telomere chromatin extracted from human, mouse and chicken nuclei forms t-loops (Griffith et al., 1999; Nikitina and Woodcock, 2004). Thus, the t-loop model presents one possible mechanism for distinguishing telomeres from genuine double strand breaks. The characterization of another equally effective protective structure, comprised of two proteins that bind the ends of chromosomes in Oxytricha nova, reinforces the idea that t-loops are only one (albeit rather attractive) model for vertebrate telomere protection (Verdun and Kalseder, 2007).

7 Telomerase maintains telomere length Telomerase, initially known as telomeric terminal transferase, is a reverse transcriptase that extends the length of the 3 G-strand following chromosomal replication. The activity of telomerase is one example of a reversal of the central dogma of biology, which states that the directionality of synthesis proceeds from DNA to RNA to protein. Telomerase uses an RNA template to synthesize replacement DNA repeats at the terminal ends of telomeres (Chan and Blackburn, 2004). Telomerase has a protein component (TERT) and an RNA sequence component (TR) that it uses to prime DNA synthesis. In humans and yeast, telomerase forms a dimeric complex, but it is undetermined whether this dimerization is a conserved or essential characteristic of the enzyme. Although the protein component of telomerase is responsible for catalyzing the polymerization reaction, it has been shown that TR RNA template mutations can have an effect on enzymatic function. A trinucleotide substitution in the TR template domain of S. cerevisiae destroys the enzymatic function of telomerase, indicating that the template region requires base-specific interactionsfor functional enzyme activity (Chan and Blackburn, 2004). Telomerase lengthens the 3 single-stranded overhang of telomeric DNA. The distal nucleotides of this strand base pair with the complementary TR component of telomerase. The strand is extended by polymerization of additional G, T and A nucleotides using the TR RNA as a template. Telomerase releases this newly synthesized segment, which is then available either for further elongation by telomerase or for complementary lagging-strand synthesis of the C-strand using the newly synthesized Gstrand region as a template for primase-polymerase (as described above in the chromosome replication process) (Chan and Blackburn, 2004). In this way, the function of telomerase opposes the losses to telomere length due to the end replication problem and other DNA damage. Some minimal number of telomeric repeats is necessary for the foundation of the telomerase-shelterin complex that protects the telomere. The length of telomeric repeat tract seems to be one determinant of whether or not telomerase can access the chromosome end; shortened telomeres are uncapped, or accessible to telomerase, while elongated telomeres are capped, or telomeraseinaccessible. Initially, this might imply the conclusion that telomerase has no function at telomeres until they reach a critically short length (Chan and Blackburn, 2004). However, this does not appear to be the whole story. Telomerase appears to play an important role in preventing inappropriate repair by the DNA damage response. Rather than merely the presence of long telomeres and t-loops, it is in part the attendance of

8 telomerase that protects telomeres from fusions. Instead of promoting end-joining, the DNA damage response factors attracted to telomeres actually promote telomerase action (Chan and Blackburn, 2004). In one possible model, chromosomes are regularly cycling through end-capped and -uncapped forms, with the DNA damage response as an important feedback mechanism for promoting telomerase activity (Chan and Blackburn, 2004). Telomerase activity is also connected with the cell growth and division cycle, with the protein only disconnecting from the telomeres during mitosis. This explains the role of telomerase in maintaining adequate telomere length to ensure cell proliferation (Chan and Blackburn, 2004). In Xenopus egg extracts, the activity of telomerase was higher when associated with interphase chromatin than with mitotic chromatin. This finding suggests that telomere chromatin is actively regulated by processes dependent on the timing of the cell cycle, including recruitment of telomerase to the replicating chromatin during interphase (Nishiyama et al., 2006). Telomerase is expressed ubiquitously in X. laevis somatic cells, with differential activity in different tissues not solely due to differential amounts of diffusible telomerase inhibitor (Bousman et al., 2003). A lack of telomerase activity in cells results in telomere shortening, reduced proliferation and, eventually, cell senescence. Even within a single cell, telomere lengths are highly heterogeneous, but the overall population of telomeres in a group of dividing cells is kept within limits specific to that cell type (Chan and Blackburn, 2004). The limited amount of telomerase in human cells maintains telomeres at a certain equilibrium, and a low concentration of telomerase is critical for preferential lengthening of short telomeres. One in vivo study showed that overexpression of the limiting hTERT and hTR telomerase components resulted in a greater association of telomerase with telomeres and their consequent elongation at a constant rate independent of telomere length (Cristofari and Lingner, 2006). This equilibrium is maintained via the regulation of telomerase access to telomeres (Evans and Lundblad, 2000). A complex called shelterin and other associated proteins bind to telomeres, playing a role in telomere structure and in the regulation of telomerase.

The shelterin complex and associated factors

Also referred to as the telosome, shelterin is a complex of six proteins that bind to telomeres, protect them from recognition by double-strand break machinery, and regulate their length (De Boeck et al., 2009). These proteins are TRF1, TRF2, TIN2, TPP1, POT1, and RAP1 (Figure 1.3). The shelterin complex also recruits other protein factors, among which is TRF1-interacting PinX1.

Figure 1.3. Domain diagrams of human shelterin and PinX1 proteins. Matching colors correspond to either similar domain structures or protein-protein interaction domains (de Lange, 2005; Palm and de Lange, 2008). Domain structure acronyms for each protein are as follows, from the N terminus to the C terminus: TRF1: Tankyrase-binding D/E-rich domain, also known as the acidic domain (white); TRFH (TRF Homology) dimerization domain (blue); SANT/Myb DNAbinding domain (green) TRF2: GAR(Gly/Arg-rich) domain, also known as the basic domain (white); TRFH (TRF Homology) self-dimerization domain (blue); RAP1 interaction domain (brown); TIN2 interaction domain (orange); SANT/Myb DNA-binding domain (green) POT1: OB (oligonucleotide/oligosaccharide/oligopeptide binding) folds (shades of red); TPP1-binding domain (yellow) TIN2: TPP1 and TRF1 interaction domain (purple and orange); TRF1-binding domain (blue) TPP1: OB fold / potential telomerase interacting motif (red); POT1 interaction domain (yellow); Ser-rich region (white); TIN2 interaction domain (purple) RAP1: BRCT (BRCA1 C-terminal) protein interaction domain (white); Myb domain (green); TRF2 interaction domain (brown) PinX1: G-patch (glycine-rich RNA-interacting domain) (white); TERT nucleolar localization domain (white); TID (telomerase inhibitory domain) (white)

10 The proteins interact with each other and numerous other factors to regulate the actions of telomerase, prevent DNA damage response signaling, and maintain telomere structure. Shelterin specifically binds telomeric DNA due to the specificity of its proteins TRF1, TRF2, and POT1 for the telomeric repeat sequence TTAGGG (Figure 1.4) (Palm and de Lange, 2008). POT1 binds the single stranded region of the G-strand overhang and in the D-loop within the t-loop structure. TRF1 and TRF2 bind the duplex region of telomeres and recruit the other four components of the shelterin complex. Even in the absence of telomeric DNA in nuclear cell extract isolations, shelterin forms a stable complex (Palm and de Lange, 2008).

Figure 1.4. The protein components of the shelterin complex bound to the telomeric overhang (used with permission, de Lange, 2005).

TRF1 (Telomeric Repeat binding Factor 1) TRF1 is a 56 kDa telomeric protein that recruits shelterin-associated factors and negatively regulates telomere length. The mammalian protein has an acidic domain at its N-terminus, followed in sequence by a TRF homology (TRFH) dimerization domain near its N-terminus and a C-terminal DNA-binding SANT-Myb-like domain (Chong et al., 1995; Bianchi et al., 1997). The dimerization and Myb domains are joined by a highly flexible linker of about 100 aa (Court et al., 2004). TRF1 binds double-stranded DNA in vivo (Smogorzewska et al., 2000). The C-terminal Myb-like domain, consisting of residues 371433 in human TRF1 (Hanaoka et al., 2005), is responsible for this binding of TRF1 to double-stranded DNA. The Myb domain recognizes two repeats of the GGGTTA sequence for selective binding (Konig et al., 1998). Although TRF1 is able to bind DNA as a monomer, two Myb-like domains can bind 6 bp apart (Konig et al., 1998), and TRF1 homodimers require the Myb domains of both proteins for high-affinity binding (Bianchi et al., 1997). TRF1 binds double-stranded telomeric DNA as a homodimer, formed by the interaction of the

11 TRFH/dimerization domains of each protein. As a consequence of this interaction, the TRF1 homodimer bends the site of its telomeric DNA to an angle of approximately 120 (Bianchi et al., 1997). The two Myb-like domains of dimerized TRF1 can independently bind two recognition sites with great spatial flexibility (Nishikawa et al., 2001). This function could contribute to the overall structure of the telomeric complex (Bianchi et al., 1997). Though there may be some cooperative interaction between TRF2 and TRF1 in end loop formation, the presence of TRF1 does not directly mediate the formation of tloops (Yoshimura et al., 2004). TRF1 is a negative regulator of telomere length. One study in human cell lines showed that preventing TRF1 binding prompts telomere lengthening, while TRF1 overexpression in telomerase-positive cells causes telomere shortening. A TRF1 clone lacking DNA binding ability was created via deletion of the Myb domain. This dominant-negative mutant heterodimerizes with coexpressed wild-type TRF1 and prevents it from binding telomeric DNA, resulting in lengthening of telomeres (van Steensel and de Lange, 1997). TRF1 regulates telomerase via physically preventing access to the telomere, rather than by affecting telomerase expression levels (Smogorzewska et al., 2000). TRF1 is itself regulated by the ADP-ribose polymerase, tankyrase. Tankyrase removes TRF1 from telomeres, allowing access to telomerase and thereby promoting telomere elongation (Smith et al., 1998). Human tankyrase binds the human TRF1 (hTRF1) sequence RXXPDG contained within the D/E-rich acidic domain (Sbodio and ChiDagger, 2002). Xenopus laevis and Xenopus tropicalis both have homologs of TRF1 with substantially shorter D/E-rich acidic domains (Crumet et al., 2006). This truncated acidic domain has implications for the regulation of Xenopus TRF1 by tankyrase, as it does not contain the RXXPDG sequence. The 49 kDa Xenopus TRF1 protein has previously been cloned and characterized, the most distantly related vertebrate genes from mammals that have been characterized to date (Crumet et al., 2006; Nishiyama et al., 2006). The Myb domain is characterized by 76% identity to human TRF1 Myb domain (Smogorzewska and de Lange, 2004), and the dimerization domain shares 49% identity and 68% similarity with the human equivalent (Crumet et al., 2006). Overexpression of dominant-negative TRF1 causes increased telomere elongation in cultured human cells. Cell viability is not affected by the inhibition of human TRF1 with a dominant-negative allele (van Steensel and de Lange, 1997). But the surprising finding that deletion of the first exon of mouse TRF1 results in rapid embryonic lethality suggests an essential function for TRF1 that is independent of its role in telomere length

12 regulation (Kalseder et al., 2003). Deletion of TRF1 results in activation of the ATRdependent DNA damage response because of its role in recruiting other shelterin factors. Recruitment by TIN2-TRF1 is crucial for POT1 to repress the ATR response (Sfeir and de Lange, unpublished data in Palm and de Lange, 2008). TRF1 deletion results in a loss of TIN2 and TRF2 association with the telomere (Iwano et al., 2004). It could be this loss of TRF2 that causes embryonic lethality as a result of TRF1 deletion. Another possible lead on this telomere-length-independent function is the role TRF1 plays in preventing activation of the ATM DNA damage response pathways. TRF1/Pin2 (very similar proteins likely encoded by the same gene) coimmunoprecipitates with ATM kinase. ATM kinase phosphorylates TRF1/Pin2 in vitro and in vivo, inhibiting TRF1/Pin2 from carrying out its normal function of mitotic induction (Kishi et al., 2001b). This interaction between ATM kinase and TRF1 is notable because DNA damage response factors recruited to telomeres also promote telomerase action (Chan and Blackburn, 2004). This may imply some involvement of ATM damage response factors in regulating TRF1s function as a negative regulator of telomerase. TRF1 has additional functions in the cell cycle. In Xenopus embryos, TRF1 associates with mitotic chromatin, an interaction promoted by TRF1 phosphorylation by the mitotic kinase Plx1. Xenopus TRF1 dissassociates from chromatin during the transition into interphase, a process coupled with reduced Cdc2 kinase activity and increased telomerase activity. This is consistent with the finding presented earlier that the activity of Xenopus telomerase is higher in associations with replicating interphase chromatin than with mitotic chromatin, as the presence of TRF1 throughout mitosis would exclude telomerase association (Nishiyama et al., 2006). This finding stands in contrast to other studies that have shown that hTRF1 associates with telomeres throughout the cell cycle. Chromatin immunoprecipitation experiments showed that hTRF1 shows a 50% decrease in telomere binding at the start S phase, an increase in binding at the end of the S phase, and then an approximate 20% decrease in binding in G2 (Verdun et al., 2005). One reason this may differ from the TRF1-telomere associations in Xenopus is because Xenopus embryos alternate between S and M phases without the G1 or G2 growth cycles of human somatic cells (Nishiyama et al., 2006). TRF2 (Telomeric Repeat binding Factor 2) Like TRF1, TRF2 is a recruitment protein for the shelterin complex and a negative regulator of telomere length. Like TRF1, TRF2 binds double-stranded DNA in

