Getting To Know Your Data: - Chapter 2

— Chapter 2 —
Getting to Know Your Data
April 7, 2019 Data Mining: Concepts and Techniques 1

What is about Data?
 General data characteristics

 Basic data description and exploration
 Measuring data similarity

What is Data?
Attributes
 Collection of data objects and their
attributes
Tid Refund Marital Taxable
 An attribute is a property or Status Income Cheat
characteristic of an object 1 Yes Single 125K No
 Examples: eye color of a

2 No Married 100K No
person, temperature, etc. 3 No Single 70K No
 Attribute is also known as

4 Yes Married 120K No
variable, field, characteristic, or 5 No Divorced 95K Yes

Objects
feature 6 No Married 60K No
7 Yes Divorced 220K No
 A collection of attributes describe
8 No Single 85K Yes
an object
9 No Married 75K No
 Object is also known as record,
10 No Single 90K Yes
point, case, sample, entity, or 10
instance

Important Characteristics of Structured Data
 Dimensionality
 Curse of dimensionality
 Sparsity vs Density
 Density counts only presence; and Sparsity,
absence
 Data Value Conflict Detection and Resolution
Patterns depend on the scale
 Similarity
 Distance measure

Attribute Values
 Attribute values are numbers or symbols assigned to an attribute
 Distinction between attributes and attribute values

 Same attribute can be mapped to different set of values
(different scales)
 Example: height can be measured in feet or meters
 Different attributes can be mapped to the same set of

values
 Example: Attribute values for ID and age are integers
 But properties of attribute values can be different
 ID has no limit but age has a maximum and

minimum value
Types of Attributes
 Nominal
 Relating to names. The values of a nominal attribute are symbols or
names of things. Each value represents some kind of category, code, or
state, and so nominal attributes are also referred to as categorical. The
values do not have any meaningful order. E.g., profession, ID numbers,
eye color, zip codes
 Nominal values can also be represented as numbers (black hair= 0, grey
hair =1,…)
 Ordinal
 Attribute with possible values that have a meaningful order or ranking
among them, but the magnitude between successive values is not
known.
 E.g., rankings {Prof., Assistant Prof.}, grades {A, B,…} , height {tall,
medium, short}, drink size or ready-made garments size {small,

medium, and large}: The values have a meaningful sequence (which
corresponds to increasing size)
Types of Attribute Values
The above attributes are qualitative: they describe a feature of an object without
giving an actual size or quantity
Binary and numeric attributes are quantitative which provide quantitative
measurements of an object
 Binary
 E.g., medical test (positive vs. negative)
 Numeric: is quantitative (i.e., measurable quantity). It is represented in
integer or in real values. They can be interval-scaled or ratio-scaled.
 Interval
 measured on a scale of equal-size units. The values of interval-scaled
attributes have order and can be positive, 0, or negative. Thus, in

addition to providing a ranking of values, such attributes allow us to
compare and quantify the difference between values
 E.g., calendar dates, body temperatures (difference between 20°C
and 10°C). We cannot say that that 10°C is twice as warm as 5°C.
Types of Attribute Values
 Ratio
 Ratio is a numeric attribute with an inherent zero-point.
That is, if a measurement is ratio-scaled, we can speak of
a value as being a multiple (or ratio) of another value. In
addition, the values are ordered, and we can also compute
the difference between values, as well as the mean,
median, and mode.
 E.g., temperature in Kelvin, (0°K = −273.15°C: It is the
point at which the particles that comprise matter have
zero kinetic energy), counts (years_of_experience,
number_of_words in a document)

Properties of Attribute Values
 The type of an attribute depends on which of the following properties it

possesses:
 Distinctness: = 
 Order: < >
 Addition: + -
 Multiplication: */
 Nominal attribute: distinctness

 Ordinal attribute: distinctness & order
 Interval attribute: distinctness, order & addition
 Ratio attribute: all 4 properties

