Genotyping of Hsp70 and ANKRD1 in Dilated Cardiomyopathy

By, By, C.Swathi (09D41D0307)

Project work carried out at : Dept of Genetics, Osmania University, Hyderabad. Under the Guidance of : Prof.Prathiba Nallari.

SCOPE & OBJECTIVE

1.Collection of blood samples from dilated cardiomyomathy (DCM) patients and healthy individuals (controls). 2.Isolation of Genomic DNA from blood samples. 3.Visualization of the Genomic DNA. 4.PCR Amplification of Genomic DNA. 5.Genotyping of the genes associated with DCM using SSCP and RFLP techniques.

CARDIOMYOPATHY


Cardiomyopathy refers to progressive impairment of the structure and function of the muscular walls of the heart chambers. Cardiomyopathy, literally means "heart muscle "heart disease . People with cardiomyopathy are often at risk of arrhythmia or sudden cardiac death or both.

Types of Cardiomyopathy There are three main types of cardiomyopathies : 1) Dilated Cardiomyopathy. 2) Hypertrophic Cardiomyopathy. 3) Restrictive Cardiomyopathy. Dilated cardiomyopathy is the most common form.

DILATED CARDIOMYOPATHY


Dilated cardiomyopathy (DCM) is a condition in which the heart becomes weakened and enlarged, cannot pump blood efficiently, resulting in heart failure. Dilated cardiomyopathy can develop at any age but is more common among people aged 20 to 60 years. It is estimated that approximately 1 out of every 2500 persons has DCM.

The decreased heart function can affect the lungs, liver, and other body systems. Coronary artery disease, viral infections, and some hormonal disorders are common causes of dilated cardiomyopathy. Shortness of breath and fatigue are often the first symptoms. Electrocardiography and echocardiography are used to diagnose dilated cardiomyopathy. Treatment for cardiomyopathies focuses on treating heart failure.

Drugs that may be used include:



 

 

ACE inhibitors, such as captopril, enalapril, captopril, enalapril, lisinopril, and ramipril lisinopril, Angiotensin receptor blockers (ARBs) such as losartan and candesartan BetaBeta-blockers, such as carvedilol and metoprolol Diuretics, including thiazide, loop diuretics, and potassium-sparing diuretics potassiumDigitalis glycosides Drugs that dilate blood vessels (vasodilators)

The Genes Associated with Dilated Cardiomyopathy ANKRD1 :



ANKRD1 is the novel gene known as ankyrin repeat domain 1 . This ANKRD1 encodes a protein, that plays a role in the structure and functional ability of the heart. The ANKRD1 gene is located on the long (q) arm of chromosome 10 at position 23.31

The protein encoded by this gene is localized to the nucleus of endothelial cells and is induced by IL-1 and TNF-alpha stimulation. ILTNF ANKRD1 plays an important role in endothelial cell activation.  May act as a nuclear transcription factor that negatively regulates the expression of cardiac genes.  The other names of ANKRD1 are: 1. CARP (cardiac ankyrin repeat protien) 2. Cytokine inducible nuclear protien.


Heat shock protein-Hsp70 protein

Heat shock proteins (HSP) are a class of functionally related proteins whose expression is increased when cells are exposed to elevated temperatures or other stress. HSPs are found in virtually all living organisms, humans. from bacteria to humans. Hsp70 was originally discovered by FM Ritossa in the 1960s when a lab worker accidentally boosted the incubation temperature of Drosophila (fruit flies).

The Hsp70s are an important part of the cell's machinery for protein folding, and help to protect cells from stress  The Hsp70 proteins have three major functional domains : 1.N-terminal ATPase domain. 1.N 2.Substrate binding domain. 3.C-terminal domain. 3.C  HSP 70 is overexpressed in malignant melanoma and underexpressed in renal cell cancer.


DNA ISOLATION AND VISUALIZATION

The Genomic DNA was isolated from 25 patients samples and 25 healthy individual samples (controls), by 2 methods of DNA extraction. They are: 1. Rapid Genomic DNA Extraction method (RGDE) (Saremi et al 2008). 2. Non-Enzymatic Method (Laheri et al 1991). Non-

The DNA Pellet obtained was completely dried and stored in TE buffer.

 The DNA collected were visualized on a 0.8% agarose gel containing ethidium bromide.  The purity of the DNA obtained was determined by the spectrophotometric analysis.  The absorbance ratio of OD260/OD280 was calculated and a purity of 1.84 was obtained.  The DNA isolated was stored at 4C or -20C for 4 20 later use.

PCR (Polymerase chain reaction)



PCR is a technique that enables the amplification of specific sequence of nucleic acids. In PCR ,two primers are used that are complementary to opposite strand of DNA sequence to be amplified. Primer design is one of the parameters fo successful amplification in a PCR.

The Setting and running of the PCR usually involves: 1. Initial Denaturation 2. Denaturation 3. Primer annealing 4. Extension 5. Final extension  Each round of denaturation , annealing and extension is known as a cycle .


The reaction components of a typical PCR includes:

 Deoxyribonucleotide triphosphates (dNTPs) i.e, dATP,dCTP,dGTP, and dTTP.  10x Reaction buffer  Primers  Template DNA  Double distilled water / HPLC water  DNA polymerase The most commonly used DNA polymerase is Taq polymerase, which is isolated from a bacterium, Thermus aquaticus(found in hot springs).

Primers used and PCR Conditions for Hsp70  Hsp70 FP: CGCCATGGAGACCAACACCC RP: GCGGTTCCCTGCTCTCTGTC Amplimer size: 488bp Hsp70 PCR conditions: conditions:  Initial denaturation 94C 3min 94  Denaturation 94C 30sec 94  Annealing 55C 30sec 55  Extension 72C 1min 72  Final extension 2min

Primers used and PCR Conditions for ANKRD1 are :  FP: TCAGCTTCCCAGACACTGAG  RP: AAACCAAGATGAACCAGTTTTCA PCR Conditions for ANKRD1 are :
    

Initial denaturation 95C 5min 95 Denaturation 94C 30sec 94 Annealing 55.7C 30sec 55.7 Extension 72C 1min 72 Final extension 5min

Future work


Once the PCR products are obtained ,they are analyzed using SSCP and RFLP techniques. With the help of Hsp70 , the genotyping of ANKRD1 is to be done, which is a novel gene causing DCM.

THANK YOU