13 vivo (Smogorzewska et al., 2000), recognizing the same TAGGG sequence as TRF1 (Hanaoka et al., 2005). The presence of TRF2 is dependent on telomere length. TRF2 also functions as a telomerase regulator, preventing telomerase access to the telomere when the tract is long. Overexpression of TRF2 causes telomere shortening (Smogorzewska et al., 2000). Unlike TRF1, Xenopus TRF2 has been found to associate with telomeric chromatin throughout the cell cycle (Nishiyama et al., 2006). TRF2 also binds DNA as a homodimer. It also shares the TRFH-hingeSANT/Myb domain structure of TRF1, with a basic Gly/Arg-rich domain at the Nterminus instead of the acidic domain of TRF1 (de Lange, 2005; Palm and de Lange, 2008). However, TRF1 and TRF2 do not heterodimerize (Broccoli et al., 1997). The TRFH site of TRF2 interacts with the shelterin accessory factor Apollo (Chen et al., 2008). As discussed above, TRF2 is implicated in the formation of t-loops. The involvement of the tumor suppressor protein p53 at the t-loop junction with TRF2 is notable given the interaction of these proteins in the DNA damage response pathway (Palm and de Lange, 2008). A dominant-negative mutant of TRF2 lacking the basic and myb domains removed endogenous TRF2 from telomeres and caused telomere end-toend fusions (van Steensel et al., 1998). Deletion and dominant-negative mutation of TRF2 are lethal because they activate the p53/p21 DNA damage response pathway, mediated by ATM as the signal transducer (Karlseder et al., 1999). The role of TRF2 in averting the action of the ATM kinase may be either through maintaining the higherorder telomere structure (for example, t-loops) or through abrogating a more downstream step in the response pathway (Palm and de Lange, 2008). TRF2 binds ATM in vitro and inhibits the autophosphorylation of ATM on S1981, providing one possible mechanism for preventing the response of the ATM kinase to DNA damage (Karlseder et al., 2004). POT1 (Protection of Telomeres 1) POT1 is a negative regulator of telomerase activity, inhibiting the enzyme by restricting access to the 3 priming single-stranded overhang (Kelleher et al., 2005; Xin et al., 2007). Thus, the telomerase-regulating activity of POT1 is dependent upon its ability to bind single-stranded telomeric DNA (Kelleher et al., 2005). POT1 is characterized by several OB (oligonucleotide/ oligosaccharide/ oligopeptide binding) folds, which are also common to many other single-stranded DNA binding proteins (Kerr et al., 2003). POT1 binds single-stranded DNA and negatively impacts telomerase activity in vitro (Kelleher et al., 2005). The ability of POT1 to regulate telomere length requires the interaction with both single-stranded telomeric DNA and TPP1 (Kelleher et al., 2005; Hockemeyer

14 et al., 2007). RNA interference of TPP1 function or a point mutation in the TPP1binding domain of POT1 impedes POT1 localization to telomeres (Liu et al., 2004; Hockemeyer et al., 2007). POT1 is implicated in the regulation of the terminal specificity of telomeres, as POT1 knockdown cells show randomization of the typically conserved ATC-5 terminal nucleotide sequence. Inhibition of POT1 causes chromosome ends to behave as sites of DNA damage (Hockemeyer et al., 2005). POT1 is the crucial player in the repression of the ATR pathway at telomeres, and a deficiency in POT1 initiates the DNA damage response (Wu et al., 2006). This repression capability is also dependent upon the association of POT1 with TPP1. POT1 mutants without the TPP1 interaction domain are not recruited to the nucleus (Palm and de Lange, 2008). TPP1 (TINT1 / PTOP / PIP1) TPP1, named for its former identities as TINT1, PTOP, and PIP1, is another component of the shelterin complex (Palm and de Lange, 2008). This protein bridges TIN2 with POT1 through its C-terminal TIN2 interaction domain and its central POT1 interaction domain (Figure 1.3). As mentioned above, this linkage is crucial for the recruitment of POT1 to telomeres, as the deletion or mutagenesis of TPP1 results in POT1 depletion from telomeres (Liu et al., 2004). Impaired function of TPP1 results in deprotection of telomeres and subsequent lengthening consistent with POT1 loss phenotypes. TPP1 is also necessary for the nuclear localization of POT1 (Palm and de Lange, 2008). In its interaction with POT1, TPP1 plays a critical role in capping the ends of telomeres by protecting the single-stranded overhang. The N-terminal OB fold of TPP1 interacts with telomerase, providing a physical association between telomerase and potentially recruiting it to the telosome. The recruitment and regulation of telomerase by TPP1 provides a balance to the negative regulation performed by the capping function of the TPP1-POT1 complex (Xin et al., 2007). TPP1 is also critical to the interaction of TRF1 and TRF2 through TIN2 by regulating the connectivity of TRF1 and TRF2 subcomplexes and directly regulating the TRF1-TIN2 interaction (O'Connor et al., 2006). TIN2 (TRF1-Interacting Nuclear protein 2) TIN2 is a negative regulator of telomere length due to its interaction with TRF1 (Kim et al., 1999). TIN2 protects TRF1 from poly(ADP-ribosyl)ation in vitro and theoretically from subsequent removal from telomeres by tankyrase (Ye and Lange, 2004). Diminished TIN2 function endangers the end-capping function of TRF1, resulting

15 in activation of the ATR damage response pathways at telomeres (Palm and de Lange, 2008). The TRFH dimerization domain of TRF1 interacts with a FxLxP motif in the Cterminal region of TIN2, identified by crystal structure. In contrast, Far-Western assays and a gel-filtration chromatographic analysis identified a C-terminal motif of TRF2 and the N-terminal residues of TIN2 that mediate the interaction between those two proteins (Chen et al., 2008). Because these two interactions each depend on different domains, they can take place concurrently, allowing TIN2 the ability to bridge TRF1 and TRF2 and stabilize the complex (Ye et al., 2004). TIN2 also recruits TPP1 to shelterin via a distinct N-terminal protein interaction domain (Palm and de Lange, 2008). This TPP1 binding is necessary for effective TRF2-TIN2-TRF1 interaction. The TIN2-TPP1 interaction appears to be a crucial factor in overall shelterin stability (O'Connor et al., 2006). RAP1 (Repressor/Activator Protein 1) The human ortholog of the yeast Repressor/Activator Protein 1 (RAP1) is recruited to telomeres via its interaction with TRF2. RAP1 has a BRCT motif at its Nterminus, a Myb domain that may interact with another unknown protein, and a Cterminal RCT domain (Li et al., 2000). This C-terminal region interacts with the hinge domain of TRF2. Yeast RAP1 binds to telomeric DNA via a second Myb domain, but mammalian RAP1 lacks this direct binding capability. Mammalian RAP1 is therefore dependent upon TRF2 for its interaction with the telosome complex (Palm and de Lange, 2008). Rap1 is a negative regulator of telomerase length, though the exact mechanism for its regulation is unknown (De Boeck et al., 2009).

PinX1 is a TRF1-interacting telomerase inhibitor

PinX1 is a 328 amino acid, 45kDa protein that interacts with TRF1 and inhibits telomerase in vivo and in vitro. As described in detail above, human telomerase is composed of the catalytic subunit, hTERT, and the template RNA, hTR. The PinX1 Nterminal (aa 1-142) and C-terminal (aa 254-328) domains both interact with hTERT. However, only the C-terminal region appears to be responsible for telomerase inhibition, and so it is designated the telomerase inhibitory domain (TID). Overexpression of the PinX1 C-terminal TID substantially reduces the replicative capacity of a cell population by hindering the telomere-lengthening function of telomerase. Depletion of endogenous PinX1 by RNA interference causes an increase in the enzymatic activity of telomerase

16 and a lengthening of telomeres, as shown by a standard TRAP assay (Zhou and Lu, 2001). PinX1 binds to the region of hTERT that also interacts with the hTR template RNA. The PinX1-interacting hTERT fragments (aa 17-546 and aa 523-924) overlap with the hTERT N-terminal RNA-binding domain (aa 326-620). The mutation or absence of the hTR RNA subunit did not reduce the PinX1-hTERT interaction effect (Banik and Counter, 2004). The C-terminal (aa 253-328) region of PinX1 also binds directly to the telomerase hTR subunit in vitro. The N-terminal (aa 2-252) region of PinX1 is unable to bind hTR. The binding of PinX1 to hTR is thus not attributable to the general RNA binding ability of PinX1 (Banik and Counter, 2004) via its G-patch, a glycine-rich domain widely conserved among eukaryotes (Aravind and Koonin, 1999). PinX1 also binds hTR in vivo in telomerase-positive cells, but not without the presence of hTERT. This is important to note considering the overlaps of the hTR and PinX1 binding regions of hTERT. Still, hTERT immunoprecipitates with hTR in the presence of PinX1, implying that even though the hTERT binding regions for PinX1 and hTR overlap, binding of PinX1 does not obstruct the interaction of the telomerase components in vivo. Rather, it is likely that PinX1 accomplishes its function as a telomerase inhibitor via its interaction with the assembled hTERT-hTR holoenzyme. Telomerase activity is repressed in vivo by the PinX1 TID binding to the assembled hTERT-hTR complex (Banik and Counter, 2004). Both human and yeast PinX1 homologues are nucleolar proteins (Lin et al., 2007). Yeast PinX1p (also known as Gno1p) has functions in both telomerase regulation and snRNA/rRNA processing. The yeast PinX1p is involved in pre-ribosomal RNA (rRNA) processing and end-trimming of two small nucleolar RNAs (snoRNAs). The Gpatch RNA binding domain is essential for both of these functions. Unlike human PinX1, the yeast homologue is not known to interact with any other telomeric proteins. A study by Guglielmi and Werner (2002) asserts that though it does have a function in telomere length regulation, the yeast Gno1p does not act in vivo as a negative regulator of telomerase activity like its human homologue. In fact, in contrast to the lengthening of telomeres caused by depletion of hPinX1, depletion or mutation of the yeast Gno1p in this study resulted in slightly shorter telomeres. However, this effect may be an artifact of slow growth in the mutant phenotype (Guglielmi and Werner, 2002). This artifact effect is more probable in light of a study overexpressing yeast PinX1 in wild-type cells that found a consequent shortening of telomeres. Cell extracts with yPinX1 overexpression exhibited decreased telomerase activity when compared to those cells

17 with vector-only control, showing that yeast PinX1 directly decreases telomerase enzymatic activity in vitro. One resulting model proposes that yPinX1 homologue regulates telomerase by sequestering the reverse-transcriptase protein subunit TERT (Est2p in yeast) in a nucleolar inactive complex lacking the RNA component (Lin and Blackburn, 2004). The model for human regulation of telomerase is different. Overexpression of hPinX1 does force hTERT to translocate from the nucleoplasm into the nucleolus. However, the centrally located domain of hPinX1 that mediates nucleolar localization of hTERT is functionally and structurally separated from the C-terminal TID. A substantial fraction of cells coexpressing hTERT and the central region of the hPinX1 polypeptide (aa 142-254) showed nucleolar concentration. Those cells coexpressing hTERT with either the hPinX1 N-terminal (aa 1-142) or C-terminal terminal TID (aa 254-328) domain showed no such effects on subnuclear localization patterns of hTERT. Lin et al. assert that their results show that a double mutation affecting the nucleolar localization capacity of PinX1 does not impact telomerase inhibition. TRAP assays comparing overexpression of wild-type PinX1 and this mutated PinX1 with a vector control do not show dramatic telomerase inhibition with either PinX1 as effectively as the authors claim (Lin et al., 2007). Still, with this data on the overexpression of the central hTERT subnuclear localization domain, along with the above identification of the TID by Zhou and Lu (2001), it is safe to conclude that sub-nuclear shuttling and telomerase regulation are directed by different domains of hPinX1. This stands in contrast to the yeast PinX1 homologue, which purportedly accomplishes telomerase regulation via the mechanism of nucleolar sequestering. The function of PinX1 as a nucleolar protein that regulates telomere length is conserved in the rat, supporting the possibility for conservation of function among other vertebrates. The nucleolar localization function of PinX1 is also conserved in the rat. Cellular overexpression of rat PinX1 in mouse cells caused gradual telomere shortening, but no observable impact on telomerase activity. This does not conclusively refute the possibility for rat PinX1 inhibition of telomerase, however, as a recombinant protein may be necessary for detection of this effect (Oh et al., 2007). Xenopus laevis PinX1 has been previously cloned and its expression in various tissues characterized. There is differential PinX1 expression among X. laevis tissues, exhibiting a negative relationship between PinX1 abundance and telomerase activity (Gaubatz, 2007). There have been preliminary investigations into the function of X. laevis PinX1 as a telomerase inhibitor, though there is no conclusive evidence thus far (Constant, 2009).