Attribute Description Examples Operations
Type
Nominal The values of a nominal attribute are zip codes, employee mode, entropy,
just different names, i.e., nominal ID numbers, eye color, contingency
attributes provide only enough sex: {male, female} correlation, 2 test
information to distinguish one object
from another. (=, )
Ordinal The values of an ordinal attribute hardness of minerals, median, percentiles,

provide enough information to order {good, better, best}, rank correlation,
objects. (<, >) grades, street numbers run tests, sign tests
Interval For interval attributes, the calendar dates, mean, standard

differences between values are temperature in Celsius deviation, Pearson's
meaningful, i.e., a unit of or Fahrenheit correlation, t and F
measurement exists. tests
(+, - )
Ratio For ratio variables, both differences temperature in Kelvin, geometric mean,
and ratios are meaningful. (*, /) monetary quantities, harmonic mean,
counts, age, mass, percent variation
length, electrical
current

Discrete vs. Continuous Attributes
 Discrete Attribute
 Has only a finite or countably infinite set of values
 E.g., zip codes, profession, or the set of words in a

collection of documents
 Sometimes, represented as integer variables
 Note: Binary attributes are a special case of discrete

attributes
 Continuous Attribute
 Has real numbers as attribute values
 Examples: temperature, height, or weight
 Practically, real values can only be measured and

represented using a finite number of digits
 Continuous attributes are typically represented as
floating-point variables
Types of data sets
 Record
 Data Matrix
 Document Data
 Transaction Data
 Graph
 World Wide Web
 Molecular Structures
 Ordered
 Spatial Data
 Temporal Data
 Sequential Data
 Genetic Sequence Data

Record Data
 Data that consists of a collection of records, each

of which consists of a fixed set of attributes
Tid Refund Marital Taxable
Status Income Cheat
1 Yes Single 125K No

2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10

Data Matrix
 If data objects have the same fixed set of numeric attributes, then the data
objects can be thought of as points in a multi-dimensional space, where each
dimension represents a distinct attribute
 Such data set can be represented by an m by n matrix, where there are m

rows, one for each object, and n columns, one for each attribute
Projection Projection Distance Load Thickness

of x Load of y load
10.23 5.27 15.22 2.7 1.2

12.65 6.25 16.22 2.2 1.1

Document Data
 Each document becomes a `term' vector,
 each term is a component (attribute) of the vector,
 the value of each component is the number of times
the corresponding term occurs in the document.
timeout
season
coach
game
score
team
ball
lost
pla
wi
n
y
Document 1 3 0 5 0 2 6 0 2 0 2
Document 2 0 7 0 2 1 0 0 3 0 0
Document 3 0 1 0 0 1 2 2 0 3 0

Transaction Data
 A special type of record data, where

 each record (transaction) involves a set of items.
 For example, consider a grocery store. The set of
products purchased by a customer during one
shopping trip constitute a transaction, while the
individual products that were purchased are the items.
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk

Graph Data
 Examples: Generic graph and HTML Links

<a href="papers/papers.html#bbbb">
Data Mining </a>
<li>
2 <a href="papers/papers.html#aaaa">
Graph Partitioning </a>
5 1 <li>
2 <a href="papers/papers.html#aaaa">
Parallel Solution of Sparse Linear System of Equations </a>
5 <li>
<a href="papers/papers.html#ffff">
N-Body Computation and Dense Linear System Solvers

Chemical Data
 Benzene Molecule: C6H6

Ordered Data
 Sequences of transactions
Items/Events
An element of
the sequence

Ordered Data
 Genomic sequence data

GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG

Ordered Data
 Spatio-Temporal Data
Average Monthly
Temperature of
land and ocean

 Measuring data similarity

Mining Data Descriptive Characteristics
 Motivation
 To better understand the data: central tendency, variation
and spread
 Data dispersion characteristics
 median, max, min, quantiles, outliers, variance, etc.
 Numerical dimensions correspond to sorted intervals
 Data dispersion: analyzed with multiple granularities of
precision
 Boxplot or quantile analysis on sorted intervals
 Dispersion analysis on computed measures
 Folding measures into numerical dimensions
 Boxplot or quantile analysis on the transformed cube

Measuring the Central Tendency
1 n x
 Mean (algebraic measure) (sample vs. population): x   xi
n i 1

N
 Weighted arithmetic mean: n
w x i i
 Trimmed mean: chopping extreme values x i 1

n
w i
 Median: A holistic measure i 1
 Middle value if odd number of values, or average of the middle two

values otherwise
 Estimated by interpolation (for grouped data):
N / 2  (  freq)l
 Mode median  L1  ( ) width
freqmedian
 Value that occurs most frequently in the data
 Unimodal, bimodal, trimodal
 Empirical formula: mean  mode  3  (mean  median)
Symmetric vs. Skewed Data
 Median, mean and mode of symmetric
symmetric, positively and
negatively skewed data
positively skewed negatively skewed

Measuring the Dispersion of Data
 Quartiles, outliers and boxplots

 Quartiles: Q1 (25th percentile), Q3 (75th percentile)
 Inter-quartile range: IQR = Q3 – Q1
 Five number summary: min, Q1, M, Q3, max
 Boxplot: ends of the box are the quartiles, median is marked, whiskers, and
plot outlier individually
 Outlier: usually, a value higher/lower than 1.5 x IQR
 Variance and standard deviation (sample: s, population: σ)
 Variance: (algebraic, scalable computation)
1 n 1 n 2 1 n n n
 [ xi  ( xi ) 2 ]
1 1
s  ( xi  x )         xi   2
2 2 2 2 2
( x )
n  1 i 1 n  1 i 1 n i 1 N i 1
i
N i 1
 Standard deviation s (or σ) is the square root of variance s2 (or σ2)

Boxplot Analysis
 Five-number summary of a distribution:

Minimum, Q1, M, Q3, Maximum
 Boxplot
 Data is represented with a box
 The ends of the box are at the first and third
quartiles, i.e., the height of the box is IQR
 The median is marked by a line within the box
 Whiskers: two lines outside the box extend to
Minimum and Maximum

Histogram Analysis
 Graph displays of basic statistical class descriptions

 Frequency histograms
 A univariate graphical method

 Consists of a set of rectangles that reflect the counts or
frequencies of the classes present in the given data

Histograms Often Tells More than Boxplots
 The two histograms

shown in the left may
have the same boxplot
representation
 The same values
for: min, Q1,
median, Q3, max
 But they have rather
different data
distributions

Quantile Plot
 Displays all of the data (allowing the user to assess both
the overall behavior and unusual occurrences)
 Plots quantile information
 For a data xi data sorted in increasing order, fi
indicates that approximately 100 fi% of the data are
below or equal to the value xi

Quantile-Quantile (Q-Q) Plot
 Graphs the quantiles of one univariate distribution against

the corresponding quantiles of another
 Allows the user to view whether there is a shift in going
from one distribution to another

Scatter plot
 Provides a first look at bivariate data to see clusters of
points, outliers, etc
 Each pair of values is treated as a pair of coordinates and
plotted as points in the plane

Loess Curve
 Adds a smooth curve to a scatter plot in order to

provide better perception of the pattern of dependence
 Loess curve is fitted by setting two parameters: a
smoothing parameter, and the degree of the
polynomials that are fitted by the regression

Positively and Negatively Correlated Data
 The left half fragment is positively

correlated
 The right half is negative correlated

Not Correlated Data

Data Visualization and Its Methods
 Why data visualization?
 Gain insight into an information space by mapping data onto
graphical primitives
 Provide qualitative overview of large data sets
 Search for patterns, trends, structure, irregularities, relationships
among data
 Help find interesting regions and suitable parameters for further
quantitative analysis
 Provide a visual proof of computer representations derived
 Typical visualization methods:
 Geometric techniques
 Icon-based techniques
 Hierarchical techniques

Geometric Techniques
 Visualization of geometric transformations and projections

of the data
 Methods
 Landscapes
 Projection pursuit technique
 Finding meaningful projections of multidimensional
data
 Scatterplot matrices
 Prosection views
 Hyperslice
 Parallel coordinates
Scatterplot Matrices
Used by ermission of M. Ward, Worcester Polytechnic Institute
Matrix of scatterplots (x-y-diagrams) of the k-dim. data

Landscapes
Used by permission of B. Wright, Visible Decisions Inc.
news articles
visualized as
a landscape
 Visualization of the data as perspective landscape

 The data needs to be transformed into a (possibly artificial) 2D
spatial representation which preserves the characteristics of the data
Parallel Coordinates
 n equidistant axes which are parallel to one of the screen axes and
correspond to the attributes
 The axes are scaled to the [minimum, maximum]: range of the
corresponding attribute
 Every data item corresponds to a polygonal line which intersects each
of the axes at the point which corresponds to the value for the
attribute
• • •
Attr. 1 Attr. 2 Attr. 3 Attr. k