18

The roles of telomeres, TRF1 and PinX1 in oncogenesis

Because of their role in maintaining chromosome integrity and facilitating cell proliferation, defective telomeres play a crucial role in oncogenesis. The expression of the human telomerase TERT component in fibroblasts results in telomere elongation. Continuous activity of telomerase causes these cells to be immortal, avoiding senescence caused by the gradual telomere shortening that occurs during successive cell replication (Verdun and Kalseder, 2007). Telomerase-activity-linked expression of hTERT occurs in about 85% of cancerous cells. Such expression is thus the best available marker for cancer detection (De Boeck et al., 2009). Because of their regulatory effects on telomerase, TRF1 and PinX1 have implications in the proliferative potential of cancerous cells. Overexpression of the TRF1 isoform Pin2 induces apoptosis in cells with short telomeres, though it does not have this affect in cells with long telomeres. Down-regulation of TRF1/Pin2 permits the maintenance of long telomeres by allowing greater telomerase access to the chromosome ends. TRF1/Pin2 abundance is significantly lower in cancerous tissues, suggesting that this down-regulation is key for the proliferative capability of tumor cells (Kishi et al., 2001a). Overexpression of human PinX1 decreases telomerase activity and therefore also reduces the proliferative potential of cancerous cells. Depletion of PinX1 expression increases telomerase activity and tumorigenicity (Zhou and Lu, 2001). Overexpression of human PinX1 forces hTERT to translocate from the nucleoplasm to the nucleolus of cancer cells. A mutant version of hPinX1 reported in some cancers does not have the capacity for this hTERT nucleolar localization. Mutations of two residues that are found commonly in human hepatocarcinoma patients were introduced to an hPinX1 construct, disrupting the ability of the mutant construct to accumulate in the nucleolus. This blockade to nucleolar localization would, in turn, disrupt the ability of PinX1 to sequester hTERT in the nucleolus (Lin et al., 2007). These observations suggest that PinX1 may be a tumor suppressor in humans.

The interaction of PinX1 and Trf1

PinX1 was first identified as a TRF1/Pin2-interacting protein in a human HeLa cell yeast two-hybrid cDNA library screen (Zhou and Lu, 2001). Pin2 is a splice variant of TRF1, structurally identical apart from an internal 20 aa deletion. Pin2 is 5-10 fold more abundant in cells than TRF1 (Shen et al., 1997). The interaction of PinX1 and TRF1/Pin2, both in vivo and in vitro, was further confirmed via coimmunoprecipitation and colocalization experiments (Zhou and Lu,

19 2001). The TRFH domain of human TRF1/Pin2 binds the R284-E-G-R-D-F-T-L-K-P-KK-R-R-G-R299 fragment of PinX1. This interaction was confirmed by ITC (isothermal titration microcalorimetry) using TRF2 as a non-binding control. This PinX1 binding region contains the conserved motif F/Y-X-L-X-P, also found in the TRFH-interacting domains of TIN2 and Apollo. The PinX1 R291-L and the TRF1 R142-F residues were crucial to this interaction in mutagenesis studies (Chen et al., 2008).

Xenopus as a model organism

X. laevis is an especially ideal model for studying cellular and developmental genetics, as its embryos are particularly large and manipulable. Progeny are quickly generated from in vitro fertilizations and embryos have easily identifiable developmental stages. These characteristics, along with differences in telomere length and patterns between individuals, make X. laevis an interesting model for the study of telomere variation (Bassham et al., 1998). In humans, telomerase is not expressed in most somatic tissues. This lack of telomerase causes telomeres to shorten and cells to senesce after a certain quantity of divisions (Chan and Blackburn, 2004). Xenopus laevis is an ideal model organism for the study of telomere function because it exhibits constitutive telomerase activity in all somatic tissues (Bousman et al., 2003) and developing embryos (Mantell and Greider, 1994). Xenopus telomere length regulation is different from that observed in humans, in that telomeres in Xenopus somatic cells are no shorter than germ cells (Bassham et al., 1998). In Xenopus egg extracts, the activity of telomerase is higher when associated with interphase than with mitotic chromatin, suggesting that telomere length is actively regulated by cell cycle dependent recruitment of TRF1 to telomeres (Nishiyama et al., 2006). As discussed in more detail above, Xenopus laevis TRF1 (xlTRF1) has previously been sequenced and characterized, and a clone is readily available in the lab for further manipulations. Both X. laevis and X. tropicalis have homologs of TRF1 with a truncated D/E-rich acidic domain. The hTRF1 motif, RXXPDG, that interacts with the hTRF1 regulator tankyrase is not present in this shortened acidic domain, which may have implications for xlTRF1 regulation. The X. laevis dimerization domain shares 49% identity and 68% similarity with the human equivalent (Crumet et al., 2006). This high identity within the X. laevis TRFH dimerization domain may have implications for the interaction of this region with PinX1.

20 Xenopus laevis PinX1 (xlPinX1) has previously been cloned and is readily available in the lab. A previous study found a negative relationship between endogenous PinX1 abundance and telomerase activity in X. laevis tissues (Gaubatz, 2007). The differential telomerase activity among tissues is not due only to diffusible inhibitors of telomerase, as shown by mixing experiments combining extracts from tissues with high and low telomerase activity (Bousman et al., 2003). The TERT unit of X. laevis telomerase has been cloned (Kuramoto et al., 2001) and characterized previously. Human PinX1 interacts with the hTERT regions aa 17-546 and aa 523-925 (Banik and Counter, 2004).

Experimental goals and design

This study strives to investigate the in vitro interaction of TRF1 and PinX1 in Xenopus laevis. This interaction has previously been established with the human homologues of these proteins (Zhou and Lu, 2001). Ascertaining whether the Xenopus proteins interact in a similar fashion will provide another building block towards using Xenopus as a model organism for the study of telomeres and telomeric regulation. This study aims to use epitope tagged clones of the xlTRF1 and xlPinX1 proteins to investigate interaction in a coimmunoprecipitation assay. As it has not yet been confirmed in X. laevis that TRF1 does in fact form a homodimer, the experiment will also test this potential in parallel, through coimmunoprecipitation assays with epitope-tagged full-length xlTRF1 and the xlTRF1 dimerization domain. One possible hypothesis is that the X. laevis proteins TRF1 and PinX1 will exhibit the same interaction as they do in humans. Xenopus TRF1 has exhibited very similar structure and functions to those of humans and other vertebrates (Crumet et al., 2006; Nishiyama et al., 2006). If the X. laevis proteins are found to interact, this outcome would be in line with the trend of intra-species conservation of telomeric protein function among vertebrates. Another possible hypothesis is that X. laevis PinX1 and TRF1 will be shown not to interact. Such a finding would move toward a model for X. laevis telomere regulation that is, at least in one aspect, substantially different from that for humans. Finding that the proteins do not interact would imply the evolution of some other mechanism by which X. laevis regulates its abundant telomerase. This hypothesis can first be refined by probing the conservation of the interacting domains of PinX1 and TRF1 between X. laevis and humans. The amount of identity in these regions between species (discussed further in the results and discussion section

21 below) could provide a refined hypothesis of the likelihood that PinX1 and TRF1 interact. But if the domains are not highly similar between species and the proteins are still shown to interact, this finding would provide valuable information as well in the quest for better understanding of the relationships of protein interactions among and within species.

Materials & Methods

Sequence alignment analysis
Preliminary analyses were performed to visually compare TRF1 and PinX1 gene and protein sequences between different species. Sequence data was retrieved from the NCBI Entrez Nucleotide database (http://www.ncbi.nlm.nih.gov/sites/entrez?db= nuccore) and aligned using the program Multiple Sequence Alignment by ClustalW (http://align.genome.jp/). The program BoxShade (http://www.ch.embnet.org/software/ BOX_ form.html) was then used to shade the sequences in a visually logical pattern corresponding to similarity and identity of individual residues. The PinX1 protein sequences used were human (AAS19507), Xenopus laevis (sequence of clone available in lab, Gaubatz, 2007), Xenopus tropicalis (translation from mRNA EU520259), mouse (NP_082504) and rat (ABO28828). The TRF1 sequences used were human (AAB54036), Xenopus laevis (sequence of clone available in lab, Crumet and Shampay, unpublished), Xenopus tropicalis (NP_001137394), mouse (NP_033378), and chicken (ACD68268).

PCR construction of Myc-tagged xlTRF1dd

Primer design Polymerase Chain Reaction (PCR) primers were designed to amplify the gene of interest with epitope tag sequences (Table 2.1). The primers were designed using gene sequences of an xlTRF1 (Crumet et al., 2006) clone already available. The full-length xlTRF1 protein sequence of the clone of study is available in Figure 3.1. The program DNA Strider (CEA, France) was used to reverse translate epitope tag sequences into DNA primer sequence. Primers were designed using the program AmplifX v.1.4 (Institut Jean Roche) to check for potential primer-dimer complications and to anticipate annealing temperatures for PCRs. Primers for xlTRF1dd sequences were obtained from IDT.
Table 2.1. PCR primers used to create Myc-tagged xlTRF1dd construct.

Primer name xlTRF1dd-F (w/ MluI site, kozak sequence, Myc tag) xlTRF1dd-R (w/ NotI site)

5 3 Sequence ACGCGTaccatgggcGAACAGAAGTTGATTTCCGAAG AAGACCTCgatgacacggccGCTGTTG GCGGCCGCttaCTGAATATCCAGTTCTTCTTTTGCT

24 Amplification of desired construct PCR was used to amplify the dimerization domain from the xlTRF1 T16 pCR2.1 plasmid clone available (Crumet et al., 2006). Each 25 L PCR was run in a thin-walled PCR-specific 0.2 mL tube. PCRs included the following reagents, each an aliquot from a master mix designed for multiple reactions: 0.25 L Phusion HighFidelity DNA Polymerase (2 U/L; Finnzymes), 5 L 5X Phusion High-Fidelity buffer (1X final; Finnzymes), 0.5 L dNTPs (200 M final each of dATP, dGTP, dCTP, dTTP; New England Biolabs), 0.25 L each of forward and reverse primers (0.25 M final; IDT), 100 pg T16 xlTRF1 pCR2.1 plasmid DNA template (generous gift of J. Shampay), and 18.25 L nanopure H2O to bring to final volume. PCRs were performed in a MJ PTC-200 Peltier Gradient Thermal Cycler (MJ Research). Conditions for the PCR program were optimized by first running several reactions over a gradient of annealing temperatures to find the optimal temperatures of 50C (first 5 cycles) and 64C (final 25 cycles) for xlTRF1dd amplification. Reactions were run under cycle conditions with two different annealing temperatures, as specified in Table 2.2. Such optimization was crucial due to the particularly lengthy nature of the xlTRF1dd-F primer.
Table 2.2. Cycling program for amplification of xlTRF1dd.

Step # 1 2 3 4 5 6 7 8 9 10 11

Purpose Initial Denaturation Denaturation Annealing Extension Repeat steps 2-4 Denaturation Annealing Extension Repeat steps 6-8 Final Extension Hold

Temperature 98C 98C 50-58C gradient 72C

Duration 30 sec 10 sec 30 sec 20 sec (5 cycles total)

98C 64-72C gradient 72C

10 sec 30 sec 20 sec (25 cycles total)

72C 4C

10 min

25 To ensure the production of appropriately sized products, a portion of each PCR product was analyzed on 1% SeaKem LE agarose gel in 1X TBE buffer (ISC). Gels were run at 106 V for approximately 45 minutes. A 100 bp DNA ladder (New England Biolabs) was used as a size marker for product comparison. Gels were stained for 15-30 minutes in ethidium bromide (1 g/mL) and de-stained for 10-20 minutes in deionized water. Gels were visualized via trans-UV illumination in a Kodak EDAS 290.