Parallel Coordinates of a Data Set

Icon-based Techniques
 Visualization of the data values as features of icons

 Methods:
 Chernoff Faces
 Stick Figures
 Shape Coding:
 Color Icons:
 TileBars: The use of small icons representing the
relevance feature vectors in document retrieval

Chernoff Faces
 A way to display variables on a two-dimensional surface, e.g., let x be

eyebrow slant, y be eye size, z be nose length, etc.
 The figure shows faces produced using 10 characteristics--head
eccentricity, eye size, eye spacing, eye eccentricity, pupil size,
eyebrow slant, nose size, mouth shape, mouth size, and mouth
opening): Each assigned one of 10 possible values, generated using
Mathematica (S. Dickson)
 REFERENCE: Gonick, L. and Smith, W. The

Cartoon Guide to Statistics. New York:
Harper Perennial, p. 212, 1993
 Weisstein, Eric W. "Chernoff Face." From
MathWorld--A Wolfram Web Resource.
mathworld.wolfram.com/ChernoffFace.html

Hierarchical Techniques
 Visualization of the data using a hierarchical

partitioning into subspaces.
 Methods
 Dimensional Stacking
 Worlds-within-Worlds
 Treemap
 Cone Trees
 InfoCube

Tree-Map
 Screen-filling method which uses a hierarchical partitioning
of the screen into regions depending on the attribute values
 The x- and y-dimension of the screen are partitioned
alternately according to the attribute values (classes)
MSR Netscan Image

Tree-Map of a File System (Schneiderman)

 Measuring data similarity (Sec. 7.2)

Similarity and Dissimilarity
 Similarity
 Numerical measure of how alike two data objects are
 Value is higher when objects are more alike
 Often falls in the range [0,1]
 Dissimilarity (i.e., distance)

 Numerical measure of how different are two data
objects
 Lower when objects are more alike
 Minimum dissimilarity is often 0
 Upper limit varies
 Proximity refers to a similarity or dissimilarity

Data Matrix and Dissimilarity Matrix
 Data matrix
 n data points with p  x11 ... x1f ... x1p 
 
dimensions  ... ... ... ... ... 
x xip 
 Two modes
... xif ...
 i1 
 ... ... ... ... ... 
x ... xnf ... xnp 
 n1 
 Dissimilarity matrix
 0 
 n data points, but
 d(2,1) 0 
registers only the  
 d(3,1) d ( 3,2) 0 
distance  
 A triangular matrix  : : : 
d ( n,1) d ( n,2) ... ... 0
 Single mode

Example: Data Matrix and Distance Matrix
p1
point x y
2
p1 0 2
p3 p4
1
p2 2 0
p2 p3 3 1
0 p4 5 1
0 1 2 3 4 5 6 Data Matrix
p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
Distance Matrix (i.e., Dissimilarity Matrix) for Euclidean Distance

Minkowski Distance
 Minkowski distance: A popular distance measure
d (i, j)  q (| x  x |q  | x  x |q ... | x  x |q )
i1 j1 i2 j2 ip jp
where i = (xi1, xi2, …, xip) and j = (xj1, xj2, …, xjp) are two
p-dimensional data objects, and q is the order
 Properties
 d(i, j) > 0 if i ≠ j, and d(i, i) = 0 (Positive definiteness)
 d(i, j) = d(j, i) (Symmetry)
 d(i, j)  d(i, k) + d(k, j) (Triangle Inequality)
 A distance that satisfies these properties is a metric
Special Cases of Minkowski Distance
 q = 1: Manhattan (city block, L1 norm) distance

 E.g., the Hamming distance: the number of bits that are
different between two binary vectors
d (i, j) | x  x |  | x  x | ... | x  x |
i1 j1 i2 j 2 ip jp
 q= 2: (L2 norm) Euclidean distance

d (i, j)  (| x  x |2  | x  x |2 ... | x  x |2 )
i1 j1 i2 j2 ip jp
 q  . “supremum” (Lmax norm, L norm) distance.