Subcloning of xlTRF1dd PCR product into intermediate vector

PCR product purification PCR products were purified to stop the action of the Phusion polymerase in preparation for topoisomerase-mediated subcloning of the xlTRF1dd gene. The products from multiple PCRs were pooled in one vial. Nanopure water was added to bring the total volume to 100 L. An equal volume (100 L) of phenol:chloroform:IAA was added to the vial and the reaction was shaken until cloudy. The sample was then spun for 10 minutes at 2000 xg and the aqueous phase was transferred to a clean tube. To this aqueous phase, 1/10 volume (10 L) of 3 M NaCl was added, followed by 2.5 volumes (250 L) of cold (-20C) 95% EtOH. The reaction was vortexed briefly, then placed on ice for 20 minutes. The tube was centrifuged at 12000 xg for 15 minutes. Excess EtOH was removed by pipetting, leaving a pellet of DNA in the bottom of the vial. The pellet was dried at room temperature for about 20 minutes before proceeding with the next step. The dried DNA pellet was resuspended in 21.5 L of nanopure H2O with 2.5 L of 10X Taq buffer (New England Biolabs) and 0.5 L Taq polymerase (New England Biolabs) to add an A overhang for TOPO cloning. The reaction was incubated for 10 minutes at 72 C before proceeding immediately to TOPO cloning. Products from the Taq polymerase A overhang addition were confirmed by visualization on a 1.0% agarose gel. Subcloning and transformation of E. coli Subcloning of xlTRF1dd was performed using the TOPO TA Cloning kit (Invitrogen). Four microliters of purified PCR product with A overhangs was combined with 1L TOPO kit salt solution and 1L pCR8/GW/TOPO vector (hereafter abbreviated TOPO vector). The reaction was mixed gently and incubated for 5 minutes at room temperature and then placed on ice. These clones were then transformed into One Shot chemically competent E. coli cells (Invitrogen). For each reaction, one vial of One Shot cells was thawed on ice and

26 divided into two 25 L aliquots. Subsequently, 1.5 L of the TOPO cloning reaction product were added to one of these 25 L aliquots of cells. The other aliquot was used as a positive control for transformation by addition of 10 pg of pUC19 vector, a supercoiled control plasmid. Cells were mixed gently with these vector additions and incubated on ice for 30 minutes. Cells were heat shocked for 30 seconds in a 42C water bath and immediately returned to ice. Next, 250 L of room temperature S.O.C. medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, 20 mM glucose) was added to these cells. The vials were capped and shaken horizontally at 200 rpm in a 37C incubator for one hour. Reactions utilizing the xlTRF1dd transformants in the pCR8/GW/TOPO vector were plated on LB agar plates containing 100 g/mL spectinomycin. Transformants with the pUC19 control plasmid were selected for on 100g/mL ampicillin LB agar plates. Each reaction was plated in two different amounts of 10 L and 290 L to ensure at least one plate with a good distribution of colonies. Plates were incubated overnight at 37C. Small plasmid DNA isolations Plasmid-containing bacteria were grown overnight in 2 mL LB liquid cultures inoculated with appropriate selection antibiotic, shaking at 200 rpm in a 37C inclubator, slanted for aeration. From each of these cultures, 500 L were transferred into plastic reaction tubes and centrifuged at 12,000 xg for 1 minute. The supernatant was removed and the cells were resuspended in 100 L STET buffer (5% Triton X-100, 8% w/v sucrose, 50 mM EDTA, 50 mM Tris (pH 8.0)). Following suspension, 10 L of freshlyprepared lysozyme solution (10 mg/mL) was added to each sample. Samples were boiled for 45 seconds then immediately centrifuged for 10 minutes at 12,000 g. The resulting large, balloon-like pellets of cellular detritus and chromosomal DNA were then removed from the samples and discarded. To the remaining supernatant, 100 L of cold isopropanol was added. The samples were then vortexed and chilled at -20C for 30 minutes. DNA was collected by centrifugation for 10 minutes at 12,000 g. The supernatant was removed from each sample and the remaining pellets were resuspended in 25 L RNase A solution (50 g/mL in TE buffer). Samples were incubated for 30 minutes at 37C, and stored at 4C for later use. Analysis of isolated plasmid DNA TOPO plasmid isolations were checked for proper size of insert with double digests with MluI and NotI restriction enzymes. DNA was treated with a master mix (1x

27 final concentration NEBuffer 3, 0.1 mg/mL final concentration bovine serum albumen) and cut with five units (0.5 L each) of MluI and/or NotI enzymes (New England Biolabs). Reactions were incubated overnight at 37C. Restriction digest products were visualized by electrophoresis in 1.0% SeaKem LE agarose in 1X TBE buffer. Samples of plasmid DNA were purified by polyethylene glycol (PEG) precipitation. An equal volume of 13% PEG in1.6 M NaCl was added to plasmid DNA preparations. The reaction was placed on ice for 20 minutes, then centrifuged at 12,000xg at 4C for 15 minutes. The resulting pellet was rinsed with cold 70% EtOH and suspended in 20 L nanopure H2O. DNA concentration was quantified on 0.8% SeaKem LE agarose in 1X TBE buffer by comparison with lanes of -phage DNA cut with HindIII (25ng and 75ng; New England Biolabs). Sequencing was performed following procedure outlined below.

Construction of pTNT in vitro translation clone

Ligation into pTNT vector Proper clones containing both the xlTRF1dd and Myc-tag epitope sequences were cut out of the TOPO vector using the same restriction digestion protocol outlined above. The pTNT in vitro translation vector (Promega) was cut in its multiple cloning site using these same MluI and NotI restriction enzymes, using the procedure described above for TOPO clone analysis. DNA was treated with a master mix (1x final concentration NEBuffer 3, 0.1 mg/mL final concentration bovine serum albumen) and cut with five units (0.5 L each) of MluI and/or NotI enzymes (New England Biolabs). The samples were then heat inactivated for 20 minutes at 65C. Samples of each of the digestion products (3 L each of MluI- and NotI-digested pTNT vector and TRF1ddTOPO vector) were run on a 0.8% agarose gel and quantified by comparison with lanes of -phage DNA cut with HindIII (25ng and 75ng). The xlTRF1dd-Myc clones were then ligated into the pTNT in vitro translation vector, using an approximately 2-to-1 ratio of insert to vector to produce optimal ligation results. The reaction combined 12 L double-digested TRF1dd-TOPO plasmid DNA (approximately 150-200 ng), 2 L double-digested pTNT vector (approximately 65 ng), 2.5 L T4 DNA ligase buffer with 10mM ATP (1X final; New England Biolabs), 1 L T4 NA ligase (400 units/L; New England Biolabs), and nanopure H2O to a final volume of 25 L. The ligation reaction was incubated overnight at 17.5C.

28 Transformation of E. coli with pTNT-xlTRF1dd vector The ligation product was transformed into One Shot chemically competent E. coli cells (Invitrogen). One vial of One Shot cells was thawed on ice and divided into two 25 L aliquots. Subsequently, 3.5 L of the pTNT-xlTRF1dd ligation product were added to one of these 25 L aliquots of cells. A positive control reaction and transformation procedures were performed as outlined above for E. coli transformation with TOPO clones. The reactions were then plated on LB agar plates with 100 g/mL ampicillin. The pTNT-xlTRF1dd transformation reaction was plated in three different amounts of 10 L, 25 L and 240 L. Control pUC19 transformations were plated with 10 L and 265 L. Plates were incubated overnight at 37C. Plasmid DNA was isolated and analyzed by restriction digestion. pTNT-xlTRF1dd plasmid purification The pTNT-TRF1dd plasmid was purified using the QIAfilter Midi Plasmid Purification Kit (all components from Qiagen unless otherwise noted). A large 100 mL of ampicillin-selective (100 g/mL) LB medium culture was inoculated with 200 L of starter culture from the initial ligation products. The culture was grown overnight at 37C shaking at 300 rpm. The culture was divided into two 50 mL conical tubes and centrifuged at 3000xg at 4C for 30 minutes. One of the resulting pellets was resuspended by vortexing in 4 mL Buffer P1 with RNase A (final 100 g/mL). Next, 4 mL of Buffer P2 was added and the solution was mixed by inversion before incubation at room temperature for 5 minutes. To the lysate was added 4 mL chilled Buffer P3. The lysate was mixed by inversion, poured into the QIAfilter cartridge, and incubated at room temperature for 10 minutes. A QIAGEN-tip 100 was equilibrated by gravity flow of 4 mL of Buffer QBT through the tip. The QIAfilter cartridge outlet nozzle tip was removed, the plunger was inserted, and the lysate was filtered into the equilibrated tip. The lysate was allowed to enter the tip resin by gravity, then the tip was washed with two 10 mL volumes of Buffer QC. The DNA was eluted into a glass centrifuge tube with 5 mL Buffer QF. The eluate was precipitated with 3.5 mL of room temperature isopropanol, mixed, and centrifuged at 15,000xg for 30 minutes at 4C. The supernatant was decanted and the pellet was washed with 2 mL of room temperature 70% EtOH. The solution was centrifuged at 15,000xg for 10 minutes at 4C. The supernatant was decanted and the pellet dried for 10 minutes. The pellet was redissolved in 100 L nuclease-free TE. A sample of this DNA (0.5 L) was digested with 4 units each of MluI and NotI restriction endonucleases (New England Biolabs) in NEBuffer3 and BSA (1X final each;

29 New England Biolabs) in a final volume of 20 L. These samples of the purified DNA (0.2 L, 0.5 L, and 1.0 L uncut, and 1L and 3L restriction digested) were run on a 0.8% SeaKem LE agarose gel in TBE and quantified by comparison with lanes of phage DNA cut with HindIII (25ng and 75ng). Sequencing was performed following the procedure below.

Sequence analysis of plasmid DNA

For sequencing of both TOPO and pTNT clones, approximately 150-300 ng of purified template DNA were combined with either 3.2 pmol of the appropriate forward or reverse primer to a final volume of 9 L in 0.2 mL PCR tubes. These samples were sent to the Vollum DNA sequencing core facility. The resulting sequence files were visualized with FinchTV software (Geospiza, http://www.geospiza.com/Products/finchtv.shtml). Text files of each of the sequences were created in DNA Strider (CEA, France). These text files were then aligned in the DNA anti-parallel method and analyzed for inconsistencies between forward and reverse sequences. The resulting sequence data was compared with published sequences to ensure the construct was properly inserted without mutations or deletions.

In vitro expression of proteins

Protein products were created using the TNT coupled reticulocyte transcription/translation kit (all reagents from Promega except plasmid templates). The xlTRF1-Flag plasmid template was the generous gift of J. Jin (cloning described in Jin, 2009). The TNT T7 quick master mix was rapidly thawed then placed immediately on ice. The reaction was assembled with the following components: 20 L TNT T7 quick master mix (containing TNT rabbit reticulocyte lysate, TNT reaction buffer, TNT T7 RNA polymerase amino acid mixture minus leucine, RNasin ribonuclease inhibitor, and amino acid mixture minus methionine), 0.5 L methionine (1 mM), 1.0 L Transcend tRNA, ~0.6 g plasmid DNA template, and nuclease-free H2O to a final volume of 25 L. A parallel control reaction was performed to translate luciferase. The reaction was assembled with the following: 20 L TNT T7 quick master mix, 0.5 L methionine (1 mM), 1.0 L Transcend tRNA, 1 L luciferase control DNA template (0.5 g/L), and nuclease-free H2O to a final volume of 25 L. The components were gently mixed by pipetting and then incubated at 30C for 90 minutes. Reactions used for immunoprecipitation and coimmunoprecipitation procedures contained the following components (double these volumes for co-IP): 40 L TNT T7

30 quick master mix, 1.0 L methionine (1 mM), 2.0 L Transcend tRNA, 5.0 L 7X protease inhibitor (Roche), 1.2 g purified plasmid DNA template, and nuclease-free H2O to a final volume of 50 L. The contents were gently mixed and incubated as above at 30C for 90 minutes.

Immunoprecipitation
Immunoprecipitation (IP) was performed to isolate the proteins of interest. Ten percent of each in vitro translation reaction was set aside to serve as an input comparison in SDS-PAGE analysis of IP results. First, Protein A Magnetic Beads (New England Biolabs) were precleared for nonspecific binding from the translation reaction reticulocyte lysate. To do this, 25 L of Protein A Magnetic Beads were added to the remaining 45 L of the in vitro translation product. The mixture was mixed gently and incubated for 1 hour at 4 C with rotation. A magnetic field was applied with a BioMag Microcentrifuge Tube Separator (Polysciences, Inc.) to pull the beads to the side of the tube, and the supernatant was transferred to a clean tube. The beads were kept for later comparison with elutions of desired IP product. Next, 4 g of the appropriate antibody for each construct was added to the supernatant. The mixture was again gently mixed and incubated for 2 hour at 4 C with rotation. Then, 25 L of fresh Protein A Magnetic Beads were added and gently mixed, and the solution was then incubated for 1 hour at 4 C with rotation. Following incubation, the magnetic field was applied to the side of the tube and the supernatant set aside for later comparison. The protein beads were washed four times with 500 L of TBS (25 mM Tris base, 150 mM NaCl, pH 7.6), gently mixing the contents each time then removing the supernatant after pulling the beads to the side with the magnet. The bead pellet was resuspended in 30 L 1X SDS sample loading buffer (50 mM Tris-HCl (pH 6.8), 2% SDS, 0.1% bromophenol blue, 10% glycerol, 100 mM DTT). The protein and antibody was eluted from the beads by incubating suspension at 70 C for 5 minutes. The magnetic field was applied again and the supernatant removed. This supernatant contains the immunoprecipitated protein and was run on SDS-PAGE gels in various dilutions.

Coimmunoprecipitation
Purified xlPinX1-His protein was the generous gift of D. Constant (cloning and expression described in Constant, 2009). A xlPinX1-His mixture had to be developed that mimicked the in vitro translated xlTRF1full-Flag protein. To do this, a 100 L

31 reticulocyte transcription/translation reaction was performed as outlined above, only without any plasmid template. The mixture for this reaction was incubated at 30 C for 90 minutes in parallel to mimic the translation conditions of the xlTRF1full-Flag reaction. For co-immunoprecipitation (co-IP), 50 L of this xlPinX1-His mixture was combined with 50 L of in vitro translated xlTRF1full-Flag product. This solution was incubated for 30 minutes at 30 C. Just as for the IP, a portion of the mixture was then set aside for an input comparison, and the rest was split into two 40 L, one each to have a co-IP performed with either the Flag or His antibody (Sigma). The rest of the co-IP procedure copies that of the IP, starting with the step intended to preclear the Protein A Magnetic Beads from nonspecific binding. IP experiments were performed in parallel with the other 50 L from each of the in vitro xlTRF1full-Flag and mock-in vitro xlPinX1-His solutions created above. A schematic of the experimental design for the IP and co-IP reactions and visualization procedures for each antibody can be found in Figure 3.12.

Visualization of proteins
SDS-PAGE separation of protein products Samples were prepared in 15 L final volume of 1X SDS sample loading buffer (50 mM Tris-HCl (pH 6.8), 2% SDS, 0.1% bromophenol blue, 10% glycerol, 100 mM DTT). Input protein samples were denatured in this buffer volume for 10 minutes at 60C. (The 5 minute, 70 C incubation at the end of the IP procedure serves to similarly denature IP and co-IP protein samples.) Samples were run on two halves of a 15% denaturing polyacrylamide gel (40% acrylamide/bisacrylamide, 10% SDS, 1.5 mM Tris (pH 6.8), 10% ammonium persulfate, tetramethylethylenediamine) along with unstained and stained protein standards (Bio Rad Precision Plus) brought to a final volume of 15 L with 1X SDS sample loading buffer. Gels were run in 1X Tris-Glycine Electrophoresis buffer (25 mM Tris base, 250 mM glycine, 0.10% SDS) at a constant 200 V until all dyes from the loading buffers had run off the bottom of the gel. Visualization of total protein For initial detection of total protein and standards, one half of a gel with duplicate samples was visualized using Coomassie Fluor (Invitrogen). Gel was incubated in 30 mL Coomassie Fluor in a covered dish for 1 hour with gentle shaking. Excess stain

32 was rinsed off in H2O for 5 minutes. Gel was visualized and photographed via trans-UV illumination in a Kodak EDAS 290. Electroblotting Proteins were electroblotted to a nitrocellulose membrane. The Genie Blotter (Idea Scientific Company) transfer apparatus was assembled with the gel was sandwiched next to the membrane in between thin blotting paper, sponges and two electrodes. The membrane and adjacent components were submerged in X Transfer buffer / 10% methanol (12.5 mM Tris, 96 mM glycine, 10% methanol). The protein was transferred for 1 hour at 12 V. The membrane was removed from the device. Standards and other transferred proteins were visualized by staining in Ponceau for 5 minutes. Major transferred bands were marked with a permanent pen and membrane was destained in H2O. The membrane was blocked in TBST (TBS pH 7.6, 0.5% Tween 20) for anywhere from an hour to overnight. Detection of biotin labeled amino acids Colorimetric detection was performed to visualize Transcend biotin labeled amino acids incorporated into in vitro-expressed proteins. The blocked membrane was incubated with 6 L Streptavidin Alkaline Phosphatase (Promega) in 15 mL TBST for 1 hour with shaking. The membrane was washed twice in 15 mL TBST for 1 minute each, then twice in 15 mL water for 1 minute each. Color signal was developed by incubating in 5 mL Western Blue Stabilized Substrate for Alkaline Phosphatase (Promega) for 515 minutes until the bands reached a desired intensity. The membrane was washed in H2O for several minutes to stop the development reaction and then air-dried for storage. Detection of His-tagged protein on western blot A western was performed to visualize IP and co-IP reactions precipitated with a His antibody. Following electroblot transfer to a nitrocellulose membrane and blocking in 3% BSA in TBST, the membrane was washed twice for 10 minutes each in 15 mL TBST with shaking. The membrane was incubated in 10 mL His-probe (Pierce) working solution (1/5000 dilution of His probe in TBST with 3% BSA) for 1 hour with shaking. The membrane was washed four times in 15 mL TBST for 10 minutes each. The probe was detected by incubating in 1.6 mL pre-mixed Western LightningPlus-ECL (PerkinElmer Life Sciences, Inc.) equal parts oxidizing and enhanced luminol reagents for 5 minutes. Excess Western Lightning substrate was drained and the membrane was placed between two transparency sheets with occasional rocking. The membrane was

33 exposed to Blue Lite Autorad Film (ISC) in a light-tight folder for periods ranging from 30 seconds to 10 minutes. The film was developed in GBX Developer and Replenisher (Kodak) for 5-10 minutes, rinsed for 30 seconds, fixed in GBX Fixer and Replenisher (Kodak) for 5-10 minutes, washed in running water for 5-10 minutes and hung to dry.

Results & Discussion

Overview
The present study endeavored to express three proteins in vitro in order to study the interaction of Xenopus laevis TRF1 and PinX1 (hereinafter abbreviated xlTRF1 and xlPinX1, respectively). The constructs involved in the study were a His- and GFP-tagged xlPinX1, a Flag-tagged full-length xlTRF1, and a Myc-tagged xlTRF1 dimerization domain. X. laevis PinX1 and full-length TRF1 have previously been cloned. This chapter first outlines the cloning and expression of the xlTRF1 dimerization domain (xlTRF1dd) protein with a unique Myc epitope tag. Next, it describes preliminary experiments to test the interaction of xlPinX1 and xlTRF1.

In silico protein sequence analyses

As a preliminary analysis and to aid in the development of primers, the nucleotide and amino acid sequences of TRF1 and PinX1 proteins were compared. These alignments make evident the regions of similarity and divergence between the homologues of the proteins of study in different species. TRF1 sequence analysis A species comparison of TRF1 protein sequences is presented in Figure 3.1. There is significant identity between X. laevis and human sequences of the TRF1 dimerization domain, indicating a good chance that the domains function and interaction characteristics will be conserved between species. The dimerization domain of human TRF1 (hTRF1) comprises residues 72-265. The X. laevis sequence that aligns with this region of hTRF1 the putative xlTRF1dd stretches from residues 15-211 (based on TRF1 sequence available in lab). The putative xlTRF1dd is further towards the Nterminus than its human homologue in because xlTRF1 is characterized by a truncated Nterminal acidic domain (Crumet et al., 2006). The dimerization domain region shows more significant identity between species than most of the rest of the TRF1 sequence, with the exception of a high inter-species identity in the C-terminal Myb domain. The xlTRF1 Myb domain is characterized by 76% identity with the hTRF1 Myb domain, and the dimerization domain shares 49% identity and 68% similarity with the human equivalent (Crumet et al., 2006).

36

Figure 3.1. TRF1 amino acid sequence alignment among species. Star indicates conserved residue R142-F. Line indicates the region corresponding to the human TRF1 dimerization domain. This region was the sequence cloned in the xlTRF1dd Myc-tagged construct. Sequences used for alignment are human (AAB54036), mouse (NP_033378), chicken (ACD68268), Xenopus laevis (sequence of clone available in lab, Crumet and Shampay, unpublished), and Xenopus tropicalis (NP_001137394).

This high sequence similarity of the dimerization domain between human and X. laevis proteins lends credence to the possibility of similar domain interaction functions in the

37 two species. Furthermore, the TRF1 residue found to be essential for interaction with PinX1 in humans, R142-F (Chen et al., 2008), is conserved across all species aligned, including X. laevis, further supporting the potential for X. laevis TRF1-PinX1 interaction. Xenopus TRF1 exhibits a polymorphism at residue 27, with some clones exhibiting an A (Crumet et al., 2006; accession numbers AAH75168, DQ000293), and others a T (Crumet et al., unpublished observations). The sequence with the R27-T residue was used for the alignment in Figure 3.1, as this is the sequence in the available clone. PinX1 sequence analysis A cross-species comparison of PinX1 protein homologues is presented in Figure 3.2.

Figure 3.2. PinX1 amino acid sequence alignment among species. Line indicates region of human PinX1 found to bind the TRF1 homology / dimerization domain. Protein sequences used are mouse (NP_082504), rat (ABO28828), human (AAS19507), Xenopus laevis (sequence of clone available in lab, Gaubatz, 2007), and Xenopus tropicalis (translation of mRNA EU520259).

38 The N-terminus of PinX1 exhibits significant identity among the five species presented, with only occasional differences in sequence up through residue 153. Both Xenopus species have two 9-12 aa inserts in the middle of the protein. The X. laevis and human PinX1 alignments exhibit 42.9% identity and 55.7% similarity. In humans, the R284-S-G-R-D-F-T-L-K-P-K-K-R-R-G-R299 fragment of PinX1 interacts with the TRFH/dimerization domain of TRF1 (Chen et al., 2008). Alignments of the PinX1 interaction domains, including the domain in X. tropicalis, are presented in Figure 3.3. Of note is the difference between the hPinX1 sequence published online and supported by Zhou and Lu (2001) and that sequence used by Chen et al. (2008) in their analyses. The Chen et al. sequence replaces the R285-S at the N-terminus of the segment with a R285-E residue. Though this difference has no effect on the alignments of the human and X. laevis sequences, it does impact their sequence similarity.
(A) (B)

Figure 3.3 Cross-species alignment of domain of PinX1 that interacts with TRF1dd. Alignment of PinX1 domains found to (in human) or purported to (in Xenopus) interact with the TRF1dd. The FxLxP domain is indicated with a line above both alignments. Star indicates R291-L, a residue essential for TRF1 interaction in humans. (A) Segment alignment based on alignment of full-length PinX1 sequences (Figure 3.1). (B) Segment alignment based on KPKKR motif.

There are two possibilities for homologous sequences in X. laevis that correspond to the TRFH-interacting human PinX1 fragment. One X. laevis sequence (Figure 3.3A) is what results from aligning the full-length PinX1 sequences (Figure 3.2), and spans X. laevis residues 311-324. Only 3 of the 14 (21%) residues exhibit exact identity between human and Xenopus sequences (when the Chen human sequence is used as the more generous comparison), though an additional 3 aa do have functional similarity to their corresponding human residues. The other option for PinX1 interaction domain alignment is presented in Figure 3.3B. This is a manual alignment of a short peptide only, prioritizing the nearby KPKKR residues, and spans X. laevis residues 305-320. Five of the 14 (36%) residues exhibit exact identity in this alignment, with an additional two sharing similarity (50% total). Thus, neither of these alignments exhibit particularly high identity between the protein sequences of this PinX1 interaction domain in the two species.

39 The FxLxP domain found to be critical for the interactions of many proteins with TRF1 in humans is not conserved in Xenopus in either alignment. And the particular residue found by mutagenesis studies to be crucial for the PinX1-TRF1 interaction in humans, PinX1 R291-L (Chen et al., 2008), is not conserved in the Xenopus sequences in either alignment alternative. This suggests one of three possible outcomes from this lack of homology: (1) X. laevis PinX1 and TRF1 may not interact due to the lack of conservation in this critical domain; or (2) the X. laevis PinX1 interacting domain is adequately homologous to facilitate an interaction similar to that between hPinX1 and xlTRF1; or (3) if this homology is inadequate for interaction, any interaction found between xlPinX1 and xlTRF1 must be facilitated by some other feature of the proteins. Interaction with xTERT Human PinX1 interacts with the hTERT N-terminal 17-546 aa and C-terminal 523-925 aa (Banik and Counter, 2004). The N-terminal region of hTERT shares only 27% identity and 40% similarity with that of xTERT (Xenopus TERT), while the Cterminal region exhibits 52% identity and 70% similarity between species. Overall, fulllength xTERT shares 38% identity and 53% similarity with the human homologue (alignment not shown).

Design of experimental constructs

PinX1 construct design The xlPinX1 clone used in this study was originally obtained by J. Gaubatz (2007). A His-tag, a GFP-coding motif, a consensus sequence, and restriction enzyme recognition sites were added to Gaubatz clone to produce a His-GFP-xlPinX1 protein construct via E. coli expression and purification (Constant, 2009). Primers amplify dimerization domain from full-length xlTRF1 clone PCR primers were designed to amplify the dimerization domain from an available full-length xlTRF1 clone (Crumet et al., 2006) and to add on to it sequences containing MluI and NotI restriction enzyme sites, a Kozak consensus sequence, and a Myc-epitope tag (Figure 3.4). The dimerization domain of the xlTRF1 protein amplified by the primers is identified by the red line in Figure 3.1. In order to prevent primer dimers and other PCR artifacts, it was necessary to position the primers to anneal 12 nt to the 5 end of the start of the dimerization domain and 30 nt past the 3 end of the dimerization domain. It was also necessary to introduce a translation stop codon as the natural stop codon for the

40 TRF1 protein falls far beyond the amplified region. The final sequence of the xlTRF1dd section is available in Appendix A.