 This is the maximum difference between any component of the
vectors
 Do not confuse q with n, i.e., all these distances are defined for all
numbers of dimensions.
 Also, one can use weighted distance, parametric Pearson product
moment correlation, or other dissimilarity measures
Example: Minkowski Distance
L1 p1 p2 p3 p4
p1 0 4 4 6
p2 4 0 2 4
p3 4 2 0 2
p4 6 4 2 0
point x y
p1 0 2 L2 p1 p2 p3 p4
p2 2 0 p1 0 2.828 3.162 5.099
p3 3 1 p2 2.828 0 1.414 3.162
p4 5 1 p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
L p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0
Distance Matrix

Binary Variables Object j
1 0 sum
 A contingency table for binary data Object i 1 a b a b
0 c d cd
sum a  c b  d p
 Distance measure for symmetric
binary variables: d (i, j)  bc
 Distance measure for asymmetric
a b c  d
binary variables: d (i, j)  bc
 Jaccard coefficient (similarity a bc
measure for asymmetric binary simJaccard (i, j)  a
variables):
a b c
 A binary variable is symmetric if
both of its states are equally
valuable and carry the same weight.
Dissimilarity between Binary Variables
 Example
Name Gender Fever Cough Test-1 Test-2 Test-3 Test-4
Jack M Y N P N N N
Mary F Y N P N P N
Jim M Y P N N N N
 gender is a symmetric attribute
 the remaining attributes are asymmetric binary
 let the values Y and P be set to 1, and the value N be set to 0
01
d ( jack , mary )   0.33
2 01
11
d ( jack , jim )   0.67
111
1 2
d ( jim , mary )   0.75
11 2
Nominal Variables
 A generalization of the binary variable in that it can take

more than 2 states, e.g., red, yellow, blue, green
 Method 1: Simple matching
 m: # of matches, p: total # of variables
d (i, j)  p 
p
m
 Method 2: Use a large number of binary variables

 creating a new binary variable for each of the M
nominal states

Ordinal Variables
 An ordinal variable can be discrete or continuous

 Order is important, e.g., rank
 Can be treated like interval-scaled
 replace xif by their rank rif {1,...,M f }
 map the range of each variable onto [0, 1] by replacing
i-th object in the f-th variable by
rif 1
zif 
M f 1
 compute the dissimilarity using methods for interval-
scaled variables

Ratio-Scaled Variables
 Ratio-scaled variable: a positive measurement on a

nonlinear scale, approximately at exponential scale,
such as AeBt or Ae-Bt
 Methods:
 treat them like interval-scaled variables—not a good
choice! (why?—the scale can be distorted)
 apply logarithmic transformation
yif = log(xif)
 treat them as continuous ordinal data treat their rank
as interval-scaled

Variables of Mixed Types
 A database may contain all the six types of variables

 symmetric binary, asymmetric binary, nominal, ordinal,
interval and ratio
 One may use a weighted formula to combine their effects
 pf  1 ij( f ) dij( f )
d (i, j) 
 pf  1 ij( f )
 f is binary or nominal:
dij(f) = 0 if xif = xjf , or dij(f) = 1 otherwise
 f is interval-based: use the normalized distance
 f is ordinal or ratio-scaled
 Compute ranks rif and r 1
zif  if
 Treat zif as interval-scaled M 1 f

Vector Objects: Cosine Similarity
 Vector objects: keywords in documents, gene features in micro-arrays, …
 Applications: information retrieval, biologic taxonomy, ...
 Cosine measure: If d1 and d2 are two vectors, then
cos(d1, d2) = (d1  d2) /||d1|| ||d2|| ,
where  indicates vector dot product, ||d||: the length of vector d
 Example:
d1 = 3 2 0 5 0 0 0 2 0 0
d2 = 1 0 0 0 0 0 0 1 0 2
d1d2 = 3*1+2*0+0*0+5*0+0*0+0*0+0*0+2*1+0*0+0*2 = 5
||d1||= (3*3+2*2+0*0+5*5+0*0+0*0+0*0+2*2+0*0+0*0)0.5=(42)0.5
= 6.481
||d2|| = (1*1+0*0+0*0+0*0+0*0+0*0+0*0+1*1+0*0+2*2)0.5=(6) 0.5
= 2.245
cos( d1, d2 ) = .3150
Correlation Analysis (Numerical Data)
 Correlation coefficient (also called Pearson’s product

moment coefficient)
rp ,q 
 ( p  p)( q  q)  ( pq)  n p q

(n  1) p q (n  1) p q
where n is the number of tuples, p and q are the respective

means of p and q, σp and σq are the respective standard deviation
of p and q, and Σ(pq) is the sum of the pq cross-product.
 If rp,q > 0, p and q are positively correlated (p’s values
increase as q’s). The higher, the stronger correlation.
 rp,q = 0: independent; rpq < 0: negatively correlated