Figure 3.4. Myc-tagged xlTRF1dd construct resulting from amplification by designed primers. Cartoon is not to scale. Numbers between regions indicate nt positions of region start and end.

PCR products were analyzed on an agarose gel to ensure appropriate size products. The gel showed a band around the expected size (683 bp), as well as four other main bands of larger sizes (results not shown). However, since shorter pieces of DNA are more likely to ligate into vectors, these larger PCR artifacts did not pose a significant challenge to acquiring the desired insert in the following steps.

Intermediate subcloning of xlTRF1dd-Myc construct

Following amplification by PCR, the desired construct was cloned into the pCR8/GW/TOPO intermediate vector (hereafter abbreviated TOPO vector) (Figure 3.5). Topoisomerase-mediated cloning was used as an intermediate step between PCR and restriction enzyme-based plasmid ligation and provides a simple insertion process that does not require cutting PCR products with restriction enzymes. This process is ideal because the restriction sites lie at the terminal ends of the desired construct. Thus, this intermediate cloning process allows for sequencing of the PCR primer-created construct, including the MluI and NotI restriction sites, and confirmation of successful cleavage at these sites before insertion into the in vitro expression vector. The vector is supplied in a linear form with a single 3 thymidine overhang on each end, which complements the single adenosine overhang formed by the terminal transferase activity of Taq polymerase during PCR. The resulting plasmids formed by the complementation of these overhangs include ones containing the xlTRF1dd-Myc insert with MluI and NotI restriction sites (Figure 3.5). Because the thymidine overhangs of the vector and the adenosine overhangs of the construct complement each other indiscriminately, the construct can be inserted in the vector in either direction.

41

Figure 3.5. Insertion of xlTRF1dd-Myc construct in intermediate cloning vector. Diagrams show different potential orientations of MluI and NotI recognition sites at the 682 bp and 1357/9 bp locations. The xlTRF1dd insert lies between restriction sites at 682 bp and 1357/9 bp, with a length of 675 bp after restriction digest. Arrows indicate direction transcription and translation would read along construct transcript. The TOPO vector contains a spectinomycin resistance selectable marker for selection in E. coli.

Transformed bacteria contain intermediate vector with insert DNA from E. coli transformants was analyzed to confirm the expected insertion. The xlTRF1dd construct should contain three MluI and one NotI restriction sites (Figure 3.5). Thus, a double digest of this construct with these enzymes yields four different fragments, only one of which is the desired xlTRF1dd clone. Luckily, the four fragments are easily distinguished by size on an agarose gel (Figure 3.6, lane 3). The 1441 bp, 932 bp and 452 bp bands are all present in the gel visualization, as is the 675 bp band that represents the desired xlTRF1dd construct.

42

Figure 3.6. Analytical gel to confirm restriction digests and estimate concentration of purified TOPO-xlTRF1dd DNA. Lanes 1 and 2: HindIII-cut phage DNA (25 ng and 75 ng, respectively) was included for estimation of sample DNA concentration. Lane 3: TOPO-xlTRF1dd construct digested overnight with MluI and NotI restriction enzymes. Lane 4: Uncut purified TOPO-xlTRF1dd plasmid DNA. Lane 5: pTNT vector linearized by overnight digestion with MluI and NotI restriction enzymes. Lanes 6 and 7: Two ladders, 100 bp and 1kb respectively, were included for sizing. Gel was 0.8% SeaKem agarose in TBE.

Purified xlTRF1dd-Myc construct inserted into in vitro translation vector

The concentration of purified TOPO-xlTRF1dd plasmid DNA was estimated to be 15-20 ng/L by comparison with known amounts of HindIII-cut DNA (Figure 3.6). This concentration was used to determine the amount of the TOPO-xlTRF1dd digestion to include in the ligation reaction, the cut TOPO-xlTRF1dd and in vitro translation vectors were ligated, and the resulting products were used to transform E. coli. Though many products were possible from the ligation (discussed below), the desired plasmid construct resulting from ligation is presented as a graphic in Figure 3.7 and as sequence data in Appendix A.

43

Figure 3.7. Desired pTNT-xlTRF1dd-Myc in vitro translation construct. The expressed protein (light pink) should contain an N-terminal Myc epitope tag (grey) followed by the dimerization domain (dark pink). A Kozak sequence (green) contains a start codon for translation of the protein construct. The construct was inserted into the pTNT vector using MluI and NotI restriction enzymes (sites red). The vector contains a ampicillin resistance gene (orange) to be used as a selectable marker for transformation into E. coli, T7 and SP6 transcription promoters (green), and a T7 transcription termination sequence (not shown). Diagram was created using PlasMapper 2.0 (Dong et al., 2004).

Transformed bacteria contain expression vector with desired insert Transformation of E. coli with ligation was successful, yielding colonies resistant to ampicillin. Plasmid DNA was isolated from cultures grown from individual colonies. Insertion of the desired xlTRF1dd insert was confirmed by restriction digest analysis. Such analysis was necessary to distinguish between the ligation products of several different possible inserts resulting from the multiple cut sites on the TOPO-xlTRF1dd vector constructs (Figure 3.5). Restriction digest reactions were visualized on an agarose gel (Figure 3.8).

44

Figure 3.8. Restriction enzyme analysis of clones obtained from plasmid purification of pTNT-xlTRF1dd samples. Clones g, h, j, k, l, m, n and p were digested with NotI and MluI for 1 hour 15 minutes prior to gel analysis. A100 bp ladder was used for sizing in the left-most lane. In the far right lane, HindIII-cut phage DNA (25 ng) was included for estimation of sample concentration. Gel was 1% SeaKem agarose in TBE.

This gel analysis revealed that only pTNT-xlTRF1dd clones j, l and p contained the desired insert length of 683 bp. Clones g, m and n seem to contain no insert, as the only band in each of those lanes represents the vector at its original size of 2871 bp. Clone k contains an insert between 400-500 bp, consistent with ligation of the 452 bp fragment product of a double-MluI digest of the plasmid in Figure 3.5A or a NotI-MluI digest of the plasmid in Figure 3.5B. Clone h contains this same 452 bp band, as well as a band that could be the 1441 bp restriction product from the MluI-NotI digest of the vector pictured in Figure 3.5A or the MluI double digest of that in Figure 3.5B. These products are likely due to double ligations of multiple TOPO-xlTRF1dd restriction products into the in vitro translation vector. Only clones j, l and p contained the desired construct for future use.

45

Sequence analyses confirm no mutations in xlTRF1dd construct

Plasmid isolations at both stages were both further analyzed to ensure the proper gene and epitope had been cloned. The xlTRF1dd-Myc construct was sequenced to ensure that there were no mutations, insertions or deletions introduced during PCR amplification of the product. Inconsistencies between the forward and reverse sequence reads were resolved by determining which sequence had the stronger quality peak at the location of the questionable nucleotide. The sequence of the inserted construct was found to be identical to the expected sequence of the Myc-tagged xlTRF1dd construct with added MluI and NotI cut sites (Figure 3.9).

Figure 3.9. Sequenced 5 and 3 terminal fragments of xlTRF1dd-Myc construct. Construct was sequenced as insert in both intermediate and in vitro translation vectors. Blue highlighted regions indicate MluI and NotI restriction sites at each terminus. Sequences were obtained from the Vollum DNA Sequencing Core and peaks were visualized using FinchTV (Geospiza).

The sequence data (not shown) confirms successful integration of the Kozak sequence, Myc tag, TAA stop codon, and restriction sites that were not a part of the original TRF1 clone sequence but rather incorporated by the primer design. Alignments with the expected sequence verify that there were no mutations or frame shifts introduced in the final construct. The confirmed sequence of the dimerization domain inserts in both TOPO-xlTRF1dd and pTNT-xlTRF1dd clone j is available in Appendix A.

pTNT-xlTRF1dd clone j used for in vitro translation

Clone j was chosen for further amplification and plasmid purification. A double restriction digest with MluI and NotI followed by agarose gel analysis was used to confirm that the purified plasmid still contained the desired insert and to quantify DNA

46 concentration for further steps (results not shown). This purified plasmid was used in the in vitro transcription/translation reaction using biotin labeled amino acids to allow for detection of newly synthesized proteins. Flag-tagged pTNT-TRF1full was also used in an identical in vitro transcription/translation reaction to express the protein needed for further studies. A reaction with a plasmid containing the luciferase gene was used as a control for successful protein expression. The xlTRF1full-Flag reaction also served as a control for proper translation technique, since attempts to express the full-length protein had previously been successful in the lab (Jin, 2009).

Visualization of protein products

Protein products of both the xlTRF1dd-Myc and luciferase control reactions were then visualized using SDS-PAGE denaturing protein gels. Two identical sets of the protein samples were run on two halves of the gel. The first of these gel sections was stained to visualize total protein in each lane and to identify protein standard size marker locations. The other half of the gel was electroblotted to a nitrocellulose membrane, blocked and stained to visualize the labeled amino acids. The translation detection system incorporates a biotinylated lysine residue into newly synthesized proteins during in vitro translation, which can then be visualized using a specialized chemical interaction with these incorporated residues. Multiple bands were visualized in both TRF1dd and luciferase reactions, making it impossible to confirm production of the expected proteins (data not shown). Similar experiments were performed with products from xlTRF1dd-Myc and xlTRF1full-Flag translation products. Two samples of xlTRF1dd-Myc translation products were included, one from an earlier reaction originally run alongside the luciferase control and the second from a reaction performed concurrently with the xlTRF1full-Flag reaction. Figure 3.10A visualizes total protein from the translation reaction, including all those endogenous proteins necessary for the in vitro transcription/translation machinery. Visualizing this many protein bands is to be expected, and this gel is typical of results from other experiments. However, the biotin-detected membrane (Figure 3.10B) shows a large number of bands in all reaction lanes, obscuring the potential presence of xlTRF1dd-Myc or xlTRF1full-Flag. Membranes were expected only to exhibit bands representing proteins synthesized from the added templates. The high background is representative of that found in the xlTRF1dd-Myc and luciferase reactions above, and in all other analysis

47 attempts of in vitro translation products. The background bands are suspected to be the result of incorporation of the labeled amino acids into expression of the endogenous transcripts present in the lysate of the transcription/translation kit.

Figure 3.10. Visualizations of protein products from in vitro transcription/translation reactions of xlTRF1dd-Myc and xlTRF1full-Flag. Proteins were run on a 15% SDSPAGE gel. Numbers to left of each figure indicate protein standard size in kDa. Lane 1: Dual color protein standard. Lane 2: Unstained protein standard. Lane 3: xlTRF1dd-Myc protein expression product, sample from earlier reaction originally performed alongside the luciferase control reaction. Lane 4: xlTRF1dd-Myc protein expression product. Lane 5: xlTRF1full-Flag protein expression product. (A) Coomassie Fluor stained gel showing total protein present after in vitro reaction. (B) Electroblotted membrane with colorimetric visualization of biotin labeled amino acids.

The especially problematic characteristic of these background bands is not their frequency but their intensity at particular sizes. In particular, there are particularly strong background bands around 30 kD in all lanes (including the luciferase control, data not shown). Since the xlTRF1dd domain is 25 kD, with the biotin labeled residues it may weigh approximately 30 kD and be easily concealed by these background bands. The high background around 50 kD and slighly larger is equally problematic, as that is around

48 the expected size for biotin-labeled full-length xlTRF1-Flag. The background is so intense in these areas that it is impossible to discern any differences in protein signal between the lanes at the sizes where the newly synthesized plasmid proteins might be expected, making TRF1 production unconfirmable.

Immunoprecipitation
Since the studies of total protein from the in vitro translation reaction could neither confirm nor reject the presence of the TRF1 proteins of interest, immunoprecipitation (IP) reactions were performed to isolate the TRF1 proteins from the total reaction. Both xlTRF1dd-Myc and xlTRF1full-Flag in vitro translation products were immunoprecipitated with the corresponding Myc and Flag antibodies, respectively. The products from the IP reactions were run on a denaturing gel, blotted to a membrane, and visualized using detection of the biotin labeled amino acids (Figure 3.11). The results for TRF1full-Flag appeared to be as expected, with a 50 kD band isolated in the IP. What is surprising about this visualization is the presence of the ~50 kD bands in the fifth and sixth TRF1dd IP lanes (indicated by the top white arrow), where one would expect to find only ~25 kD bands representative of the xlTRF1dd-Myc expressed protein. Instead, there are very prevalent 50 kD bands in both the IP and IP lanes. A replication of this experiment using freshly translated protein and a new set of IPs returned the same confusing results. This blot does also show, however, in the sixth IP of xlTRF1dd-Myc lane a band of size slightly larger than 25 kD, perhaps closer to 30 kD (indicated by the bottom white arrow). [However, this band did not appear in the replication of this experiment.] It is possible that the 25 kD could be the xlTRF1dd-Myc protein of interest, running slower on the gel because the incorporated biotins in the labeled amino acids add mass to the in vitro expressed protein. Still, even if this is the dimerization domain, it seems odd that it should appear in the IP lane but not in the IP lane, as it would be expected that any bands would only show up darker in the more concentrated IP lanes. Furthermore, the 50 kD bands still remain unexplained. And the identical nature of the 50 kD bands in both the xlTRF1dd-Myc and xlTRF1full-Flag IP lanes disallows any claim to the successful isolation of xlTRF1full-Flag in lanes 7-10. The xlTRF1dd-Myc lanes are also serving as a negative control for xlTRFfull-Flag, and since the same bands appear in both sets of lanes, it is impossible to confirm the production or isolation of either of the two proteins.