Correlation (viewed as linear relationship)
 Correlation measures the linear relationship

between objects
 To compute correlation, we standardize data
objects, p and q, and then take their dot product
pk  ( pk  mean( p)) / std ( p)

qk  (qk  mean(q)) / std (q)
correlation( p, q)  p  q

Visually Evaluating Correlation
Scatter plots
showing the
similarity from
–1 to 1.

Getting To Know Your Data: - Chapter 2

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Getting To Know Your Data: - Chapter 2

Uploaded by

Copyright:

Available Formats

— Chapter 2 —

Getting to Know Your Data

April 7, 2019 Data Mining: Concepts and Techniques 1

 General data characteristics

April 7, 2019 Data Mining: Concepts and Techniques 2

characteristic of an object 1 Yes Single 125K No

 Examples: eye color of a

person, temperature, etc. 3 No Single 70K No

 Attribute is also known as

variable, field, characteristic, or 5 No Divorced 95K Yes

April 7, 2019 Data Mining: Concepts and Techniques 3

April 7, 2019 Data Mining: Concepts and Techniques 4

 Attribute values are numbers or symbols assigned to an attribute

 Distinction between attributes and attribute values

 Different attributes can be mapped to the same set of

 But properties of attribute values can be different

 ID has no limit but age has a maximum and

medium, short}, drink size or ready-made garments size {small,

 measured on a scale of equal-size units. The values of interval-scaled

attributes have order and can be positive, 0, or negative. Thus, in

April 7, 2019 Data Mining: Concepts and Techniques 8

 The type of an attribute depends on which of the following properties it

 Nominal attribute: distinctness

April 7, 2019 Data Mining: Concepts and Techniques 9

Ordinal The values of an ordinal attribute hardness of minerals, median, percentiles,

Interval For interval attributes, the calendar dates, mean, standard

April 7, 2019 Data Mining: Concepts and Techniques 10

 E.g., zip codes, profession, or the set of words in a

 Note: Binary attributes are a special case of discrete

 Examples: temperature, height, or weight

 Practically, real values can only be measured and

April 7, 2019 Data Mining: Concepts and Techniques 12

 Data that consists of a collection of records, each

1 Yes Single 125K No

April 7, 2019 Data Mining: Concepts and Techniques 13

 Such data set can be represented by an m by n matrix, where there are m

Projection Projection Distance Load Thickness

10.23 5.27 15.22 2.7 1.2

April 7, 2019 Data Mining: Concepts and Techniques 14

April 7, 2019 Data Mining: Concepts and Techniques 15

 A special type of record data, where

April 7, 2019 Data Mining: Concepts and Techniques 16

 Examples: Generic graph and HTML Links

April 7, 2019 Data Mining: Concepts and Techniques 17

 Benzene Molecule: C6H6

April 7, 2019 Data Mining: Concepts and Techniques 18

April 7, 2019 Data Mining: Concepts and Techniques 19

 Genomic sequence data

April 7, 2019 Data Mining: Concepts and Techniques 20

April 7, 2019 Data Mining: Concepts and Techniques 21

April 7, 2019 Data Mining: Concepts and Techniques 22

April 7, 2019 Data Mining: Concepts and Techniques 23

 Trimmed mean: chopping extreme values x i 1

 Middle value if odd number of values, or average of the middle two

positively skewed negatively skewed

April 7, 2019 Data Mining: Concepts and Techniques 25

 Quartiles, outliers and boxplots

 Standard deviation s (or σ) is the square root of variance s2 (or σ2)

April 7, 2019 Data Mining: Concepts and Techniques 26

 Five-number summary of a distribution:

April 7, 2019 Data Mining: Concepts and Techniques 27

 Graph displays of basic statistical class descriptions

 A univariate graphical method