49

Figure 3.11. Biotin labeled amino acids obtained from immunoprecipitation. Proteins were run on a 15% SDS-PAGE gel, electroblotted to a membrane, and visualized via colorimetric detection of labeled amino acids. Image contrast has been adjusted to make bands easier to view. Numbers along left side are protein standard values in kDa. Lane 1: Dual color protein standard. Lane 2: Unstained protein standard. Lane 3: Input sample from xlTRF1dd translation reaction, prior to IP. Lane 4: Input sample from xlTRF1full translation reaction, prior to IP. Lanes 5, 6, 7: One-half, one-quarter, and one-eighth volumes from anti-Myc IP of xlTRF1dd-Myc translation reaction, respectively. Lanes 8, 9, 10: One-half, one-quarter, and one-eighth volumes from anti-Flag IP of xlTRF1fullFlag translation reaction.

Coimmunoprecipitation experimental design

A coimmunoprecipitation (co-IP) experiment was performed to test for in vitro interaction (or lack thereof) between xlTRF1full and xlPinX1, despite the unexpected IP results. Full-length Flag-tagged xlTRF1 was used instead of xlTRF1dd-Myc because the former had previously been successfully expressed and coimmunoprecipitated with another X. laevis telomeric protein in the lab (Jin, 2009). Flag-xlTRF1 and His-GFPxlPinX1 were each immunoprecipitated and coimmunoprecipitated with their appropriate antibodies. The IP and co-IP using the anti-His antibody were run on a denaturing gel, electroblotted to a membrane, and visualized by colorimetric detection of incorporated

50 labeled amino acids. The IP and Co-IP using the anti-Flag antibody were run on a denaturing gel in the same manner, and then visualized using a His-probed western blot. Schematic representations of this experiment and of the band locations that would corroborate a PinX1-TRF1 interaction are shown in Figure 3.12. If the xlTRF1full-Flag and xlPinX1-His proteins interact, one would expect to see all of the bands indicated in the gel diagrams in the lower section of Figure 3.12. Input lanes should show which proteins were present in the mixture before the IP or co-IP reactions were performed. These input lanes serve to ensure that the protein product in each mixture can be visualized, positive controls for the efficacy of the translation and detection systems. Inputs in lanes 1, 2 and 3 in the biotin visualization (right panel) may exhibit substantial background due to the problem of translation of endogenous proteins discussed earlier. Ideally, when visualizing the labeled amino acids, one would be able to view a distinct 50 kD band in lanes 1 and 3 indicating production of the xlTRF1full-Flag protein, but even in the previous detections such discernment was not possible because of this background. Lane 2 should be empty in the biotin visualized gel because xlPinX1-His was not expressed in vitro with labeled amino acids. Ideally, in the absence of substantial background, this lane would serve as an internal negative control to ensure that the biotin labeled residues being visualized in lanes 1 and 3 are not merely artifacts of proteins endogenous to the in vitro translation system. In the western blot (left panel), a different pattern among input bands should be visible. One should see 67 kD bands in both the xlPinx1-His input lane 2 and the co-IP input lane 3, indicating the presence of the His-tagged protein in each. In lane 1 the xlTRF1full-Flag should not react with the His probe, so any signal should be attributed to background from reactivity with the in vitro translation kit reagents, thus serving as a negative control and source for background comparison for the other input bands. Nothing should appear in the IP lanes in either cases of PinX1-TRF1 interaction or non-interaction. Lanes 4 and 5 contain proteins immunoprecipitated with anti-Flag antibody. The antibody should successfully extract xlTRF1dd-Flag from the total reaction, but this IP should not react with the His-probe, and so should not be visible on the western blot. The anti-Flag antibody should not successfully pull down xlPinX1-His, so there should be nothing in lane 5 to be visualized with the His probe (except background).

51

Figure 3.12. Schema of experimental design for IP and co-IP reactions. Top two tubes represent inputs of in vitro translated xlTRF1full-Flag and E. coli expressed xlPinX1-His (mixed with reticulocyte transcription/translation reagents as described in the methods) proteins. These reactions were split in half, one half for IPs and one half for interaction experiments. Lower tube represents incubation of PinX1 and TRF1 together, which then was split for two co-IPs, one each using antibodies to Flag or His. Light grey circles correspond to lane numbers visualized on western blot using His probe. Dark grey circles correspond to lane numbers visualized using colorimetric detection of biotin labeled amino acids. White circles represent lanes included in both analyses.

52 The IP reactions in the membrane visualized with the biotin detection system (right panel) utilized the anti-His antibody. Here, anti-His should not interact with xlTRF1dd-Flag, so any of this protein in the reaction should not bind to the protein beads and thus should not be visible in lane 6. In lane 7, the anti-His antibody should interact with xlPinX1-His, but since this protein was not expressed in vitro using the biotin labeled amino acids, it will not be visible with the colorimetric detection system used on this membrane. Thus, the IP lanes serve as negative controls in each membrane to ensure that none other but the targeted proteins of interest are being detected in the co-IP reactions, should any be detected. If the proteins interact, certain co-IP results would be expected. Lane 8 in the His-probe detected western blot (left panel) should exhibit a band at 67 kD. This band would result from the detection of xlPinX1-His that interacted with xlTRF1full-Flag when xlTRF1full-Flag was isolated with anti-Flag antibody. Lane 9 in the biotin visualized membrane should exhibit a band at 50kD, where xlTRF1full-Flag interacted when xlPinX1-His was isolated with anti-His antibody in the co-IP. If the proteins do not interact in X. laevis, one would expect to see neither of these bands in the co-IP lanes 8 and 9 but still to see the bands in the input lanes. Coimmunoprecipitation attempt The co-IP experiment outlined above was attempted. In the colorimetric detection of the labeled amino acids (results not shown), no bands were visible in the co-IP lanes where they were expected to be present if xlTRF1full-Flag and xlPinX1-His interact. However, the input lanes of protein products from the translation reaction before the IP processes were significantly fainter than input lanes in previous gels. This may indicate that either in vitro protein expression or colorimetric detection may not have been very efficient in this particular experiment. The western blot was completely blank, exhibiting no background or expected bands in the input lanes (results not shown).

Conclusions and recommendations for further study

Because the western blot of the co-IP experiment did not show any signal, and the input lanes in the membrane utilizing biotin detection exhibited only dim background, these results are inconclusive. It cannot be determined from these results whether or not TRF1 and PinX1 interact in X. laevis. Further experiments should first seek conclusive confirmation that xlTRF1 is being produced in vitro. Advances with this investigation

53 should continue with efforts towards a rigorous co-IP experiment with appropriate controls. One missing control in the above is a successful co-IP with proteins that are known to interact as a comparison for a potential negative result suggesting that xlTRF1full-Flag and xlPinX1-His do not interact. Such a positive control would be essential for making confident conclusions about whether xlTRF1 and xlPinX1 do or do not interact. With a little more preliminary work, the xlTRF1dd clone created in this study may be useful for this purpose. Co-IP studies could investigate the interaction of xlTRF1full-Flag and xlTRF1dd-Myc. Although TRF1 has not yet been shown to homodimerize in X. laevis, the high similarity of human and X. laevis TRFH protein sequences (Figure 3.1) suggests that such an interaction is likely. If TRF1 is found to homodimerize in X. laevis, this interaction could then serve as a positive control for testing the TRF1-PinX1 interaction.

Appendix A: Sequence of Myc-tagged xlTRF1dd protein construct

Sequence of xlTRF1dd as confirmed in both TOPO and pTNT vectors. A diagram of the regions of this sequence is presented in Figure 3.4 Nucleotide sequence of full xlTRF1dd construct, including untranslated regions: The sequence is a composite of: MluI restriction site (uppercase), Kozak consensus sequence, including -atg- start codon (lowercase), sequence coding for Myc epitope tag (uppercase), 12 nt leading up to dimerization domain (lowercase), xlTRF1 dimerization domain (uppercase), 30 nt past the 5 end of the dimerization domain (lowercase), stop codon (uppercase), and NotI restriction site (lowercase). The putative sequence was confirmed by sequencing of the construct in both the pCR8/GW/TOPO and pTNTvectors.
ACGCGTaccatgggcGAACAGAAGTTGATTTCCGAAGAAGACCTCgatgacacggccGCTGTTGCTACTA ACTGGATGTGCGACTTCATGTTCACCAGCATGTGTTTCTACTTCAGAGAAGATCGAACGGAGG ATTTCCAGAGAAGCACACACATGCTGGAATGGCTGCTAGAGGGTTCTCAAAAAATAGACGCT CACAGGAAGACAATACCTATTGCGCAGTTTCTTATGCGAGTGGCTGAAGGAAAAAATCTGGA TTCTCAGTTTGACACGGATGAGAGCCTTACACCTTTAGAAACCGCTTTAATGGCTTTTAATCAA ATTGAAGAAGAGGAGGATCTGAAGCATCTCCATGAAGAAATTGAACTGCTTTTGAAAGTGCA GGCAGTGGTCACTTGCATGGAAAAAGGAAGATTTAAGCTGTCCGCAGAAATCCTCGACAGAC TTTTTAAAGAATCTGGGTCAAACAAGTATTTGAGAATGAAGTTAACAATGCTGATAGAGAAG AAAGATCCATATCATGAGTTTCTACAAAATTTCACTTATGCTCAAATGATGAAGAAAATAAAA TCGTATATCGCCCTTAAGATGAAGGAAAGGCCATCTGTTTTTCTCTTAAAGGCAGCAGCCAAG GTGGTGGAAgctacagcaaaagaagaactggatattcagTAAgcggccgc

DNA sequence of TRF1dd construct with accompanying translation:

Bibliography
Aravind, L. and Koonin, E.V. G-patch: a new conserved domain in eukaryotic RNAprocessing proteins and type D retroviral polyproteins. Trends in Biochemical Sciences 24 (1999), pp. 342-344. Bailey, S.M., Meyne, J., Chen, D.J., Kurimasa, A., Li, G.C., Lehnert, B.E. and Goodwin, a.E.H. DNA double-strand break repair proteins are required to cap the ends of mammalian chromosomes. PNAS 96 (1999), pp. 14899-14904. Banik, S.S. and Counter, C.M. Characterization of Interactions between PinX1 and Human Telomerase Subunits hTERT and hTR. The Journal of Biological Chemistry 279 (2004), pp. 51745-51748. Bassham, S., Beam, A. and Shampay, J. Telomere Variation in Xenopus laevis. Molecular and Cellular Biology 18 (1998), pp. 269-275. Bianchi, A., Smith, S., Chong, L., Elias, P. and Lange, T.d. TRF1 is a dimer and bends telomeric DNA. The EMBO Journal 16 (1997), pp. 1785-1794. Blasco, M.A. Telomeres and Human Disease: Ageing, Cancer and Beyond. Nature Reviews Genetics 6 (2005), pp. 611-622. Bousman, S., Schneider, G. and Shampay, J. Telomerase Activity Is Widespread in Adult Somatic Tissues of Xenopus. Journal of Experimental Zoology 295B (2003), pp. 82-86. Broccoli, D., Smorgorzewska, A., Chong, L. and Lange, T.d. Human telomeres contain two distinct Myb-related proteins, TRF1 and TRF2. Nature Genetics 17 (1997), pp. 231-235. Chan, S.R. and Blackburn, E.H. Telomeres and telomerase. Phil. Trans. R. Soc. Lond 359 (2004), pp. 109-121. Chen, Y., Yang, Y., van Overbeek, M., Donigian, J.R., Baciu, P., de Lange, T. and Lei, M. A Shared Docking Motif in TRF1 and TRF2 Used for Differential Recruitment of Telomeric Proteins. Science 319 (2008), pp. 1092-1096. Chong, L., van Steensel, B., Broccoli, D., Erdjument-Bromage, H., Hanish, J., Tempst, P. and de Lange, T. A Human Telomeric Protein. Science 270 (1995), pp. 16631667. Constant, D.: Production and purification of X. laevis PinX, a putative telomerase inhibitor, Biology. Reed College, Portland, OR (2009). Court, R., Chapman, L., Fairall, L. and Rhodes, D. How the human telomeric proteins TRF1 and TRF2 recognize telomeric DNA: a view from high-resolution crystal structures. EMBO reports 6 (2004), pp. 39-45. Cristofari, G. and Lingner, J. Telomere length homeostasis requires that telomerase levels are limiting. The EMBO Journal 25 (2006), pp. 565-574. Crumet, N., Carlson, R., Drutman, S. and Shampay, J. A truncated acidic domain in Xenopus TRF1. Gene 369 (2006), pp. 20-26. De Boeck, G., Forsyth, R.G., Praet, M. and Hogendoom, P.C. Telomere-associated proteins: cross-talk between telomere maintenance and telomere-lengthening mechanisms. Journal of Pathology 217 (2009), pp. 327-344. de Lange, T. Shelterin: the protein complex that shapes and safeguards human telomeres. Genes & Development 19 (2005), pp. 2100-2110.

58 Dong, X., Stothard, P., Forsythe, I.J. and Wishart, D.S. PlasMapper: a web server for drawing and auto-annotating plasmid maps. Nucl. Acids Res. 32 (2004), pp. W660-W664. Evans, S.K. and Lundblad, V. Positive and negative regulation of telomerase access to the telomere. Journal of Cell Science 113 (2000), pp. 3357-3364. Gaubatz, J.T.: PINX1: A potential telomerase inhibitor in Xenopus laevis, Biology. Reed College, Portland, OR (2007), pp. 49. Griffith, J.D., Comeau, L., Rosenfield, S., Stansel, R.M., Bianchi, A., Moss, H. and Lange, T.d. Mammalian Telomeres End in a Large Duplex Loop. Cell 97 (1999), pp. 503-514. Guglielmi, B. and Werner, M. The Yeast Homolog of Human PinX1 Is Involved in rRNA and Small Nucleolar RNA Maturation, Not in Telomere Elongation Inhibition. Journal of Biological Chemistry 277 (2002), pp. 35712-35719. Hanaoka, S., Nagadoi, A. and Nishimura, Y. Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities. The Protein Society 14 (2005), pp. 119-130. Harley, C.B., Futcher, A.B. and Greider, C.W. Telomeres shorten during ageing of human fibroblasts. Nature 345 (1990), pp. 458-460. Hockemeyer, D., Palm, W., Else, T., Daniels, J.-P., Takai, K.K., Ye, J.Z.S., Keegan, C.E., de Lange, T. and Hammer, G.D. Telomere protection by mammalian Pot1 requires interaction with Tpp1. Nat Struct Mol Biol 14 (2007), pp. 754-761. Hockemeyer, D., Sfeir, A.J., Shay, J.W., Wright, W.E. and Lange, T.d. POT1 protects telomeres from a transient DNA damage response and determines how human chromosomes end. The EMBO Journal 24 (2005), pp. 2667-2678. Iwano, T., Tachibana, M., Reth, M. and Shinkai, Y. Importance of TRF1 for Functional Telomere Structure. The Journal of Biological Chemistry 279 (2004), pp. 14421448. Jin, J.: Is the interaction between human telomere proteins TIN2 and TRF1 conserved in Xenopus laevis?, Biology. Reed College, Portland, OR (2009). Kalseder, J., Kachatrian, L., Takai, H., Mercer, K., Hingorani, S., Jacks, T. and Lange, T.d. Targeted Deletion Reveals an Essential Function for the Telomere Lenth Regulator Trf1. Molecular and Cellular Biology 23 (2003), pp. 6533-6541. Karlseder, J., Broccoli, D., Dai, Y., Hardy, S. and Lange, T.d. p53- and ATM-Dependent Apoptosis Induced by Telomeres Lacking TRF2. Science 283 (1999), pp. 13211325. Karlseder, J., Hoke, K., Mirzoeva, O., Bakkenist, C., Kastan, M., Petrini, J. and de Lange, T. The telomeric protein TRF2 binds the ATM kinase and can inhibit the ATMdependent DNA damage response. PLOS Biology 2 (2004), pp. 1150-1156. Kelleher, C., Kurth, I. and Lingner, J. Human protection of telomeres 1 (POT1) is a negative regulator of telomerase activity in vitro. PLOS Biology 2 (2005), p. E240. Kerr, I.D., Wadsworth, R.I.M., Cubeddu, L., Blankenfeldt, W., Naismith, J.H. and White, M.F. Insights into ssDNA recognition by the OB fold from a structural and thermodynamic study of Sulfolobus SSB protein. The EMBO Journal 22 (2003), pp. 25612570. Kim, S.-h., Kaminker, P. and Campisi, J. TIN2, a new regulator of telomere length in human cells. Nature Genetics 23 (1999), pp. 405-412.

59 Kishi, S., Wulf, G., Nakamura, M. and Lu, K.P. Telomeric protein Pin2/TRF1 induces mitotic entry and apoptosis in cells with short telomeres and is down-regulated in human breast tumors. Oncogene 20 (2001a), p. 1497. Kishi, S., Zhou, X.Z., Ziv, Y., Khoo, C., Hill, D.E., Shiloh, Y. and Lu, K.P. Telomeric Protein Pin2/TRF1 as an Important ATM Target in Response to Double Strand DNA Breaks. Journal of Biological Chemistry 276 (2001b), pp. 29282-29291. Konig, P., Fairall, L. and Rhodes, D. Sequence-specific DNA recognition by the myblike domain of the human telomere binding protein TRF1: a model for the protein-DNA complex. Nucl. Acids Res. 26 (1998), pp. 1731-1740. Kuramoto, M., Ohsumi, K., Kishimoto, T. and Ishikawa, F. Identification and analyses of the Xenopus TERT gene that encodes the catalytic subunit of telomerase. Gene 277 (2001), pp. 101-119. Lander, E.: Genetics: The Molecular Basis of Inheritance. In: Campbell, N.A. and Reece, J.B. (Campbell, N.A. and Reece, J.B.(Campbell, N.A. and Reece, J.B.s), Biology. Benjamin Cummings, San Francisco (2005), pp. 293-308. Lechel, A., Satyanarayana, A., Ju, Z., Plentz, R.R., Schaetzlein, S., Rudolph, C., Wilkens, L., Wiemann, S.U., Saretzki, G., Malek, N.P., Manns, M.P., Buer, J. and Rudolph, K.L. The cellular level of telomere dysfunction determines induction of senescence or apoptosis in vivo. EMBO reports 6 (2005), pp. 275-281. Li, B., Oestreich, S. and de Lange, T. Identification of Human Rap1: Implications for Telomere Evolution. Cell 101 (2000), pp. 471-483. Lin, J. and Blackburn, E.H. Nucleolar protein PinX1p regulates telomerase by sequestering its protein catalytic subunit in an inactive complex lacking telomerase RNA. Genes & Development 18 (2004), pp. 387-396 Lin, J., Jin, R., Zhang, B., Yang, P.X., Chen, H., Bai, Y.X., Xie, Y., Huang, C. and Huang, J. Characterization of a novel effect of hPinX1 on hTERT nucleolar localization. Biochemical and Biophysical Research Communications 353 (2007), pp. 946-952. Liu, D., Safari, A., O'Connor, M.S., Chan, D.W., Laegeler, A., Qin, J. and Songyang, Z. PTOP interacts with POT1 and regulates its localization to telomeres. Nature Cell Biology 6 (2004). Mantell, L.L. and Greider, C.W. Telomerase activity in germline and embryonic cells of Xenopus. The EMBO Journal 13 (1994), pp. 3211-3217. Meyne, J., Ratliff, R.L. and Moyzis, R.K. Conservation of the human telomere sequence (TTAGGG)n among vertebrates. Proc. Natl. Acad. Sci. USA 86 (1989), pp. 70497053. Nikitina, T. and Woodcock, C.L. Closed chromatin loops at the ends of chromosomes. J. Cell Biol. 166 (2004), pp. 161-165. Nishikawa, T., Okamura, H., Nagadoi, A., Konig, P., Rhodes, D. and Nishimura, Y. Solution structure of a Telomeric DNA Complex of Human TRF1. Structure 9 (2001), pp. 1237-1251. Nishiyama, A., Muraki, K., Saito, M., Ohsumi, K., Kishimoto, T. and Ishikawa, F. Cellcycle-dependent Xenopus TRF1 recruitment to telomere chromatin regulated by Polo-like kinase. The EMBO Journal 5 (2006), pp. 1403-1406. O'Connor, M.S., Safari, A., Xin, H., Liu, D. and Songyang, Z. A critical role for TPP1 and TIN2 interaction in high-order telomeric complex assembly. Proceedings of the National Academy of Sciences 103 (2006), pp. 11874-11879.

60 Oh, B.-K., Yoon, S.-M., Lee, C.-H. and Park, Y.N. Rat homolog of PinX1 is a nucleolar protein involved in the regulation of telomere length. Gene 400 (2007), pp. 35-43. Palm, W. and de Lange, T. How Shelterin Protects Mammalian Telomeres. Annual Review of Genetics 42 (2008). Sbodio, J.I. and ChiDagger, N.-W. Identification of a Tankyrase-binding Motif Shared by IRAP, TAB182, and Human TRF1 but Not Mouse TRF1. Journal of Biological Chemistry 277 (2002), pp. 31887-31892. Shen, M., Haggblom, C., Vogt, M., Hunter, T. and Lu, K. Characterization and cell cycle regulation of related human telomeric proteins Pin2 and TRF1 suggest a role in mitosis. Proc. Natl. Acad. Sci. USA 94 (1997). Smith, S., Giriat, I., Schmitt, A. and Lange, T.d. Tankyrase, a Poly(ADP-Ribose) Polymerase at Human Telomeres. Science 282 (1998), pp. 1484-1487. Smogorzewska, A. and de Lange, T. Regulation Of Telomeraase by Telomeric Proteins. Annual Review of Biochemistry 73 (2004), pp. 177-208. Smogorzewska, A., Steensel, B.v., Bianchi, A., Oelmann, S., Schaefer, M.R., Schnapp, G. and Lange, T.d. Control of Human Telomere Length by TRF1 and TRF2. Molecular and Cellular Biology 20 (2000), pp. 1659-1668. Stansel, R.M., Lange, T.d. and Griffith, J.D. T-loop assembly in vitro involves binding of TRF2 near the 3' telomeric overhang. The EMBO Journal 20 (2001), pp. 55325540. Stansel, R.M., Subramanian, D. and Griffith, J.D. p53 Binds Telomeric Single Strand Overhangs and t-Loop Junctions in Vitro. Journal of Biological Chemistry 277 (2002), pp. 11625-11628. van Steensel, B. and de Lange, T. Control of telomere length by the human telomeric protein TRF1. Nature 385 (1997), pp. 740-743. van Steensel, B., Smogorzewska, A. and de Lange, T. TRF2 Protects Human Telomeres from End-to-End Fusions. Cell 92 (1998), pp. 401-413. Verdun, R.E., Crabbe, L., Haggblom, C. and Karlseder, J. Functional Human Telomeres Are Recognized as DNA Damage in G2 of the Cell Cycle. Molecular Cell 20 (2005), pp. 551-561. Verdun, R.E. and Kalseder, J. Replication and protection of telomeres. Nature 447 (2007), pp. 924-931. Wei, C. and Price, M. Protecting the terminus: t-loops and telomere end-binding proteins. Cellular and Molecular Life Sciences (CMLS) 60 (2003), pp. 2283-2294. Wu, L., Multani, A.S., He, H., Cosme-Blanco, W., Deng, Y., Deng, J.M., Bachilo, O., Pathak, S., Tahara, H., Bailey, S.M., Deng, Y., Behringer, R.R. and Chang, S. Pot1 Deciency Initiates DNA Damage Checkpoint Activation and Aberrant Homologous Recombination at Telomeres. Cell 126 (2006), pp. 49-62. Xin, H., Liu, D., Wan, M., Safari, A., Kim, H., Sun, W., O/'Connor, M.S. and Songyang, Z. TPP1 is a homologue of ciliate TEBP- and interacts with POT1 to recruit telomerase. Nature 445 (2007), pp. 559-562. Ye, J.Z.-S., Donigian, J.R., van Overbeek, M., Loayza, D., Luo, Y., Krutchinsky, A.N., Chait, B.T. and de Lange, T. TIN2 Binds TRF1 and TRF2 Simultaneously and Stabilizes the TRF2 Complex on Telomeres. Journal of Biological Chemistry 279 (2004), pp. 47264-47271.

61 Ye, J.Z.-S. and Lange, T.d. TIN2 is a tankyrase 1 PARP modulator in the TRF1 telomere length control complex. Nature Genetics 36 (2004), pp. 618-623. Yoshimura, S.H., Maruyama, H., Ishikawa, F., Ohki, R. and Takeyasu, K. Molecular mechanisms of DNA end-loop formation by TRF2. Genes to Cells 9 (2004), pp. 205-218. Zhou, X.Z. and Lu, K.P. The Pin2/TRF1-interacting: Protein PinX1 is a potent telomerase inhibitor. Cell 107 (2001), pp. 347-359.